Revision of the World species of Xeris Costa (Hymenoptera: Siricidae)

CJAI #28
September 25, 2015

doi:10.3752/cjai.2015.28

Henri Goulet¹

,

Caroline Boudreault¹

,

Nathen M. Schiff²

¹K. W. Neatby Building, 960 Carling Avenue, Ottawa, Ontario K1A 0C6, Canada (e-mail: henri.goulet@agr.gc.ca, caroline.boudreault@agr.gc.ca)
²USDA Forest Service, Southern Research Station, Center for Bottomland Hardwoods Research, Stoneville, MS 38776, USA (e–mail: nschiff@fs.fed.us)

ZooBank LSID: urn:lsid:zoobank.org:pub:1360ED3A-8330-43BD-B051-2DDBBBD76AA0

Revision of the World species of Xeris Costa (Hymenoptera: Siricidae)

CJAI #28
September 25, 2015

doi:10.3752/cjai.2015.28

Henri Goulet¹

,

Caroline Boudreault¹

,

Nathen M. Schiff²

ZooBank LSID: urn:lsid:zoobank.org:pub:1360ED3A-8330-43BD-B051-2DDBBBD76AA0

Abstract

Xeris is one of ten extant genera of Siricidae known as as woodwasps or horntails. They are important wood-boring Hymenoptera from the Northern Hemisphere. Adults and larvae of Xeris are often intercepted at ports and are consequently of concern as potential alien invasive species.
The genus consists of 16 species with eight in the New World and eight in the Old World. Despite records of numerous intercepted specimens, no species has been accidentally established anywhere.

Five new species all by Goulet are described: Xeris degrooti n. sp., X. pallicoxae n. sp., X. umbra n. sp., X. xanthoceros, n. sp and X. xylocola n. sp. Two new synonyms are proposed: Neoxeris melanocephala Saini and Singh, 1987 = X. himalayensis Bradley, 1934 and X. indianus Vasu and Saini, 1999 = X. himalayensis Bradley, 1934. Two synonyms are upheld:Sirex nanus O. F. Müller, 1776 = X. spectrum (Linnaeus, 1758) and Sirex emarginatus Fabricius, 1793 = X. spectrum (Linnaeus, 1758). Two changes in rank from subspecies to species level are proposed: X. cobosi Viedma and Suarez from X. spectrum cobosi and X. malaisei Maa from X. spectrum malaisei.

We characterize the genus, the world species are keyed and a partial reconstructed phylogeny is proposed. For each species we include the following (if available and/or pertinent): synonymic list, type material, diagnosis, description of one or both sexes, origin of specific name, geographical variation, taxonomic notes, biological notes, hosts and phenology (emergence or flight period data), and range.

DNA barcoding (cytochrome oxidase 1 – CO1) was shown to be a reliable identification tool for adult and larval Siricidae (Schiff et al. 2012). Larvae cannot be identified using classical morphological methods, but DNA barcoding can accurately distinguish larvae of Xeris spp. We include barcodes for nine of the 16 species (one species, X. pallicoxae, could be a complex of two species based on barcodes). DNA data has been most useful for confirming morphologically similar species, associating specimens with discrete color forms, and deciding the rank of populations. The results have proved to be accurate and in agreement with almost all species determined by classical morphological methods.

Introduction

With a sudden interest in horntails following the accidental introduction of the European Sirex noctilio Fabricius into northern New York State (Hoebeke et al. 2005), there was a need to resolve numerous taxonomic problems, which resulted in a revision of the Western Hemisphere Siricidae (Schiff et al. 2012). In the latter paper, while attempting to understand Maa’s (1949) concept of the North American Xeris spectrum spectrum, we had to study the European populations of X. spectrum as well as other subspecies of X. spectrum and remaining Eurasian species. Surprisingly, the North American population of X. spectrum spectrum was not X. spectrum but consisted of two species not found in Eurasia. Moreover, we discovered that the Eurasian X. spectrum was a complex of two species in Europe and four species in Asia, so no species are shared between North America and Asia. Moreover, there were still some nomenclatural problems with Eurasian species. We recently found another cryptic North American species of Xeris that was not included in Schiff et al. (2012). After further study of the above species complexes, based on over 2400 specimens, we felt confident doing this revision.

Adults of Xeris are usually large and elegant insects. Most collections have specimens. However, standard collecting methods rarely work to capture adults and only a few collections have large numbers of specimens. Adults are best collected by rearing from short sections of boles of dead trees. Adults have been found at the top of hills with short vegetation, others were attracted to fire in fire-prone forests, and some have been hand collected on trunks and stumps. As taxonomists are usually poorly equipped to collect Siricidae high in trees, our best friends are forest entomologists who have reared successfully Siricidae from sections of identified tree boles usually during their main research that often involves cerambycid or buprestid beetles.

Adults of Xeris are easily distinguished from other Siricidae. In both sexes, there is a small vertical ridge on the gena posterior to the eye. In addition, the metatibia has one spur at the apex and the hind wing has no anal cell. Females of almost all species are recognized by the unusually long ovipositor. Schiff et al. (2012) provide more information about their recognition and their phylogenetic position among the Siricidae see .

Through 2014, seventeen names have been proposed for Xeris. The first species described was Ichneumon spectrum Linnaeus, 1758, based on a female. By 1800 two more species, based on males from northern Europe, were described, Sirex nanus O. F. Müller, 1776, and S. emarginatus Fabricius, 1793. Both have been treated as synonyms of X. spectrum. No new taxa were then proposed until 1865, when the area of study shifted to North America as western North America became accessible to entomologists. Five species were described from 1865–1900, Urocerus caudatus Cresson, 1865, Sirex melancholicus Westwood, 1874, Urocerus morrisoni Cresson, 1880, Urocerus tarsalis Cresson, 1880, and Urocerus indecisus MacGillivray, 1893. All five are still recognized here. During the period 1901–1950 Bradley (1913) published the first North American revision of Xeris and described X. macgillivrayi, a synonym of X. tarsalis (Schiff et al. 2012). Bradley (1934) described X. himalayensis from northern India, and Maa (1949) described X. spectrum malaisei from Taiwan and X. spectrum townesi from western North America. The latter was considered as a synonym of X. indecisus (Schiff et al. 2012). After 1950 three more taxa were described, X. spectrum cobosi Viedma and Suárez, 1961, from Morocco, Neoxeris melanocephala Saini and Singh, 1987, from India, here considered as a synonym of X. himalayensis, and X. indianus Vasu and Saini, 1999, from India, also considered here as a synonym of X. himalayensis. Since the year 2000 two new species were added, X. chiricahua Smith, 2012, from southwestern United States and X. tropicalis Goulet, 2012, from southernmost Mexico (Schiff et al. 2012).

Of the 17 names previously proposed six are here considered as synonyms leaving 11 valid species. None were retained as subspecies. We add five new species, one from the central Rocky Mountain region of USA, another from Europe, one from Laos, and two from China (Yunnan).

Methods & Materials

We based this study on more than 2400 specimens. Holotypes, lectotypes and syntypes, and specimens studied are preserved in the following 39 collections. The curator or lender name follows the institution name.

ANIC	Australian National Insect Collection, CSIRO, Australia Capital Territory, Australia. Nicole Fisher.
ANSP	Academy of Natural Sciences, Philadelphia, PA, USA. J. Weintraub.
BDUC	Biology Department, University of Calgary, Calgary, AB, Canada. R. Longair.
BMNH	Department of Entomology, The Natural History Museum, London, England. C. Gillette.
BYUC	Brigham Young University, Provo, UT, USA. S. M. Clark.
CFIA	Canadian Food Inspection Agency, Ottawa, ON, Canada. H. Douglas.
CNC	Canadian National Collection of Insects and Arachnids, Ottawa, ON, Canada. H. Goulet.
CUCC	Clemson University Arthropod Collection, Clemson University, Clemson, SC, USA. J. C. Morse.
CUIC	Cornell University Insect Collection, Department of Entomology, Cornell University, Ithaca, NY, USA. E. R. Hoebeke.
DEBU	Department of Environmental Biology, University of Guelph, ON, Canada. S. A. Marshall & S. Paiero.
EDUM	Entomology Department, University of Manitoba, Winnipeg, MB, Canada. †R. E. Roughley.
FRLC	Atlantic Forestry Centre, Natural Resurces Canada, Fredericton, NB, Canada. J. Sweeney.
FRNZ	Scion – next generation biomaterials, Te Papa Tipu Innovation Park, Rotorua, New Zealand. S. Sopow.
GLFC	Great Lake Forest Centre, Natural Resources Canada, Sault Ste. Marie, ON, Canada. K. Nystrom.
INHS	Insect Collection, Illinois Natural History Survey, Champaign, IL, USA.
INIFAP	Campo Experimental Pabellón, Pabellón de Artiga, Aguascaliente, C. P. 20660, Mexico, G. Danchez-Martinez.
LECQ	Laurentian Forestry Centre, Natural Resource Canada, Ste. Foy, QC, Canada. J. Klimaszewski.
LEMQ	Lyman Entomological Museum and Research Laboratory, MacDonald College, McGill University, Ste. Anne de Bellevue, QC, Canada. T. A. Wheeler.
LSUK	Linnean Society, Burlington House, Piccadilly, London, England.
MNCN	Museo Nacional de Ciencias Naturales, Paseo de la Castellana, Spain. M. París.
MRNQ	Ministère des Ressources Naturelles, Direction de l’Environnement et de la Protection des Forêts, Service des Relevés et des Diagnostiques, Québec, QC, Canada. C. Piché.
MTEC	Department of Entomology, Montana State University, Bozeman, MT, USA. M. A. Ivie.
NFRC	Northern Forestry Centre, Natural Resource Canada, Northwest Region, Edmonton, AB, Canada. G. Pohl.
NSMT	Department of Zoology, National Museum of Nature and Science, Tsukuba, Ibaraki, Japan. A. Shinohara.
OSAC	Oregon State Arthropod Collection, Department of Zoology, Oregon State University, Corvallis, OR, USA. C. Marshall.
OLML	Oberӧsterreichische Landesmuseen, Linz, Austria. C. Reitstatter.
OXUM	Hope Entomological Collections, University Museum, Oxford, England. J. E. Hogan.
PFRC	Pacific Forestry Centre, Natural Resource Canada, Victoria, BC, Canada. L. Humble.
PUPC	Department of Zoology, Punjabi University, Patiala-147002, India. M. S. Saini.
ROME	Department of Entomology, Royal Ontario Museum, Toronto, ON, Canada. C. Darling.
SDEI	Senckenberg Deutsches Entomologisches Institut, Münchenberg, Germany. A. Taeger and S. M. Blank.
UAIC	Department of Entomology Collection, University of Arizona, Tucson, AZ, USA. D. Madison.
UAM	University of Alaska Museum, Fairbanks, AK, USA. D. Sikes.
UASM	Department of Zoology, Strickland Entomological Museum, University of Alberta, Edmonton, AB, Canada. D. Shpeley.
UCRC	University of California, Riverside, CA, USA. D. Yanega.
TARI	Taiwan Agricultural Research Institute, Taichung, Taiwan. Chi-Feng Lee.
USNM	National Museum of Natural History, Smithsonian Institution, Washington, DC, USA. D.R. Smith.
USFS–AK	USDA Forest Service, State and Private Forestry, Forest Health Protection, Fairbanks Unit, Fairbanks, AK. USA. J. J. Kruse.
USFS–GA	USDA Forest Service, Southern Research Station, Athens, GA, USA. D. Miller.
USFS–MS	USDA Forest Service, Stoneville, MS, USA. N. M. Schiff.
ZMUC	Department of Entomology, Zoological Museum, University of Copenhagen, Universitetsparken, Copenhagen, Denmark. L. Vilhelmsen.
ZMUN	Natural history Museum, University of Oslo, Department of Zoology, Insect Collection, Oslo, Norway. Lars Ove Hansen.

Most specimens in collections were reared from sections of conifer boles as described in Spradbery and Kirk (1978). Some specimens were captured on stumps or boles, trapped using Lindgren funnel and cross-vane traps, collected at forest fires in western North America, or captured on hilltops with short vegetations.

Rearing from conifer boles is most effective in gathering males and females of Xeris with tree host information. A siricid survey was done across Europe, Turkey and North Africa by Spradbery and Kirk (1978); about 4000 specimens of Xeris were collected. In summary, they located dead, dying, or damaged conifers, searched for round siricid emergence holes, dead or live ovipositing siricid females or their parasitoids, and woodpecker damage. Using an axe, they checked the bole of each tree by cutting small disks for evidence of frass-packed galleries made by siricid larvae, live siricid larvae, and characteristic brown stains from the siricid symbiotic fungus, Amylosterum sp. Attacked boles were sent to an insectary, organized by locality and tree specimen in coded bins, and emerged specimens were preserved and labelled with the tree name, collection date, and other pertinent information.

Images were made using a range of image capture systems: MZ16 Leica binocular microscope and an attached Leica DFC420. Some specimens were photographed using DSLR Canon Rebel Xti and T2i cameras with a 100 mm macro and MPE-65 lens. Multiple images through a range of focal planes from top to bottom were taken of a structure and these combined using Combine ZM or ZP (Hadley, 2010), or Zerene to produce a single, focused image. Specimens were illuminated with a 13 watt daylight fluorescent lamp or flash through a semi-transparent plastic surface and reflected with a matt aluminum surface. The final combined image was improved using Adobe Photoshop® 7, CS4 or CS6, and plates were assembled using the same software. Corel Draw® 9.0 was used to generate barcode trees.

Characters under the “MALE. Description” are in addition to those given under the “FEMALE. Description” excluding those of the “Cornus”, the “Sheath” and the “Ovipositor”

Methods for DNA studies

Adult horntails were collected by hand, in traps or by rearing from numerous locations in North America and around the world. Larvae were mostly intercepted over the last 30–40 years at ports in woody packing material and sent to the USDA Systematic Entomology Laboratory, Washington DC, for identification to family. All specimens were stored in alcohol, although some were trapped in a different liquid and then transferred to ethanol, and either sent to the Center for Bottomland Hardwoods Research in Stoneville, MS, or for most specimens from the Canadian National Collection, Ottawa, to the Biodiversity Institute of Ontario for sequencing. DNA barcode (CO1) sequences were generated in Mississippi using the extraction, amplification and sequencing protocols of Schiff et al. (2012) or in Guelph by the standard protocols detailed by Fernandez –Triana et al. (1979). Most Mississippi samples were sequenced using oligo’s LCO 1490 and HCO 2198 (Folmer et al. 1994) but in a few cases HCO 2198 was paired with a novel oligo WES1 (5’GGCTTTTCTCTACTAATCATAAGGATATTGG 3’). Most Ottawa samples were sequenced in Guelph using primers LepF1 and LepR1 but some of the more degraded samples were sequenced in pieces using the oligo pairs (LepF1, RonMWASPdeg_t1) and (LepR1, C_ANTMR1D) see BOLDSYSTEMS primer database at http://www.boldsystems.org/index.php/Public_Primer_PrimerSearch. Analysis was performed using DNAStar by Lasergene. Sequences for each specimen were combined into individual specimen contigs using Seqman, aligned by Clustal V and used to construct a Neighbor-Joining, tree (Saitou and Nei 1987) in DNAStar Megalign. Bootstrap values were calculated from 1000 trials and a random seed of 111. A single representative sequence for each taxon was used to generate an approximate table of pair distances between species also using Megalign.

Morphology

Schiff et al. (2012) discussed structural terms and most are reproduced here.

Wings. The veins of the fore and hind wings of Xeris are illustrated in Fig. A3.1. One of the most striking features of Siricidae is the incredible variation in wing venation, including the appearance or the disappearance of veins symmetrically or asymmetrically on both wings (e.g., see habitus images in Schiff et al. (2006)). Such variation is very rarely seen in other Hymenoptera, a group where wing veins are important for classification. Despite the exceptional variation in veins of Siricidae, wing venation was used in keys to subfamilies and genera (Schiff et al. 2012), usually supplemented with others features not associated with wings.

Female abdomen. The female abdomen has ten terga (singular: tergum) dorsally and seven sterna (singular: sternum) ventrally (Fig. B1.3). Terga 8–10 are conspicuously modified. Tergum 8 is greatly enlarged and extended posteriorly. Tergum 9 is the largest and has a deeply impressed dorsomedian impression, the median basin (Figs. A3.2 and B1.5), also known as the precornal basin. The lateral edges of the median basin are sharply outlined in the anterior 0.5 (Figs. A3.2 and B1.5). The anterior edge of the basin, when visible, is ridge-like and its lateral limits are outlined by two slightly convergent furrows. The maximum width of the basin at its base is measured between the outer furrows, which are usually clearly outlined and black on specimens with a reddish-brown abdomen. The posterior edge of the basin is outlined by a furrow between terga 9 and 10. Tergum 10 is modified as a long sharp horn-like projection, the cornus (Fig. A3.2). The cornus at its apex forms a short tube, probably used to assist adults to exit their larval host tunnels.

The abdomen posterior to sternum (Fig. B1.7) has an ovipositor that is covered by two sheaths when not in use.

Each sheath consists of three parts: a basal small sclerite dorsobasally (valvifer 1), a long basoventral sclerite (valvifer 2), and an apical sclerite (valvula 3). The last two sclerites are here referred to, as basal section and apical section of the sheath (Fig. B1.7). The lengths of these sections are compared to one another.
The ovipositor consists of a fused pair of dorsal lances (valvula 2) and a pair of ventral lancets (valvula 1). The lance and lancet slide along each other and help move the egg along the ovipositor as well as drill in wood and remove the resulting sawdust for egg deposition. The part detailed in the following description is the lancet, which is divided in numerous sections called annuli (singular: annulus) (Fig. A3.3). Lancet annuli usually are outlined by vertical to slanted ridges (Fig. A3.3). Annuli are present at the base of the lancet but in most species of Xeris several basal annuli are difficult to distinguish because each annulus is barely outlined dorsally near the lance. The number of annuli varies within species and occasionally between species. The apex of the lancet consists of four annuli each with a large tooth (Fig. A3.3). The last four or five annuli or all annuli anterior to these four apical toothed annuli have a pit adjacent to the annulus line or ridge (Fig. A3.3). Annuli anterior to the teeth annuli and the last apical four or five annuli may have a small to very small pit or a large pit. To photograph the lancet for the best range of tonalities we oriented it toward the light. Therefore contrary to standard, we present images of the ovipositor in lateral view but with the lancet at the top rather than at the bottom of the image. This view is most similar to what will be seen by users when viewing a female abdomen in lateral view with the ventral surface facing away from the user (toward the top of the page, as in our images).

