WO2020254533A1

WO2020254533A1 - Novel biocontrol agent and use thereof for controlling fungal diseases of plants

Info

Publication number: WO2020254533A1
Application number: PCT/EP2020/067034
Authority: WO
Inventors: Sophie LEPORINI; Julien Fagot; Sinisa Marinkovic; Nicolas Fabre; Christian BELLOY
Original assignee: Agro Industrie Recherches Et Developpements A.R.D.
Priority date: 2019-06-18
Filing date: 2020-06-18
Publication date: 2020-12-24
Also published as: FR3097557A1; EP3987068A1

Abstract

The present invention relates to a novel biocontrol agent and to the use thereof for controlling fungal diseases of plants.

Description

DESCRIPTION

TITLE: NEW BIOCONTROL AGENT AND ITS USE FOR THE CONTROL OF FUNGAL DISEASES OF PLANTS

FIELD OF THE INVENTION

The present invention relates to a novel biocontrol agent and its use for the control of fungal diseases of plants.

PRIOR ART

Various diseases threaten wheat during its growth. They can be classified into three categories:

^■ diseases of the base of stems (eg foot rot, fusarium wilt),

^■ leaf diseases (eg powdery mildew, septoria, helminthosporiosis, yellow rust and brown rust);

^■ and ear diseases (eg, fusarium head blight, ear powdery mildew and septoria).

Depending on the variety of plants and the climatic conditions, significant quantitative crop losses are possible, as with septoria which reduces the photosynthetic activity of the plant. In addition, other diseases can affect the quality of the crop, such as Fusarium head blight which produces my cotoxins.

More precisely :

[1] Septoria. whose pathogen is Septoria tritici (= Mycosphaerella graminicola), is, on common wheat, the most frequent disease and the most damaging quantitatively with for example 17 q / ha of decrease in average yield on the scale of the territory on the last ten years. "Wheat septoria" refers to two diseases:

^■ septoria on the ears caused by the fungus Phaeosphaeria nodorum (anamorph / asexual form: Stagonospora nodorum) which attacks the leaves but also the ears and grains of wheat; and

^■ leaf septoria caused by the fungus Mycosphaerella graminicola (anamorphic / asexual form: Septoria tritici, recently renamed Zymoseptoria tritici) which attacks the leaves and sheaths of wheat. Septoria caused by P. nodorum was the predominant species in France until the 1980s, nowadays the majority form is septoria caused by M. graminicola, probably for ecological reasons (Bearchell, SJ, Fraaije, BA, Shaw , MW, & Fitt, BDL (2005). Wheat archive links long-term fungal pathogen population dynamics to air pollution. Proceedings of the National Academy of Sciences of the United States of America, 102 (15), 5438-42.).

[2] Fusarium wilt. whose pathogen is Gibberella zeae (= Fusarium graminearum), is a generic term for a group of fungal diseases. In the case of wheat, this disease can devastate a crop a few weeks before harvest. Besides wheat, it is also found on other species such as corn and barley. Unlike septoria, fusarium can infect all parts of the plant, from the roots to the ears, at all stages of development. The term “fusarium” in cereals covers three types of symptoms (Parry, DW, Jenkinson, P., & McLeod, L. (1995). Fusarium ear blight (scab) in small grain cereals, a review. Plant Pathology, 44 ( 2), 207-238.):

^■ Fusarium wilt of seeds;

^■ Fusarium head blight; and

^■ Fusarium head blight.

The latter, Fusarium head blight, is associated with a complex of fungal species belonging to the genera Fusarium and Microdochium. The genus Fusarium was first described in 1809 by Link and owes its name to the Latin "fusus" (spindle) in relation to the spindle-shaped shape of its spores. It belongs to the division of Ascomycetes, to the order of Hypocreales and to the family of Nectriaceae. Among the twenty species of the Fusarium genus that can cause Fusarium head blight, F. graminearum, is one of the most problematic species in France due to its production of mycotoxins including trichothecene deoxynivalenol (DON).

[3] Brown rust of wheat, the pathogen of which is Puccinia recondita, is a disease which usually appears quite late in the spring. It can cause significant damage if poorly controlled. The fungus overwinters mainly on the regrowth of cereals and early sowing crops in the form of uredospores. These uredospores germinate in the presence of free water and at temperatures between 15 and 25 ° C. The sporulation period is 5 to 25 days depending on the temperature and the variety. Under favorable conditions, more than 3000 uredospores can be produced per pustule, which explains the character explosive disease. The spores are dispersed mainly by the wind (Ali, S., Gladieux, P., Leconte, M., Gautier, A., Justesen, AF, Hovmoller, MS, Enjalbert, J., de Vallavieille-Pope, C. ( 2014). Origin, Migration Routes and Worldwide Population Genetic Structure of the Wheat Yellow Rust Pathogen Puccinia striiformis f.sp. tritici. PLoS Pathogens, 10 (1), el003903; De Vallavieille-Pope, C., Ali, S., & Leconte, M. (2012) Special Report Virulence Dynamics and Regional Structuring of Puccinia striiformis f sp. Tritici in France Between 1984 and 2009.).

[4] Yellow rust of wheat, the pathogen of which is Puccinia striiformis, is a disease which can be very harmful in susceptible varieties if attacked early. The cool and humid conditions are favorable to its development. Yellow rust spends the winter as mycelium or active spores on regrowth of cereals or crops sown in early fall. This fungus is resistant to freezing temperatures and usually survives the winter on infected plants. In the spring, yellow rust begins to develop and produces active spores, especially since the weather is cool and humid. Optimal conditions for spore germination are met when temperatures are between 10 and 13 ° C with 100% relative humidity. The spores are dispersed mainly by the wind (Rossi, V., Racca, P., Giosue ', S., Pancaldi, D., & Alberti, F (1997). A simulation model for the development of brown rust epidemics in winter wheat, European Journal of Plant Pathology, 103 (5), 453-465.).

Among the various control methods available to fight against these diseases, in particular septoria and fusarium and their consequences, there is chemical control (fungicides), varietal resistance, plant defense stimulators (SDN or "elicitors"), agronomic control (tillage, previous crops, management of crop residues or regrowth, date and density of sowing, nitrogen fertilization, etc.). However, these present either environmental drawbacks linked to soil and groundwater pollution, or involve a significant human and time cost.

In order to respect the environment, it was then developed means of natural biological control using microorganisms. The latter, also called direct microbiological control, consists of introducing specific microbial antagonists into the soil or into the plant material. These antagonists, also called biological control agents or BCA (Biological Control Agent), can interfere with the growth and / or survival of pathogens, thus making it possible to control them. To do this, control agents biological or BCA can control target pathogens through one or more modes of action:

1 / the competition which can take place between the BCA and the pathogen for oxygen, for space, or for nutrients;

2 / antibiosis. which corresponds to interactions involving at least one diffusible low molecular compound or an antibiotic produced by a microorganism which inhibits the growth of another microorganism;

3 / parasitism and the production of hydrolytic enzymes and / or antibiotic metabolites to the detriment of another host organism; and or

4 / induction of resistance in the host plant ("elicitation") like bacteria of the rhizosphere, known under the name of PGPR Plant Growth Promoting Rhizobacteria), which are capable of inducing systemic resistance in the plant Induced Systemic Resistance (ISR) which increases resistance to pathogens thanks to a phenomenon of potentiation (or priming), which corresponds to a waking state allowing a faster and more intense immune response of the plant.

Since the genus Trichoderma comprises various species of fungi that may be biocontrol agents, their mode of action has been the subject of much work. They report in particular a capacity of this filamentous fungus to intervene according to various mechanisms: mycoparasitism, antagonism (competition), antibiosis (production of antibiotics), root stimulation, growth stimulation by solubilization of fertilizing minerals, stimulation of natural defenses plants, etc. They colonize the roots of herbaceous and woody plants without any damage. In addition, this fungus can penetrate the roots and promote development, nutrition and disease resistance. However, the effects are uneven from one species to another or even from one strain to another because a good biological control agent must be a good colonizer and a good antagonist, but above all, it must also be compatible with the rhizosphere. and with plants.

BRIEF OVERVIEW

In this context of combating fungal diseases, such as septoria and fusarium, a first aim of the invention therefore consists in providing an effective strain, such as a biological control agent (or biocontrol agent) . A second aim of the invention is to provide phytosanitary compositions for the prevention and / or treatment of fungal diseases of plants.

A third aim of the invention is also to provide phytosanitary coating compositions where, in association with a plant seed, the strain of the invention is used as an agent for accelerating the germination of said seed.

