Munidopsis species (Crustacea: Decapoda: Munidopsidae) from carcass falls in Weijia Guyot, West Pacific, with recognition of a new species based on integrative taxonomy

Sample collection and morphological examination

Information on the Munidopsis species collected at Weijia Guyot and the molecular data used in the present study are listed in Table 1. The carcass fall experiments were conducted using deep-sea landers including cow bones deployed on the seabed. The squat lobsters were collected when the landers were retrieved one year after the deployment. All specimens collected were found on the bones or within the lander boxes. After being photographed, the specimens were preserved in 80% ethanol. The size of the specimen is given as the postorbital carapace length (PCL), which refers to the carapace length excluding rostrum. All specimens collected in this study were deposited in the Sample Repository of Second Institute of Oceanography (SRSIO), Ministry of Natural Resources, Hangzhou, China. Field experiments were approved by the China Ocean Mineral Resources R & D Association (Cruise 41 and 58).

Munidopsis lauensis Baba & de Saint Laurent, 1992 was used as the comparative material for the phylogenetic analysis. The specimen was collected from a hydrothermal vent in Manus Basin, Bismarck Sea (3°42.25′S, 151°52.66′E), at 1,714 m depth, in 19 June 2015. Morphological and molecular data for specimens of M. nitida (A. Milne Edwards, 1880) used in the study were made available by Paula Rodríguez-Flores, Museo Nacional de Ciencias Naturales (MNCN-CSIC) and Centre d’Estudis Avançats de Blanes (CEAB-CSIC), Spain. Those specimens were collected off Papua New Guinea (03°31′S, 148°03′E), at a depth range of 780–855 m, in 23 April 2014.

Molecular data and analysis

Total genomic DNA was extracted from muscle tissue using QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany), following manufacturer instructions. Extracted DNA was eluted in double-distilled H₂O (ddH₂O). Partial sequences of the COI gene were amplified via polymerase chain reaction (PCR). Reactions were carried out in a 30-µl volume containing: 15 µl Premix Taq (TaKaRa Taq™ Version 2.0 plus dye; TaKaRa, Kusatsu, Japan), 1.2 µl each of forward and reverse primers (10 mM), respectively, 1.6 µl DNA template, and 11 µl ddH₂O. For M. albatrossae, the primer pair gala_COIF and gala_COIR was used to amplify a fragment of 568 base pairs (bp) of the COI gene following the original procedure (Jones & Macpherson, 2007). For M. spinifrons sp. nov. specimens, we designed a new reverse primer LCOgala (5′- ATCATAAAGACATTGGAACTTTATA - 3′) paired with the universal forward primer HCO2198 (Folmer et al., 1994) to obtain a fragment of ca. 660 bp of the COI gene in the following thermal profile: initial denaturation at 95 °C for 5 min; 40 cycles of 95 °C for 50 s; 49  °C for 50 s; 72 °C for 50 s; and a final extension at 72 °C for 10 min. We also amplified a fragment (672 bp) of the COI gene of M. lauensis for phylogenetic analysis using the universal primers HCO2198 and LCO1490 (Folmer et al., 1994) following the thermal profile described above. PCR products were purified using a QIAquick Gel Extraction Kit (QIAGEN, Hilden, Germany), and bidirectionally sequenced using the same primers with an ABI 3,730 ×l Analyzer (Applied Biosystems, Foster City, CA, USA).

Sequences were checked by the sequence peak height and then assembled based on the contigs using the DNASTAR Lasergene software package (DNASTAR, Inc., Madison, WI, USA). The sequences acquired during this study were uploaded to NCBI GenBank (Table 1). We also downloaded several COI sequences of Munidopsidae species from GenBank (Table 1) for the phylogenetic analysis. Most of the chosen species, which are morphologically similar to either one of the two species presently studied, belong to the Orophorhynchus (A. Milne Edwards, 1880) group and associated with chemosynthetic environments (Ahyong, Andreakis & Taylor, 2011). Two morphologically distinct species, M. barbarae (Boone, 1927) and M. corniculata Rodríguez-Flores, Macpherson & Machordom, 2018, were chosen for comparative analysis, and Shinkaia crosnieri Baba & Williams, 1998 was selected as the outgroup in the phylogenetic study.