Male abdomen. The male abdomen has eight terga dorsally and nine sterna ventrally (Fig. B1.4). Tergum 8 is slightly longer than the preceding terga (Fig. B1.6). The posterior edge of sternum 8 has a V-shaped median indentation or cleft, and sternum 9 extends posteriorly as a horn or cornus (Fig. B1.4). The lateral portion of the genitalia (the harpes) is usually visible between tergum 8 and sternum 9, but this was not studied.

Sculpture. In addition to structural terms for body parts, we opt for English terms to designate surface features, such as ridges (carinae), furrows (sulci), pits (concave and generally round surface features with or without a seta, but excluding the setigerous puncture just around a seta), and microsculpture.

Measurements. Because of the great variation in size (body length 9 to 35 mm) for most well sampled species, only ratios from measurements of two structures of a specimen were used. When possible, at least 30 specimens of each sex were measured. Means and standard deviations were calculated using Microsoft Excel software. The main measurements are the length of the basal and apical sections of the ovipositor sheath (Fig. B1.7) and those of tergum 9 and 10 in dorsal view (Fig. A3.2). The range of a measurement is given in the identification keys based on the calculation of two standard deviations. If a measurement falls within the overlap between values of the calculated two standard deviations, the character was rejected in favor of other characters, but if it is outside the range of the overlap portion, it is considered as a useful key character with a 1% chance of error.

For ovipositor characters with meristic values (e.g., the number of the annulus or annuli of the ovipositor aligned with the junction of the basal and apical sheath sections, the number of annuli with a very small pit on the ovipositor, and total number of annuli on the ovipositor), we recorded the range.

Biology

Introduction - Hosts - Parasitoids

Introduction

Not much has been published on the biology of Xeris species. The Asiatic X. malaisei (published as X. spectrum spectrum in Fukuda et al. 1997) from Japan is the only species with significant biological information. There is also some information on the biology of what is probably X. spectrum (Francke-Grossmann 1954), the more commonly captured species in Germany.

The most interesting feature of X. malaisei (Fukuda et al. 1997), and also X. caudatus (Schiff et al. 2012), is that females do not carry symbiotic fungus in their mycangia. The question is, therefore, what do larvae eat during their development? Females of most species of siricine Siricidae carry arthrospores of Amylostereum spp., one of the siricid host-specific basidiomycete fungi. During oviposition the fungus is deposited on each egg placed in the sap wood. The fungus produces an enzyme to decompose the wood cellulose or lignin, changing it into a form that can be assimilated by the larvae and making larval development possible. Fukuda et al. (1997) clearly showed that larvae of X. malaisei develop only if A. chailletii or A. areolatum are present at the oviposition site. Both species of fungi are equally accepted by Xeris larvae. Their observations confirm those of Francke-Grossmann (1954) on X. spectrum where females often deposit their eggs in trees already infested with Sirex and Urocerus spp. Moreover, the emergence holes of X. malaisei are in close proximity to those of other horntails (Fukuda et al. 1997). This suggests that females of Xeris are attracted by odors emitted by Amylostereum fungi inoculated by other fungus carrying horntails.

The emergence cycle of well-sampled species show interesting and distinct patterns. We have data from three species. X. spectrum has one emergence peak in late spring (Fig. C12.8), X. pallicoxae has a double emergence peak in late spring and early summer followed by a very small emergence in late September and early October (Fig. C11.9), and X. malaisei shows two clearly separated peaks of emergences, one in spring and one in summer (Fukuda et al. 1997) (Fig. C8.4). The spring oviposition cycle offers X. malaisei larvae a very viable fungus but more competition with other horntail larvae, whereas a summer oviposition cycle offers the Xeris larvae a less viable fungus with less competition from other horntail larvae (Fukuda et al. 1997).

Hosts

Hosts of North American species of Xeris are summarized from Cameron (1965), Middlekauff (1960), Ries (1951), Smith (1979), and Schiff et al. (2012), and those of Eurasia by Spradberrry and Kirk (1978), Fukuda and Hijii (1997). In the list below we provide rearing records for nine species of Xeris from two families of conifers representing 12 genera and 36 species. The host cited is the plant on which the larvae actually fed or the female was found ovipositing. Plant species on which adults were found resting are not included. In the “Hosts” section under each species treated, we list the plant species attacked and, when possible, we add in parenthesis the number of specimens we recorded from a given host, or published records when we are confident of the accuracy of the identification.

Tree Species	Xeris Species	Note

CUPRESSACEAE
Cupressus macrocarpa	Xeris tarsalis (Cresson)
*Crytomeria japonica*	Xeris malaisei Maa
*Juniperus occidentalis*	Xeris tarsalis (Cresson)
*Calocedrus decurrens*	Xeris indecisus (MacGillivray Xeris tarsalis (cresson)
*Thuya plicata*	Xaris tarsalis (Cresson)
PINACEAE
Abies sp.	Xeris indecisus (MacGillivray)
*Abies alba*	Xeris spectrum (Linnaeus) and/or X. pallicoxae n. sp.
*Abies balsamea*	Xeris caudatus (Cresson) Xeris melancholicus (Westwood)
*Abies borisii-regis*	Xeris pallicoxae n. sp.
*Abies bornmuelleriana*	Xeris pallicoxae n. sp.
*Abies cilicia*	Xeris pallicoxae n. sp.
*Abies concolor*	Xeris caudatus (Cresson) Xeris indecisus (MacGillivray) Xeris morrisoni (Cresson)
*Abies equi-trojan*	Xeris pallicoxae n. sp.
*Abies firma*	Xeris malaisei Maa
*Abies grandis*	Xeris indecisus (MacGillivray)
*Abies lasiocarpa*	Xeris caudatus (Cresson) Xeris indecisus (MacGillivray)
*Abies magnifica*	Xeris indecisus (MacGillivray)
*Abies pindrow*	Xeris himalayensis Bradley
*Abies pinsapo maroccana*	Xeris cobosi Viedma and Suárez	probable host
*Cedrus deodara*	Xeris himalayensis Bradley
*Larix decidua*	Xeris spectrum (Linnaeus) and/or X. pallicoxae n. sp.
*Larix occidentalis*	Xeris caudatus (Cresson) Xeris indecisus (MacGillivray)
*Picea abies*	Xeris indecisus (MacGillivray) Xeris spectrum (Linnaeus) and/or X. pallicoxae n. sp.
Picea engelmannii	Xeris caudatus (Cresson)
*Picea glauca*	Xeris caudatus (Cresson) Xeris melancholicus (Westwood)
*Picea orientalis*	Xeris spectrum (Linnaeus) and/or X. pallicoxae n. sp.
*Picea pungens*	Xeris caudatus (Cresson) Xeris morrisoni (Cresson)
*Picea sitchensis*	Xeris indecisus (MacGillivray) Xeris spectrum (Linnaeus) and/or X. pallicoxae n. sp.
*Picea smithiana*	Xeris himalayensis Bradley
*Pinus banksiana*	Xeris melancholicus (Westwood)
*Pinus contorta*	Xeris caudatus (Cresson) Xeris indecisus (MacGillivray)
*Pinus pinaster*	Xeris spectrum (Linnaeus) and/or X. pallicoxae n. sp.
*Pinus ponderosa*	Xeris caudatus (Cresson) Xeris indecisus (MacGillivray)
*Pinus roxburghii*	Xeris himalayensis Bradley
*Pinus sylvestris*	Xeris spectrum (Linnaeus) and/or X. pallicoxae n. sp.
*Pseudotsuga menziesii*	Xeris caudatus (Cresson) Xeris indecisus (MacGillivray) Xeris morrisoni (Cresson)
*Tsuga heterophylla*	Xeris indecisus (MacGillivray)

Parasitoids

Though several species of parasitoids are associated with Siricidae on conifers, they belong to only a few hymenopteran families. Few parasitoid species have been associated with species of Xeris (Spradbery and Kirk 1978, and collections studied here). It is likely that more species of the known parasitoids of other siricid genera associated with conifers also attack larvae of Xeris.

PARASITOID SPECIES	XERIS SPECIES	NOTE
IBALIIDAE
Ibalia leucospoides (Hochenwarth)	Xeris spectrum (Linnaeus) and/or Xeris pallicoxae n. sp.	Spradbery and Kirk 1978
Ibalia rufipes drewseni Borries	Xeris spectrum (Linnaeus) and/or Xeris pallicoxae n. sp.	Spradbery and Kirk 1978
ICHNEUMONIDAE
Megarhyssa rixator (Schellenberg)	Xeris spectrum (Linnaeus) and/or Xeris pallicoxae n. sp.	Spradbery and Kirk 1978
Megarhyssa nortoni (Cresson)	Xeris morrisoni (Cresson)	Townes 1944
Poemenia hectica (Gravenhorst)	Xeris spectrum (Linnaeus) and/or Xeris pallicoxae n. sp.	Schimitschek 1974
Pseudorhyssa sternata	cleptoparasite of Rhyssa persuasoria (Linnaeus)	Spradbery 1974
Rhyssa amoena (Gravenhorst)	Xeris spectrum (Linnaeus) and/or Xeris pallicoxae n. sp.	Spradbery and Kirk 1978
Rhyssa persuasoria (Linnaeus)	search behavior by Xeris sp. Xeris spectrum (Linnaeus) and/or Xeris pallicoxae n. sp. Xeris himalayensis Bradley	Spradbery and Kirk 1978 Spradbery and Kirk 1978 Dharmadhikari and Achan 1965
STEPHANIDAE
Schlettererius cinctipes (Cresson)	Xeris sp.

Keys

2. Key to species of Xeris

1	A)	Vertex densely pitted and without or almost without smooth surfaces (Fig. B2.1).
	B)	Maximum distance between outer genal edges shorter than maximum distance between outer edges of eyes (in frontal view outer edges of gena intersected by outer edges of eyes) (Fig. B2.4).
	C)	Maximum eye height in lateral view 0.53–0.61 times maximum head height (measured from genal transverse ridge above mandible to top of head) (Fig. B2.6).
	D)	Ventral surface of propleuron with clearly impressed meshes of microsculpture between teeth; sculpticells scale-like, dull between pits and teeth (Fig. B2.9).
	E)	In female, apical section of sheath without longitudinal ridge between dorsal and ventral edges (Fig. B2.12, insert); sheath with basal section 0.5–0.6 times as long as apical section (Fig. B2.12).
		[Additional characters. Lateral surface of pronotum with sharply reticulate pattern around one or more pits (Fig. B2.15); ovipositor with a pit on each annulus anterior to teeth annuli and each pit large and extending anteriorly toward preceding annulus as a shallow furrow (Fig. B2.16); sheath with junction of basal and apical sections aligned between annuli 8 and 9 of ovipositor. Note. All known hosts are Cupressaceae. Range. Western United States between Washington and California.]
			Xeris tarsalis (Cresson, 1880)
–	a)	Vertex less densely pitted, with obvious smooth surfaces on outer sides of median furrow (Figs. B2.2 and B2.3).
	b)	Maximum distance between outer genal edges slightly or very clearly wider than maximum distance between outer edges of eyes, thus, in frontal view, outer edge of gena not intersected by outer edges of eyes (Fig. B2.5).
	c)	Maximum eye height in lateral view at most 0.54 times maximum head height (measured from genal transverse ridge above mandible) (Figs. B2.7 and B2.8).
	d)	Ventral surface of propleuron without or with lightly impressed meshes of microsculpture, shiny between pits and teeth (Figs. B2.10 and B2.11).
	e)	In female, apical section of sheath with longitudinal ridge between dorsal and ventral edges (insert in Fig. B2.13, insert); sheath with basal section at most 0.46 times as long as apical section (Figs. B2.13 and B2.14).
		[Note. Known hosts are almost always Pinaceae except one of the recorded hosts of X. malaisei (Pinaceae and Cupressaceae).]
			2


2(1)	A)	Gena dorsal to mandible with broadly rounded and coarsely pitted transverse ridge (Fig. B2.17).
	B)	Distance between lateral ocellus and nearest eye edge about 1.0 (Fig. B2.19).
	C)	Propleuron in ventral view densely pitted (Distance between lateral ocellus and nearest eye edge about 1.0 (Fig. B2.21).
	D)	In female, femora black, tibiae and metatarsomere 1 light reddish brown in basal 0.1 (Fig. B2.23).
		[Additional characters. Gena below eye and genal ridge (including adjacent occiput) densely pitted Figs. B2.27 and B2.28; setae on frons and clypeus about twice as long as diameter of lateral ocellus (Figs. B2.27 and B2.28); female sheath with basal section 0.4 times as long as apical section (Fig. B2.29), with abdomen red, and with darkly tinted wings except for clear basal 0.5 of hind wing (Fig. B2.30). Note. The male is unknown, but characters A, B and C probably apply. Range. Southernmost Mexico in the state of Chiapas.]
			Xeris tropicalis Goulet, 2011
–	a)	Gena dorsal to mandible with sharp and smooth transverse ridge (Fig. B2.18).
	b)	Distance between lateral ocellus and nearest eye edge 1.15–1.50 times distance between inner edges of lateral ocelli (Fig. B2.20).
	c)	Propleuron in ventral view not sharply pitted or not pitted, surface in most specimens consisting of few to many isolated teeth ( Fig. B2.22)
	d)	In female, femora varying from black to light reddish brown, tibiae and tarsi light reddish brown (Fig. B2.24), or tibiae and metatarsomere 1 black but light reddish brown in at least basal 0.3 (Figs. B2.25 and B2.26).
			3

3(2)	A)	Gena below eye and genal ridge (including adjacent occiput) densely pitted (Fig. B2.31, black arrow).
	B)	Clypeus with setae 1.0–1.5 times as long as diameter of lateral ocellus (Fig. B2.33, red arrow) and vertex quite densely pitted between dorsal edge of eye and occiput outside postocellar area (Fig. B2.33, black arrow).
		[Additional characters. Flagellum black (as in Fig. B2.35). Pronotum in dorsal view with a yellowish-white longitudinal band along margin between anterolateral to posterolateral angles (Fig. B2.36). In male, base of metatibia with clearly outlined white spot [not present in other Nearctic species (Fig. B2.38). Abdomen black (Fig. B2.37). Range. Arizona and Colorado in southwestern United States.]
			Xeris chiricahua Smith, 2012
–	a)	Gena below eye and genal ridge smooth, without or with very few pits (Fig. B2.32, black arrow).
	b)	Clypeus with setae 0.6–0.7 times as long as diameter of lateral ocellus (Fig. B2.32, red arrow), or setae 1.0–1.4 times as long (only X. umbra) (Fig. B2.34, red arrow) and vertex pits scattered between dorsal edge of eye and occiput ouside postocellar area (Fig. B2.34, black arrow).
			4

4(3)	A)	Fore wing with cell C darkly tinted (yellowish brown to dark brown) and with base of stigma on both sides of junction with vein 1r-rs black or somewhat paler (as in Fig. B2.39).
	B)	Vertex with pits denser (usually touching) and bigger (0.2–0.5 times diameter of lateral ocellus) between dorsal edge of eye and occiput outside postocellar area (Fig. B2.41) or pits as in "b" (Fig. B2.42) and fore wing cell C color as in "A".
			5
–	a)	Fore wing cell C very lightly tinted (yellowish white) and with base of stigma on both sides of junction with vein 1r-rs clearly white or yellowish white (Fig. B2.40).
–	b)	Vertex with pits sparser (usually not touching) and smaller (0.05–0.25 times diameter of lateral ocellus) between eye dorsal edge and occiput outside postocellar area (Fig. B2.43).
		[Range. Europe and Asia.]
			12

5(4)	A)	Vertex between dorsal edge of eye and occiput outside postocellar area with dense (usually touching) and big pits (0.2–0.5 times diameter of lateral ocellus) (Fig. B2.44).
	B)	Gena with pits between eye outer edge and genal ridge large (0.2–0.4 times diameter of lateral ocellus) (Fig. B2.46).
	C)	In female, procoxa black (Fig. B2.48) and flagellum black (as in Fig. B2.50) or partly to completely light reddish brown (Figs. B2.51 and B2.52), or procoxa light reddish brown (Fig. B2.53) and flagellum completely light reddish brown (Fig. B2.52).
	D)	In female, pronotum in dorsal view black or with a yellowish-white spot at anterolateral corner not extending to posterolateral corner (Figs. B2.54 and B2.55).
	E)	In male, pronotum in dorsal view black or black with a yellowish-white anterolateral spot at most extending posteriorly but not reaching posterolateral corner and much narrower posteriorly (Figs. B2.57 and B2.58).
				6
–	a)	Vertex between dorsal edge of eye and occiput outside postocellar area with pits sparse (rarely touching) and smaller (0.2–0.25 times diameter of lateral ocellus) (Fig. B2.45).
	b)	Gena with pits between eye outer edge and genal ridge smaller (0.05–0.15 times diameter of lateral ocellus) (Fig. B2.47).
	c)	In female, procoxa light reddish brown (Fig. B2.49) and flagellum black (as in Fig. B2.50).
	d)	In female, pronotum in dorsal view black with a yellowish-white longitudinal band between anterolateral corner and posterolateral corner (Fig. B2.56).
	e)	In male, pronotum in dorsal view black with a longitudinal yellowish-white band between anterolateral and posterolateral corners (as in Fig. B2.59).
		[Range. North America.]
			11

