Journal of Plant Resources (2022) 20(1), 47-51 Journal of Plant Resources (2022) Vol. 20, Page no. 47-51 https://doi.org/10.3126/bdpr.v20i01.56577 Vol. 20, No. 1 Some Barcoding DNA Sequence Analysis of Sphagnum nepalense H. Suzuki, a Bryophyte Species Endemic to East Nepal Madhu Shudan Thapa Magar¹*, Seerjana Maharjan¹, Januka Pathak¹, Dhan Raj Kandel2 & Ganga Rijal¹ ¹ Department of Plant Resources, Thapathali, Kathmandu, Nepal ² National Herbarium and Plant Laboratories, Godawari, Lalitpur, Nepal *Email: ms_thapamagar@yahoo.com Abstract Sphagnum nepalense is a bryophyte endemic to Nepal. The objective of the present study is to analyze DNA barcoding markers useful for delineating the Sphagnum species. Here, a specimen of Sphagnum nepalense collected from the bank of Maipokhari lake, Ilam (2107 m asl) was used. Three chloroplast loci from the sample viz. rbcL, psbA-trnH and trnF-trnL, the latter two being intergenic spacers, were amplified and sequenced. Four accessions of plastome sequences of S. junghuhnianum, S. multifibrosum, S. palustre and S. subsecundum were retrieved from the National Center for Biotechnology Information (NCBI). Evolutionary analysis was performed following the Maximum Likelihood approach using MEGA X. The result showed that the evolutionary tree generated with single locus trnF-trnL and combined sequences of trnF-trnL and psbA-trnH was better compared to that generated with the sequence of other single locus and even the combined sequence of rbcL, psbA-trnH and trnF-trnL. The sequence data generated in this study for Sphagnum nepalense are novel to the scientific community. Keywords: Bootstrapping support, Evolutionary tree, GenBank accession, Molecular markers, Plastome Introduction Bryophytes rank second position among land plants after angiosperms in terms of species diversity (Goffinet & Shaw, 2008). There are 11 species of Sphagnum recorded from Nepal (Pradhan & Shrestha, 2022). Sphagnum nepalense H. Suzuki is an endemic bryophyte reported first from east Nepal (Hara, 1966). Correct identification of species is a prerequisite for species conservation and management. DNA barcoding, a process that involves sequencing of specific regions of DNA as a molecular tool for species identification, could be the best option for precise and rapid identification [Consortium for the Barcode of Life’s (CBOL) Plant Working Group, 2009]. Existing literature show the use of diverse markers for different taxa of plants. For example, CBOL Plant Working Group 2009 recommends rbcL and MatK for land plants. Similarly, regarding the mosses, various studies have recommended different markers for identification (Heck et al., 2021; Hofbauer et al., 2016; Liu et al., 2011). In some cases individual markers have worked well, for instance, ITS2 worked well in Schistidium (Hofbauer et al., 2016), psbA-trnH in the moss genera of Grimmiaceae (Liu et al., 2011) and BRK1 for the genus Sphagnum (Heck et al., 2021). Whereas in other works, markers have proved efficient when they were combined. For example, for the genus Dicranum, species were distinguishable with combined sequence data of ITS1, trnF-trnL, rps4-trnT, psbA-trnH, rps19-rpl2 and rpoB (Lang et al., 2014). In this paper three commonly used molecular markers have been used to illustrate the molecular identity and relationship of Sphagnum nepalense with its congeners. This is a first step towards building a DNA barcode database of Nepal’s flora. We believe it is prudent to initiate the DNA barcoding work from the endemic plants and then proceed to other categories that have had doubts or contestations. Further, DNA barcoding the endemic plants of Nepal will: (a) validate the taxa through molecular method (b) contribute to proper identification and classification of the taxa and (c) build knowledge base for floristic studies of Nepal and the wider Himalayas. 