The sequences were aligned using the software package MEGA 6.06 (Tamura et al., 2013). The average genetic distances within and between species were estimated according to the Kimura 2-parameter (Kimura, 1980) model in MEGA 6.06 (Tamura et al., 2013). The most appropriate nucleotide base substitution model for the alignment data, which is HKY+I+G, was determined by MrModeltest v2 (Nylander, 2004). The maximum likelihoods (ML) for phylogenetic analyses were assembled in PhyML 3.1 (Guindon & Gascuel, 2003) with 1,000 replicates. A Bayesian inference (BI) tree was constructed using MrBayes 3.2.6 (Huelsenbeck & Ronquist, 2001). Markov chains were run for 10,000,000 generations, sampled every 100 generations; the first 25% trees were discarded as burn-in, after which remaining trees were used to construct the 50% majority-rule consensus tree and to estimate posterior probabilities.

Zoobank registration

The electronic version of this article in portable document format will represent a published work according to the International Commission on Zoological Nomenclature (ICZN), and hence the new names contained in the electronic version are effectively published under that Code from the electronic edition alone. This published work and the nomenclatural acts it contains have been registered in ZooBank, the online registration system for the ICZN. The ZooBank Life Science Identifiers (LSIDs) can be resolved and the associated information viewed through any standard web browser by appending the LSID to the prefix http://zoobank.org/. The LSID for this publication is: urn:lsid:zoobank.org:pub:C1CC52FD-6113-4A53-91C3-8D80E713D255. The online version of this work is archived and available from the following digital repositories: PeerJ, PubMed Central, and CLOCKSS.

Taxonomy

Munidopsis sp. Wolff, 1961: 148, fig. 16.

Munidopsis albatrossae Pequegnat & Pequegnat, 1973: 163, Figs. 1, 2 (type locality: Eastern Pacific South of Madalena Bay, Baja California).—Baba, 2005: 284.—Jones & Macpherson, 2007: 480, Fig. 2A.—García Raso et al., 2008: 1282, Fig. 2.

Munidopsis aries Ambler, 1980: 17.—Wicksten, 1989: 315 (not M. aries A. Milne Edwards, 1880).

Materials examined. SRSIO1709000X, 1 male (PCL 6.29 mm), 1 female (PCL 6.51 mm), 1 sex indet. (PCL 4.02 mm). Carcass fall experimental field site, Weijia Guyot, West Pacific. R/V Haiyang 6, stn. MCMX1605, 12°43.0149′N, 156°27.2057′E, 3,225 m, 30 September 2017.

Diagnosis. Carapace (Fig. 1A) (excluding rostrum) as long as broad. Frontal margins oblique, with blunt outer orbital angle above antennal peduncle. Anterolateral corners blunt, followed by notch at lateral end of anterior cervical groove and another low process; anterior branchial margins rugose, slightly convex, each with blunt anterior tooth; posterior branchial margins converging posteriorly. Dorsal surface with numerous rugae; gastric region elevated, with pair of low epigastric process. Rostrum broadly triangular, 1.3 times longer than broad, 0.6 times of remaining carapace length; lateral margins straight, weakly serrated distally; dorsal surface and ventral surface (Fig. 1B) each with median, longitudinal ridge. Pterygostomial flaps (Fig. 1C) with oblique rugae on lateral surface; anteriorly acute. Sternal plastron (Fig. 1D) as long as broad; sternite 4 moderately elongated anteriorly, ventral surface depressed. Abdominal tergites unarmed; tergites 2 and 3 each with two transverse ridges on dorsal surface, anterior ridges more elevated. Telson (Fig. 1E) composed of 8 plates. Eyestalks short, unmovable, mesial eyespines present but reduced; cornea small. Basal article of antennular peduncle (Fig. 1B) with 2 anterior spines. Antennal peduncle (Fig. 1B) overreaching eyestalks. Merus of third maxilliped (Fig. 1F) armed with 3 or 4 small spines on flexor margin. Pereopod 1 (P1, chelipeds) (Fig. 2A) subequal; palms with rows of spines on lateral and mesial margins, dorsal surfaces with scattered spines; fingers with opposable margins distally spooned; fixed fingers with denticulate carina on distolateral margin. Pereopods 2–4 slender (P2–4) (Figs. 2B–2E); meri spinulose on extensor and flexor margins; carpi each with 2 longitudinal, spinulose carinae on extensor surface; propodi each with 2 carinae on extensor surface and 1 pair of distal spines on flexor margin; dactyli (Fig. 2E) approximately 0.7 propodi length; flexor margin straight, with 7 elevated teeth, each bearing small corneous spines. P2 slightly overreaching distal end of P1. P1 with epipods.