6(5)	A)	Abdomen reddish brown (Fig. B2.60), or black and matching state of following characters (Fig. B2.61).
	B)	In female, flagellum partly or completely light reddish brown (Figs. B2.62 and B2.63).
	C)	In female, fore wing completely to mainly darkly tinted (Fig. B2.65), or with darkly tinted central and apical bands (old specimens maybe bleached and difficult to evaluate for this feature) (Fig. B2.66).
	D)	In male, metatibia black or with an indistinct reddish-brown or brown spot at base (Figs. B2.68 and B2.69).
		[Range. North America.]
			7
–	a)	Abdomen black (as in Fig. B2.61).
	b)	In female, flagellum black (as in Fig. B2.64).
	c)	In female, fore wing clear or with very lightly tinted central and apical bands (as in Fig. B2.67).
	d)	In male, metatibia clearly yellowish white at base (as in Fig. B2.70).
		[Range.Morocco (Rif), Western Himalaya.]
			10

7(6)	A)	In female, coxae, trochanters and femora black (Fig. B2.71).
	B)	In female, flagellum brown or black in basal 0.3, gradually becoming light reddish brown in apical 0.7 (Fig. B2.73).
	C)	Gena narrow, its maximum length from eye to genal ridge 0.40–0.50 times as long as maximum eye length (Fig. B2.76).
		[Range. Arizona and Colorado in southwestern United States.]
			Xeris morrisoni (Cresson, 1880)
–	a)	In female, coxae mainly black to mainly reddish brown, trochanters and femora light reddish brown (Fig. B2.72).
	b)	In female, flagellum brown or black in basal 0.7 and light reddish brown in apical 0.3 (Fig. B2.74), or completely light reddish brown (Fig. B2.75).
	c)	Gena wide, its maximum length from eye to genal ridge 0.50–0.70 times as long as maximum eye length (Fig. B2.77).
			8

8(7)	A)	Abdomen black (Fig. B2.78).
	B)	In female, flagellum light reddish brown in apical 0.3 (rarely completely light reddish brown) (Fig. B2.80).
		[Range. Forested regions of western Canada and United States.]
			Xeris indecisus (MacGillivray, 1893)
–	a)	Abdomen reddish brown (Fig. B2.79) and
	b)	In female, flagellum completely light reddish brown (Fig. B2.81).
			9

9(6)	A)	In female, fore wing with darkly tinted central and apical bands (Fig. B2.82).
		[Note. Males of X. indecisus and X. degrooti are indistinguishable. Only X. indecisus is recorded from southern British Columbia, Washington, northern Idaho, Montana, western Oregon, and California. In the central portion of the Rocky Mountain ranges both species are sympatric.]
			Xeris indecisus (MacGillivray, 1893)
–	a)	In female, fore wing completely darkly tinted (Fig. B2.83).
		[Note. Specimens from at least South Dakota and probably those from Wyoming, Utah, eastern Nevada, Colorado, New Mexico and Arizona could belong to X. degrooti. However, both species may be sympatric in this region. Neither males nor females could be distinguished morphologically despite a remarkable 9% difference between their barcodes.]
			Xeris degrooti Goulet, n. sp. and Xeris indecisus (MacGillivray, 1893)

10(6)	A)	Clypeus in lateral view with setae about 0.6–0.7 times as long as diameter of lateral ocellus (Fig. B2.84).
	B)	In female, coxae mainly light reddish brown (Fig. B2.86).
		[Range. Morocco, Tizi-Ifri and Talasse N'Tane.]
			Xeris cobosi Viedma and Suárez, 1961
–	a)	Clypeus in lateral view with setae about 0.7–1.2 times as long as diameter of lateral ocellus (Fig. B2.85).
–	b)	In female, coxae black (Fig. B2.87).
		[Range. High elevations in Pakistan, India, Nepal and China.]
			Xeris himalayensis Bradley, 1934

11(5)	A)	In female, sheath with basal section more than 0.27 times length of apical section (if 0.25–0.27, use characters B and C) (Fig. B2.88).
	B)	In most females, tergum 10 with meshes of microsculpture lightly impressed on laterobasal angle in dorsal view (Fig. B2.90).
	C)	In most females, abdominal tergum 9 in lateral view with meshes of microsculpture clearly impressed with scale-like sculpticells on surface posterior to and above lateral furrow, thus surface slightly dull (Fig. B2.92).
		[Range. Recorded from central Alberta to Nova Scotia and south (east of Prairie region) to Minnesota and Maine. This species and X. caudatus are sympatric in the central regions of Alberta and Saskatchewan. Note. Males cannot be recognized on morphological features, but can be distinguished by their barcodes.]
			Xeris melancholicus (Westwood, 1874)
–	a)	In female, sheath with basal section less than 0.25 times length of apical section (if 0.25–0.27, use characters b and c) (Fig. B2.89).
	b)	In most females, tergum 10 without meshes of microsculpture on laterobasal angle in dorsal view (Fig. B2.91).
	c)	In most females, abdominal tergum 9 in lateral view with meshes of microsculpture not well impressed, with sculpticells almost flat and somewhat scale-like on surface posterior to and above lateral furrow, thus surface shiny (Fig. B2.93).
		[Range. Recorded from the Rocky Mountains to the Pacific coast between Alaska and California but also occurring east of the Rocky Mountains in Alberta and Northern Saskatchewan. This species and X. melancholicus are sympatric in the central regions of the above two provinces. Note. Males cannot be recognized on morphological features, but can be distinguished by their barcodes.]
			Xeris caudatus Cresson, 1865

12(4)	A)	Pronotum in dorsal view with yellowish-white longitudinal band very smooth between large teeth (Fig. B2.94).
	B)	Pronotum in lateral view almost entirely without coarse pits (pit base slightly to clearly raised as a tooth or cone and not fused with nearby teeth) (Fig. B2.96).
	C)	In female, coxae light reddish brown (Fig. B2.98).
		[Additional characters. In male, gena with yellowish-white spot large, almost always sharply outlined, and extending to genal ridge but not behind ridge on occiput (Fig. B2.100); hind leg with metafemur reddish brown to completely black, apex of metatarsomere 1 narrowly reddish brown, and in most males, with black central transverse band on metatarsomere 2 (Fig. B2.101). Range. Central Europe.]
			Xeris pallicoxae Goulet, n. sp.
–	a)	Pronotum in dorsal view with surface of lateral margin (usually margin yellowish white) bearing small ridges between large teeth (Fig. B2.95).
	b)	Pronotum in lateral view with coarse reticulate pits over 0.3–0.9 of surface (Fig. B2.97).
	c)	In female, coxae black, at least on outer surface (Fig. B2.99).
			13

13(12)	A)	Clypeus with setae 1.0–1.4 times as long as length of lateral ocellus (Fig. B2.102).
	B)	Metanotum posterior to cenchrus and on lateral 0.5 of metascutellum with fine, isolated pits (Fig. B2.104).
	C)	In female, trochanters black, pro- and mesofemur brown, metafemur mostly black, and tarsomeres 1 (in apical 0.5) and all of tarsomeres 2–5 black, tibiae and basal 0.5 of metatarsomere 1 light reddish brown (Fig. B2.106).
	D)	In female, tergum 10 in dorsal view with teeth along lateral margin in apical 0.3 very small but larger toward apex (Fig. B2.109).
	E)	In male, pro- and mesotibiae black or at most clearly or indistinctly yellowish white in basal 0.1 (Fig. B2.111).
		[Additional characters. In female, flagellum black (Fig. B2.113). Range. China, Yunnan.]
			Xeris umbra Goulet, n. sp.
–	a)	Clypeus with setae 0.6–0.7 as long as length of lateral ocellus (Fig. B2.103).
	b)	Metanotum posterior to cenchrus and on lateral 0.5 of metascutellum with coarse, dense and usually polygonal pits (Fig. B2.105).
	c)	In female, legs below coxae light reddish brown (Fig. B2.107), or metafemur mostly black, tarsomeres (apical 0.6) and all of tarsomeres 2–5 black, tibiae in basal and apical 0.3 and mesofemur light reddish brown (Fig. B2.108, hind leg).
	d)	In female, tergum 10 in dorsal view with teeth along lateral margin in apical 0.3 large (Fig. B2.110).
	e)	In male, pro- and mesotibia clearly yellowish white in basal 0.5–0.6 and quite sharply separated from black apex (Fig. B2.112).
		[Note. The male of X. xanthoceros (couplet 17) is unknown. Characters “a” and “b” probably apply.]
			14

14(13)	A)	In female, flagellum black (Fig. B2.114).
	B)	In male, tarsomeres 2–5 light reddish brown (metatarsomere 2 may have an indistinct dark central spot) (Fig. B2.118).
	C)	In male, metatarsomere 1 black, but broadly reddish brown at apical margin (Fig. B2.120).
	D)	In male, metafemur (almost always) and trochanter reddish brown (Fig. B2.122).
		[Additional characters. Tergum 10 with surface anterior to anus often light reddish brown (Fig. B2.124). Range. Transpalaearctic, mainly in cold temperate and boreal regions.]
			Xeris spectrum (Linnaeus, 1758)
–	a)	In female, flagellum light reddish brown in apical 0.3–0.7 (Fig. B2.115, B2.116 and B2.117).
	b)	In male, at least tarsomeres 5 dark brown or black and usually tarsomeres 2–5 dark brown or black (Fig. B2.119).
	c)	In male, metatarsomere 1 black to apex, at most narrowly reddish brown at apical margin (Fig. B2.121).
	D)	In male, metafemur and trochanter black (Fig. B2.123).
		[Note. The male of X. xanthoceros (couplet 17) is unknown. Character “b”, “c” and “d” are likely to apply. Range. Eastern Asia from extreme southeastern Russia to Laos and Taiwan.]
			15

15(14)	A)	Pronotum in lateral view with deep and coarse polygonal pits on about 0.9 of surface (Fig. B2.125).
	B)	In female, flagellum black in basal 0.5 (7 or 8 basal flagellomeres) and light reddish brown apically (Fig. B2.127).
	C)	In male, gena with yellowish-white spot large, sharply outlined, and extending to genal ridge and clearly behind ridge on occiput (spot comma-like) (Fig. B2.130).
	D)	In male, pro- and mesotarsomeres 1 light reddish brown (Fig. B2.132).
		[Range. Laos, Huaphan.]
			Xeris xylocola Goulet, n. sp.
–	a)	Pronotum in lateral view with coarse polygonal pits on posterior 0.5 of surface (as in Fig. B2.126).
	b)	In female, flagellum black either in basal 0.3 (Fig. B2.129) or in basal 0.7 (Fig. B2.128) and light reddish brown apically.
	c)	In male, gena with yellowish-white spot large, sharply (rarely indistinctly) outlined, and extending to genal ridge but not behind ridge on occiput (Fig. B2.131).
	d)	In male, pro- and mesotarsomeres 1 light reddish brown in basal 0.1–0.8 and black thereafter (Fig. B2.133).
		[Note. The male of X. xanthoceros (couplet 16) is unknown. Character "a" probably applies, but character states "c" and "d" may not apply.]
			16

16(15)	A)	Pronotum medially in dorsal view with a wide shiny surface and with a deep impression near center (Fig. B2.134, insert).
	B)	In female, flagellum black in basal 0.7–0.75 (9–10 basal flagellomeres) and light reddish brown apically (Fig. B2.136).
	C)	In female, last labial paplpomere black (Fig. B2.138).
	D)	In female, tergum 8 dull over surface (sculpticells scale-like at or near lateral edge) (as in Fig. B2.140).
		[Additional character. In female, pronotum in dorsal view along lateral margin with a yellowish-white band (usually wide except at high elevation) (Fig. B2.142). Range. China (northeastern region), Japan (Hokkaido and Honshu), Russia (Primorsky Kray), South Korea, and Taiwan (high elevation).]
			Xeris malaisei Maa, 1949
–	a)	Pronotum medially in dorsal view with a narrow shiny surface and without an impression near center Fig. B2.135).
	b)	In female, flagellum black in basal 0.3 (3 or 4 basal flagellar segments) and light reddish brown beyond flagellomere 4 (Fig. B2.137).
	c)	In female, last labial paplpomere reddish brown (Fig. B2.139).
	d)	In female, tergum 8 shiny along most of lateral margin (sculpticells flat or meshes absent) (Fig. B2.141).
		[Note. The male of X. xanthoceros is unknown, characters "16 a", “14c” and “14d” probably applies. Additional characters. In female, pronotum black except for a trace of a pale narrow spot along margin of anterolateral corner (Fig. B2.143). Range. China, Yunnan.]
			Xeris xanthoceros Goulet, n. sp.

DNA

Introduction - Results of DNA analysis - Discussion - Conclusion

Although the preponderance of this work is a worldwide morphological revision of the genus Xeris, DNA barcoding was also used to look for cryptic species and develop a database of sequences that could be used to identify larvae, the life stage most often intercepted in commerce (Schiff et al. 2012).

DNA barcodes, as we use them (i.e. 658 bp of Cytochrome Oxidase 1), were originally introduced as an easy, rapid, inexpensive way for investigators with no specialized taxonomic knowledge to assess biodiversity (Hebert et al. 2003). The methodology proved to be popular and barcodes were used to identify animal species including fish, birds and arthropods, to associate life stages and to uncover cryptic species (Ball and Armstrong 2006, Hajibabaei et al. 2006, Hebert et al. 2004, Hebert et al. 2004A, Hogg and Hebert 2004, Smith et al. 2006, Ward et al. 2005).

However, as more taxa were barcoded a variety of pitfalls and problems were identified including; heteroplasmy, where more than one haplotype is present in a single individual; accidentally sequencing nuclear pseudogenes of mitochondrial origin (NUMT’s); bacterial mediated mitochondrial introgression; misleading results due to hybridization; insufficient variation and taxon discrimination (see discussion in Rubinoff et al. 2006, Blaxter et al. 2005, Linnen and Farrell 2007, 2008, Smith et al., 2012, Whitworth et al. 2007). These limitations made using barcodes more complicated and to clarify when and how to use them. DeSalle (2006) drew a distinction between species discovery and species identification. He argued that barcodes alone were probably not sufficient for species discovery but that if there were a sequence database derived from identified specimens, barcodes could be used to identify unknown specimens with the caveat that some unknowns might not be identifiable. He further proposed that a novel barcode (haplotype) should be considered as a species hypothesis that should only be accepted with verification by a second method. Thus, DNA barcodes should have taxonomic utility but only if there is a database of knowledge with good taxon coverage and appropriate sampling.

DNA barcodes have already proved useful in understanding siricid taxonomy. Based on barcodes, Schiff et al. (2012) synonymized color morphs that had been described as separate species, identified new species that were later supported by morphological characters and hypothesized two new cryptic species that they chose not to describe for lack of morphological characters. Based on these findings it seems likely that DNA barcodes would have utility in a worldwide revision of Xeris.

Results

Cytochrome oxidase 1 DNA barcodes, including 144 that were new for this study, were obtained for 149 specimens of the genus Xeris (see Table 2, under Appendices). 110 sequences (74%) were obtained from adult specimens identified using morphological keys to siricid genera and species and 39 sequences (26%) were obtained from larvae identified as Xeris by their placement in the barcode tree to Siricidae (Schiff et al. 2012). At least one complete sequence (658bp) was obtained for each taxon although only 117 of the barcodes (78%) were full length. Thirteen sequences (9%) were longer than 600bp, nine (6%) were longer than 500bp, eight (5%) were longer than 400bp and two (2%) were between 250 and 300bp in length. The distribution of sub full length sequences was not random. Four of five sequences (80%) of a new species, Xeris degrooti, were less than full length including the two shortest sequences used in the study (289bp and 290bp respectively) and four of six sequences (67%) of Xeris morrisoni were incomplete whereas all other taxa had at least 50% complete sequences. The length of each sequence is reported at the end of each species description in the section listing specimens for molecular studies.

Prior to sequencing, seven Xeris species could be morphologically recognized among the adult specimens. When a Neighbor-Joining phylogenetic tree was constructed from the 149 larval and adult sequences of this study, the resulting tree had 10 branches indicating three potential extra taxa, one from adult and two from larval specimens. Bootstrap analysis showed strong support (above 90) for all major branches except for X. caudatus and X. indecisus with bootstrap values of 40.4 and 62.6 respectively (Fig. D1.1). Figures D1.2a, D1.2b, D1.2c, D1.2d and D1.2e graphically represent the within and between species variation and clearly show that 100% of specimens assort to their respective taxa. Pairwise comparisons show that the divergence between all species pairs (45 comparisons) was greater than 10% except for X. caudatus and X. melancholicus (3.4%), X. morrisoni and X. indecisus (3.0%), X. malaisei and X. spectrum (4.1%) and X. pallicoxae "type 1" and X. pallicoxae "Type 2" (2.2%) (Table 1,. under Appendices).

Discussion

When using more than one method to discriminate species one hopes for congruence of results. In this case, we expected that all the morphologically defined taxa would exactly match those identified by DNA sequencing of Cytochrome Oxidase 1. The neighbor joining tree (Figs. D1.2a, D1.2b, D1.2c, D1.2d and D1.2e) shows 149 specimens segregated into ten well differentiated haplotype groups but unfortunately, morphological analysis was not always able to resolve the same taxa. The most complicated problem was the resolution of the new species X. degrooti from the widespread North American species X. indecisus. Although we recognized color variation in X. indecisus, there was nothing to suggest a new species, especially in light of the considerable color variation in other Siricidae (Schiff et al. 2012), until specimens were barcoded. Five specimens formed a distinctive clade approximately 12% divergent from X. indecisus. Initially we were leery of the result, because the samples were obviously degraded (they were not collected into ethanol but another preservative and only later transferred to ethanol), most of the sequences used were incomplete with numerous individuals collected at the same time not producing any readable sequence and the divergence was quite large for North American Xeris species. However, the single complete sequence was a powerful hypothesis. Eventually, we were convinced, because the single complete sequence did not contain any stop-codons suggesting it was not a NUMT (a nuclear pseudogene of mitochondrial origin) one of the possible errors in barcoding (Lopez et al. 1994, Song et al. 2008, Pamilo et al. 2007, Koutroumpa et al. 2009), its closest blastn search match was Xeris morrisoni (89.2% identity, searched 20 March 2015) and its position in the tree was within, not basal to, the other Xeris species. Once we accepted the new species hypothesis, we used the sequence information to make sense of the morphological variation. The results are provided in detail under the species treatments for X. degrooti and X. indecisus but basically X. degrooti females can be separated from X. indecisus females with black abdomens and X. indecisus females with reddish abdomens and clear wings but not from X. indecisus females with reddish abdomens and darkly tinted wings. We further believe that putative male X. degrooti can be separated from male X. indecisus with black abdomens but not from those with reddish brown abdomens. Since none of the five sequenced specimens are males, we cannot be positive that the specimens we posit to be male X. degrooti actually are X. degrooti so we have chosen not to provide a male description (page 47). Although we are convinced of the validity of X. degrooti, we would still like to generate barcodes for more specimens of both genders and all color morphs over more of its putative range.