47 Journal of Plant Resources (2022) Vol. 20, No. 1 Materials and Methods Plant material and DNA extraction During exploration in February 2021 we encountered Sphagnum nepalense at the bank of Maipokhari lake (Altitude 2107m, latitude 27.00723oN and longitude 87.93075oE) (Figure 1), which formed a dense mat. DNA material of Sphagnum nepalense was collected and preserved in silica gel with all the necessary field notes about the specimen. The sample code was assigned as BT-2. Voucher specimens were collected and deposited at KATH (specimen no. B1_9/2/2021). Total genomic DNA was isolated from silica-dried samples using CTAB method (KebLlanes et al., 2002). markers were 35 cycles of denaturation at 94°C for 30 sec., annealing at 54°C for 30 sec. and extension at 72°C for 1 min. Figure 2: PCR amplification of rbcL, psbA-trnH and trnFtrnL from BT-2 The sequencing was carried out in ABI310 Genetic Analyzer. The raw sequences were quality trimmed, and the sequences with both forward and reverse reads were aligned into a consensus sequence. We also compared the DNA sequence data with chromatogram in SnapGene Viewer tool and edited the sequence manually whenever required. The newly generated sequences were registered at the NCBI; the assigned NCBI accessions are presented in Table 2. Figure 1: Sphagnum nepalense plant PCR amplification and sequencing Three plastid markers rbcL (Ribulose-1,5bisphosphate carboxylase), psbA-trnH (the intergenic spacer between the gene coding protein D1, a polypeptide of the photosystem II reaction center (psbA) and gene coding histidine accepting tRNA (trnH)) and trnF-trnL (the intergenic spacer between two genes coding for transfer RNA) were amplified (Figure 2) and sequenced using primers listed in Table 1. The PCR conditions for all the three Table 2: GenBank accessions generated in the study Species Sphagnum nepalense H. Suzuki Locus psbA-trnH rbcL trnF-trnL GenBank Accession OP918673 OP985339 OP985340 Sequence downloads and data analysis Four accessions of plastome sequences were retrieved from the NCBI, representing four Sphagnum species viz. S. junghuhnianum, S. multifibrosum, S. palustre and S. subsecundum. Similarly, one accession of plastome of a bryophyte species Andreaea rupestris was also retrieved (Table 3). Respective aligned Table 1: Primers used in the study Locus rbcL psbAtrnH trnFtrnL 48 Primer name rbcL-F rbcL-R psbA trnH trnF trnL Sequence (5’ 3’) ATGTCACCACAAACAGAGACTAAAG GTAAAATCAAGTCCACCACG GTTATGCATGAACGTAATGCTC CGCGCATGGTGGATTCACAATC ATTTGAAGTGGTGACACGAG CGAAATCGGTAGACGCTACG Remarks Modified from Kress et al., 2009 Modified from Sang et al., 1997 Modified from Tate et al., 2003 Taberlet et al. 1991 Journal of Plant Resources (2022) sequences of rbcL, psbA-trnH and trnF-trnL were extracted from each accession manually using SnapGene viewer tool. Table 3: Plastome sequences retrieved from NCBI S.N. Species GenBank Accession 1. Andreaea rupestris MW561627.180840-81296 2. Sphagnum junghuhnianum NC_060704.162998-63198 3. Sphagnum multifibrosum NC_060705.164202-64400 4. Sphagnum palustre MW822172.163056-63255 5. Sphagnum subsecundum NC_060384.163996-64195 Vol. 20, No. 1 et al. (2010) suggested rbcL, rpoC1, rps4, psbA-trnH and trnL-trnF as suitable barcode loci for moss, out of which the best performing single loci are rbcL and rpoC1. Consistent with our finding, psbA-trnH exhibited poor performance as a barcoding marker for delineating closely related bryophyte taxa of selected moss (Hassel et al., 2013) The DNA sequences were aligned by MUSCLE. Phylogenetic analysis was performed following the Maximum Likelihood approach and Kimura 2 Parameter (K2P) model with 1000 bootstrapping replications using Molecular Evolutionary Genetics Analysis (MEGA X) tool. The sequence of Andreaea rupestris was used as an out-group to root the tree. Results and Discussion rbcL and psbA-trnH are weaker marker for Sphagnum The phylogenetic analysis using rbcL and psbAtrnH sequences showed rather poor species discrimination. Though different species formed separate clades, bootstrapping support values were very weak, less than 50 in the majority of clades. Also, the phylogenetic position of individual species was not consistent in two trees (Figure 3 and 4). Liu Figure 3: Maximum Likelihood tree generated using rbcL sequences based on the K2P model. The number on the branches represents bootstrapping support after 1000 bootstrap replications test. Scientific names are followed by respective GenBank accession numbers. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. There were a total of 530 positions in the final dataset. Evolutionary analyses were conducted in MEGA X Figure 4: Maximum Likelihood tree generated using psbAtrnH sequences based on the K2P model. The number on the branches represents bootstrapping support after 1000 bootstrap replications test. Scientific names are followed by respective GenBank accession numbers. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. There were a total of 208 positions in the final dataset. Evolutionary analyses were conducted in MEGA X Tree generated with trnF-trnL and combined psbAtrnH and trnF-trnL is better Interestingly, the tree generated with trnF-trnL sequence is better compared to that generated with rbcL and psbA-trnH sequences. Here, each species formed distinct clades supported with significantly higher bootstrap values (Figure 5), suggesting that the trnF-trnL could be the single locus marker for species delineation of Sphagnum. Lang et al. (2014) also found trnF-trnL as one of the most promising single locus markers for Dicranum. The tree generated with combined sequences of psbA-trnH and trnF-trnL was also better than that generated with single locus rbcL and psbA-trnH respectively (Figure 3, 4 and 5). The tree is comparable to that generated with trnFtrnL sequence. Specifically in S. nepalense, the bootstrapping support value was found significantly increased from 68 to 84. Furthermore, phylogenetic positions of all the species are consistent in both the trees (Figure 5 and 6). 49 Journal of Plant Resources (2022) Figure 5: Maximum Likelihood tree generated using trnFtrnL sequences based on the K2P model. The number on the branches represents bootstrapping support after 1000 bootstrap replications test. Scientific names are followed by respective GenBank accession numbers. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. There were a total of 802 positions in the final dataset. Evolutionary analyses were conducted in MEGA X Vol. 20, No. 1 Figure 7: Maximum Likelihood tree generated using rcbL + psbA-trnH + trnF-trnL sequences based on the K2P model. The number on the branches represents bootstrapping support after 1000 bootstrap replications test. Scientific name is followed by respective Gene bank accession number. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. There were a total of 1539 positions in the final dataset. Evolutionary analyses were conducted in MEGA X Conclusion Figure 6: Maximum Likelihood tree generated using psbAtrnH + trnF-trnL sequences based on the K2P model. The number on the branches represents bootstrapping support after 1000 bootstrap replications test. Scientific name is followed by respective GenBank accession number. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. There were a total of 1010 positions in the final dataset. Evolutionary analyses were conducted in MEGA X Further, the sequences of rbcL, psbA-trnH and trnF-trnL were combined and the tree generated. Combination of sequence was done to get more robust tree. Contrastingly, the tree generated with three sequences combined is very poor (Figure 7). Similar results have also been reported in previous studies (Raskoti & Ale, 2021; Starr et al., 2009; Xiang et al., 2011; Xu et al., 2015), suggesting that combining the sequences need not always be a good strategy for phylogenetic analysis. 