Coloration. In preserved condition, grey white.

Distribution. East Pacific: south of Madalena Bay, Baja California, Costa Rica, East Pacific Rise, and Monterey Bay (California). Antarctic waters: Bellingshausen Sea. West Pacific: Weijia Guyot. Depth 1,920–3,680 m.

Habitats. The specimens described here were collected from cow bones in an artificial carcass fall, deployed at 3,225 m at Weijia Guyot. This species was previously found on a whale fall in Monterey Bay (Jones & Macpherson, 2007), and on soft sea bottom in the Bellingshausen Sea (García Raso, García Muñoz & Manjón-Cabeza, 2008).

Remarks. The specimens from Weijia Guyot show a few differences from the holotype and the specimen from Monterey Bay. In the present specimens, the mesial eyespines are blunt and the anterior branchial margins are faintly serrated, whereas in the holotype, the mesial eyespines are prominent and the anterior branchial margins have numerous small spines (Pequegnat & Pequegnat, 1973). The present specimens are all juveniles, with the PCL not longer than 7 mm; in contrast, the specimens described from the East Pacific exceed 70 mm PCL. Therefore, the slight morphological differences can be considered intraspecific variations due to size.

Munidopsis spinifrons sp. nov.

urn:lsid:zoobank.org:act:B1A381D7-7BF1-4C37-A15F-33ACF009C833

(Figs. 3B, 4 and 5)

Munidopsis vrijenhoeki Jones & Macpherson, 2007: 496 (part, small leg fragments?).

Materials examined. SRSIO18100001, holotype, 1 male (PCL 24.89 mm); SRSIO18100002, paratypes, 4 females (PCL 15.79–20.45 mm). Carcass fall experimental field site, Weijia Guyot, West Pacific. R/V Dayang 1, stn. DY48-II-MX1802, 12°56.96′N, 156°57.25′E, 1427.5 m, 25 October 2018.

Description. Carapace (Fig. 4A) (excluding rostrum) distinctly longer than broad. Frontal margins oblique, antennal spines well developed. Lateral margins approximately parallel, bearing short, sparse setae. Anterolateral spines relatively short. Anterior branchial margin with 3 or 4 spines; anteriormost spine strongest; posterior two spines usually rudimental. Posterior branchial margin rugose, with distinct spine at base of posterior cervical groove. Posterior margin unarmed, slightly concave. Dorsal surface covered with transverse, interrupted ridges, bearing long setae. Gastric region elevated, with 2 strong epigastric spines (followed with 2 tiny spines in holotype). Cervical groove distinct. Cardiac region with distinct transverse uninterrupted ridge. Rostrum spiniform (Fig. 4B), 0.4 times as long as remaining carapace length, 1.2 times broader than long (base at level of antennal spine base); dorsal surface evenly and longitudinally carinate; distal 0.3 length of lateral margins strongly upturned, bearing 1 or 2 small but distinct spines. Pterygostomial (Fig. 4C) flaps with oblique rugae on lateral surface.

Sternal plastron (Fig. 4D) slightly longer than broad, widening posteriorly. Sternite 3 broader than anterior margin of sternite 4, divided into two parts by median longitudinal groove; anterior margins with median notch. Sternite 4 narrowly elongated with longitudinal groove in anterior part; posterior part broad, surface with short scales, posterior surface depressed. Sternites 5–7 each with elevated, transverse ridges, bearing simple setae.

Abdominal tergites smooth and unarmed; tergites 2–4 each with 2 transverse ridges bearing stiff setae anteriorly, posterior ridge relatively short.

Telson (Fig. 4E) composed of 10 distinct plates.