Perhaps the most surprising result of this study was the independent discovery by both barcoding and morphology of the new species X. pallicoxae sympatric with X. spectrum. The current morphological analysis of X. spectrum of Western Europe revealed two species, X. spectrum and X. pallicoxae and barcode analysis of larval specimens revealed at least two and maybe three taxa that we refer to as X. spectrum, X. pallicoxae “Type 1” and X. pallicoxae “Type 2”. The results are considered to be independent because all the sequences of X. pallicoxae “Type 1” and “Type 2” and most of the sequences of X. spectrum were derived from larval specimens and larvae could not be assigned to a species a priori because there are no keys to larvae of any Siricidae. Fortunately, we were able to obtain sequences of three adults of X. spectrum positively associating the name to the haplotype group but we were unable to obtain sequences of adult X. pallicoxae and therefore had to associate the species to the haplotype group by elimination. As there are two closely related (2.2% divergence see Table 1) X. pallicoxae haplotype groups, we believe one of them is X. pallicoxae and the other is a cryptic species close to X. pallicoxae waiting to be described. Unfortunately, we do not know which haplotype group is associated with the holotype of X. pallicoxae and which is associated with the new species. Consequently, we are forced to call the species X. pallicoxae “Type 1” and X. pallicoxae “Type 2” until adults of at least one species can be sequenced. Initially, we considered that the cryptic species might only be variation within X. pallicoxae, but a fairly large sample size, relatively high bootstrap support (Fig. D1.2e) and a second annual emergence peak (most siricids only have one, see see (Fig. C11.9) support the new cryptic species hypothesis.

The remaining barcode species complement morphological species nicely and support the morphological phylogenetic analysis fairly well (see "Notes on Affinities" under Xeris). The X. indecisus lineage; X. indecisus, X. morrisoni and X. degrooti is supported as is the X. caudatus lineage of X. caudatus and X. melancholicus. Third, Xeris malaisei is recognized as a distinct species from X. spectrum. Finally, we were able to obtain a sequence of the Old World X. himalayensis from genbank. We were surprised to see that it was so divergent from the other Xeris species (16.9%-19.7%) but gratified to see that it clustered with the other Xeris within the Siricidae (Fig. D1.1).

Conclusion

The combination of classical morphological and DNA barcoding methods have allowed us to revise the siricid genus Xeris on a worldwide basis and add to the DNA database that enables identification of siricid larvae. DNA barcodes can unambiguously identify all species for which we were able to obtain sequences (9 of 16) and suggest there is a new cryptic species in Western Europe awaiting morphological description. One new North American species, X. degrooti, can only be positively identified using barcodes at this point but we expect additional sequences of different color morphs over more of the species range will help us clarify its morphological characteristics. This work demonstrates the utility of barcoding for generating species hypotheses and associating color morphs and different life stages.

Acknowledgements

For this study many colleagues generously contributed various elements that helped us produce a comprehensive revision. We are most appreciative and indebted to them for their support.

Systematic research is based on specimens stored in collections and looked after by conscientious colleagues. The quality of research is proportional to the number of specimens studied. We were fortunate to obtain a large number of them and are most thankful to the curators mentioned under “Materials and methods” that either facilitated our visit to their collection or sent us specimens on loan. With the establishment of Sirex noctilio in the Great Lakes region, many surveys were carried out and long series of specimens (including those of Xeris) were submitted to us for identification. We greatly appreciate the survey specimens of Siricidae generously given to us by H. Douglas (CFIA), D. Langor (NFRC), the late P. de Groot, K. Nystrom and I. Ochoa (GLFC), L. Humble and J. Smith (PFRC), J. Kruse (USFS–AK), D. Miller (USFS–GA), C. Piché (MNRQ), and J. Sweeney and J. Price (FRLC). These fresh and clean specimens permit us to study the DNA of significant specimens and enriched our collections.

We would like to thank A. Lancaster, for assistance in the lab and with rearing specimens and the following who helped either with specimens or in the field: I. Aguayo, M. Allen, R. Bashford, L. Bezark, C. Brodel, J. Cena, M. Chain, K. Cote, D. Crook, E. Day, Y. DeMarino, P. Denke, D. Duerr, the Fish family, H. Hall, D. Haugen, S. Heydon, R. Hoebeke, B. Hofstrand, A. Horne, L. Humble, W. Johnson, V. Klasmer, R.L. Koch, B. Kondratieff, J. Kruse, J. LaBonte, P. Lago, E. Lisowski, V. Mastro, S. McElway, H. McLane, J. Meeker, D. Miller, A. and G. Mudge, D. Patterson, T. Price, J. Quine, L. Reid, V. Scott, C. Snyder, S. Spichiger, W. Tang, P. Tolesano, M. Ulyshen, M. Vardanega, G. Varkonyi, S. Vaughn, J. Vlach, and R. Westcott.

Traditionally, only morphological features were studied from specimens in collections. Lately, DNA sequencing of properly preserved specimens has opened a new set of characters, previously unavailable. Many of the submitted specimens were freshly collected and offered us the opportunity to extract information from DNA barcodes (cytochrome c oxidase 1 – CO1). This new tool in conjunction with the classical morphological approach gave us much confidence in our conclusions. We greatly appreciate having access to specimens properly preserved for DNA sequencing provided by H. Douglas (CFIA), V. Grebennikov (CFIA), D. Langor (NFRC), P. de Groot, K. Nystrom and I. Ochoa (GLFC), L. Humble and J. Smith (PFRC), and D. Miller (USFS–GA). We are also very grateful for support from the Government of Canada through Genome Canada and the Ontario Genomics Institute in support of the International Barcode of Life Project. This funding allowed staff at the Biodiversity Institute of Ontario under the leadership of P. Hebert to sequence 100 specimens of Xeris, and covered the costs in the preparation and digitization of specimen data by J. Fernandez–Triana. We also appreciate the time spent by A. Smith and J. Fernandez–Triana explaining details of the results to Henri Goulet.
Adults of Xeris are easily damaged so we were worried about borrowing type specimens. We tried to study types during our visit to various North American collections but we did not have the opportunity to visit European collections. To avoid having types sent by post, we studied the description and previous opinions about each type. Then, we decided if photos of a type would be enough to resolve its identity. Through the kindness of M. París (MNCN), J. E. Hogan (OXUM), and L. Vilhelmsen (ZMUC), we were able to get the necessary pictures taken. We also had access to the Linnaean Society site for type images. All images of X. cobosi used in this paper were prepared by M. París (MNCN). Finding live Xeris specimens is a challenge. We appreciate access to two images of live females of X. spectrum for a thumbnail (image: http://www.biolib.cz/en/image/id1106/) and a habitus (image: DSCF068.jpg) from Ondřej Zicha (e-mail: ondrej.zicha@gmail.com) on line thumbnail).
Much information came from many colleagues. The following people kindly spent time trying to find specimens of unusual species in their respective collections, providing information about type’s whereabouts, and hand carrying of such specimens. We are very grateful to C. P. D. T. Gillett (BMNH), H. Vardal (Swedish Museum of Natural History), Y. Bousquet (CNC), V. Grebennikov (CFIA), M. Sharkey (University of Kentucky), A. Shinohara (NSMT) for their efforts. When problems arise there is nothing better than your closest colleagues to discuss them. We are much indebted to L. Masner (CNC), and J. T. Huber (CNC). Sometimes questions go beyond Siricidae and even insects. We greatly appreciate detailed information by our esteemed botanical colleague G. Mitrow (National Collection of Vascular Plants, Department of Agriculture, Ottawa), about ranges of European conifers. Finally, we thank the late R. Roughley (EDUM), G. E. Ball and D. Shpeley (UASM) for courtesies extending during our visits to their respective institutions.
Locating and verifying references could become an extremely challenging task especially with older books and journals. We made a special effort to verify and quote completely each of the reference. We are especially thankful to P. Madaire, our librarian, who spent numerous hours helping us finding the information needed and to D. R. Smith who put at my disposal his very large reprint collection. I am also thankful to Y. Bousquet for a few difficult to find references.
At completion of a large manuscript, it is very difficult to see our own errors in the text. We are most thankful to reviewers, J. T. Huber, D. R. Smith and A. Taeger for their vey critical reading of the manuscript rounding up most errors and insuring the uniformity of style.

References

- A - B - C - D - E - F - G - H - I - J - K - L - M - N - O - P - R - S - T - V - W - X - Y - Z -

Abe, M. and Smith, D. R. The genus-group names of Symphyta (Hymenoptera) and their type species. Esakia, Fukuoka 31: 1–115.

Aerts, W. 1960. Die rheinischen Blatt-, Halm- und Holzwespen (Tenthredinoidea). Decheniana 113(2): 285-312.

André, E. 1879–1882. Species des Hyménoptères d’Europe & d’Algérie. Tome 1er. André, Beaune. xi + cxcvi + 642 + 4 pp.

Andguladze, T. Y. 1951. Sawflies of Georgia. Akademia Nauk Gruzinskii SSR, Trudy Zoologiskogo Instituta 10: 223–233. [in Russian]

Ashmead, W. H. 1898. Classification of the horntails and sawflies, or the sub-order Phytophaga (Paper No. 2). The Canadian Entomologist 30: 177–183.

Ashraf, W. 1964. Wood-wasps in West Pakistan. Technical Bulletin No. 6, Commonwealth Institute of Biological Control. Commonwealth Agricultural Bureau. Farnham Royal. P. 66.

Ass, M. and Funtikow, G. 1932. Über die Biologie und technische Bedeutung der Holzwespen. Zeitschrift für Angewandte Entomologie 19: 557–578.

Bachmaier, F. 1966. Übersicht und Bestimmungstabelle der europäischen nadelholzwohnenden Siriciden (Hymenoptera, Symphyta). Anzieger für Schädlingskunde 39: 130–131.

Bakke, A. 1960. Utbredelsen av treveps (Hym., Xiphydridae et Siricidae) i Norge. Norsk Entomologisk Tidsskrift 11: 117–120.

Ball, S. L. and Armstrong, K. F. 2006. DNA barcodes for insect pest identification: a test case with tussock moths (Lepidoptera: Lymantriidae). Canadian Journal of Forest Research 36: 337–350.

Bechstein, J. M. (ed.) 1818-1819: Die Forst- und Jagdwissenschaft nach allen ihren Theilen für angehende und ausübende Forstmänner und Jäger. Ausgearbeitet von einer Gesellschaft und herausgegeben von Dr. Johannes Matthäus Bechstein. Vierter Theil. Forstschutz. Zweyter Band. Beschreibung der schädlichen Forstinsecten nebst ihren Verhütungs- und Vertilgungsmitteln. - Forstinsectologie oder Naturgeschichte der für den Wald schädlichen und nützlichen Insecten nebst Einleitung in die Insectenkunde überhaupt, für angehende und ausübende Forstmänner und Cameralisten. - In der Hennings'schen Buchhandlung, Gotha : XII + 551 + [8] pp. + pp. 552–558.

Bechstein, J. M. and Scharfenberg, G. L. 1805. Vollständige Naturgeschichte der Schädlichen Forstinsekten. Ein Handbuch für Forstmänner. Cameralisten und Oekonomen. Dritte und letzte Abteilung. Nebst dem Anhang von den nützlichen Forstinsekten. C. F. E. Richter, Leipzig. 605–1042 + [4] pp.

Bedard, W. D. 1938. An annotated list of the insect fauna of Douglas fir (Pseudotsuga mucronata Rafinesque) in the northern Rocky Mountain region. The Canadian Entomologist 70: 188–197.

Bednarz, S. 1960. Nowe stanowiska kilku rzadkich trzpiennikowwatych (Siricidae) I Oryssidae w Polsce. Przeglad Zoologiczne 4(3): 210–212.

Benson, R. 1935. The alien elements in the British sawfly fauna. Annals of Applied Biology 22: 754–768.

Benson, R. B. 1940. Sawflies of the Berkhamsted district: with a list of the sawflies of Hertfordshire and Buckinghamshire, and a survey of the British species (Hymenoptera Symphyta). Transactions of the Hertfordshire Natural History Society and Field Club 21(3): 177–231.

Benson, R. B. 1941. The ecology and control of the forest insects of India and the neighbouring countries. Forest Research Institute, Dehra Dun. P. 511.

Benson, R. B. 1943. Studies in Siricidae, especially of Europe and southern Asia (Hymenoptera, Symphyta). Bulletin of Entomological Research 34: 27–51.

Benson, R. B. 1951. Hymenoptera, Symphyta. Handbooks for the identification of British Insects. Royal Entomological Society of London 6(2a). 49 pp.

Benson, R. 1955. The sawflies (Hymen., Symphyta) of Israel. Bulletin of the Research Council of Israel 4: 351–356.

Berland, L. 1947. Hyménoptères Tenthredinoides. Faune de France 47. Paul Lechevalier, Paris. 496 pp.

Berlese, A. 1890. Materiali per un catalogo dei tenthredinei Italiani. Bollettino della Societá Entomologica Italiana 22: 144–202.

Bezares, E. 1929. Fauna entomologica de los pinabetares, Valle de Aran. Revista de Biologia Forestal y Limnologia I ( series A) 2: 83–107.

Billberg, G. J., 1820. Enumeratio Insectorum in Museo Gust. Joh. Bilberg. Gadelianis, Stockholm. 138 pp.

Bischoff, H. 1925. Hymenoptera (Aculeata, Ichneumonidae, Chalastogastra). Abhandlungen der Bayerischen Akademie der Wissenschaften, Mathematisch-Naturwissenschaftliche Abteilung Supplement-band 5: 278–337.

Blanchard, E. 1840. Histoire naturelle des Animaux articulés Annelides, Crustacés, Arachnides, Myriapodes et Insectes. Histoire naturelle des insectes Orthoptères, Névroptères, Hémiptères, Hyménoptères, Lépidoptères et Diptères. Vol 3. P. Duméril, Paris. 472 pp.

Blank, S. M., Boevé, J.-L., Heitland, W., Jänicke, M., Jansen, E., Kopelke, J.-P., Koch, F. Kraus, M., Liston, A. D., Ritzau, C., Schmidt, S. and Taeger, A. 1998, Checkliste der Pflanzenwespen Deutschlands (Hymenoptera, Symphyta). Pp. 13–34 in Taeger, A. and Blank, S. M. (eds.), Pflanzenwespen Seutschlands (Hymenoptera Symphyta). Goeke and Evers. Keltern. 364 pp. + 8 plates.

Blaxter, M., Mann, J., Chapman, T., Thomas, F., Whitton, C., Floyd, R. and Abebe, E. 2005. Defining operational taxonomic units using DNA barcode data. Philosophical Transactions of the Royal Society B 360: 1935–1943.

Bradley, J. C. 1913. The Siricidae of North America. Journal of Entomology and Zoology 5: 1–30 + 5 plates.

Bradley, J. C. 1934. A new species of Xeris (Hymenoptera, Siricidae) from the Himalayas. Records of the Indian Museum 36(2): 145.

Brischke, C. G. A. 1883: Beobachtungen über die Arten der Blatt- und Holzwespen von C. G. A. Brischke, Hauptlehrer a. D. in Langfuhr und Dr. Gustav Zaddach weiland Professor in Königsberg. Zweite Abtheilung. - Schriften der Naturforschenden Gesellschaft in Danzig, N. S., Danzig 5[1881-1883](4): 201–328.

Brünnich, M. T. 1761. Prodromus insectologie siellandicae, quem dissertationis loco publico examini. Hafniae. 31 pp.

Burks, B. D. 1958. Symphyta. Pp. 8–18 in Krombein, K. V. (ed.), Hymenoptera of America North of Mexico, Synoptic Catalog. First Supplement (Agricultural Monograph No. 2), United States Department of Agriculture, Washington, D.C. 305 pp.

Burks, B.D. 1967. Symphyta. Pp. 6–27 in Krombein, K. R. and B. D. Burks (eds.), Hymenoptera of America North of Mexico, Synoptic Catalog. Second Supplement (Agriculture Monograph No. 2), United States Department of Agriculture, Washington, D.C. 584 pp.

Byalaya, I. V. 1963. [Identification of the larvae of the horntails of the subfamily Siricinae (Hymenoptera, Chalastogastra)] pp. 25-28 in Rozhkov, A.S. (ed.), [Forest Pests in Cisbaikalia: scientific Publication]. Akademija nauk SSSR Sibirskoe otdelenie Vostochno-sibirskij biologicheskij institut, Irkutsk : 29 pp. [in Russian]

Byalaya, I. V. 1964a. [Geographical range and habitat distribution of trunk pests of Siberian larch in the Baikal area]. Izvestiya Vostochno-sibirskogo otdeleniya Geograficheskogo Obshchestva SSSR 62: 23–41. [in Russian]

Byalaya, I. V. 1964b. [A key to trunk pests of Siberian larch in the Baikal area, from larval and pupal stages]. Izvestiya Vostochno-sibirskogo otdeleniya Geograficheskogo Obshchestva SSSR 62: 42–63. [in Russian]

Byalaya, I. V. 1966. Family Siricidae. Pp. 158–163 in Rozkhov, A. S., (ed.), Pests of Siberian Larch. Akademiya nauk SSSR, sibirskoe otdelenie. Vostchno-sibirskii biologicheskii institut. 385 pp. (translated by Nemchnok, S., 1970, Israel program for scientific translation).