50 From the present study, it was found that either single locus trnF-trnL or in combination with psbA-trnH could be the possible marker for species delineation of Sphagnum. More new accessions of Sphagnum and analysis of other barcoding markers such as BRK1, MatK, ITS etc. individual as well as in combination are necessary to get clearer picture of Sphagnum nepalense, particularly to assign its phylogenetic position. However, the study provided molecular evidence for S. nepalense as endemic species since the sequences are unique to other nucleotide sequences available in the public domain for Sphagnum species. Author Contributions MSTM designed the research. MSTM, SM, JP, DRK and GR performed experiments. MSTM analyzed data and wrote the manuscript. All authors read and approved the final manuscript. Acknowledgements We would like to thank Dr. Radha Wagle, Director General; Mr. Saroj Kumar Chaudhary, Deputy Director General; Dr. Sanjeev Kumar Rai and Dr. Journal of Plant Resources (2022) Buddi Sagar Poudel, former Director Generals of DPR for their continuous encouragement and support. We are thankful to Mr. Chandra Mohan Gurmachhan and his team at Plant Research Center, Ilam, for cooperation during field study. We are also thankful to the two anonymous reviewers for their constructive suggestions. References Consortium for the Barcode of Life’s Plant Working Group (2009). A DNA barcode for land plants. Proceedings of the National Academy of Sciences, 106, 12794-12797. Goffinet, B., & Shaw, A. J. (2008). Bryophyte biology. Cambridge University Press. Hara, H. (Ed.). (1966). The flora of Eastern Himalaya. The University of Tokyo Press. Hassel, K., Segreto, R., & Ekrem, T. (2013). Restricted variation in plant barcoding markers limits identification in closely related bryophyte species. Molecular Ecology Resources, 13(6), 1047-1057. Heck, M. A., Lüth, V. M., Gessel, N. V., Krebs, M., Kohl, M., Prager, A., Joosten, H., Decker, E. D., & Reski, R. (2021). Axenic in vitro cultivation of 19 peat moss (Sphagnum L.) species as a resource for basic biology, biotechnology, and paludiculture. New Phytologist, 229(2), 861-876. Hofbauer, W. K., Forrest, L. L., Hollingsworth, P. M., & Hart, M. L. (2016). Preliminary insights from DNA barcoding into the diversity of mosses colonising modern building surfaces. Bryophyte Diversity and Evolution, 38(1), 001-022. Keb-Llanes, M., Gonzalez, G., Chi-Manzanero, B., & Infante, D. (2002). A rapid and simple method for small-scale DNA extraction in Agavaceae and other tropical plants. Plant Molecular Biology Reporter, 20, 299a-299e. Kress, W. J., Erickson, D. L., Jones, F. A., Swenson, N. G., Perez, R., Sanjur, O., & Bermingham, E. (2009).References Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama. Proceedings of the National Academy of Sciences, 106(44), 1862118626. Vol. 20, No. 1 Lang, A. S., Kruijer, J. D., & Stech, M. (2014). DNA barcoding of Arctic bryophytes: an example from the moss genus Dicranum (Dicranaceae, Bryophyta). Polar Biology, 37 (8). Liu, Y., Cao, T., & Ge, X. (2011). A case study of DNA barcoding in Chinese Grimmiaceae and a moss recorded in China for the first time. Taxon, 60(1), 185-193. Liu, Y., Yan, H. F., Cao, T., & Ge, X. J. (2010). Evaluation of 10 plant barcodes in Bryophyta (Mosses). Journal of Systematics and Evolution, 48(1), 36-46. Pradhan, N., & Shrestha, P. (2022). A Handbook of Bryophytes of Nepal (Vol. 2). National Herbarium and Plant Laboratories. Raskoti, B. B., & Ale, R. (2021). DNA barcoding of medicinal orchids in Asia. Scientific Reports, 11, 23651. Sang, T., Crawford, D. J., & Stuessy, T. F. (1997). Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany, 84, 1120-1136. Starr, J. R., Naczi, R. C., & Chouinard, B. N. (2009). Plant DNA barcodes and species resolution in sedges (Carex, Cyperaceae). Molecular Ecology Resources, 9 (Suppl s1), 151-163. Taberlet, P., Gielly, L., Pautou, G., & Bouvet J. (1991). Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology, 17, 1105-1109 Tate, J. A., & Simpson, B. B. (2003). Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Systematic Botany, 28(4), 723-737. Xiang, X. G., Hu, H. A. O., Wang, W. E. I., & Jin, X. H. (2011). DNA barcoding of the recently evolved genus Holcoglossum (Orchidaceae: Aeridinae): A test of DNA barcode candidates. Molecular Ecology Resources, 11(6), 1012-1021. Xu, S., Li, D., Li, J., Xiang, X., Jin, W., Huang, W., Jin, X., & Huang, L. (2015). Evaluation of the DNA barcodes in Dendrobium (Orchidaceae) from mainland Asia. PLoS One, 10, e0115168. 51