Another object of the invention is to provide methods for manufacturing said compositions and for implementing the prevention and / or treatment of fungal diseases of plants, and the acceleration of germination.

DETAILED DESCRIPTION

A first aspect of the invention relates to an isolated strain of Trichoderma atroviride in which the ech42 gene has a sequence identity of at least 98% with the sequence SEQ ID NO: 1 of the ech42 gene of the TAL-17 strain deposited on July 03. 2018 at the CNCM under number CNCM 1-5333.

Surprisingly, it appeared that the strain of Trichoderma atroviride TAL-17 developed by the inventors, of which the ech42 gene was sequenced, has excellent growth stimulating properties, antagonistic properties useful in agriculture as well as great stability. in terms of sustainability. In fact, it is an ideal biocontrol agent to effectively fight against fungal diseases of plants.

By "a sequence identity of at least 98% with the sequence SEQ ID NO: 1" is meant a sequence identity of at least 98.5%, at least 99% or even at least 99, 5% with the sequence SEQ ID NO: 1 represented by the following nucleic acid sequence:

AC AG T AT AAG CAT AT CG GAGAAAT GC CAC CAC C AG C AAC GTTGCT AGAC TTGGC GAG GTGCG GCATAGT TCAGTGATAT TGCGCCGGGGCATCCCCTGGATATGCT TATCT TCTGAATCTGGGG AACT TGGGAAT TCTACGAGTCGACAGCCGCCGAGCCCTGGGCACGGGACAGGGGCCACAAGC TCTTG ACC GAT GG CAC T AT TCT AGAG C AGAAG T GAG CAT AAC GTTGC GAT T GAC CAT GTTGGC AAAG CAT GGGTT AC AT AC C TAC TCGTGCT AAGAAC CCC GAAAG G GAAG CTT CAT AAG TT GA CTT CAGAT TT CGC T GAACAATAGGAGGC T CCACAAT CAC T TATAAATAT GC T GCATAT CC TT CCAGCACT TCG GAT G AAAAT TCCATCCAGTAGCAGCAG TCAG TTCA AAGCAGCAGC TTCA A TCT TCCT T TCAAAGCATCTCT TGACAACCT T TGCTGAATCTCAAACACT TCACCATGT T GGGCT TCCTCGGAAAATCCGTGGCCCTGCT TGCTGCGCTGCAGGCCACTCTCAT T TCTGCAT

CTCCTGTAACTGCAAACGACGTCTCTGT TGAGAAGAGAGCCAGTGGATACGCAAACGCCGTC TAC TT CAC C AAC TGGT AAG T GAAG CTGCTTC AGAG T CAT GAAAAT C AG GAC T AAC CAT TGGT GATTAAAGGGGTATTTACGGCCGCAACTTCCAGCCTCAGAACCTGGTCGCGTCGGACATCAC TCATGTCATCTACTCGTTCATGAACTTCCAAGCAGACGGCACTGTGTAAGTTTTGAAGACAA GAGTCAAGATATTCTAATTTCCATATCCAGTGACTAATCTTTTCACTTATAGCGTCTCTGGA GAT CCG TAC CCG GAT T AT C AGAAG CAC T AT GAC GAC GAT TGT AT GCT AG CCC TAC TCCCTTT GTTCTCTCCTGTTTTTGAGCTCTTCAGGTATACTAACGTCTACAACAGCTTGGAACGACGTC GGTAACAATGCGTACGGCTGTGTGAAGCAGCTGTTCAAGCTGAAGAAGGCCAACCGCAACTT GAAGGTTATGCTTTCCATCGGTGGCTGGACCTGGTCCACCAACTTTCCTTCTGCAGCAAGCA CCGATGCCAACCGCAAGAACTTTGCCAAGACTGCCATCACCTTCATGAAGGACTGGGGTTTC GATGGTATTGACGTCGATTGGGAGTACCCCGCCGATGATACCCAGGCCACCAACATGGTTCT TCTGCTCAAGGAGATCCGATCTCAGCTAGATGCCTATGCTGCGCAATACGCTCCGGGCTACC ACTTCCTTCTTTCCATTGCTGCCCCCGCTGGCCCAGAGCACTACTCTTTCCTGCACATGTCC GACCTTGGCCAAGTTCTCGACTATGTCAACCTCATGGCCTACGACTATGCTGGTTCTTGGAG CAGCTACTCCGGACACGATGCCAACTTGTTTGCCAACCCGTCCAACCCCAACTCTTCACCAT AC AC C AAC GAT AAG C AT C CT AAG GAC AAG Tatat C G GAG AAG GTGTTCCCG C C AAG AT CGTT CTTGGCATGCCCATCTACGGACGAGCTTTTGAGAGCACCGGTGGCATTGGCCAGACCTACAG TGGAATTGGATCTGGAAGCTGGGAGAACGGTATTTGGGACTACAAGGTTCTTCCCAAGGCCG GCGC CAC AG TCC AG T AT GAC TCTGTCG CAC AG G CAT AC T AC AG CT AT GAC CCC AG C AG C AAG GAGCTCATCTCTTTCGATACCCCTGACATGATCAACACCAAGGTCTCTTACCTCAAGAACCT CGGCCTGGGAGGCAGCATGTTCTGGGAAGCTTCTGCTGACAAGACTGGCTCTGACTCCTTGA TCGG AAC AAG C CAC AG AG CTTTGG GAAG CTC AG AC TC CAC TC AG AAC TTGCT GAG CT AC CCC AACTCCCAGTATGATAACATCCGAAGCGGTCTCAACTAGAGATCTTTCTTCTTCTTATCTTT TTCTTTTACTTCCCCTATGGTTGTACCAACATTTCACACACGTTATGCGAAACGATTATGCA GG GAG CGTTATTTTTTAG AT AAAT AG TTG TAC GAC AGCTTTTTTAG AT AAAT AG TTG TAC GCC AGCTTT GATT AT ATG AT AG TTG TAC GAC GCTTT AT AT ATG ATG AT AG TTG TAC GCTTT GATT AT ATG AT AG TTG TAC GCT GAC ATTT AT AT

Within the meaning of the invention, the sequence identity is measured by conventional tools for comparing sequences known to those skilled in the art such as the algorithms of the BLAST platform or the MatGat program (Campanella, Bitincka and Smalley, 2003) .

More particularly, one of the objects of the invention is the isolated strain of Trichoderma atroviride deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333 and / or one of its mutants.

By “isolated strain” is meant the culture of a single microorganism which has been isolated from various microorganisms present on and / or in the tissues of a leaf fragment. of wheat grown in fields. By “one of its mutants” is meant mutant strains obtained by mutations or genetic manipulations of a reference strain, which in the context of the invention is the isolated strain of Trichoderma atroviride TAL-17 filed on July 3, 2018 at the CNCM under the number CNCM 1-5333. These mutants, however, retain the same physiological properties as the reference strain or even may exhibit improved physiological properties (eg. Improvement in biocontrol capacities).

In view of the foregoing, it is therefore understood that one of the subjects of the invention also relates to an isolated strain of Trichoderma atroviride, the ech42 gene of which has a sequence identity of at least 98% with the sequence SEQ ID NO: 1 of the ech42 gene of the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333 and / or one of its mutants,

in particular said isolated strain of Trichoderma atroviride is the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333 and / or one of its mutants, and preferably, said isolated strain of Trichoderma atroviride is the strain TAL-17 filed on July 03, 2018 at the CNCM under number CNCM 1-5333.

All of these strains (ie TAL-17 and its mutants) can moreover be easily identified via the so-called real-time Polymerase Chain Reaction (qPCR) method. The inventors have developed specific tools thereof namely, a TaqMan ^® probe GS285741-P1 and a pair of nucleotide primers associated GS285741-F1 and GS285741-R1 (see Table 1), which can amplify a sequence specific to the strains of the invention {cf. Table 2).

