The generic position of Stachys tibetica Vatke and amalgamation of the genera Eriophyton and Stachyopsis (Lamiaceae subfam. Lamioideae) Mika Bendiksby, Yasaman Salmaki, Christian Bräuchler & Olof Ryding Plant Systematics and Evolution ISSN 0378-2697 Plant Syst Evol DOI 10.1007/s00606-013-0935-2 1 23 Your article is protected by copyright and all rights are held exclusively by SpringerVerlag Wien. This e-offprint is for personal use only and shall not be self-archived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”. 1 23 Author's personal copy Plant Syst Evol DOI 10.1007/s00606-013-0935-2 ORIGINAL ARTICLE The generic position of Stachys tibetica Vatke and amalgamation of the genera Eriophyton and Stachyopsis (Lamiaceae subfam. Lamioideae) Mika Bendiksby • Yasaman Salmaki Christian Bräuchler • Olof Ryding • Received: 2 March 2013 / Accepted: 12 October 2013 Ó Springer-Verlag Wien 2013 Abstract We have investigated the phylogenetic position of Stachys tibetica by use of both plastid (rps16 intron, trnL-F region and matK) and nuclear ribosomal (ITS) DNA sequence data and both parsimony and Bayesian phylogenetic methods. All data corroborate that S. tibetica is extraneous in Stachys (tribe Stachydeae) and suggest a phylogenetic affiliation in a different lamioid tribe, Lamieae. The molecular data suggest that the species is most closely related to the genus Stachyopsis, while most of the morphological data suggest an intermediate position between Stachyopsis and Eriophyton. Due to difficulties in distinguishing Stachyopsis and Eriophyton, and the possible embedding of the former in the latter genus, we prefer to amalgamate the two closely related genera and refer S. M. Bendiksby (&) NTNU University Museum, Norwegian University of Science and Technology, 7491 Trondheim, Norway e-mail: mika.bendiksby@ntnu.no Y. Salmaki Center of Excellence in Phylogeny of Living Organisms, Department of Plant Science, School of Biology, College of Science, University of Tehran, PO Box 14155-6455, Tehran, Iran C. Bräuchler Department of Biology I, Biodiversity Research-Systematic Botany, Ludwig-Maximilians Universität München, Menzinger Str. 67, 80638 Munich, Germany C. Bräuchler Botanische Staatssammlung München, Menzinger Str. 67, 80638 Munich, Germany O. Ryding Botanical Garden, Natural History Museum of Denmark, University of Copenhagen, Sølvgade 83, opg. S, 1353 Copenhagen, Denmark tibetica to the expanded Eriophyton. As a consequence, five new combinations are made: Eriophyton lamiflorum (Rupr.) Bräuchler, Eriophyton maleolens (Rech.f.) Salmaki, Eriophyton marrubioides (Regel) Ryding, Eriophyton oblongatum (Schrenk) Bendiksby and Eriophyton tibeticum (Vatke) Ryding. Keywords W Himalaya
Molecular phylogenetics
Stachyopsis
Eriophyton
Stachys tibetica
Taxonomy Introduction Scheen et al. (2010) and Bendiksby et al. (2011a) studied the phylogeny of the whole subfamily Lamioideae (Lamiaceae) and discerned altogether ten tribes, among them Stachydeae and Lamieae. The largest genus of the subfamily, the subcosmopolitan Stachys L. alone comprises about 300 species (Harley et al. 2004), of which one, S. tibetica Vatke (from the highlands of northern Pakistan and northern India; Dickoré 2013), is the main focus of the present study. Kumar et al. (2012) mentions the species as an important medicinal plant in traditional medicine. Originally (Vatke 1875), Stachys tibetica was placed in the predominantly American section Calostachys Benth., with similarities to the large section Lamiotypus Benth. Hooker (1885) considered the Iranian to Caucasian S. macrocheilos Boiss. (now treated as synonym under S. fruticulosa M. Bieb.) as closely related, while a more recent treatment (Hedge 1990) regarded it as very distinct with respect to some unusual characteristics such as spiny bracteoles and triquetrous, apically truncate nutlets. Consequently, Krestovskaya (2003) placed the species in the new monotypic subgenus Menitskia, raising it to generic 123 Author's personal