Eyestalk (Fig. 4F) hardly movable. Cornea oval, globular, broader than long. Ocular peduncle short, nearly invisible in dorsal view, broader than cornea; mesial eyespine prominent, anterolaterally directed, reaching to distal 0.6 of rostrum; lateral eyespine relatively short, closely adjacent to cornea and followed with distinct spine on base of peduncle (usually covered by carapace in dorsal view).

Antennular peduncle (Figs. 4G, 4H) with basal article longer than broad; distal margin bearing strong ventrolateral spine and dorsolateral spine (rarely bearing another minute intermedian spine); lateral face slightly inflated, covered with short rugae; mesial margin straight.

Antennal peduncle (Fig. 4G) reaching to half length of rostrum, bearing setae on lateral and mesial margins. Article 1 immovable, with strong distomesial and distolateral spines. Article 2 armed with strong distolateral spine and small mesial spine at midlength. Article 3 subrectangular, with strong distomesial and distolateral spines, and minute dorsodistal spine. Article 4 short and unarmed.

Third maxilliped (Fig. 4I) slender. Ischium approximately as long as merus length, disto-extensor corner acute; crista dentata well-developed, extending onto basis. Merus subrectangular, extensor margin with distinct distal spine followed by small tubercle; flexor margin irregularly denticulate. Carpus unnamed. Propodus with distoflexor margin convex. Dactylus short. Dactylus flexor margin, propodus distoflexor margin, and carpus dorsal distoflexor margin densely covered in long setae.

Pereopod 1 (P1, chelipeds) (Figs. 5A, 5B) subequal, 1.4 times PCL, densely covered in long and stiff setae on rugae and base of spines on surface and margins. Ischium short, approximately 0.7 merus length, distal margin with distinct dorsolateral spine and small ventrolateral spine; ventrodistal margin anteriorly produced, with strong subterminal spine. Merus approximately 0.4 PCL, subtriangular in cross-section, with short rugea on surfaces; dorsal surface armed with longitudinal row of spines (strongest on distal margin, successively decreasing in size); dorsodistal margin with another strong spine on mesial side; ventrodistal margin with strong mesial and lateral spines. Carpus less than half merus length, dorsomesial margin with strong subdistal spine and small median spine (disappearing on right P1 of holotype); dorsolateral margin with strong distal spine; ventrodistal margin produced into triangular lobe. Chela relatively compressed, approximately 1.3 merus length (including fixed finger), twice as longer as broad; palm unarmed. Fingers 0.8 palm length, opposable margins distally spooned and crenulated; occlusal margins sinuous, with low, triangular tooth proximally on fixed finger, and broad, low tooth medially on movable finger; distolateral margin of fixed finger with indistinct denticulate carina.

Pereopods 2–4 (P2–4, ambulatory legs 1–3) (Figs. 5C–5F) setose, bearing long, stiff setae on margins and surfaces of each segment. P2 approximately 1.8 times PCL, overreaching distal end of cheliped. Meri somewhat compressed; P2 merus approximately 0.7 times PCL (P3 merus 0.9 P2 merus length; P4 merus 0.8 P2 merus length), 4.3 times as long as broad (P3 3.8 times, P4 3.3 times); extensor margin armed with row of spines, distal-most spine prominent; flexor margin rugose, with strong distal spine. Carpi each with 2 longitudinal ridges on extensor surface; lateral carina rugose, armed with small distal spine (P2, sometimes absent) or unarmed (P3 and P4); mesial carina armed with row of 3–6 spines, distal spine laterally situated and subequal (or smaller) in size to penultimate spine; flexor margin armed with small but acute distal spine. Propodi subcylindrical, P2 propodus 0.8 merus length (P2–4 propodi subequal in length); extensor surface nearly flat, with 2 longitudinal carinae; flexor margin rugose, with pair of distal corneous spines. Dactyli (Fig. 5F) 0.4–0.5 propodi length; extensor margin rugose; flexor margin straight, with 11 movable corneous spines (increasing in size distally) each based on triangular tooth.

P1 with epipod.

Distribution. Known only from the type locality, Weijia Guyot, West Pacific; 1,427.5 m.

Coloration. In fresh condition, body entirely white, cornea light orange.

Habitats. The species is currently recorded only from the artificially placed deep-sea carcass fall (cow bones) at Weijia Guyot, western Pacific.