Name Sequence SEQ ID NO: Tm (° C)

GS285741-R1 AAC-GAG-ACT-TGA-CAG-TAG-CG 3 60.0

GS285741-P1 FAM-ACG-GCG-TAT-ATT-GTT-GAC-AAA- 4

CAA-GAT-GC-MGB

Table 1: Nucleotide primers (Fl and RI) and TaqMan ^® probe (PI)

FAM: 6-carboxyfluorescein, MGB: minor groove binder. SEQ ID

Name Sequence

NO:

Dell 1_285741 GCAATAAC T GC T CGTAT TAC T CCAGAAAAAGGGGCAAGT C TA 5 Ins (251-264) TCAACAGCCGCCGCTGCCAAGAATACGGGCTGGTCCTAGT TC

STW TGT TCATCGTCGCT TGGTGCTGCGTAGTCT TGAGCTAA AT GT T TAGCCAAT TCT CAAACGC TT GGCAGATAAAT TT TAT T AT T TAC CTC Agaat AT GGT CAT TGGC GAAT GCC AGAC GAAT C ACLS T GGAT GAT GCC TT CAACAGAT GGCCAT GCATCT TGT TT GTCAACAATATACGCCGT TGATGGGGCGCTACTGTCAAGTCT CGT TT TGATACTCTAGT T TCTCTCTCGTGATATATCAGCCGC CAC CTT AT GT AAAAC AG CCTGC AT CAAT TCTC CAAAT T GAC ATT GT T GTATAAAGAGGAAGGCGC T CATAGAT GC TATACAT CA T GAT T AACAAAGG TT AT TT AC T ACAAT TCTTCTTGTT AT GC T CGCAAT TCTCTACT TCTGATGGAATGTGTAGTGCTGTG

Table 2: Target sequence of oligonucleotides and of the TaqMan ^® probe in strain TAL-17 and / or its mutants

Very particularly, one of the subjects of the invention relates to an isolated strain of Trichoderma atroviride, the ech42 gene of which has a sequence identity of at least 98% with the sequence SEQ ID NO: 1 of the ech42 gene of the TAL- strain. 17 filed on 03 July 2018 at the CNCM under number CNCM 1-5333,

in particular said isolated strain of Trichoderma atroviride is the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333.

More particularly still, one of the objects of the invention is the isolated strain of Trichoderma atroviride deposited on July 3, 2018 at the CNCM under number CNCM 1-5333.

According to this same aspect, another of the objects of the invention relates to the isolated strain of Trichoderma atroviride of the invention in the form of spores, produced by fermentation in solid or liquid medium, said spores possibly in purified form or in the matrix of production, said production matrix being solid or liquid.

By “in the form of spores” is meant in the form of conidiospores or chlamydospores (more particularly conidiospores) ensuring the function of asexual multiplication in the fungus. The term “fermentation in a solid medium (FMS)” is understood to mean any process allowing the development of the microorganism on the surface and / or inside a solid and humidified porous production matrix, in the absence of free water.

By "liquid fermentation" is meant any process allowing the development of the microorganism using a production matrix with the presence of free water.

By "production matrix" is meant any natural and / or synthetic substrate, which allows the development of the microorganism and induces the production of biomass, and / or enzymes, and / or primary and / or secondary metabolites. Examples of families of enzymes or enzymes produced by the fungus are proteases, chitinases and beta-1,3-glucanase.

By "spores [...] in purified form" is meant the concentrated spores following the elimination of the major part of the remainder of the matrix after production which has not been used for the formation of the spores, with the help of 'a sieving process for example.

By "spores [...] in the production matrix" is meant the spores that remain in the production matrix at the end of the manufacturing process, without a purification step.

Another object of the invention relates to the isolated strain of Trichoderma atroviride of the invention as a biological control agent.

By “biological control agent” is meant that a strain of Trichoderma atroviride according to the invention can interfere with the growth and / or the survival of pathogens, thus making it possible to control them, via one or more of the methods. action described above (eg via the development of its biomass and / or its production of enzymes and / or secondary metabolites). For example, one of the means of demonstrating that a strain of Trichoderma atroviride according to the invention is a biological control agent is to carry out a Dual culture test on culture medium in a Petri dish such as those presented among the examples. below. More precisely by “Dual culture test” is meant a test on a Petri dish in the laboratory on culture medium, where the strain of the microorganism, biological control agent and the strain of the pathogen are cultured on the same dish in order to observe. the effect of one strain on another over time and vice versa.

Another object of the invention relates to the isolated strain of Trichoderma atroviride of the invention, as an antifungal agent of plants.

By “plant antifungal agent” is meant that a strain of Trichoderma atroviride according to the invention is capable of combating phytopathogenic fungi. For example, one of the means of demonstrating that a strain of Trichoderma atroviride according to the invention is an antifungal agent for plants is to carry out a dual culture test such as those presented among the examples below.

Very particularly, one of the objects of the invention relates to the isolated strain of Trichoderma atroviride of the invention as a biological control agent,

in particular as an antifungal agent for plants directed against a fungus pathogenic for plants, said pathogenic fungus being chosen in particular from Septoria tritici or Gibberella zeae (= Fusarium graminearum) or Puccinia recondita or Puccinia striiformis.

A second aspect of the invention relates to the use of the isolated strain of Trichoderma atroviride of the invention, in particular in the field of malting.

More particularly, the invention relates to the use of said isolated strain of Trichoderma atroviride in the prevention and / or treatment of fungal diseases of plants, in particular of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley. Advantageously, the invention relates to the use of said isolated strain of Trichoderma atroviride in the prevention and / or treatment of fungal diseases of wheat and / or corn and / or barley.

The invention also relates to the use of said isolated strain of Trichoderma atroviride for promoting the germination of a seed of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley. Advantageously, the invention relates to the use of said isolated strain of Trichoderma atroviride to promote the germination of a seed of wheat and / or corn and / or barley. Regarding this particular aspect, it should be noted that the germination aid advantageously and at the same time allows the prevention and / or treatment of fungal diseases at the time of sowing. The development of a disease after sowing is thus avoided and the yield is optimized via the biostimulant aspect of the strain of the invention. Advantageously, this aspect also makes it possible to avoid a significant slowdown in the development of the crop if a period of drought occurs some time after sowing (which can happen in spring) and therefore to avoid loss of yields at harvest.

A third aspect of the invention relates to a phytosanitary composition comprising: the isolated strain of Trichoderma atroviride of the invention as an active principle; or

the metabolites emitted during the production of the isolated strain of Trichoderma atroviride of the invention as an active principle; or

the isolated strain of Trichoderma atroviride of the invention and its metabolites emitted during its production as an active principle; or

the isolated strain of Trichoderma atroviride of the invention in combination with at least one other biological control agent (BCA) as active principle; or the isolated strain of Trichoderma atroviride of the invention and its metabolites emitted during the production of the strain in combination with at least one other biological control agent as an active principle.

By "metabolites emitted during the production of the strain" or "its metabolites emitted during its production" is meant any molecule produced by the strain of the invention during its development. For example and without limitation, such metabolites can be enzymes produced by the fungus such as proteases, chitinases and beta-1,3-glucanase.

By “biological control agent” is meant a microorganism capable of interfering with the growth and / or survival of pathogens, thus making it possible to control them. The strain of the invention TAL-17 (deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333) is an example, but within the meaning of the invention it is a question here of combining the strain of invention to at least one other biological control agent, which is different from the strain of the invention. By “at least one other biological control agent” is meant that the plant protection composition of the invention can contain 2 biological control agents (that of the invention and another), just as it can contain 3, 4 or more. 5 (that of the invention and 2, 3 or 4 others).

More particularly, one of the objects of the invention relates to the phytosanitary composition described above, said phytosanitary composition being initially (on purchase) in the form of a solid or concentrated liquid composition. Such a solid or concentrated liquid composition can be, for example, obtained by means of a particular formulation of the spores of the isolated strain of Trichoderma atroviride of the invention produced by fermentation in solid or liquid medium, said spores possibly being in purified form or in the production matrix, said production matrix being solid or liquid.

By "concentrated composition" is meant a composition in which the concentration of the active principle (ie the strain of the invention, which can be in the form of spores) is greater than an effective amount of 10 ⁷ spores / g, i.e. 10 ⁷ CFU / g. Also, a particular aspect of the invention relates to the phytosanitary composition comprising the isolated strain of Trichoderma atroviride of the invention as active principle, said phytosanitary composition being in the form of a solid or concentrated liquid composition in which the concentration of the active principle is greater than an effective amount of 10 ⁷ spores / g.

By "greater than an effective amount of 10 ⁷ spores / g" is also meant greater than an effective amount of 10 ⁸ spores / g, greater than an effective amount 10 ⁹ spores / g, greater than an effective amount 10 ¹⁰ spores / g. g, greater than an effective amount of 10 ¹¹ spores / g or greater than an effective amount of 10 ¹² spores / g.