copy M. Bendiksby et al. rank only 3 years later (Krestovskaya 2006). Diagnostic features provided for Menitskia are: bracteoles subulate instead of herbaceous or absent; flowers sessile; corolla lips equally long, instead of the lower longer; mid-lobe of lower lip of corolla bent down at a right angle at the base, equal to lateral lobes and boat-shaped; all stamens long, curved and projecting forward instead of having the anterior pair bending outward after pollination; anthers slightly hairy; nutlets triquetrous and apically truncate instead of rounded; leaves indistinctly three to five lobed. Govaerts et al. (2013), nonetheless, reduce Menitskia to synonymy and retain the species in Stachys. Embedded in ongoing research on the phylogeny and classification of Stachys (Salmaki et al. 2008, 2009, 2011, 2012a, b, 2013), this paper aims at establishing the phylogenetic position of S. tibetica using molecular and morphological analyses, and to help review this part of the World Checklist of Seed Plants (Govaerts et al. 2013) by improving the classification. Materials and methods The names used for taxa in the present study follow Govaerts et al. (2013), with Betonica L. recognized as the distinct genus (see e.g., Scheen et al. 2010). Taxon sampling We have generated altogether 19 DNA sequences for the present study, of which 16 are the nuclear ribosomal internal transcribed spacer (nrITS) and three are plastid DNA (pDNA) regions of S. tibetica (trnL intron, trnL-F spacer and rps16 intron). We aligned the plastid sequences of S. tibetica into a trimmed version (82 accessions) of the dataset used by Bendiksby et al. (2011a) that includes all currently recognized lamioid genera except three (i.e., Metastachydium Airy Shaw ex C.Y. Wu & H.W. Li, Paralamium Dunn. and Pseudomarrubium Popov), from which no DNA sequences are available. We established the nrITS dataset (59 accessions) by sequencing a subset of the accessions included in the plastid data and also included a few lamioid nrITS sequences from GenBank. All tribes except for Gomphostemmatae, Synandreae and Leucadeae are represented in the nrITS dataset. We have deposited all sequences new to the present study in GenBank. Voucher information and GenBank accession numbers to all included specimens are provided (see Table 2 in Appendix). The molecular work We performed the molecular work (PCR-amplification, PCR purification, cycle sequencing, sequence editing and 123 aligning) in different laboratories (Munich and Oslo) as described in previous studies (Scheen et al. 2010; Bendiksby et al. 2011a; Salmaki et al. 2012a, b). To test for potential errors in the process from tissue to phylogenetic position in a gene tree, we compared separate gene tree results prior to final analyses on concatenated congruent datasets. It is well known that the risk of PCR contamination increases with decreasing DNA quality as well as with the use of universal primers. We included some poor-quality DNA templates and used several universal primer combinations. Despite this, we detected only a single contaminated sequence: the nrITS of Eriophyton rhomboideum (Benth.) Ryding, which we excluded from further analysis. We analyzed both datasets using maximum parsimony and Bayesian phylogenetic methods. We performed the parsimony analyses using NONA (Goloboff 1999) in combination with WinClada v. 1.0 (Nixon 1999) applying the heuristic search option with 2,000 replicates and maxtrees set to 10,000 and otherwise default settings. We performed parsimony jackknifing with 2,000 replicates and otherwise default setting. For the Bayesian phylogenetic analyses, we used Mr Bayes 3.1.2 (Huelsenbeck and Ronquist 2001; Ronquist and Huelsenbeck 2003) with prior models of nucleotide substitution set according to the output of TreeFinder (Jobb et al. 2004). We determined posterior probabilities by running one cold and three heated chains for five million generations in parallel mode, saving trees every 1,000th generation. We