Cameron, E. A. 1965. The Siricinae (Hymenoptera: Siricidae) and their parasites. Technical Bulletin No. 5, Commonwealth Institute of Biological Control.Commonwealth Agricultural Bureaux. Farnham. Pp. 1–31.

Cameron, P. 1890. Monograph of British phytophagous Hymenoptera (Tenthredo, Sirex and Cynips Linné). Vol. 3. The Ray Society, London. 274 pp. + 17 plates.

Ceballos, G. 1956. Cátalogo de los Himenópteros de Espana. Trabajos del Instituto español de Entomologia, Madrid. 554 pp.

Ceballos, J. 1963. Siricidos españioles (Himenoptera). Graellsia 20: 55–67.

Cherepanov, A. I. 1956. Insects of Tuva District. Akademia Nauk SSSR Zapadno-Sibirskia Filial, Trudy Biologischeskogo Instituta 1: 35–76. [in Russian]

Chou, L. Y. and Naito, T. 1991. Name list of insects in Taiwan – Hymenoptera: Symphyta. Chinese Journal of Entomology 11: 85–95.

Christ, J. L. 1791. Naturgeschichte, Klassification und Nomenclatur der Insekten vom Bienen, Wespen und Ameisengeschlecht; als der fünften Klasse fünfte Ordnung des Linneischen Natursystems von den Insekten: Hymenoptera. Mit häutigen Flügeln. Hermann, Frankfurt. 535 pp. (Symphyta & Cynipidae pp. 409–482).

Cobelli, R. 1891. Gli imenotteri del Trentino: notizie preliminari. Fasc. 2, Tenthredinidae, Apidae, Chrysididae, Pompilidae, Scoliidae, Mutillidae, Sapygidae. Pubblicazione fatta per cura del Museo Civico di Roverto 19: 1–33.

Conde, O. 1935. Oryssoidea et Tenthredinoidea collecta in Ussuri et Sachalin ab N. Delle. Notulae Entomologicae 15: 67–87.

Costa, A. 1860. Fauna del Regno di Napoli. Imenotteri. Parte III. – Trivellanti Sessiliventri. Famiglia de’ Siricidei ; (Siricoidea (gen. Sirex part. Lin.). Pp. 1–6. A. Cons, Napoli. 188 pp.

Costa, A. 1894. Prospetto degli imenotteri Italiani. III, Tenthredinidei e Siricidei. Atti della Reale Accademia delle Scienze Fisiche e Matematiche, Napoli 3. 290 pp.

Costa A. 1895. Prospetto degli imenotteri Italiani. Atti della Reale Accademia delle Scienze Fisiche e Matematiche, Napoli 7. 211 pp. + 3 plates.

Cresson, E. T. 1865. Catalogue of Hymenoptera in the collection of the entomological society of Philadelphia, from Colorado Territory. Proceedings of the Entomological Society of Philadelphia 4: 242–247.

Cresson, E. T. 1880. Catalogue of the Tenthredinidae and Uroceridae of North America. Transactions of the American Entomological Society 8: 53–68.

Cresson, E. T. 1916. The Cresson types of Hymenoptera. Memoirs of the American Entomological Society 1. 141 pp.

Dahlbom, A. G. 1835. Conspectus Tenthredinidum, Siricidum et Oryssinorum Scandinaviae, quas Hymenopterorum Familias. Brunnichianis, Havniae. 16 pp.

Dalla Torre, de C. G. 1894. Catalogus Hymenopterorum hucusque Descriptorum systematicus et synonymicus. Volume I: Tenthredinidae incl. Uroceridae (Phyllophaga & Xylophaga). G. Engelmann, Lipsiae. 459 pp.

DeGeer, C. 1752. Dix-septième mémoire.Pp. 545–609, plate 36, figures 1–7. Mémoire pour servir à l’histoire des insectes. Tome 1. 707 pp. + 37 plates.

Desalle, R. 2006. Species discovery versus species identification in DNA barcoding efforts: Response to Rubinoff. Conservation Biology 20: 1545–1547.

Dharmadhikari, P. R., and Achan, P. D. 1965. Siricids and their parasites from North western Himalayas in India. Technical Bulletin No. 6, Commonwealth Institute of Biological Control. Commonwealth Agricultural Bureau, Farnham. Pp.77–80.

Donovan, E. 1798.The natural history of British Insects explaining them in their several States, with the Period of their Transformation, their Food, Oeconomy, &c. Together with the History of such minute Insects as require Investigation by the Microscope. The Whole illustrated by coloured Figures. Vol. 7. London. 96 + 6 pp.

Dovnar-Zapolskij, D. P. 1929. Key to larvae to larval Chalastogastra. Izvestija Severo-Kavkazkoj Krajevoj Stancii zaschtschity rastenij 12: 1–47. [in Ukranian]

Dovnar-Zapolskij, D. P. 1931. [An overview of the sawflies (Chalastogastra) of the north Caucasus region.] Izvestija Severo-Kavkazkoj Krajevoj Stancii zaschtschity rastenij, Rostov/Don 6- 7: 33-62. [in Russian]

Dufour, L. 1854. Recherches anatomique sur les Hyménoptères de la famille des Urocerates. Annales des Sciences naturelles 4(1): 201–236.

Enslin, E. 1918. Die Tenthredinoidea Mitteleuropas VII. (Schulss). Deutche Entomologische Zeitschrift 7: 663–790.

Essig, E. O. 1926. Insects of Western North America. The MacMillan Company, New York. xii + 1035 pp.

Evenhuis, N. L. 1997.Litteratura taxonomica Dipterorum (1758–1930). Vol. 1 (A–K) Vol. 2 (L–Z). Backhuys Publishers, Leiden. vii+ 871 pp.

Eversmann. E. 1847. Fauna hymenopterologica volgo-uralensis exhibens Hymenopterorum species quas in provinciis Volgam fluvium inter et montes Uralenses sitis observavit et nunc descripsit. Bulletin de la Société Impériale des Naturalistes de Moscou 20(1): 3–68.

Fabricius, J. C. 1775.Systema entomologicae, sistens Insectorum Classes, Ordines, Genera, Species, adiectis Synonymis, Locis, Descriptionibus, Observationibus. Korte, Flensburgi et Lipsiae. 12 + 16 + 832 pp.

Fabricius, J. C. 1781.Species Insectorum exhibentes eorum Differentias specificas, Synonyma Auctorum, Loca natalia, Metamorphos, adiectis Observationibus, Descriptionibus. Tome 1. C. E. Bohnii, Hamburgi et Kilonii, viii + 552 pp.

Fabricius, J. C. 1787.Mantissa Insectorum sistens eorum Species nuper detectas adiectis Characteribus, Genericis, Differentiis specificis, Emendationibus, Observationibus. Tome I. C. G. Proft, Hafniae. 20+348 pp.

Fabricius, J. C. 1793.Entomologica systematica emendata et aucta. Secundum Classes, Ordines, Genera, Species adjectis Synonimis, Locis, Observationibus, Descriptionibus. Tome 2. C. G. Proft, Hafniae. viii + 519 pp.

Fabricius, J. C. 1804.Systema Piezatorum secundum Ordines, Genera, Species adiectis Synonymis, Locis, Observationibus, Descriptionibus. C. Reichard, Brunscigae. 30 + 440 pp.

Fernandez-Triana, J., Smith, M. A., Boudreault, C., Goulet, H., Hebert, P. D. N., Smith, A.C. and Roughley, R. 2011. A poorly known high-latitude parasitoid wasp community: Unexpected diversity and dramatic changes through time. PLoS One 6(8): e23719. doi:10.1371/journal.pone.0023719

Francke-Grossmann, H. 1954. Tierische Holzschädlinge, Holzwespen. Holz als Roh- und Werkstoff 12: 35–38.

Frison, T. H. 1927. List of the insect types in the collections of the Illinois State Natural History Survey and the University of Illinois. Bulletin of the Illinois State Laboratory of Natural History 16 (4): 137–309.

Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA Primers for amplification of mitochondrial cytochrome c oxidase subunit 1 from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.

Forsius, R. 1919. Verzeichnis der bisher aus dem Lojo-Gebiete bekannt gewordenen Tenthredinoiden nebst einer Übersicht sämmtlicher in Finland festgesteller Arten. Acta Societatis pro Fauna et Flora Fennica 46(4): 1–26.

Fukuda, H. and Hijii, N. 1997. Reproductive strategy of a woodwasp with no fungal symbionts, Xeris spectrum (Hymenoptera: Siricidae). Oecologia 112: 551–556.

Fueßlin, J. C. 1775. Verzeichnis der ihm bekannten Schweitzerischen Inseckten: mit einer ausgemahlten Kupfertafel: nebst der Ankündigung eines neuen Inseckten Werks. Vol. 1. Heinrich Steiner, Zürich and Winterthur. xii + 62 pp. + 1 plate.

Furniss, R. L. and Carolin, V. M. 1977. Western Forest Insects. U. S. Department of Agriculture, Forest Service. Miscellaneous Publication No. 1339. 654 pp.

Ghigi, A. 1905 (1904). Catalogo dei Tenthredinidi del Museo zoologico di Napoli con osservazioni critiche et sinonimiche. Napoli Annuario Museo Zoologia 1(2): 1–28.

Ghiliani, V. 1873. Ancora della Thalessa clavata edi un altro imenottero nuevo per la fauna entomologica del piemonte. Bollettino della Societa Entomologica Italiana 5: 237–243.

Gløwacki, J. 1956. Klucze do oznaczania owadow Polsky. Hymenoptera. Trzpiennikowate – Siricidae. (Keys for the identification of Polish insects. Siricidae.) Polsky Zwiazek Entomologiczny 24(2): 3–20.

Gmelin, J. F. 1790.Caroli a Linné, Systema naturae per Regna tria naturae secundum Classes, Ordines, Genera, Species, cum Caracteribus, Differentiis, Synonymis, Locis. Editio decima tertia, aucta, reformata. Tome I Pars V. G. E. Beer, Lipsiae. Pp. 2225–3020.

Gobbi, G. 1973. Reperti. Urocerus (=Sirex) gigas L. (Hym., Siricidae), Xeris spectrum L. (Hym., Siricidae), Rhyssa persuasoria (L.) (Hym., Ichneumonidae). Bollettino Associacione Romana di Entomologia 27: 31.

Goulet, H. 1986. The genera and species of the Nearctic Dolerini (Symphyta: Tenthredinidae: Selandriinae): classification and phylogeny. Memoirs of the Entomological Society of Canada 135: 1–208.

Göze, J. A. E. 1778.Abhandlungen zur Geschichte aus dem Französischen übersetzt und mit Anmerkungen herausgegeben. Erster Theil, G. N. Raspe, Nürenberg. xxiv + 152 + 124 + 100 + 146 pp. + 37 plates. [Translation into German of K. De Geer’s Mémoire pour server à l’histoire des insectes.]

Gregor, F. and Bata, L. 1940. Prodromus Hymenopterorum Patriae nostrae. Pars IV-VI (Symphyta, Tenthredinoidea). Acta Entomologica Musei Nationalis Prague 18: 201–240.

Griffini, A. 1895 (1894). Note sur la faune entomologique piémontaise. I. Siricidae du Piémont. Miscellanea Entomologica 12(2): 131–133.

Gusev, V. I. 1951. Key to the injuries of forest and ornamental trees and shrubs of the European part of the USSR. Moscow. 580 pp. [in Russian]

Gussakovskij, V. V. 1935. Insectes Hyménoptères. Tome II. Vol. 1. Chalastogastra. Part 1. Faune de l’URSS (Nouvelle série) 2(1). 453 pp.

Hadley, A. 2010. CombineZP. Available at
www.hadleyweb.pwp.blueyonder.co.uk [accessed January 10, 2010]

Hajibabaei, M., Janzen, D. H., Burns, J.M., Hallwachs, W. and Hebert, P.D.N. 2006. DNA barcodes distinguish species of tropical Lepidoptera. Proceedings of the National Academy of Science 103: 968–971.

Harrington, W. H. 1893. IX. – Canadian Uroceridae. Transactions of the Royal Entomological Society of Canada. Section IV: 131–153.

Hartig, T. 1837. Die Aderflügler Deutschlands mit besonderer Berücksichtigung ihres Larvenzustandes und ihres Wirkens in Wäldern und Gärten für Entomologen, Wald- und Gartenbesitzer. Band 1. Die Familien der Blattwespen und Holzwespen nebst einer allgemeinen Einleitung zur Naturgeschichte der Hymenopteren. Haude und Spenersche Buchhandlung, Berlin. 416 pp + 8 plates.

Hebert, P.D.N., Cywinska, A., Ball, S. L. and deWaard, J. R. 2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society London B 270: 313–321.

Hebert, P. D. N., Penton, E. H., Burns, J.M., Janzen, D. H. and Hallwachs, W. 2004. Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proceedings of the National Academy of Science 101: 14812–14817.

Hebert, P.D. N., Stoeckle, W., Zemlak, T S. and Francis, C. M. 2004A. Identification of birds through DNA barcodes. PLOS Biol 2 (10): e312.

Hedicke, H. 1930. Hautflügler, Hymenoptera. Abteilung, XI. Pp. 1–246 in Brohmer, P., Ehrman, P. und Ulmer, G (eds), Die Tierwelt Mitteleuropas. Ein Handbuch zu ihrer Bestimmung als Grundlage für faunistisch- zoogeographische Arbeiten. Band V. Insekten. Teil 2. Quelle and Mayer, Leipzig. 524 pp.

Hedicke, H. 1938. Sirecidae. in Hedicke, H. (ed), Hymenopterorum Catalogus, pars 6.W. Junk, 's-Gravenhage. 32 pp.

Hennig, W. 1966. Phylogenetics. University of Illinois Press, Urbana. 263 pp.

Hoebeke, E. R. 1980. Catalogue of the Hymenoptera Types in the Cornell University Collection. Part I: Symphyta and Apocrita (Parasitica). Cornell University Agricultural Experimental Station, Ithaca, New York, No. 9. 36 pp.

Hoebeke, E. R., Haugen, D. A. and Haack, R. A. 2005. Sirex noctilio: Discovery of a Palearctic siricid woodwasp in New York. Newsletter of the Michigan Entomological Society 50: 24–25.

Hogg, I. D. and Hebert, P.D. N. 2004. Biological identification of springtails (Collembola: Hexapoda) from the Canadian arctic, using mitochondrial DNA barcodes. Canadian Journal of Zoology 82: 1–6.

Hoop, M. 1968. Holsteinische Pflanzenwespen (Symphyta). Schriften des naturwissenschaftlichen Vereins für Schleswig-Holstein 38: 51–72.

Howard, L. O. 1901. The Insect Book. Doubleday and Page, New York. xxvii + 1 + 429 pp.

Huber, C. 1807. Vollständige Naturgeschichte aller in Deutschland einheimischen und einiger nationalisirten Bau- und Baumhӧlzer: in besonderer Hinsicht auf alle Fende und Hindernisse ihres Wachsthumes… ; nebst einem Nachtrage über das Kohlenwesen und mehrere auf Blättern der Bäume vorkommenden Gewächse; in II Bänden. 2: 150–399. Hauptverlag auf dem Rindermarkt, München.

Ionescu, V. 1954. Contributions à la connaissance des Tenthredinides (Insectes Hyménoptères) de la Republique Populaire Roumaine. Buletin Stiintific Academia Republicii Romane Bucharest (Biol) 6: 329–339.

Isaev, A. S., and Tarasova, D. A. 1965. Stem pests of Pinus sylvestris in the central Amur region. Pp. 5–19 in Konikov, A. S. (ed.), Investigation on Forest Protection in Siberia. Akademia Nauk Sibirskoe Otdelenie Institut Lesa I drevesiny. Izdatel’stvo ‘Nauka’, Moscow. 112 pp.

Iwata, K. 1958. The comparative anatomy of the ovary in Hymenoptera. Part II. Symphyta. Mushi 31: 47–60.

Jansson, A. 1939. Något om försommarens fjärillarver. Entomologbladet: popular bilaga till Entomologisk Tidskrift 3(1–4): 28–37.

Jurine, L. 1807. Nouvelle Méthode de classer les Hyménoptères et les Diptères. Genève et Paris, Vol. 4. J. J. Paschoud, Genève. 319 pp + 7 pl.

Kaltenbach, J. H. 1874. Die Pflanzenfeinde aus der Klasse der Insekten. Ein nach Pflanzenfamilien geordnetes Handbuch sämtlicher auf den einheimischen Pflanzen bisher beobachteten Insekten zum Gebrauch für Entomologen, Insektensammler, Botaniker, Land- und Forstwirthe und Gartenfreunde. Mit 402 charakteristischen Holzschnitt-Illustrationem der wichtigsten Pflanzenfamilien. J. Hoffman, Stuttgart. Pp. i–viii, 1–848.

Karsten, D. L. G. 1789: Museum Leskeanum, Regnum animale, quod ordine systematico. Leipzig, Erben L. G. Müller - 1 [44]+320+[I-III]+IV-XLIV+[XLV-XLVIII] p.

Kawall, J. H. 1864. Beiträge zur Kenntniss der Hymenopteren-Fauna Russland. Bulletin de la Société Impériale des Naturalistes de Moscou 37: 293–303.

Kiaer, H. 1896. Uebersicht der phytophagen Hymenopteren der arktischen Norwegens. Trømso Museums Aarshelter 19: 1–111.

Kiaer, H. 1902. Die arktischen Tenthrediniden. Band II, Lieferund 3. Pp. 403–438 in Römer, F. and Schaudinn, F. (eds). Fauna Arctica. G. Fischer, Jena.

Kim, C. W. 1963. Hymenoptera from Korea. The Humanities and Sciences (Natural Sciences), Korea University 6: 243–374.