The user of the aforesaid composition must then incorporate or suspend it in a solid (eg. Soil, etc.) or aqueous (eg water) medium to obtain a dilute composition comprising an effective amount of 10 ⁴ to 10 ¹² spores / g of the Trichoderma atroviride strain of the invention, which may be in the form of spores. The resulting diluted solid or liquid composition can then be applied to plants for which prevention and / or treatment of a fungal plant disease is desired.

Within the meaning of the invention, the spreading of the aforesaid composition comprises in particular the conventional spreading techniques known to those skilled in the art, which are used to spread solid materials (eg sewage sludge, manure over an area to be treated). , etc.) or liquid (eg pesticides, etc.) of agronomic interest.

More particularly, one of the subjects of the invention relates to the phytosanitary composition described above, comprising an effective amount of 10 ⁴ to 10 ¹² spores / g, more particularly 10 ⁷ to 10 ⁹ spores / g,

said phytosanitary composition optionally being obtained after a preparation step (e.g. dilution by suspending or mixing) making it ready for spreading.

By “effective quantity of spores / g” is meant the number of spores capable of forming a colony on culture medium (CFU = colony-forming unit) per g (gram) of product.

In addition, the expression "from 10 ⁴ to 10 ¹² spores / g" can also mean from 10 ⁴ to 10 ⁵ spores / g, from 10 ⁴ to 10 ⁶ spores / g, from 10 ⁴ to 10 ⁷ spores / g, from 10 ⁴ to 10 ⁸ spores / g, from 10 ⁴ to 10 ⁹ spores / g, from 10 ⁴ to 10 ¹⁰ spores / g, from 10 ⁴ to 10 ¹¹ spores / g, from 10 ⁵ to 10 ⁶ spores / g, from 10 ⁵ to 10 ⁷ spores / g, from 10 ⁵ to 10 ⁸ spores / g, from 10 ⁵ to 10 ⁹ spores / g, from 10 ⁵ to 10 ¹⁰ spores / g, from 10 ⁵ to 10 ¹¹ spores / g, from 10 ⁵ to 10 ¹² spores / g, from 10 ⁶ to 10 ⁷ spores / g, from 10 ⁶ to 10 ⁸ spores / g, from 10 ⁶ to 10 ⁹ spores / g, from 10 ⁶ to 10 ¹⁰ spores / g, from 10 ⁶ to 10 ¹¹ spores / g, from 10 ⁶ to 10 ¹² spores / g, from 10 ⁷ to 10 ⁸ spores / g, from 10 ⁷ to 10 ⁹ spores / g, from 10 ⁷ to 10 ¹⁰ spores / g, from 10 ⁷ to 10 ¹¹ spores / g, from 10 ⁷ to 10 ¹² spores / g, from 10 ⁸ to 10 ⁹ spores / g, from 10 ⁸ to 10 ¹⁰ spores / g, from 10 ⁸ to 10 ¹¹ spores / g, from 10 ⁸ to 10 ¹² spores / g, from 10 ⁹ to 10 ¹⁰ spores / g, from 10 ⁹ to 10 ¹¹ spores / g, from 10 ⁹ to 10 ¹² spores / g, from 10 ¹⁰ to 10 ¹¹ spores / g, from 10 ¹⁰ to 10 ¹² spores / g or from 10 ¹¹ to 10 ¹² spores / g.

Within the meaning of the invention, the latter also relates to a phytosanitary coating composition comprising the isolated strain of Trichoderma atroviride of the invention and optionally at least one fixing agent, said phytosanitary coating composition making it possible to produce a coated seed. . The invention therefore also relates to a phytosanitary coating composition comprising the isolated strain of Trichoderma atroviride of the invention, said phytosanitary coating composition making it possible to produce a coated seed; a phytosanitary coating composition comprising the isolated strain of Trichoderma atroviride of the invention and at least one fixing agent, said phytosanitary coating composition making it possible to produce a coated seed.

One of the objects of the invention therefore relates to a coated seed comprising a plant seed, said plant seed being coated with said phytosanitary coating composition and said plant belonging in particular to the Poaceae family, in particular wheat and / or corn and / or barley. By “coated seed” is meant a seed selected for sowing, said seed having undergone a particular treatment which has enabled it to be coated in a phytosanitary coating composition. Advantageously, the invention relates to the coated seed as described above, said plant being wheat and / or corn and / or barley. Advantageously, the invention also relates to the coated seed as described above, said coated seed comprising an effective amount of 10 ⁵ to 10 ⁸ (or 10 ⁶ to 10 ⁷ ) spores / coated seed, preferably 10 ⁶ ( or 10 ⁷ ) coated spores / seed.

A fourth aspect of the invention relates to the use of the composition of the invention. More particularly, the invention relates to the use of the composition of the invention in the prevention and / or treatment of fungal diseases of plants, in particular of plants belonging to the Poaceae family, in particular wheat and / or corn. and / or barley. Advantageously, the invention relates to the use of the composition of the invention in the prevention and / or treatment of fungal diseases of wheat and / or corn and / or barley. The invention also relates to the use of the composition of the invention for promoting the germination of a seed of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley. Advantageously, the invention relates to the use of the composition of the invention for promoting the germination of a seed of wheat and / or corn and / or barley.

Very particularly, one of the subjects of the invention relates to the use of the isolated strain of Trichoderma atroviride of the invention or of the phytosanitary composition described above in the prevention and / or treatment of fungal diseases of plants, in particular of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley; and or

to promote the germination of a seed of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley.

A fifth aspect of the invention relates to a method of protecting and / or treating a plant against a disease caused by a pathogenic fungus for plants comprising the application of the composition of the invention to at least part of said plant or soil near said plant.

More particularly, the invention relates to said method of the invention, wherein said part of said plant is a leaf, a fruit, a seed.

Very particularly, one of the objects of the invention relates to a method of protecting and / or treating a plant against a disease caused by a pathogenic fungus for plants comprising the application of the composition of the invention to at least part of said plant or of the soil near said plant,

in particular said part of said plant is a leaf, a fruit, a seed, and

in particular said plant belongs to the Poaceae family, in particular wheat and / or corn and / or barley.

Still according to this fifth aspect, the invention relates to the method described above, in which said composition is applied

at a rate of 10 to 500 L / ha, in particular from 50 to 250 L / ha, in particular for aerial spraying; or at an effective amount of 10 ¹⁰ to 10 ¹⁴ spores / ha, in particular 10 ¹⁰ to 10 ¹² spores / ha, in particular for aerial spraying of the foliar spray type.

The expression "10 to 500 L / ha (liter / hectare)" also means 10 to 400 L / ha, 10 to 300 L / ha, 10 to 200 L / ha, 10 to 100 L / ha , 100 to 500 L / ha, 200 to 500 L / ha, 300 to 500 L / ha, 400 to 500 L / ha, 50 to 500 L / ha, 50 to 250 L / ha or 250 to 500 L / ha. The expression "from 10 ¹⁰ to 10 ¹⁴ spores / ha" also means from 10 ¹⁰ to 10 ¹¹ spores / ha, from 10 ¹⁰ to 10 ¹³ spores / ha, from 10 ¹¹ to 10 ¹² spores / ha, from 10 ¹¹ to 10 ¹³ spores / ha, 10 ¹¹ to 10 ¹⁴ spores / ha, 10 ¹² to 10 ¹³ spores / ha, 10 ¹² to 10 ¹⁴ spores / ha or 10 ¹³ to 10 ¹⁴ spores / ha.

The invention relates more particularly to the process described above, in which said plant belongs to the Poaceae family, in particular wheat and / or corn and / or barley. Advantageously, the invention relates to the process described above, in which said plant is wheat and / or corn and / or barley.

The invention preferably relates to the method described above, in which said pathogenic fungus is Septoria tritici or Gibberella zeae (= Fusarium graminearum) or Puccinia recondita or Puccinia striiformis.

By "Septoria tritici" is meant the pathogen of septoria.

By "Gibberella zeae (= F. graminearum)" is meant the pathogen of Fusarium wilt.

By "Puccinia recondita" is meant the pathogen of brown rust of wheat.

"Puccinia striiformis" is understood to mean the pathogen of yellow rust of wheat.

The invention relates more particularly to the method described above, in which

the protection of said plant comprises a step of coating the seed with said phytosanitary composition; and or

the protection of said plant comprises spraying said composition at the time of sowing or at the germination of said plant; and or

the protection of said plant comprises either a preventive application at soil level before sowing said phytosanitary composition with the addition of organic amendment, or a preventive application at soil level before sowing said phytosanitary composition on the previous crop; and or

the treatment of said plant comprises spraying said composition during different phenological stages of the plant to prevent a risk of infection of said pathogenic fungus of the whole or part of the plant. By “different phenological stages” is meant from seed to flowering (BBCH000 to BBCH619 according to the BBCH scale of phenological stages of vegetables in the Solanaceae family (Feller et al., 1995 - Phànologische entwicklungsstadien von gemüsepflanzen: II . Fruchtgemüse und hülsenfrüchte; Nachrichtenbl. Deut. Pflanzenschutzd)).