Etymology. Latin words “spini-” means spinose or spiny, and “frons” means the rostrum. The new specific name refers to the special character that discriminates it from the closely related species.

Remarks. The new species is morphologically similar to M. nitida in having a narrow rostrum, parallel carapace lateral margins, pair of strong epigastric spines, mesial and lateral eyespines, broad cornea, unarmed abdominal segments, anterior branchial margin with 2–4 spines, P1 shorter than P2, and epipod present on P1. Munidopsis spinifrons sp. nov. can be readily distinguished from M. nitida in having small distal spines on the lateral margins of the rostrum, and a basal lateral eyespine; in M. nitida, the lateral margins of the rostrum are entire (Baba, 2005) and the eyestalk bears only a distal lateral eyespine. The latter character has not been mentioned in previous literature, but according to the illustration in Baba (2005: Fig. 72e), M. nitida lacks such a basal lateral eyespine. This was also supported by examination of specimens from New Guinea (P Rodríguez-Flores, pers. comm., 2019). The character of the spinose rostrum can be observed on all five of the present specimens, regardless of the size and sex, although the spines are weak on the smallest specimen; therefore we accept it as a consistent and reliable interspecific character. The new species resembles M. exuta Macpherson & Segonzac, 2005 in having a narrow rostrum with small lateral marginal spines and a pair of strong epigastric spines. Munidopsis spinifrons sp. nov. differs from M. exuta in having antennal spines, 10 telson plates, lateral eyespines, and denticulate carina on the P1 fixed finger.

COI sequence data (see below) show that the new species is closely related to M. vrijenhoeki. However, these two species differ morphologically. Besides the spinose rostrum, the new species has a narrow rostrum, pair of strong epigastric spines, 10 telson plates, large cornea, anterior branchial margins with 2 or 3 spines, 3rd maxillipeds meri with irregular denticles on the flexor margins, P1 with epipods, and P2–4 meri each with a row of spines only on the extensor margin. In contrast, M. vrijenhoeki has a broad rostrum, pair of small epigastric spines, 8 telson plates, small cornea, branchial margins nearly unarmed, 3rd maxillipeds meri with well-developed spines on the flexor margin, P1 without epipod, and P2–4 meri with a row of spines on the flexor margin. The genetic relationships are discussed in the Discussion section.

Molecular data analysis

Kimura’s two-parameter pairwise genetic distances between M. albatrossae from the Weijia Guyot and a specimen from the Monterey Bay (Jones & Macpherson, 2007) was 0.4%, suggesting that the specimens are the same species. The genetic distances between M. aries from the northeastern Atlantic (Jones & Macpherson, 2007) and M. albatrossae from both the Weijia Guyot and Monterey Bay were 1.8% and 1.4%, respectively, indicating a close relationship between these two species.

Kimura’s two-parameter pairwise genetic distance between M. spinifrons sp. nov. and M. nitida was 4%, indicating clear genetic divergence. However, M. spinifrons sp. nov., including all five sequences, showed no significant genetic distance compared with M. vrijenhoeki Mvri2 (DQ677675), yet displayed high genetic distance compared with M. vrijenhoeki Mvri3 (DQ677676), at 1.7%.

The combined phylogenetic trees (Fig. 6) reconstructed from both the ML and BI analyses are generally congruent. In the combined trees, M. albatrossae from both the west and east Pacific cluster together (BP [maximum likelihood bootstrap percentage] = 91), although the Bayesian posterior probability (PP) are modest. Meanwhile, M. albatrossae and M. aries form a highly supported monophyletic clade A (BP = 100, PP = 1.00) suggesting the close relationship of these two species.

In the phylogenetic tree (Fig. 6), M. spinifrons sp. nov., M. vrijenhoeki (both Mvri2 and Mvri3), and M. nitida form highly supported clade B (BP = 94, PP = 1.00), indicating their close relationship. The five specimens of the new species cluster together into a subclade, although the bootstrap value is modest (BP = 65); nevertheless, M. vrijenhoeki Mvri3 and M. nitida form a strongly supported subclade (BP = 98, PP = 1.00), illustrating that they are more genetically related than the rest of the species (individuals) within clade B. Munidopsis lauensis and M. myojinensis Cubelio et al., 2007, together with clade B, compose a large clade C with high Bayesian support (PP = 0.99).