Kim, C. W. 1970. Illustrated Encyclopedia of Fauna & Flora of Korea Vol. 11, Insecta III. The Ministry of Education, Korea. 873 pp.

Kirby, W. F. 1882. List of Hymenoptera with Descriptions and Figures of the typical Specimens in the British Museum. 1. Tenthredinidae and Siricidae. London, by Order of the Trustees, Vol. 1. Trustees, London. 450 pp.

Kirk, A. A. 1975. Siricid woodwasps and their associated parasitoids in the southwestern United States. Pan-Pacific Entomologist 51: 57–61.

Kirchner, L. 1854. Verzeichniss der in der Gegend von Kaplitz, Budweiser Kreises in Bӧhmen, vorkommenden Aderflügler. Verhandlungen Zoologisch-Botanischen Gesellschaft Wien 4: 285–316.

Kirchner, L. 1867. Catalogus Hymenopterorum Europae. Societas zoologico-botanicae, Vindebonus. 2 + 285 pp.

Kjellander, E. 1945. De svenska arterna av familjerna Xiphydriidae, Siricidae och Oryssidae (Hym.). Opuscula Entomologica 10: 1–16.

Klug, J. C. F. 1803. Monographia Siricum Germaniae atque Generum illis adnumeratorum, cum Tabulis aeneis coloratis VIII. I. F. Schüppel, Berolini. xii + 64 pp. + 8 plates.

Ko, J. H. 1969. List of Forest Insect Pests of Korea. Forest Research Institute, Seoul. 468 pp.

Kôno, H., and Sugihara, Y. 1939. A list of the food-plants of Siricidae and Xiphydriidae. Insecta Matsumurana 13: 108–109.

Konow, F. W. 1896. Verschiedenes aus der Hymenopteren-gruppe der Tenthrediniden. Wiener Entomologische Zeitung 15: 41–59.

Konow, F. W. 1898a. Systematische und kritische Bearbeitung der Siriciden–tribus Siricini. Wiener Entomologische Zeitung 17: 73–91.

Konow, F. W. 1898b. Nuer Beitrag zur Synonymie der Chalastogastra. Entomologische Nachrichten 24: 224–245.

Konow, F. W. 1905a. Fam. Siricidae. in Wytsman, P. (ed.), Genera Insectorum, Fascicle 28. L. Desmet-Verteneuil, Bruxelles. 14 pp.

Konow, F. W. 1905b. Systematische Zusammenstellung der bisher bekannt gewordenen Chalastrogastra (Hym.). 2 Fam Siricidae Knw. Zeitschrift für Systematische Hymenopterologie und Dipterologie 5: 33–64, 97–128, 177–200.

Kontuniemi, T. 1960. Die Futterpflanzen der Sägenwespen Larven (Hymenoptera Symphyta). Suomen Elaïmet . Porvoo, Helsinki. 104 pp.

Koornneef, T. 1925. Losse Aanteeekeningen over Hymenoptera. Entomologische Berichten Amsterdam 6: 357–365.

Koutroumpa F.A., Lieutier, F. and Roux-Marabito, G. 2009. Incorporation of mitochondrial fragments in the nuclear genome (Numts) of the longhorned beetle Monochamus galloprovincialis (Coleoptera, Cerambycidae) Journal of Zoological Systematics and Evolutionary Research 47: 141–148.

Krivolutskaya, G. O. and Stroganova, V. K. 1966. The horntail fauna (Hymenoptera, Siricoidea) of the Kuril Islands. Pp. 50–62 in The Entomofauna of the Forests of the Kuril Islands, Kamchatka, and Magadanskaya Oblast. Akademia nauk SSSR Sibirskoe oddelenie. Moscow. 138 pp. [in Russian]

Lamarck, J. B. A. P. 1817. Histoire Naturelle des Animaux sans Vertèbres, présentant les Caractères généraux et particuliers de ces Animaux, leur Distribution, leurs Classes, leurs Familles, leurs Genres, et la Citation des principales Espèces qui s’y apportent; précédée d’une Introduction offrant la Détermination des Caractères essentiels de l’Animal, sa Distinction du V égétal et des autres Corps naturels; enfin, l’Exposition des Principes fondamentaux de la Zoologie. Tome 4ième. Verdière, Paris. 603 pp.

Lamarck, J. B. A. P. 1835. Histoire naturelle des Animaux sans Vertèbres. J. B. Baillière, Paris. 787 pp.

Latreille, P. A. 1805. Histoire naturelle générale et particulière des Crustacés et Insectes. Tome 13. F. Dufart, Paris. 432 pp.

Latreille, P. A. 1807 Genera Crustaceorum et Insectorum secunda Ordinem naturalem in Familias dispositas, Iconibus Examplisque plurimis explacata. A. Konig, Parisii et Argentorati. 258 + 1 pp.

Leach, W. 1830. Family II. Xiphydrida. P. 141 in Brewster, D (ed.), Edinburgh Encyclopedia. Vol IX. Entomology. Edinburg. Pp. 57–172.

Leonardi, G. 1927. Elenco delle Specie di Insetti dannosi e Loro parassiti ricordati in Italia fino all’anno 1911 Vol.2. (Opera postuma publiccata per cura del Prof. F. Silvestri). Tip. E. Della Torre, Portici,. 592 pp.

Lepeletier, A. L. M. 1828. SIREX, Sirex. Pp. 438. UROCĖERE, Urocerus. P. 769 in Latreille, P. A., Lepeletier, A. L. M., Audinet-Servelle, J. G. and Guérin-Méneville, F. E. (eds), Encyclopédie méthodique, ou par Ordre de Matières; par une Société de Gens de Lettres, de Savans et d’Artistes ; précédée d’un Vocabulaire universel, servant de Table pour tout l’Ouvrage, ornée des Portraits de Mm. Diderot & d’Alambert, premiers Editeurs de l’Encyclopédie. Histoire naturelle, Entomologie, ou Histoire naturelle des Crustacés, des Arachnides et des Insectes. Tome dixième. Livraison 96. Agasse, Paris. Pp. 345–832.

Linnaeus, C. 1758. Systema naturae, per Regna tria naturae secundum Classes, Ordines, Genera, Species cum Characteribus differentiis, Synonymis, Locis. 10th Edition. Vol. 1. L. Salvius, Holmiae. 824 pp.

Linnaeus, C. 1761. Fauna Svecica sistens animalia Sveciae Regni: Mammalia, Aves, Amphibia, Pisces, Insecta, Vermes. Ed. 2. L. Salvius, Holmiae. 578 pp.

Linnaeus, C. 1767. Systema naturae per Tegna tria naturae, secundum Casses, Ordines, Genera, Species cum Characteribus differentiis, Synonymis, Locis. Editio Duodecima Reformata (12 ed.) Tom I. Pars II. L. Salvius, Holmiae. Pp. 533–1328 + 34 pp. + 2 pp.

Linnen, C.R. and Farrell, B. D. 2007. Mitonuclear discordance is caused by rampant mitochondrial introgression in Neodiprion (Hymenoptera: Diprionidae) sawflies. Evolution 61: 1417–1438.

Linnen, C. R. and Farrell, B.D. 2008. Phylogenetic analysis of nuclear and mitochondrial genes reveals evolutionary relationships and mitochondrial introgression in the sertifer species group of the genus Neodiprion (Hymenoptera: Diprionidae ). Molecular Phylogenetics and Evolution 48: 240–257.

Lopez, J.V., Yuhki, N., Masuda, R., Modi, W. and Obrien, S. J. 1994. Numt, a recent transfer and tandem amplification of Mitochondrial DNA to the nuclear genome of the domestic cat. Journal of Molecular Evolution 39: 174-190.

Lozovoy, D. I. 1941. Contributions to the study of injurious entomofauna in the forest of Georgia. Akademia Nauk SSSR, Gruzinskii Filial, Trudy Zoologiskogo Sektora 3: 191–207. [in Russian]

Ludvig, C. F. 1799. Erste Aufzählung der bis jetzt in Sachsen entdeckten Insekten. C. Gottlieb Rabenhorst, Leipzig. viii + 66 pp.

Maa, T. 1949. A synopsis of Asiatic Siricoidea with notes on certain exotic and fossil forms (Hymenoptera Symphyta). Musée Heude, Notes d’Entomologie Chinoise 13: 11–189.

Maa, T. 1950. New or little known Chinese sawflies and woodwasps (Hymenoptera). Quarterly Journal of the Taiwan Museum 3(1): 14–21.

MacGillivray, A. D. 1893. Washington Tenthredinidae and Uroceridae. The Canadian Entomologist 25: 237–244.

MacGillivray, A. D. 1916. Tenthredinoidea. Pp. 25–175 in Viereck, H. L. (ed.), Hymenoptera of Connecticut. Part III. The Hymenoptera, or wasp-like insects, of Connecticut. Connecticut Geological Natural History Survey Bulletin 22. 824 pp.

Magretti, P. 1882. Imenotteri della lombardia. Memoria II. Bollettino della Società Entomologica Italiana 14: 269–301.

Maidl, P. 1923. Beiträge zur Hymenopterenfauna Dalmatiens, Montenegros und Albaniens. Annalen des Naturhistorichen Museums in Wien 36: 25–35.

Malaise, R. and Benson, R. B. 1934. The Linnean types of sawflies (Hymenoptera Symphyta). Arkiv für Zoologi 26(4[20A]): 1–14.

Maréchal, P. 1935. Insectes intéressants récoltés par le “Cercle des entomologistes liégeois". Lambillionea 35: 55–58.

Middlekauff, W. W. 1960. The siricid wood wasps of California (Hymenoptera: Siricidae). Bulletin of the California Insect Survey 6(4): 59–77.

Midtgaard, F. 1988. The Norwegian Siricoidea. Fauna norvergica Series B 35: 53–60.

Minamikawa, J. 1969. Host records of Ichneumonidae (Hymenoptera). Kontyû 37(2): 220–232.

Miyatake, M. 1950. A contribution to the Siricoidea of Shikoku (Hymenoptera). Transactions of the Shikoku Entomological Society 1: 38–39.

Móczár, L., and Zombori, L. 1973. Leveldarazs - alkatnak 1. - Tenthredinoidea 1. Fauna Hungariae 111: 1–128.

Mocsáry, A. 1878. Data ad faunam hymenopterologicam Sibiriae. Tidschrift voor Entomologie 21: 198–200.

Mocsáry, S. 1886a. A magyarországi fa-rontó darázsok. III. III. A Siricinae alcsalád. Rovartani Lapok 3: 9–13.

Mocsáry, S. 1886b. A magyarországi fa-rontó darázsok. I. Rovartani Lapok 3: 67–73.

Morris, E. V.1967. Distribution and hosts of some horntails (Siricidae) in British Columbia. Journal of the Entomological Society of British Columbia 64: 60–63.

Müller, O. F. 1764. Fauna Insectorum fridrichsdalina sive methodica Descriptio Insectorum agri Fridrichsdalensis, cum Characteribus genericis et specificis, Nominibus trivialibus, Locis natalibus, Iconibus allegatis, novisque pluribus Speciebus additis. I. F. Gleditschii, Hafniae et Lipsiae. xxiv + 96 pp.

Müller, O. F. 1776. Zoologiae Danicae Prodomus, seu Animalium Daniae et Norvigiae indigenarum Characteres, Nomina, et Synonyma imprimis popularium. Hallageriis, Havniae. 32 + 282 pp.

Müller, P. L. S. 1775. Des Ritters Carl von Linné vollständiges Natursystem, nach der zwoelften lateinischen Ausgabe und nach Antleitung des holländischen Houttynischen Werks, mit einer ausführlichen Erklärung ausgefertigt. Fuenfter Teil. Von den Insecten. Zweyter Band. G. N. Raspe, Nürnberg. [14] pp. + pp. 761–1066.

Müller, A. 1920: Zur Kenntnis der siebenbürgischen Blattwespen (Tenthredinoidea). Verhandlungen und Mitteilungen des siebenbürgischen Vereins für Naturwissenschaften zu Hermannstadt 70: 1-21.

Nielson, J. C. and Henriksen, K. 1915. Trae- og Blad-hvepse (Hymenoptera phytophaga). Danmarks Fauna 18: 1–232.

Norton, E. 1869. Catalogue of the described Tenthredinidae and Uroceridae of North America. Transactions of the American Entomological Society 2: 211–242, 321–368.

Obarski, J. 1931. Beitrag zur Tenthredinoiden-Fauna (Hymen.) von Polen. Polskie Pismo Entomologiczne 10: 40–50.

Obarski, J. 1931. Materjalis do fauny rósliniarek (Tenthredinoidea, Hymenoptera) Polski II. Beitrag zu Polens Tenthredinoiden Fauna II. Fragmenta Faunisitca Zoologici Polonici 1(13): 362–370.

Obrtel, R. 1948. Contribution to the knowledge of Tenthredinoidea and parasitic Hymenoptera. Acta Universitatis Agriculturae et Silviculturae Brno D 35: 1–19.

Okutani, T. 1963. Description of the larvae of horntails. Science Reports of the Hyogo University of Agriculture. Series Agriculture Biology 6(1): 23–27.

Okutani, T. 1965. A list of horntails found on imported logs. Akitu 12: 30–32.

Okutani, T. 1967. Food plants of Japanese Symphyta (1). Japanese Journal of Applied Entomology and Zoology 11: 43–49.

Pamilo, P., Viljakainen, L. and Vihaiven, A. 2007. Exceptionally high density of NUMT’s in the honey bee genome. Molecular Biology and Evolution 24: 1340–1346.

Panzer, G. W. F. 1798. Faunae Insectorum Germanicae, initia oder Deutschlands Insecten. Hefte 109. Felsecker, Nürnberg. Pages

Panzer, G. W. F. 1806. Kritische Revision der Insekfaune Deutschlands nach dem System bearbeitet. Entomologischer Versuch die Jürineschen Gattungen der Linnéschen Hymenoptern nach dem Fabriziusschen System zu prüfen: im Besug auf die in der deutschen Insektenfaune bekannt gemachten Gattungen und Arten dieser Klasse. I – C Heft. II Bändchen mit zwey illuminirten Kupfertafeln. Vol 2. Felsecker, Nürnberg. 17 + 271 pp.

Precupetu A. and Negru, St. 1961. Contribution to the knowledge of the woodwasps (Hymenoptera, Siricidae) of the Romanian People’s Republic fauna. Revista de Biologia, Bucharest 6(1): 81–89.

Provancher, L. 1878. Faune canadienne. Les insectes – Hyménoptères. Le Naturaliste Canadien 10(8): 225–238.

Provancher, L. 1883. Petite Faune entomologique du Canada et particulièrement de la Province de Québec. Vol 2 comprenant les Orthoptères, les Neuroptères et les Hyménoptères. C. Darveau, Québec. 830 pp.

Pruja, P. J. 1959. Note sur deux Siricidae des sapinières du Rif occidental. Bulletin de la Société des Sciences Naturelles et Physiques du Maroc 39: 203–204.

Ratzeburg, J. T. C. 1844. Die Forst-Insecten, oder Abbildung und Beschreibung der in den Wälden Preussens und der Nachbarstaaten als schädlich oder nützlich bekannt gewordenen Insecten; In systematischer Folge und mit besonderer Rücksicht auf die Vertilgung der Schädlichen. Dritter Theil. Die Ader-, Zwei-, Halb-, Netz- und Geradflügler. Nicolai'sche Buchhandlung, Berlin. viii + 314 + 5 pp.

Ratzeburg, J. T. C. 1863. C. Uber flügler. Pp. 187–193 in Srunert, J. Th. (ed.), Forstliche Blätter. Zeitschrift für forst- und Jagdwesen 5. Berlin, J. Springer.

Ratzeburg, J. T. C. 1866. Die Waldverderbniss, oder dauernder Schade, welcher durch Insecktenfrass, Schälen, Schlagen und Verbeissen an lebenden Waldbäumen entsteht, etc. Volume 1. Nicolai, Berlin. 298 pp.

Reichert, A. 1933. Die Tenthredinoidea von Leipzig und Umgegend. Sitzungsberichte der Naturforschenden Gesellschaft zu Leipzig 59:37–74.

Retzius, A. J. 1783. Genera et Species Insectorum e generossimi Auctoris scriptis extraxtit, digessit, latine quoad partem reddidit, et Terminologiam Insectorum Linneanam addidit. S. L. Crusium, Lipsiae. vi + 7–220 pp.

Ries, D. T. 1951. Siricoidea. Pp. 82–86 in Muesebeck C. F. W., Krombein K. V., and Townes H. K. (eds), Hymenoptera of America North of Mexico. Synoptic Catalog. United States Department of Agriculture, Agriculture Monograph No. 2. 1420 pp.

Roberti, D., Frilli, F. and Pizzaghi, W. 1965. Contributo alla conoscenza dell'entomofauna del Piacentino (Specie raccolte nel decennio 1955-1964). Entomologica Bari 1: 1–118.

Rohwer, S. A. 1912. The sawflies (Chalastogastra) of Boulder County, Colorado. University of Colorado Studies 9(2–3): 96.

Ross, H. H. 1937. A generic classification of the Nearctic sawflies (Hymenoptera: Symphyta). Illinois Biological Monograph 15: 1–173.

Rubinoff, D., Cameron, S. and Will, K. 2006. A genomic perspective on the shortcomings of Mitochondrial DNA for “Barcoding” Identification. Journal of Heredity 97: 581–594.

Rudow, F. 1909 Lebensweise der Holzwespen, Siricidae. Internationale Entomologische Zeitschrift 3: 135–136.

Saini, M.S. 2009. Indian sawflies. Biodiversity, Keys, Catalogue & Illustrations. (Vol. VI) Families Argidae, Cimbicidae, Diprionidae, Pamphiliidae, Siricidae, Xiphydriidae and Orussidae. Bishen Singh Mahendra Pal Singh, Dehra Dun, India. 168 pp.