Regarding the above process, it should be noted that its implementation for the treatment of fusarium wilt at the flowering stage of the plant preferably implies that the strain of the invention is active rapidly and in this sense that said composition or rather in liquid form and does not contain “formulants” incompatible with the strain which could hinder the development and the mode of action of said strain of the invention. By “formulants” is meant wetting adjuvants or preservative protectants.

In all respects, it should be noted that the different aspects of the invention, as well as the different embodiments thereof, are interdependent. The latter can therefore be combined in abundance to obtain aspects and / or preferred embodiments of the invention not explicitly described. This also applies to all of the definitions provided in this description, which applies to all aspects of the invention and its embodiments.

The present invention is further illustrated, without however being limited to, by the following figures and examples.

LIST OF FIGURES

Figure 1 represents the visual observations of the Dual culture test against Fusarium graminearum, to the left of the Petri dishes, at 6 (A and B) and 10 (C and D) days of cultures for the TAL-17 strain (A and C) and the BCA C strain (B and D), to the right of the Petri dishes.

FIG. 2 represents the microscopic observation (x100 magnification) with an inverted microscope of the mycelia of F. graminearum (black arrow) and of the TAL-17 strain (white arrow) on a Petri dish containing PDA medium (potato, dextrose, agar), after 8 days of growth.

Figure 3 represents the occupied surface (in%) and the associated photographs of the front face of a Petri dish inoculated with a rake with three strains of microorganisms (F. graminearum, TAL-17 and BCA C alone or in mixtures after 7 growing days Average ± sd Different letters indicate a significant difference between the modalities (1-way ANOVA, p <0.05).

FIG. 4 represents the change in the surface area occupied by the BCA TAL-17 and Fusarium graminearum microorganisms alone or as a mixture after depositing 30 μL in the center of a culture dish with PDA medium after 72 h (A) and after 96 h (B) of culture at 25 ° C under a light hood.

Figure 5 shows the change in the percentage inhibition of Fusarium graminearum on a dish depending on the formulation used.

Figure 6 shows the percentage of CIV tubes showing septoria spots as a function of treatment after 18 days and 26 days of disease inoculation.

FIG. 7 represents the percentage of healthy grains observed at harvest during the tests in the phytotronic room.

FIG. 8 represents the mass of grains per ear at harvest during the tests in a phytotronic room.

FIG. 9 represents the percentage of visual symptoms of contamination on ears by Fusarium wilt during the tests in the phytotronic room.

FIG. 10 represents the mass of grains per ear at harvest during the tests in a phytotronic room.

FIG. 11 represents the percentage of fusarious grains at harvest during the phytotronic room tests carried out.

FIG. 12 represents the germination of maize plants after 6 days of growth with a sowing treatment of a suspension of TAL-17 spores at 1.10 ⁵ CFU spores / seed or 1.10 ⁸ CFU spores / seed. An aerial treatment is carried out later during the 5-leaf stage and is not taken into account when measuring germination. Mean ± sd Different letters indicate a significant difference between the different modalities (1-way ANOVA, p <0.05).

FIG. 13 represents the measurement of the height in height of corn plants after 25 days of growth with a sowing treatment of a suspension of TAL-17 spores at 1.10 ⁵ UFC spores / seed or 1.10 ⁸ UFC spores / seed. An aerial treatment is carried out later during the 5-leaf stage and is not taken into account when measuring germination. Mean ± sd Different letters indicate a significant difference between the different modalities (1-way ANOVA, p <0.05).

FIG. 14 represents the percentage of germination of seeds of spring wheat (Calixo) in the presence or absence of suspended spores of Trichoderma atroviride TAL-17 at sowing. Culture in a phytotron chamber with photoperiod. Mean ± s.d. Significant difference between the water modality and the TAL-17 modality (1-factor ANOVA, p <0.05).

Figure 15 includes photographs (A) and a graphic (B).

(A) Visual observations of the Dual culture test against Fusarium graminearum, to the right of the Petri dishes, at 6 and 10 days of co-cultures with the TAL-17 strain (top panel) or the BCA D strain (center panel) , to the left of the Petri dishes. The bottom panel corresponds to the culture of Fusarium graminearum alone. The white arrows indicate the area of overlap of the TAL-17 strain on Fusarium graminearum.

(B) Graphical representation of the length of recovery of the pathogen F. graminearum (F. gram) by the BCA in Dual culture on PDA agar (25 ° C without photoperiod).

Figure 16 includes photographs (A) and a graphic (B).

(A) Visual observations of the Dual culture test against Fusarium graminearum after 6 days of co-cultures with the TAL-17 strain (left panel) or the SCI strain (right panel). Line 1 (the top one) corresponds to BCA alone at the dose of 1.10 ⁴ CFU / mL, line 2 corresponds to the BCA / Fusa ratio 2/1 mixture (BCA at 1.10 ⁴ CFU / mL and Fusa at 5.10 ³ CFU / mL), line 3 corresponding to the BCA / Fusa ratio 1/1 mixture (BCA at 1.10 ⁴ UFC / mL and Fusa at 1.10 ⁴ UFC / mL) and line 4 corresponds to the BCA / Fusa ratio 1/2 mixture (BCA at 1.10 ⁴ CFU / mL and Fusa at 2.10 ⁴ CFU / mL). The bottom panel corresponds to the culture of Fusarium graminearum alone, from left to right, at a dose of 2.10 ⁴ , 1.10 ⁴ and 5.10 ³ CFU / mL.

(B) Graphic representation of the percentage occupancy of BCA (TAL-17 or SCI) and of the pathogen F. graminearum (F. gram) at the end of the dual culture test on PDA agar (25 ° C without photoperiod).

Figure 17 includes photographs (A) and a graphic (B).

(A) Visual observations of the Dual culture test against Fusarium graminearum after 10 days of co-cultures with the TAL-17 strain (left panel) or the SCI strain (right panel). Line 1 (the top one) corresponds to BCA alone at a dose of 1.10 ⁴ CFU / mL, line 2 corresponds to the BCA / Fusa ratio 2/1 mixture (BCA at 1.10 ⁴ UFC / mL and Fusa at 5.10 ³ UFC / mL), line 3 corresponding to the BCA / Fusa ratio 1/1 mixture (BCA at 1.10 ⁴ UFC / mL and Fusa at 1.10 ⁴ UFC / mL) and line 4 corresponds to the BCA / Fusa ratio 1/2 mixture (BCA at 1.10 ⁴ UFC / mL and Fusa at 2.10 ⁴ UFC / mL). The bottom panel corresponds to the culture of Fusarium graminearum alone, from left to right, at a dose of 2.10 ⁴ , 1.10 ⁴ and 5.10 ³ CFU / mL.

EXAMPLES

(I) Isolation of Trichoderma atroviride strain TAL-17

Isolated stump of a wheat leaf grown in fields.

The leaf sample from the wheat crop was ground and then brought into contact in an infinitely mixed with a PDA (Potato Dextrose Agar) agar at 50 ° C which contains spores of Fusarium graminearum. The dish was cultured at 25 ° C. under a light hood. Thus only the strains being able to reproduce in the presence of Fusarium graminearum developed on the dish. Among these strains TAL-17 was present. A specific sample from an area of interest in the box and several successive subcultures made it possible to isolate the TAL-17 strain, which was then deposited on July 3, 2018 at the CNCM under number CNCM 1-5333.

(II) In vitro study of the efficacy and mode of action of TAL-17 against F. sraminearum

Competitiveness, mycoparasitism and antibiosis 1 / Side-by-side dual-culture tests on a Petri dish

Several dual-culture tests with BCA vs. F. graminearum were carried out in proximity on PDA medium (Potato Dextrose Agar). 30 μL containing 1.10 ⁴ spores / mL (sp / mL) of F. graminearum are inoculated, 2 cm from the end of an 8.5 cm diameter Petri dish containing PDA medium, and 30 μL containing 1.10 ⁶ spores / mL of another microorganism (TAL-17 or another Trichoderma BCA C) at the other end of the Petri dish. The boxes Petri dishes were incubated at 23-27 ° C under artificial light (24 hours a day) (fluorescent tube F36WT8 / 2084 BriteGro ^® ). Macroscopic observations were made 6 days and 10 days after inoculation (Figure 1). Controls of F. graminearum alone and of BCA alone were carried out. The strains tested were the TAL-17 strain and another reference strain also referred to as a Trichoderma atroviride used in Biocontrol (= BCA C> Reference: ATCC ^® 20476).