performed the analyses twice to check their convergence for the same topology. To test whether the Markov chain converged, we monitored the average standard deviation of split frequencies (ASDSF), which should fall below 0.01 when comparing two independent runs. Morphology We re-examined morphology in light of the molecular phylogenetic results presented herein based on herbarium material in C, GB, M, MSB and UPS, images in the JSTOR plant science (2013) database and the illustrations in Hedge (1990). Results Alignments and analyses The lengths in aligned characters of the various DNA regions were: 1,031 for the trnL-F region (intron and spacer), 1,058 for the rps16 intron, 1,155 for the matK gene and 702 for the nrITS. The estimated best-fit model of nucleotide substitution for the trnL-F region, rps16 intron, Author's personal copy The generic position of Stachys tibetica Vatke 1 97 1 100 1 91 1 89 1 100 Cymaria dicotoma Achyrospermum fruticosum Eurysolen gracilis 1 Leucosceptrum canum Comanthosphace japonica 94 1 Rostrinucula dependens 99 Colebrookea oppositifolia Craniotome furcata Microtoena patchoulii 1 Anisomeles indica 100 Gomphostemma parviflorum 1 1 Bostrychanthera deflexa 87 Chelonopsis longipes 100 Colquhounia elegans 1 1 1 1 100 1 99 1 90 POGOSTEMONEAE Pogostemon heyneanus GOMPHOSTEMMATEAE 1 Synandra hispidula Macbridea alba Physostegia virginiana Brazoria truncata Warnockia scutellarioides SYNANDREAE Betonica alupecuros Betonica officinalis Galeopsis angustifolia Galeopsis pubescense 1 Melittis melissophyllum 1 Melittis melissophyllum 2 100 Stachys alpigena 1 1 Stachys sylvatica 1 1 100 Suzukia shikikunensis 98 100 Stachys debilis 1 87 1 Haplostachys haplostachya 99 1 1 Phyllostostegia velutina 94 100 65 Stenogyne sessilis 1 Stachys spinosa Sideritis hyssopifolia 86 1 Stachys byzantina Prasium majus 100 .99 Stachys hyssopoides 1 Phlomidoschema parviflorum 77 1 1 Hypogomphia turkestana 86 1 Chamaesphacos illicifolius 100 Thuspeinanta persica 100 1 Ajugoides humilis Matsumurella tuberifera PARAPHLOMIDEAE 97 Paraphlomis javanica 1 Phlomis fruticosa 1 1 Phlomoides rotata 3 .99 100 PHLOMIDEAE 1 Eremostachys laevigata 1 71 Phlomoides tuberosa 82 Lagochilus cabulicus 1 1 Chaiturus marrubiastrum 1 Loxocalyx ambiguus 99 1 80 Leonurus glaucescens 65 Leonurus turkestanicus 1 LEONUREAE 1 Lagopsis marrubiastrum 1 Panzerina lanata 99 .99 1 Leonurus chaituroides 99 Leonurus sibiricus 2 98 60 Roylea cinerea 1 Acanthoprasium integrifolium 1 Moluccella laevis 83 1 MARRUBIEAE Ballota nigra subsp. ruderalis .99 Marrubium supinum 1 95 Marrubium vulgare 63 86 Rydingia integrifolia 1 Leucas lavandulifolia 1 97 Isoleucas arabica 1 98 Otostegia modesta 1 LEUCADEAE 92 Leucas spiculifolia 79 1 Leucas inflata 59 1 Acrotome hispida 100 Leonotis leonurus 99 Lamium album 1 Lamium amplexicaule 1 1 99 Lamium galeobdolon subsp. galeobdolon 1 99 Lamium multifidum Lamium purpureum 1 Stachys tibetica 1 Stachyopsis oblongata 2 Stachyopsis oblongata 3 84 Eriophyton wallichii 1 Eriophyton rhomboideum 1 Eriophyton rhomboideum 2 STACHYDEAE 1 62 0.0080 1 98 LAMIEAE Fig. 1 The 50 % majority rule consensus phylogram from a Bayesian analysis of a concatenated matrix with 83 accessions and 3,244 aligned base pairs from four pDNA regions (trnL intron, trnL-F spacer, rps16 intron and matK). The Bayesian posterior probability values of at least 0.95 are reported above branches and parsimony jackknifing of at least 50 % in italics below branches. Multiple accessions of the same species are numbered according to Table 2 in Appendix. Lamioid tribes are indicated. Inset picture of Stachys tibetica (with permission from the photographer: Dr. Ori FragmanSapir, Jerusalem Botanical Gardens, www.en.botanic.co.il) and nrITS was GTR ? G ? I, whereas GTR ? G was selected for matK. Preliminary parsimony analyses of each plastid region resulted in congruent topologies that were resolved to different extents. Therefore, we concatenated all plastid regions prior to the final analyses. This