Saini, M. S., Blank, S. M. and Smith, D. R. 2006. Checklist of the sawflies from India (Hymenoptera: Symphyta). Pp. 575–612 in Blank, S. M., Schmidt, S. and Taeger, A. (eds), Recent Sawfly Research: Synthesis and Prospects. Goecke and Evers, Keltern. 704 pp.

Saini, M. S. and Singh, D. 1987. A new genus and a new species of Siricinae (Insecta, Hymenoptera, Siricidae) from India with a revised key to its world genera. Zoologica Scripta 16: 177–180.

Saitou, N. and Nei, M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Evolution Biology and Evolution 4: 406–425.

Schedl, W. von. 1972. Die Pflanzenwespen (Hymenoptera, Symphyta) des Landesmuseums Joanneum in Graz. Teil I: Megalodontoidea, Siricoidea, Orussoidea und Cephoidea). Mitteilungen der Abteilung für Zoologie am Landesmuseum Joanneum 1(3): 95–110.

Schedl, W. 1980. Catalogus Faunae Austriae. Ein systematisches Verzeichniss aller auf österreichischem Gebiet festgestellten Tierarten. Teil XVIa : U.-Ordn. : Symphyta. Verlag der Österreichischen Akademie der Wissenschaften, Wien. 16 pp.

Scheidter, F. 1923. Zur Lebensweise unserer Holzwespen. Zeitschrift für Schädlingsbekämpfung Berlin 1: 89–98.

Schiff, N. M., Valley, S. A., LaBonte, J. R. and Smith, D. R. 2006. Guide to the siricid woodwasps of North America. United States Department of Agriculture, Forest Service, Forest Health Technology Enterprise Team, Morgantown, West Virginia, FHTET–2006–15. 102 pp. Available on line at http://www.aphis.usda.gov/plant_health/plant_pest_info/sirex/downloads/guidesiricidwoodwasps.pdf [accessed January 10, 2011]

Schiff, N. M., Goulet, H., Smith, D. R., Boudreault, C., Wilson, A. D., and Scheffler, B. E. 2012. Siricidae (Hymenoptera: Symphyta: Siricoidea) of the Western Hemisphere. Canadian Journal of Arthropod Identification 21: 305 pp. (PDF version).
Published on 6 July, 2012. Available online at http://www.biology.ualberta.ca/bsc/ejournal/sgsbws_21/sgsbws_21.html.
doi: 10.3752/cjai.2012.21.

Schimitschek, E. 1968. Ursachen der Befallisbereitschaft für Holzwespen, Ausmass der Schäden und Vorbeugungsmassnahmen. Zeitschrift für Angewandte Entomologie 61: 45–60.

Schimitschek, E. 1974. Beiträge zur Ökologie von Nadelbaum- und Laubbaum- Holzwespen (Hymenoptera: Siricidae). Zeitschrift für Angewandte Entomologie 75(3): 225–247.

Schmiedeknecht, O. 1907. Die Hymenopteren Mittleleuropas nach ihren Gattungen und zum grossen Teil auch nach ihren Arten analytisch Bearbeitet. G. Fischer, Jena. 804 pp.

Schmiedeknecht, O. 1930. Die Hymenopteren Nord- und Mittleleuropas mit Einschluss von England, Südschweiz, Südtirol und Ungarn nach ihren Gattungen und zum grossen Teil auch nach ihren Arten analytisch Bearbeitet. Zweize, gänzlich umgearbeitete auflage. G. Fischer, Jena. 1062 pp.

Scobiola-Palade, X. 1968. Contributions à l'étude des hyménoptères de la région sudique de la Valachie. Travaux du Muséum d'Histoire Naturelle Grigoria Antipa 9: 369–393.

Scobiola-Palade, X. and Istrate, G. 1972. Hymenoptera (Symphyta) din Jud. Suceava. Studii si Communicari de Ocrotirea Naturii, Suceava-RSR 3: 279–288.

Scopoli, J. A. 1763. Entomologia Carniolica exhibens Insecta Carnioliae indigena et distribute in Ordines, Genera, Species Varietates. Methodo Linnaeana. I. T. Trattmer, Vindobonae. 30 + 420 + 1 pp.

Shrank, F. von. 1802. Fauna Boica. Durchgedachte Geschichte der Baiern einheimischen und zahmen Thiere. Zweite Band. Zweite Abtheilung. P. W. Krüll, Ingolstadt. 412 pp.

Siebke, H. 1880. Catalogum Hymenopterorum Continenten. in Siebke, H. (ed.), Enumeratio Insectorum Norvegicorum. Vol. 5. Part 1. A. W. Broegger, Christania (Olso). 95 pp.

Siebold, C. T. E. von 1844: Beiträge zur Fauna der wirbellosen Thiere Preußens. Neunter Beitrag: Preußische Blatt-Wespen, Holz-Wespen und Gall-Wespen nebst Nachtrag zu den Grab-Wespen. Archiv für vaterländische Interessen oder Preußische Provinzial-Blätter 31 (2): 121-133.

Smetana, A. and Herman, l. 2001 Brief history of taxonomic studies of the Staphylinidae including biographical sketches of the investigators. Pp. 17–159 in Herman, L. (ed.), Catalog of the Staphylinidae (Insecta: Coleoptera), 1758 to the end of the second millennium. I. Introduction, history, biographical sketches, and omaliine group. Bulletin of the American Museum of Natural History No 265. vi + 649 pp.

Smith, D. R. 1978. Suborder Symphyta (Xyelidae, Parachexyelidae, Parapamphiliidae, Xyelydidae, Karatavitidae, Gigasiricidae, Sepulcidae, Pseudosiricidae, Anaxyelidae, Siricidae, Xiphydriidae, Paroryssidae, Xyelotomidae, Blasticotomidae, Pergidae). In van der Vecht, J. and R. D. Shenefelt, (eds), Hymenopterorum Catalogus, pars 14. W. Junk, The Hague. 193 pp.

Smith, D. R. 1979. Symphyta. Pp. 3–132 in Krombein, K. V., Hurd, Jr. P. D., Smith, D. R. and Burks, B. D. (eds), Catalog of Hymenoptera in America North of Mexico, Vol. 1. Smithsonian Institution Press, Washington, DC. 1198 pp.

Smith, D.R. 1982. List of Symphyta (Hymenoptera) of Israel, with description of four new species. Israel Journal of Entomology 16: 1–25.

Smith, D. R. 1988. A synopsis of the sawflies (Hymenoptera: Symphyta) of America south of the United States: Introduction, Xyelidae, Pamphiliidae, Cimbicidae, Diprionidae, Xiphydriidae, Siricidae, Orussidae, Cephidae. Systematic Entomology 13: 205–261.

Smith, D. R. and Schiff, N. M. 2002. A review of the siricid woodwasps and their ibaliid parasitoids (Hymenoptera: Siricidae, Ibaliidae) in the eastern United States, with emphasis on the mid–Atlantic region. Proceedings of the Entomological Society of Washington 104: 174–194.

Smith, M. A., Woodley, N. E., Janzen, D. H., Hallwachs, W. and Hebert, P.D.N. 2006. DNA barcodes reveal cryptic host-specificity within the presumed polyphagous members of a genus of parasitoid flies (Diptera: Tachinidae). Proceedings of the National Academy of Science 103: 3657–3662.

Smith, M.A., Bertrand, C., Crosby, K., Eveleigh, E. S., Fernandez-Triana, J., Fisher, B. L., Gibbs, J., Hajibabaei, M., Hallwachs, W., Hind, K., Hrcek, J., Huang, D., Janda, M., Jansen, D. H., Li, Y., Miller, S. C., Packer, L., Quicke, D., Ratnasingham, S., Rodriguez, J., Rougerie, R., Shaw, M. R., Sheffield, C., Stahlhut, J. K., Steinke, D., Whitfield, J., Wood, M. and Zhou, X. 2012. Wohlbachia and DNA barcoding insects: Patterns, Potential and Problems. PLoS ONE 7(5): e36514. Doi:10.1371/journal.pone.0036514.

Song, H., Buhay, J. E., Whiting, M. F. and Crandall, K. A. 2008. Many species in one: DNA barcoding overestimates the number of species when nuclear mitochondrial pseudogenes are coamplified. Proceedings of the National Academy of Science 105: 13486–13491.

Spradbery, J. P. 1969. The biology of Pseudorhyssa sternata Merrill (Hym, Ichneumonidae), a cleptoparasite of siricid woodwasps. Bulletin of Entomological Research 59: 290–297.

Spradbery, J. P. 1970. Host finding by Rhyssa persuasoria (L.) and ichneumonid parasite of siricid woodwasps. Animal behaviour 18(1): 103–114.

Spradbery, J. P. and Kirk, A. A. 1978. Aspects of the ecology of siricid woodwasps (Hymenoptera: Siricidae) in Europe, North Africa and Turkey with special reference to the biological control of Sirex noctilio F. in Australia. Bulletin of Entomological Research 68: 341–359.

Steck. T. 1893. Beiträge zur Kenntnis der Hymenopterenfauna der Schweiz. Mitteilungen der Schweizerischen Entomologischen Gesellschaft 9: 1–45.

Stephens, J. F. 1835.Illustrations of British Entomology; or a Synopsis of indigenous Insects: containing their generic and specific Distinctions; with an Account of their Metamorphosis, Times of appearance, Localities, Food, and Economy, as far as practicable. Mandibulata. Vol VII. Baldwin and Cradock, London. 2 + 310 pp.

Stillwell, M. A. 1960. Decay associated with woodwasps in balsam fir weakened by insect attacks. Forest Science 6(3): 225–229.

Stillwell, M. A. 1966. Woodwasps (Siricidae) in conifers and the associated fungus, Stereum chailletii in eastern Canada. Forest Science 12: 121–128.

Strand, E. 1898. Enumeratio Hymenopterorum Norvegicorum. Entomologisk Tidskrift 19: 71–112.

Strobl, G. 1895. Beiträge zur geographischen Verbreitung der Tenthrediniden. Wiener Entomologische Zeitung 14: 277–279.

Stroganova, V. K. 1963. Horntail of western Siberia<. Pp. 24–41 in Cherepanov, A. J., (ed.), Fauna, Taxonomy and Ecology of Insects and Mites. Academy of sciences of the USSR, Siberian Branch, Proceeding of the Biological Institute, Issue 10. [in Russian]

Stroganova, V. K. 1968. The horntail Wasps of Siberia. Izdatelstvo Nauka, Novosibirsk. 148 pp. [in Russian]

Stroganova, V. K. 1976. Materials on the fauna of sawflies of the plains of western Siberia. Trudy biologischeskogo Institut sibirskogo Otdelentia Akademiia Nauk SSSR 18: 257–271. [in Russian]

Strøm, H. 1788. Beskrivelse over Norske Insecter, femte Stykke. Nye Samling af det Kongelige Danske Videnskabers Selskabs skrifter 3: 264–300.

Taeger, A., Altenhoffer, E., Blank, S. M. Jensen, E., Kraus, M., Pschorn-Walcher, H. and Ritzau, C. 1998. Kommentare zur Biologie, Verbreitung und Gefährdung der Pflanzenwespen Deutschlands (Hymenoptera, Symphyta). Pp. 49–136 in Taeger, A. and Blank, S. M. (eds.), Pflanzenwespen Seutschlands (Hymenoptera Symphyta). Goeke and Evers. Keltern. 364 pp. + 8 plates.

Taeger, A., and Blank, S. M. 2006. Bibliographic notes. Pp. 319–330 in Blank, S. M., Schmidt, S. and Taeger, A. (eds), Recent Sawflies Research: Synthesis and Prospects. Goecke and Evers, Keltern. 704 pp.

Taeger, A. and Blank, S. M. 2011. ECatSym – Electronic World Catalog of Symphyta (Insecta, Hymenoptera). Program version 3.10 (07.12.2011) – Digital Entomological Information, Müncheberg. http://www.sdei.de/ecatsym/index.html [accessed in December 2012]

Taeger, A., Blank, S. M. and Liston, A. D. 2006. European sawflies (Hymenoptera: Symphyta) – A species checklist for the countries. Pp. 399–504 in Blank, S. M., Schmid, S. and Taeger, A. (eds), Recent Sawflies Research: Synthesis and Prospects. Goecke and Evers, Keltern. 704 pp.

Taeger, A., Blank, S. M. and Liston, A. D. 2010. World Catalog of Symphyta (Hymenoptera). Zootaxa 2580: 1–1064.

Takeuchi, K. 1936. Tenthredinoidea of Saghalien (Hymenoptera). Tenthredo 1: 53–108.

Takeuchi, K. 1938. A systematic study on the suborder Symphyta (Hymenoptera) of the Japanese Empire (I). Tenthredo 2(2): 174–229.

Takeuchi, K. 1949. A list of the food-plants of Japanese sawflies. The Transactions of the Kansai Entomological Society 14: 47–50.

Takeuchi, K. 1955. Siricidae of Japan (Hymenoptera). Akitu 4(1): 1–9.

Takeuchi, K. 1962. Hymenoptera: Siricidae. Insecta Japonica 2(4): 1–12 + 2 pp.

Taschenberg, E. L. 1866. Die Hymenopteren Deutschlands nach ihren Gattungen und theilweise nach ihren Arten als Wegweiser für angehende Hymenopterologen und gleichzeitig als Verzeichniss der Halle’schen Hymenopterenfauna. E. Kummer, Leipzig. vi + 277 pp.

Tassi, F. 1966. Reperti 1. Urocerus gigas L. (Hymenoptera Siricidae). Bollettino dell'Associazione Romana di Entomologia 21(3): 47.

Taylor, J. S. 1962. Sirex noctilio F., a recent introduction in South Africa. Entomologist’s Record and Journal of Variation 74: 273.

Thomson, C. G. 1871. Hymenoptera Scandinaviae, Tom. 1. , (Tenthredo et Sirex). H. Ohlson, Lundae. 342 pp.

Thunberg, C. P. 1788. D. D. Museum Naturalium Academiae Upsaliensis. Pars 6. J. Edman, Upsaliae. i–iv + 69–84 pp. + 1 plate.

Togashi, I. 1965a. Preliminary report on the rectal papillae of the Symphyta (Hymenoptera). Kontyû 33: 230–234.

Togashi, I., 1965b Symphyta. Pp. 243–254 in Yasumatsu, K. Inoue, H. and Nakane, T.(eds), Iconographia Insectorum Japonicorum, Colore natutali edita, Vol. 3. Hokuryukan, Tokyo. 358 pp. [in Japanese]

Togashi, I. 1972. Sawflies of Mt. Hiko, Kyushu (Hym., Symphyta). Mushi 46: 53–64.

Togashi, I. 1973. Tenthredinoidea of Korea collected by Prof. K. Tsuneki in 1941-43 (Hym.). Life Study 17(3–4): 103–112.

Torka, V. 1926. Beobachtungen über die Eiablage von Sirex spectrum L. und den Schmarotzer Rhyssa persuasoria L. Anzeiger für Schädlingskunde 2: 166.

Townes H. K. 1944. A catalogue and reclassification of the Nearctic Ichneumonidae (Hymenoptera). Part I. The subfamilies Ichneumoninae, Tryphoninae, Cryptinae, Phaeogeninae and Lissonotinae. Memoirs of the American Entomological Society 11: 1–77.

Tsinovskii, I. P. 1953. Insects of Latvian SSSR. Horntail and Sawflies. Akademiia Nauk Latvilskoy SSR, Institut Biologii, Riga. 209 pp.

Turton, W. 1806.A general System of Nature through the three grand Kingdoms of Animals, Vegetables, and Minerals Systematically divided into their several Classes, Orders, Genera, Species, and Varieties, with their Habitations, Manners, Economy, Structure, and Pecularities. Animal Kingdom – Vol III. Insects – Part II. Lackington, Allan & Co., London. 784 pp.

Vasu, V. and Saini, M. S. 1999. Taxonomic studies on the species of Xeris (Hymenoptera: Symphyta: Siricidae) from India. Polskie Pismo Entomologiczne 68: 273–282.

Viedma, M. G. de and Suárez, F. J. 1961. Un nuevo Xeris de Marruecos (Hym. Siricidae). Graellsia 19: 19–27.

Viitasaari, M. 1984. Sahapistiäiset 3. Siricoidea, Orussoidea, ja Cephoidea, University of Helsinki, Department of Agricultural and Forest Zoology Reports 6. 66 pp.

Villers, C. J. de. 1789. Caroli Linnaei Entomologia, Faunae Suecicae Descriptionibus Aucta; DD. Scopoli, Geoffroy, de Geer, Fabricii, Schrank, &c. Speciebus vel in Systemate non enumerates, vel nuperrime detectis, vel Speciebus Galliae Australis locupletata, Generu Specierumque rariorum Iconibus ornata; curante & augente Carolo de Villers, Acad. Lugd. Massil. Villa-Fr. Rhotom. necnon Geometriae Regio Professore. Tomus Tertius. Piestre et Delamolliere, Lugdini. xxiv + 657 pp., plates 7–10.

Vité, J. P. 1952. Die holzzerstörenden Insekten Mitteleuropas. "Musterschmidt", Wissenschaftlicher Verlag Textband, Göttingen. 155 pp.

Walckener, C. A. 1802. Faune Parisienne. Insectes, ou Histoire abrégée des Insectes des Environs de Paris, classés d’après le Système de Fabricius; précédée d’une Discours sur les Insectes en général, pour servir d’Introduction à l’Etude de l’Entomologie. Volume 2. Dentu, Paris. xxii + 438 + [2] pp.

Walker F. 1873a. On some Amurland insects (Part IV). The Entomologist 6: 359.

Walker, F. 1873b. On the geographical distribution of some genera of Canadian insects. The Canadian Entomologist 5: 77–78.

Ward, R.D., Zemlak, T. S., Innes, B. H., Last, P.R. and Hebert, P. D. N. 2005. DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society B 360: 1847–1859.

Webb, D. W. 1980. Primary insect types in the Illinois Natural History Survey Collection, Exclusive of the Collembola and Thysanoptera. Illinois Natural History Survey Bulletin 32(2): 55–191.