Strains TAL-17 and BCA C both exhibited an ability to occupy space, whereas strain TAL-17 unlike strain BCA C is capable of growing on the mycelium of Fusarium graminearum (Figure 1). The TAL-17 strain therefore presents a much greater mycoparasitism potential than the other reference strain BCA C. Microscopic observations of the mycelium of the TAL-17 strain in the presence of mycelium from Fusarium graminearum also revealed a coiling of the mycelium. of the TAL-17 strain around Fusarium graminearum (Figure 2), which phenomenon was not observed with the other strain of Trichoderma atroviride (= BCA C) tested.

Compared to the existing bibliography on the subject, mycoparasitism of the genus Trichoderma, which corresponds to the genus of the TAL-17 strain, has been studied on numerous occasions and on numerous targets. Hibar et al. (Hibar, K., Daami-Remadi, M., Khiareddine, H., & Mahjoub, M. El. (2005) In vitro and in vivo inhibitory effect of Trichoderma harzianum on Fusarium oxysporum f. Sp. Radicis-lycopersici. ) showed an inhibitory effect in vivo and in vitro of Trichoderma harzianum on Fusarium oxysporum, in particular by microscopic observations of the contact zone between the two strains which shows a significant lysis, accompanied by a coiling of the strain of T harzianum on F. oxysporum. Steyaert et al. (Steyaert J., Ridgway H., Elad Y., Stewart A. (2003). Genetic basis of mycoparasitism: A mechanism of biological control by species of Trichoderma. New Zealand Journal of Crop and Horticultural Science; 31 (4), 281 -291) demonstrated the mycoparasitism of a strain of Trichoderma atroviride around a hypha of a strain of Botrytis cinerea. The previously described microscopic results therefore confirm the increased mycoparasitism potential of the TAL-17 strain, in particular compared to the BCA C.

In addition, these tests on dishes showed an inhibition zone created by the TAL-17 strain, a sign of a potential antibiosis effect and another test using culture filtrate of the strain. TAL-17 showed an inhibitory effect on the growth of the pathogen Fusarium graminearum (data not shown).

2 / Tests in mixture deposit on the entire surface

Another Dual-culture test with the BCA us F. graminearum was carried out on PDA medium, but this time in a mixture, with 100 mΐ spread over the entire Petri dish (diameter 8.5 cm) . In the center of an 8.5 cm Petri dish containing PDA medium, are spread on the surface 100 μL of a mixture containing 1.10 ⁴ spores / mL of A. graminearum and 1.10 ⁴ spores / mL of BCA (or 0, 5.10 ⁴ spores / mL of each BCA for the BCA mixture modality), moreover for certain modalities this mixture also contains 0.5% of the Appyphyt formulation, which is an emulsion of vegetable oil esters (Vegetable oil esters : 60- 80%; Biobased emulsifier; 1-5%; Qsp Water). The mixture was inoculated after 2 h of contact. The Petri dishes were incubated at 25 ° C. under artificial light (24 hours a day) (fluorescent tube F36WT8 / 2084 Britegro). Measurements of the growth of F. graminearum (in cm) were taken after 48, 72, 96 and 168 h (ie 2 to 7 days) of culture after inoculation. Controls of F. graminearum alone and of BCA alone were carried out. The strains tested were TAL-17 and BCA C.

During this test, the TAL-17 was the most efficient, its mycoparasitism making it possible to cover 100% of the box front face at 7 days (Figure 3).

(III) Tests on plants to observe whether the mode of action of TAL-17 has an endophytic character

The term endophyte comes from two Greek words "endon" and "phuton" which means respectively "inside" and "plant". The definition of endophyte has changed very often over time. First, the definition concerned any organism that could live inside a plant. Today, endophytic organisms are organisms having a way of life with the plant known as “endophism”. That is, endophytic species are able to colonize the internal structures of plants asymptomatically (Hardoim, PR, van Overbeek, LS, Berg, G., Pirttilà, AM, Compant, S., Campisano, A ., ... Sessitsch, A. (2015). The Hidden World within Plants: Ecological and Evolutionary Considerations for Defining Functioning of Microbial Endophytes. Microbiology and Molecular Biology Review s, 79 (3), 293-320.). Endophytes can be microorganisms like fungi. They can colonize the plant at different levels depending on the microorganism. The organs concerned can be, depending on the case: the stem, the roots, the leaf segments, the fruits, the buds, the seeds but also in the dead and hollow hyaline cells of the plants (Stçpniewska, Z., & Kuzniar, A. (2013). Endophytic microorganisms— promising applications in bioremediation of greenhouse gases. Applied Microbiology and Biotechnology, 97 (22), 9589-96.).

Method for preparing samples for observation

Cotton blue (LACP-00D-100 Labkem ^® ) with lactophenol was used in this study as a dye for the detection of fungi. Samples of 1 x 0.5 cm wheat leaf and 2.5 x 1.5 cm corn were taken for each modality studied. The procedure is as follows for the treatment of sections:

1. Mordanting with bleach (3 min)

2. Washing in ultra pure water

3. Coloring in lactophenol cotton blue (3 min)

4. Rinsing in lactoglycerol

5. The samples are then placed under slide and coverslip for microscopic observation (x 400).

1 / Tests on wheat

6 wheat seeds were sown per 0.5 L pot and drilled at the bottom for drainage. The substrate used is a mixture of universal soil and expanded vermiculite (0.5-10 mm) (2: 1 v / v). The substrate was moistened 24 hours before sowing with reverse osmosis water. The seeds were moistened the day before sowing for 24 h at 4 ° C. Once the sowing was done, the pots were placed under a light hood at 25 ° C (16/8 hour photoperiod) and were watered three times a week.

Different treatments have been carried out. For the sowing treatment, 1 mL of the TAL-17 solution at the desired concentration was added to the sown seed (500 pL before deposition of the seed and 500 pL after). For the control and the other conditions tested, the seeds did not receive the BCA treatment but 1 mL of sterile well water. The spray treatment was carried out during the 2 leaf stage or during the flowering stage. The pots not receiving BCA treatments were treated with borehole water by the same device. The first leaves at the bottom of the plant were used for this test.

Fungus mycelium was observed in the leaves and roots of the seedling treated plant in contrast to the untreated control plant.

2 / Tests on corn

3 seeds are sown per 5 L pot drilled at the bottom for drainage. The substrate used is a mixture of universal soil and expanded vermiculite (0.5-10 mm) (2: 1 v / v). The substrate was moistened 24 hours before sowing with reverse osmosis water. The pots were watered three times a week with an increasing volume of RO water as the plant developed.

For the sowing treatment, 1 mL of the TAL-17 solution at the desired concentration (10 ⁵ or 10 ⁸ / mL) was added to the sown seed (500 pL before seed deposition and 500 pL after). For the control and the other conditions tested, the seeds did not receive the BCA treatment but 1 mL of sterile well water. The spray treatment was carried out during the 5 leaf stage.

Finally, these tests (see Examples II and III) showed that the TAL-17 strain is capable of acting against Fusarium graminearum in different ways. It combines competition, antibiosis, my coparasitism and is able to penetrate the plant. (IV) BCA inoculation strategy

Development of formulations 1 / Mixed tests with central deposition

Another Dual-culture test with the BCA us F. graminearum was carried out on PDA medium, but this time mixed, with a drop deposited in the center of the dish (30 m 30). In this test only TAL-17 was tested. Growth measurements of F. graminearum (in cm) were taken after 48, 72 and 96 h of culture (Figure 4).

In the center of an 8.5 cm Petri dish containing PDA medium, were inoculated 30 μL of a mixture containing 1.10 ⁴ spores / mL of F. graminearum and 1.10 ⁴ spores of BCA, more for certain modalities this mixture also contains 0.5% of the Appyphyt formulation, which is an emulsion of vegetable oil esters (Vegetable oil esters: 60-80%; Bio-based emulsifier; 1-5%; Qsp Water). The mixture was inoculated after 2 h of contact. The Petri dishes were incubated at 23-27 ° C under artificial light (24 hours a day) (fluorescent tube F36WT8 / 2084 BriteGro ^® ). Growth measurements of F. graminearum were taken 2 to 7 days after inoculation. Controls for F. graminearum alone and BCA alone were made.

Strain TAL-17 resulted in a 63% reduction in the development of Fusarium graminearum in a Petri dish at 72 h and 78% at 96 h. This reduction rose to 77% at 72 h and to 85% at 96 h when combined with the Appyphyt formulation (Figure 5). It should be noted that at 96 h the Appyphyt formula alone did not show any inhibition on the growth of Fusarium graminearum.

2 / Coating of seeds

The previous results, which demonstrated the endophytic appearance, indicate a potential interest in coating the seeds of the target crops with the TAL-17 strain. This interest was confirmed by the bio-stimulation tests on germination (see below). (V) Effect of BCAs on plant protection

Phytotronic room study 1 / Septoria

The in vitro culture was developed to perform a screening of the selected BCAs potentials against the septoria blight of the wheat Septoria tritici. The standard in vitro culture medium has been modified by removing the sucrose to avoid possible contamination.

Two tests were carried out.

The disease and BCA were applied simultaneously by spraying under conditions as close to the field as possible.

The percentages of plants exhibiting septoria spots according to the methods are presented in FIG. 6. Two Trichoderma atroviride were tested, including TAL-17. The latter has proved to be the most interesting against this disease. Note the quantity of BCA is in number of viable spores (equivalent to 5.10 ¹¹ viable spores / hectare).

2 / Fusarium wilt

The phytotronic room has the possibility of increasing to 90% RH humidity during infection at the time of flowering of the ears. The tray allows you to test 30 planters of 15 plants. The tests were carried out with “Calixo” spring wheat.

The treatments with BCA were for these tests exclusively carried out at the time of flowering and the BCA used are:

^■ TAL-17 (cf. Example I);

^■ BCA A> Trichoderma asperellum (Ref: ATCC ^® 52438) and

^■ BCA B> Trichoderma atroviride (Internal ref.: BCA B-15).

A first test showed an interest for the TAL-17 strain (Figures 7 and 8). This interest was confirmed thanks to a new test (Figures 9, 10 and 11). The latter demonstrated an interest in the use of TAL-17 (equivalent to 10 ¹¹ UFC spores / ha) with the Appyphyt formulation (equivalent to lL / ha) on wheat for the visual symptoms of the disease and on the mass of grains per ear which are then both statistically different from the contaminated modality to Fusarium graminearum alone. However, the mass of grains per ear when the wheat was treated with TAL-17 and the Appyphyt formula does not reach the mass of uncontaminated control wheat (ie 0.831 g / ears for Figure 8 and 0.77 g / ears for figure 10).

In conclusion, the TAL-17 strain showed an interest for an application at the flowering stage of wheat, but in view of its endophytic character, a much earlier application is of interest in the fight against fusarium head blight.

In addition, a treatment strategy with half a dose of fungicide is possible.

Phytotronic / greenhouse / biostimulation room study 1 / Greenhouse trials on corn

Three seeds were sown per 5 L pot drilled at the bottom for drainage. The substrate used is a mixture of universal soil and expanded vermiculite (0.5-10 mm) (2: 1 v / v). The substrate was moistened 24 hours before sowing with reverse osmosis water. The pots were watered three times a week with an increasing volume of RO water as the plant developed.

The treatments carried out were identical to those of Example (III), 1 /.

As a reminder, Witness (A) did not receive any treatment; the sowing treatment (B and C) was carried out with a TAL-17 solution of 1.10 ⁵ or 1.10 ⁸ spores / seed (sp / seed); the spraying treatment at the 5-leaf stage (D and E), ie 21 days of growth, was carried out with a TAL-17 solution of 1.10 ¹¹ or 5.10 ¹¹ spores / ha.

The results obtained for the germination percentage on 6-day-old plants are shown in Figure 12. The values for corn plants not having (control) or not yet (aerial spraying) received TAL-17 treatments. are statistically identical and in the order of 80%. Similarly with the BCA treatment at sowing at 1.10 ⁵ spores / seed, no significant difference is visible compared to the untreated control. On the other hand, with the sowing treatment of 1.10 ⁸ spores / seed, that is to say a concentration lOOOx higher than the previous one, the germination percentage reaches 100% as early as 6 days after sowing. After 9 days of growth (data not shown), the germination rate tends towards 97% for the modalities having received the sowing treatment at 1.10 ⁵ spores / seed and for those who have not yet received the aerial treatment. The control mode, without treatment, increases up to a germination percentage of 93%.

The results of the size-in-height measurements of the 25-day-old plants represented are presented in FIG. 13, and demonstrated a statistical difference between the sowing treatment of TAL-17 compared with the aerial spray treatment and the control. The sowing treatments at 1.10 ⁵ and 1.10 ⁸ spores / seed (viable spores) allow plants to grow in the order of 105 cm, while the aerial treatments, carried out 4 days earlier and the control, only allow growth ranging from 97 cm for the control, to 100.5 cm for the aerial treatment at 1.10 ¹¹ spores / ha and 101 cm for the treatment at 5.10 ¹¹ spores / ha. These values are found in the same statistical group.

2 / Tests in a phytotronic room on wheat

Culture :

6 wheat seeds were sown per 0.5 L pot and drilled at the bottom for drainage. The substrate used is a mixture of universal soil and expanded vermiculite (0.5-10 mm) (2: 1 v / v). The substrate was moistened 24 hours before sowing with reverse osmosis water.

For the arrangement of the pots in the phytotronic room, they were grouped together in groups of 3 in a saucer of planters. 12 "planters" were inoculated with 0.5 mL of a suspension of TAL-17 spores containing 10 ⁶ CFU spores / seeds in 0.5 mL and 18 planters were inoculated with 0.5 mL of borehole water sterile in order to avoid a different water supply depending on the treatment.

The pots were placed in the phytotronic room (16 / 8h photoperiod) and were watered twice a week.

The germination percentage was observed at 4 and 11 days depending on the modalities.

This average percentage is calculated per gardener (ie on 18 seeds) then all the data from the planters for each modality was statistically processed by ANOVA (p <0.05). It emerges that the modalities inoculated with the TAL-17 strain exhibited a germination rate greater than the water control modality of 5% at 11 days (Figure 14). This difference is statistically significant.

(VI) Comparison of the TAL-17 strain to other BCAs

Side-by-side dual-culture tests on a Petri dish (continued from part (II) 1 /)

The experimental protocol was the same as that described previously. The TAL-17 strain was compared to the BCA D strain (= Trichoderma atroviride, Ref .: 1-12137). The Dual culture test was performed with 30 mΐ of BCA or F. graminearum deposited at the ends of the Petri dish. After 6 and 10 days of culture at 25 ° C on PDA under a light hood with 16 h photoperiod, the dishes were observed (Figure 15 A) and the length of the pathogen coverage by BCA was measured (Figure 15B).

Also in this example, the TAL-17 strain exhibited the particularity of growing on the mycelium of the pathogen over time, unlike the BCA D.

(VII) probe specificity Assay TaqMan ^® GS285741-P1 and the torque associated GS285741 primer-F1-R1 and GS285741 vis-à-vis the strain of the invention (tal- 17 and / or a mutant thereof )

Protocol

In order to test the specificity of the molecular tools (TaqMan ^® probe GS285741-P1 and the pair of associated primer GS285741-F1 and GS285741-R1), a classic analysis by Polymerase Chain Reaction in real time (qPCR) was carried out on 3 distinct strains, namely:

the strain of Trichoderma viride of the species T. asperellum (TV);

the strain Trichoderma atroviride TAS; and

the Trichoderma atroviride strain of the invention (TAL-17).

An internal control standard is also produced with genomic DNA extracted from the strain of the invention, which has been serially diluted. All qPCR assays were performed using a CFX 96 touch thermal cycler from Biorad ^® . The amplification program used is that recommended by the supplier with a temperature hybridization at 60 ° C. For the TaqMan ^® method, the Luna ^® Universal Probe qPCR Master Mix (NEB ^® ) reaction mixture was used. The amplification program is 95 ° C 2 min followed by 40X 95 ° C 15 ”and 60 ° C 30”.

Results

The results of this analysis are presented in Table 3 below.

Cq Mean

Sample (number of amplification cycles necessary to obtain a characteristic fluorescent signal) dilution 1 23.66

dilution 2 26.84

Internal standard

dilution 3 29.99

(5 ng)

(serial dilution dilution 4 33.36

of genomic DNA dilution 5 37.4

of the TAL strain - dilution 6 38.28

17)

dilution 7 ND (not enough DNA)

dilution 8 N.D. (not enough DNA)

well 1 N.D.