Wei, M., Nie, H. and Taeger, A. 2006. Sawflies (Hymenoptera: Symphyta) of China – Checklist and review of research. Pp. 505–574 in Blank, S. M., Schmidt, S. and Taeger, A. (eds), Recent Sawfly Research: Synthesis and Prospects. Goecke and Evers, Keltern. 704 pp.

Weiffenbach, H. 1967. Über wenig bekannte oder bemerkenswerten Blattwespen aus Nord- und Mittelhessen. Entomologische Zeitschrift 77(8): 97–107.

Westcott, R. L. 1971. New host and distribution records for three western wood–boring Hymenoptera (Syntexidae, Siricidae). Pan-Pacific Entomologist 47: 310.

Westwood, J. O. 1874. Thesaurus entomologicus Oxoniensis; or, Illustrations of new, rare, and interesting Insects, for the most part contained in the Collection presented to the University of Oxford by the Rev. F. W. Hope, M.A., D.C.L., F.R.S., &c. Clarendon Press, Oxford. xxiv + 205 pp. + 40 plates.

Whitworth , T.L., Dawson, R.D., Magalon, H. and Baudry, E. 2007. DNA barcoding cannot reliably identify species of the blowfly genus Protocalliphora (Diptera: Calliphoridae). Proceedings of the Royal Society B 274: 1731–1739.

Wolf, F. 1968. Ethologie des Siricidae (Hymenoptera Symphyta). Bulletin et Annales de la Société Royale Entomologique de Belgique 104: 427–457.

Wolf, F. 1969a. Les Siricides en Belgique, leurs moeurs et leur importance en sylviculture. Bulletin de la Société Royale Forestière de Belgique. 39 pp.

Xiao, G. 1982. Hymenoptera : Siricidae. Pp. 349–350 in, Insects of Xizank, Vol 2.

Xiao, G. 2006. Suborder Chalastogastra (Symphyta). Pp. 187–200 in Hua, L. (Ed.), List of Chinese insects. Vol IV. Sun Yat-sen University Press, Guangzhou.

Xiao, G. R. and Wu, J. 1983: The siricid woodwasps of China (Hymenoptera: Symphyta). Memoir Science Silvae Sinicae. 29 pp.

Xiao, G., Huane, X., Zhou, S, Wu, J. and Zhang, P. 1992. Economic sawfly Fauna of China (Hymenoptera: Symphyta). Tianze Eldonejo. 221 pp.

Yano, M. 1932. Hymenoptera. Pp. 250-476 in Uchida, S. (ed.), Iconographia Insectorum Japonicorum 1. Hokuryukan, Tokyo. 2241 pp.

Yasumatsu, K. 1938. Fig. 577 in Esaki, T., Hori, H. and Yasumatsu, K.(eds), Insectorum Japonicorum illustratio Iconographia : Coloribus ad naturam depicta. The Sanseido Co., Tokyo. 426 + 59 pp. + 189 plates.

Zemkova, R. I. 1965. Biology and host data of pests of trunk of Siberian cedars in western Soyan. Pp. 20–50. Akademia Nauk Sibirskoe Otdelenie Institut Lesa I drevesiny, Issleddovaniya po zashite lesov Sibiri. Moscow. [in Russian]

Zetterstedt, J. W. 1838. Ordo IV. Hymenoptera. Pp. 326–358 in Zetterstedt, J. W. (ed.), Insecta Lapponica descripta. Sectio secunda. L. Voss, Lipsiae. 1139 pp.

Zimsen, E. 1964. The Type Material of I. C. Fabricius. Munksgaard, Copenhagen. 656 pp.

Zhelokhovtsev, A. N., Nikol’sakja, M. N. and Popov, V. V. 1955. Order Hymenoptera. Pp. 286– 383 in Paulovskii and Shtakel’berg, (eds), Forest Pests, Reference Book. Akademia Nauk Zoologiskii Institut Vol. 1. Moscow. 421 pp.

Zhelochovtsev, A. N. and Zinovjev, A. G. 1996. A list of the sawflies and horntails (Hymenoptera, Symphyta) of the fauna of Russia and adjacent territories II. Entomologicheskoe Obozrenie 75: 357–380. [in Russian – available in English in Entomological Review 76(4): 451-470.)

Zombori, L. 1973. Symphyta collection of the Bakony Museum (Natural History) (Hymenoptera). Veszprem Megyei Muzeumok Kozlemenyei Termeszettudomany 12: 467–475.

Zombori, L. 1974a. Data to the sawfly fauna of Yugoslavia (Hymenoptera: Symphyta). Fragmenta Balcanica 9(18): 173–185.

Zombori, L. 1974b. A check-list of Symphyta from the Carpathian Basin (Hymenoptera). 1. Folia Entomologica Hungarica 27(1): 237–242.

Appendices

Sequence pair distances - Genbank accession numbers

Sequence pair distances

PERCENT IDENTITY
	1	2	3	4	5	6	7	8	9	10		Code	SPECIES
1		96.7	87.5	88.3	85.7	84.8	85.1	85.1	86.6	83.3	1	CBHR 214	X. caudatus
2	3.4		88.3	87.8	86.2	84.5	85.3	85.3	86.3	83.1	2	CBHR 203	X. melancholicus
3	13.0	11.9		97.1	87.4	85.6	87.2	86.6	88.1	83.1	3	CBHR 33	X. indecisus
4	12.1	12.5	3.0		86.5	85.0	87.2	86.6	88.1	82.7	4	CBHR 534	X. morrisoni
5	14.8	14.2	13.0	14.1		96.0	86.0	85.1	84.5	82.5	5	CBHR 41	X. spectrum
6	15.6	15.8	15.1	15.8	4.1		84.8	83.9	83.9	81.5	6	CBHR 1002	X. malaisei
7	15.8	15.8	13.6	13.6	15.1	16.4		97.9	84.8	82.1	7	S 68	X. pallicoxae "Type 2"
8	15.6	15.6	14.0	13.9	15.9	17.2	2.2		84.8	82.1	8	S 82	X. pallicoxae "Type 1"
9	14.1	14.3	12.1	12.3	16.6	17.0	16.0	15.8		81.8	9	SIR 158	X. degrooti
10	16.9	17.3	16.9	17.9	17.6	18.8	19.7	18.5	18.4		10	DEIGISHym 19732	X. himalayensis
	1	2	3	4	5	6	7	8	9	10

Table 1. Consensus sequence pair distances of Xeris percent identity and divergence for all taxa (identity.meg ClustalV - Weighted - March 02, 2015).

Genbank accession numbers

SEQ #	SPECIMEN Code	SPECIES	BOLD code	GENBANK code	# seqs	LENGTH
1	CBHR 33	indecisus		KP761936	2	658
2	CBHR 41	spectrum		KP761937	2	658
3	CBHR 98	indecisus		KP761938	2	658
4	CBHR 108	indecisus		KP761939	2	658
5	CBHR 189	indecisus		KP761940	2	658
6	CBHR 190	morrisoni		JQ619812	2	658
7	CBHR 203	melancholicus		KP761941	2	658
8	CBHR 210	indecisus		KP761942	2	658
9	CBHR 214	caudatus		KP761943	2	658
10	CBHR 215	indecisus		KP761944	2	658
11	CBHR 216	indecisus		JQ619810	2	658
12	CBHR 228	indecisus		KP761945	2	658
13	CBHR 229	caudatus		JQ619809	2	658
14	CBHR 235	indecisus		KP761946	2	658
15	CBHR 236	caudatus		KP761947	2	658
16	CBHR 236e	caudatus		KP761948	2	658
17	CBHR 238	caudatus		KP761949	2	658
18	CBHR 238b	caudatus		KP761950	2	658
19	CBHR 238c	caudatus		KP761951	1	596
20	CBHR 238d	caudatus		KP761952	2	658
21	CBHR 239	indecisus		KP761953	2	658
22	CBHR 254	indecisus		KP761954	2	658
23	CBHR 297	melancholicus		KP761955	2	658
24	CBHR 300	melancholicus		JQ619811	4	658
25	CBHR 385	indecisus		KP761956	2	658
26	CBHR 418	indecisus		KP761957	2	658
27	CBHR 419	indecisus		KP761958	2	658
28	CBHR 533	morrisoni		KP761959	1	605
29	CBHR 534	morrisoni		KP761960	2	658
30	CBHR 535	morrisoni		KP761961	2	567
31	CBHR 536	morrisoni		KP761962	2	656
32	CBHR 537	morrisoni		KP761963	3	657
33	CBHR 603	melancholicus		KP761964	2	658
34	CBHR 1001	malaisei		KP761965	2	658
35	CBHR 1002	malaisei		KP761966	2	658
36	CBHR 1003	malaisei		KP761967	2	658
37	CBHR 1078	indecisus		KP761968	2	658
38	CBHR 1090	spectrum		KP761969	2	658
39	CBHR 1310	indecisus		KP761970	2	658
40	CBHR1375	melancholicus		KP761971	2	658
41	CBHR 1461	melancholicus		KP761972	2	658
42	CBHR 1462	melancholicus		KP761973	2	578
43	CBHR 1943	caudatus		KP761974	2	658
44	CBHR 1944	caudatus		KP761975	2	658
45	CBHR 1945	caudatus		KP761976	2	658
46	CBHR 2008	caudatus		KP761977	2	658
47	SIR 074	indecisus	CNCS1074	KP761978	2	427
48	SIR 075	indecisus	CNCS 1075	KP761979	2	426
49	SIR 076	indecisus	CNCS 1076	KP761980	2	658
50	SIR 077	indecisus	CNCS 1077	KP761981	1	576
51	SIR 078	indecisus	CNCS 1078	KP761982	2	658
52	SIR 080	indecisus	CNCS 1080	KP761983	2	658
53	SIR 081	indecisus	CNCS 1081	KP761984	2	426
54	SIR 084	caudatus	CNCS 1084	KP761985	2	658
55	SIR 086	melancholicus	CNCS 1086	KP761986	2	633
56	SIR 087	melancholicus	CNCS 1087	KP761987	2	621
57	SIR 088	melancholicus	CNCS 1088	KP761988	1	630
58	SIR 089	melancholicus	CNCS 1089	KP761989	2	630
59	CNCHYM 02488	degrooti	HYCND084	KP761990	3	629
60	CNCHYM 02489	indecisus	HYCND085	KP761991	2	426
61	CNCHYM 02491	degrooti	HYCND087	KP761992	1	290
62	CNCHYM 02492	indecisus	HYCND088	KP761993	2	427
63	CNCHYM 02493	indecisus	HYCND089	KP761994	2	426
64	CNCHYM 03047	indecisus	HYCND649	KP761995	3	609
65	CNCHYM 03050	indecisus	HYCND652	KP761996	2	423
66	CNCHYM 03051	indecisus	HYCND653	KP761997	2	426
67	CNCHYM 03056	degrooti	HYCND658	KP761998	2	584
68	S10	malaisei		KP761999	2	658
69	S64	spectrum		KP762000	2	658
70	S65	pallicoxae		KP762001	2	658
71	S68	pallicoxae		KP762002	2	658
72	S69	spectrum		KP762003	2	658
73	S76	pallicoxae		KP762004	2	658
74	S79	malaisei		KP762005	2	658
75	S82	pallicoxae		KP762006	2	658
76	S92	malaisei		KP762007	2	658
77	S126	pallicoxae		KP762008	2	658
78	S179	pallicoxae		KP762009	2	658
79	S198	pallicoxae		KP762010	2	658
80	S216	spectrum		KP762011	2	658
81	S218b	malaisei		KP762012	2	658
82	S220	spectrum		KP762013	2	658
83	S235	spectrum		KP762014	2	658
84	S264	pallicoxae		KP762015	2	656
85	S269	pallicoxae		KP762016	2	658
86	S272	spectrum		KP762017	2	658
87	S274	spectrum		KP762018	2	658
88	S293	pallicoxae		KP762019	2	658
89	S296	pallicoxae		KP762020	2	658
90	S342	spectrum		KP762021	2	658
91	S344	pallicoxae		KP762022	2	658
92	S347	pallicoxae		KP762023	2	658
93	S355	spectrum		KP762024	2	658
94	S373	spectrum		KP762025	2	658
95	S375	spectrum		KP762026	2	658
96	S376	spectrum		KP762027	2	658
97	S394	pallicoxae		KP762028	2	658
98	S426	pallicoxae		KP762029	2	658
99	S442	pallicoxae		KP762030	2	658
100	S464	spectrum		KP762031	2	658
101	S473	pallicoxae		KP762032	2	658
102	S474	pallicoxae		KP762033	2	658
103	S487	pallicoxae		KP762034	2	658
104	S491	malaisei		KP762035	2	658
105	S497	pallicoxae		KP762036	2	658
106	S516	pallicoxae		KP762037	2	627
107	GLSIR 041	melancholicus	SIRCA041	KP762038	2	632
108	GLSIR 042	melancholicus	SIRCA042	KP762039	2	566
109	SIR 100	caudatus	SIRCA095	KP762040	2	589
110	SIR 101	caudatus	SIRCA096	KP762041	2	658
111	SIR 102	caudatus	SIRCA097	KP762042	2	658
112	SIR 103	caudatus	SIRCA098	KP762043	2	658
113	SIR 104	caudatus	SIRCA099	KP762044	2	658
114	SIR 105	caudatus	SIRCA100	KP762045	2	658
115	SIR 106	caudatus	SIRCA101	KP762046	2	658
116	SIR 107	caudatus	SIRCA102	KP762047	2	658
117	SIR 108	caudatus	SIRCA103	KP762048	2	658
118	SIR 109	caudatus	SIRCA104	KP762049	2	658
119	SIR 110	caudatus	SIRCA105	KP762050	2	521
120	SIR 111	melancholicus	SIRCA106	KP762051	2	658
121	SIR 112	caudatus	SIRCA107	KP762052	2	658
122	SIR 113	caudatus	SIRCA108	KP762053	2	658
123	SIR 114	caudatus	SIRCA109	KP762054	2	658
124	SIR 115	caudatus	SIRCA110	KP762055	2	570
125	SIR 117	caudatus	SIRCA 112	KP762056	2	658
126	SIR 118	caudatus	SIRCA 113	KP762057	2	658
127	SIR 120	caudatus	SIRCA115	KP762058	2	658
128	SIR 122	caudatus	SIRCA117	KP762059	2	658
129	SIR 123	caudatus	SIRCA118	KP762060	2	658
130	SIR 126	caudatus	SIRCA121	KP762061	2	658
132	SIR 128	caudatus	SIRCA123	KP762062	2	658
133	SIR 130	caudatus	SIRCA 125	KP762063	2	658
134	SIR 126	caudatus	SIRCA 126	KP762064	2	658
135	SIR 133	caudatus	SIRCA 128	KP762065	2	658
136	SIR 136	caudatus	SIRCA131	KP762066	1	609
137	SIR 137	melancholicus	SIRCA132	KP762067	2	658
138	SIR 138	caudatus	SIRCA133	KP762068	2	658
139	SIR 140	caudatus	SIRCA135	KP762069	2	658
140	SIR 144	melancholicus	SIRCA139	KP762070	2	658
141	SIR 145	caudatus	SIRCA140	KP762071	2	658
142	SIR 146	caudatus	SIRCA141	KP762072	2	658
143	SIR 147	caudatus	SIRCA142	KP762073	2	658
144	SIR 148	caudatus	SIRCA143	KP762074	2	658
145	SIR 149	caudatus	SIRCA144	KP762075	2	658
146	SIR 150	caudatus	SIRCA145	KP762076	2	658
147	SIR 155	degrooti	SIRCA150	KP762077	1	289
148	SIR 158	degrooti	SIRCA153	KP762078	2	658
149	SIR 161	spectrum	SIRCA156	KP762079	2	658

Table 2. The specimen (CBHR and CNC), Bold and Genbank accession numbers are as follows. FASTA Sequences representing each of the 9 species of this study are deposited in Genbank and at the Center for Bottomland Hardwood Research Web Site. A set of files in one zip file can be downloaded from the CBHR site at the following URL: http://www.srs.fs.usda.gov/cbhr/products/downloads/2012_nms_SiricidFASTA.zip

Cite

Goulet, C. Boudreault and N. M. Schiff. 2015. Revision of the World species of Xeris Costa (Hymenoptera: Siricidae). Canadian Journal of Arthropod Identification No. XX: XXX pp. (PDF version). Published on XXXX. Available online at doi: 10.3752/cjai.2015.28
http://zoobank.org/References/1360ED3A-8330-43BD-B051-2DDBBBD76AA0

ISSN 1911-2173

Canadian Journal of

ARTHROPOD IDENTIFICATION

Revision of the World species of Xeris Costa (Hymenoptera: Siricidae)

Henri Goulet¹

,

Caroline Boudreault¹

,

Nathen M. Schiff²

Revision of the World species of Xeris Costa (Hymenoptera: Siricidae)

Revision of the World species of Xeris Costa (Hymenoptera: Siricidae)

Henri Goulet¹

,

Caroline Boudreault¹

,

Nathen M. Schiff²

Abstract

Introduction

Methods & Materials

Morphology

Biology

Introduction

Hosts

Parasitoids

Keys

DNA

Results

Discussion

Conclusion

Acknowledgements

References

Appendices

Cite

Canadian Journal of

ARTHROPOD IDENTIFICATION

Revision of the World species of Xeris Costa (Hymenoptera: Siricidae)

Henri Goulet1

,

Caroline Boudreault1

,

Nathen M. Schiff2

Revision of the World species of Xeris Costa (Hymenoptera: Siricidae)

Revision of the World species of Xeris Costa (Hymenoptera: Siricidae)

Henri Goulet1

,

Caroline Boudreault1

,

Nathen M. Schiff2

Abstract

Introduction

Methods & Materials

Morphology

Biology

Introduction

Hosts

Parasitoids

Keys

DNA

Results

Discussion

Conclusion

Acknowledgements

References

Appendices

Cite

Henri Goulet¹

Caroline Boudreault¹

Nathen M. Schiff²

Henri Goulet¹

Caroline Boudreault¹

Nathen M. Schiff²