TV strain

well 2 N.D.

(5 ng)

well 3 N.D.

well 1 N.D.

TAS strain

well 2 N.D.

(5 ng)

well 3 N.D.

well 1 21.46

Strain TAL-17

well 2 21.46

(5 ng)

well 3 21.46

Table 3: Specific detection by qPCR of the strain of the invention

Conclusion

The TaqMan ^® probe GS285741-P1 and the pair of primer associated GS285741 GS285741--F1 and R1 have detected that the LAT-17 strain. These tools therefore allow the detection and identification in a sample of the presence of the strain of the invention TAL-17 and / or one of its mutants. (VIII) Comparison of the efficiency of the TAL-17 strain versus that of the SCI strain

Dual-culture tests in a mixture on a Petri dish

The biocontrol effect of the TAL-17 strain on the development of F graminearum was compared with that of the SCI strain (= isolated Trichoderma atroviride present in the Vintec ^® product). For this, a Dual culture test was carried out on which 100 μL of a F. graminearum / T. atroviride (Fusa / BCA) was spread on PDA medium in a Petri dish.

The mixtures used were as follows:

^■ BCA / Fusa mixture (ratio 1/2): BCA at 1.10 ⁴ CFU / mL and Fusa at 2.10 ⁴ CFU / mL (lmL mixture of BCA at 2.10 ⁴ CFU / mL + 1mL of fusa at 4.10 ⁴ CFU / mL).

^■ BCA / Fusa mixture (1/1 ratio): BCA at 1.10 ⁴ CFU / mL and Fusa at 1.10 ⁴ CFU / mL (lmL mixture of BCA at 2.10 ⁴ CFU / mL + 1mL of fusa at 2.10 ⁴ CFU / mL).

^■ BCA / Fusa mixture (ratio 2/1): BCA at 1.10 ⁴ CFU / mL and Fusa at 5.10 ³ CFU / mL (lmL mixture of BCA at 2.10 ⁴ CFU / mL + 1mL of fusa at 1.10 ⁴ CFU / mL).

After 6 and 10 days of culture at 25 ° C on PDA under a light hood with a 16 h photoperiod, the dishes were observed (Figures 16A and 17 A) and a visual evaluation of the percentage of space occupied by the different strains were made (Figure 16B and 17B). The latter corresponds to the intensity of sporulation of the BCA (TAL-17 or SCI) knowing that the control = 100%. That of F graminearum is estimated by subtracting the total area of the box minus the estimated area of occupancy in BCA.

In fine, compared to the strain Trichoderma atroviride SCI, the strain of the invention TAL-17 at the same dose combats Fusarium graminearum more. This is clearly visible for the ratio of 2 CFU of Fusa / 1 CFU of BCA. In fact, under these conditions, the SCI strain stalls unlike the TAL-17 strain.

(IX) Field trial and comparison of the efficacy of strain TAL-17 versus that of a strain of T. atroviride on brown rust of wheat

Protocol

After the sowing of the Pakito wheat variety, the sown plot was divided into 4 micro-plots of the order of 20 m ² per modality (see Table 4) and the actual test was able to start. For this, two treatments were carried out at the 'ears 6 to 8' (T1) and 'early flowering' (T2) stage with conventional treatments (Onnel ^® , Faxer ^® , Librax ^® ) in the usual dose (0.6 L / ha) or in half-dose (0.3 L / ha) in combination or not with a mixture of BCA (strain TAL-17 [BCA 1] or another strain of T. atroviride [BCA 2]) at a dose of 1.10 ¹¹ CFU / ha and Appyphyt at a dose of 1 kg / ha (see Table 4).

Table 4. Conditions tested in this field trial

One month after the last treatment, the assessment of the development of brown rust (i.e. Puccinia recondita) was measured.

Statistical analysis

The statistical analysis was carried out using StatBox ^® analysis and statistical processing software. It is paired with Excel ^® software and enriched its functions. It made it possible to carry out the ANOVAs which will be presented in the results section. The comparisons of means are carried out according to the Newman-Keuls test at the 5% threshold. Homogeneous statistical groups are determined, the modalities associated with the same letter are not statistically different.

Results

(see table below)

General average 97.2 44.33 44.33 6.18

Residual standard deviation 1.69 0.72 0.72 0.87

Coefficient of

variation 1.7 1.6 1.6 14

Table 5. Effect of treatments applied on the yield and development of brown rust

For the score for brown rust, the higher the score the less disease there is (scale 1 to 10: 10 = zero disease symptoms). The letters symbolize the calculated statistics.

Conclusion

BCA 1 (ie. Strain TAL-17) has been shown to be effective in controlling brown rust (ie Puccinia recondita) unlike strain BCA 2 (another strain of Trichoderma atroviride). This difference in efficacy is statistically different when comparing modality No. 9 to modality No. 7 of the test and looking at the notes on brown rust. In fact, for these two modalities, BCA was applied alone to the first treatment and was also applied to the second treatment with a half-dose of conventional Librax ^® fungicide. Thus, the TAL-17 strain showed in this test a statistical interest on the physical symptoms of brown rust.

In addition, the TAL 17 strain when it is applied (cf. modality No. 9), it allowed to obtain a brown rust score of the same statistical group as the best modality (cf. modality No. 4) for the brown rust notation.

Finally, all of these tests showed statistical efficacy against brown rust in microplots of the strain of the invention TAL-17 compared to another strain of T. atroviride with a T1 treatment and a T2 treatment completed. with half a dose of Librax ^® . PCT

(original in electronic form)

(This sheet does not form part of or count as a sheet of the international application)

RESERVED AT THE RECEIVING OFFICE

FOR INTERNATIONAL OFFICE

Claims

1. Isolated strain of Trichoderma atroviride, the ech42 gene of which has a sequence identity of at least 98% with the sequence SEQ ID NO: 1 of the ech42 gene of the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333 and / or one of its mutants,

in particular said isolated strain of Trichoderma atroviride is the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333 and / or one of its mutants, and

preferably, said isolated strain of Trichoderma atroviride is the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333.

2. Isolated strain of Trichoderma atroviride according to claim 1, in the form of spores, produced by fermentation in a solid or liquid medium, said spores possibly being in purified form or in the production matrix, said production matrix being solid or liquid.

3. Isolated strain of Trichoderma atroviride according to claim 1 or 2, as a biological control agent,

4. Phytosanitary composition comprising:

the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 as an active principle; or

the metabolites emitted during the production of the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 as active principle; or the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 and its metabolites emitted during its production as an active principle; or the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 in combination with at least one other biological control agent as active principle; or

the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 and its metabolites emitted during the production of the strain in association with at least one other biological control agent as active principle.

5. Phytosanitary composition according to claim 4, comprising an effective amount of 10 ⁴ to 10 ¹² spores / g, more particularly 10 ⁷ to 10 ⁹ spores / g,

said phytosanitary composition optionally being obtained after a preparation step making it ready for spreading.

6. Use of the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 or of the phytosanitary composition according to claim 4 or 5 in the prevention and / or treatment of fungal diseases of plants, in particular of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley; and or

7. A phytosanitary coating composition comprising the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 and optionally at least one fixing agent.

8. Coated seed comprising a plant seed, said plant seed being coated with the phytosanitary coating composition as defined in claim 7 and said plant belonging in particular to the Poaceae family, in particular wheat and / or corn. and / or barley.

9. A method of protecting and / or treating a plant against a disease caused by a pathogenic fungus for plants comprising the application of the composition according to claim 4 or 5 on at least part of said plant or of the soil in the vicinity of said. vegetal,

in particular said part of said plant is a leaf, a fruit, a seed, and

10. The method of claim 9, wherein said composition is applied

at a rate of 10 to 500 L / ha, in particular from 50 to 250 L / ha, in particular for aerial spraying; or

at an effective amount of 10 ¹⁰ to 10 ¹⁴ spores / ha, in particular 10 ¹⁰ to 10 ¹² spores / ha, in particular for aerial spraying of the foliar spray type.

11. The method of claim 9 or 10, wherein said pathogenic fungus is Septoria tritici or Gibberella zeae (= Fusarium graminearum) or Puccinia recondita or Puccinia striiformis.

12. A method according to any one of claims 9 to 11, wherein

the treatment of said plant comprises spraying said composition during different phenological stages of the plant to prevent a risk of infection of said pathogenic fungus of the whole or part of the plant.