concatenated pDNA matrix of 3,244 aligned characters contained 604 parsimony informative characters. The nrITS contained 278 parsimony informative characters. The parsimony analysis of the pDNA and nrITS datasets produced 2,688 and 162 most parsimonious trees of lengths 1,749 and 1,304 steps, and the rescaled consistency and homoplasy indices were 0.6/0.30 and 0.33/0.52, 123 Author's personal copy M. Bendiksby et al. Craniotome furcata Colebookea oppositifolia 1 99 Anisomeles indica 1 100 Colquhounia elegans Paraphlomis hispida 1 Paraphlomis javanica 2 99 Paraphlomis javanica 3 79 1 97 Lagochilus cabulicus 2 Leonurus glaucescens LEONUREAE Leonurus turkestanicus 2 1 Leonurus chaituroides 100 Leonurus sibiricus 1 1 Roylea cinerea 1 100 Roylea cinerea 2 1 Ballota hirsuta 99 1 Ballota hispanica MARRUBIEAE 1 91 Marrubium supinum 79 Marrubium vulgare 1 Phlomis fruticosa 2 100 Phlomis fruticosa 1 1 Phlomoides tuberosa 50 1 1 Eremostachys laevigata 1 PHLOMIDEAE 84 100 Eremostachys laevigata 2 1 Phlomoides rotata 2 99 Phlomoides rotata 1 1 Eriophyton wallichii 1 99 Eriophyton wallichii 2 89 .98 Stachys tibetica 79 .98 Stachyopsis oblongata 1 64 Stachyopsis oblongata 2 Lamium galeobdolon subsp. galeobdolon 1 .99 Lamium multifidum 95 1 Lamium purpureum 2 1 98 Lamium amplexicaule 2 79 Lamium album .97 Betonica alopecuros 99 Betonica officinalis 2 1 100 1 Melittis melissophyllum 1 100 Melittis melissophyllum 2 Stachys byzantina 57 Prasium majus 1 .96 Stachys spinosa 98 81 Sideritis hyssopifolia Stachys hyssopoides 1 Phlomidoschema parviflorum 60 95 .98 Thuspeinantha persica 1 81 Chamaesphacos illicifolius 100 93 Hypogomphia turkestana Stachys alpigena Stachys sylvatica .95 Stachys debilis 76 Suzukia shikikuensis Haplostachys haplostachya 1 59 Stenogyne bifida 90 Phyllostegia velutina 1 100 1 81 .99 0.07 POGOSTEMONEAE Pogostemon cablin Pogostemon heyneanus LAMIEAE Galeopsis angustifolia Galeopsis pubescens STACHYDEAE Fig. 2 The 50 % majority rule consensus phylogram from a Bayesian analysis of 59 accessions and 702 aligned base pairs from the nuclear ribosomal ITS region. The Bayesian posterior probability values of at least 0.95 are reported above branches and parsimony jackknifing of at least 50 % italics below branches. Multiple accessions of the same species are numbered according to Table 2 in Appendix. Lamioid tribes are indicated. Inset picture of Stachys tibetica (with permission from the photographer: Dr. Ori Fragman-Sapir, Jerusalem Botanical Gardens, www.en.botanic.co.il) respectively. In the Bayesian analyses of the pDNA and the nrITS datasets, the ASDSF had fallen to 0.003165 and 0.005567, respectively, at termination (5th million generation). We discarded 1,250 generations (25 %) as burn-in and summarized the remaining trees as Bayesian 50 % majority rule consensus trees (Figs. 1, 2) with Bayesian posterior probabilities above branches and parsimony jackknife support in italics below branches. with Stachyopsis oblongata (Schrenk) Popov & Vved. (accession 2) in both the pDNA and nrITS trees (Figs. 1, 2). Note that the second accession of S. oblongata in the two gene trees are represented by different specimens (1 vs. 3; see Table 2 in Appendix), which attain somewhat different positions in the plastid versus nuclear trees. Stachyopsis oblongata is paraphyletic in the plastid topology (Fig. 1) and monophyletic in the nuclear topology (Fig. 2), although neither are strongly supported. The topology of the Lamioideae pDNA phylogeny published by Bendiksby et al. (2011a) is retained herein (Fig. 1) despite a strongly reduced number of accessions (280 vs 83), the only difference being lower branch support for some clades (e.g., Pogostemoneae and Eriophyton Benth.) and higher for others (e.g., Leonureae and a few of Phylogenies Both gene trees (pDNA and nrITS) are generally well resolved with well-supported clades that are largely congruent at the tribal level (Figs. 1, 2). Stachys tibetica attains a phylogenetic position in tribe Lamieae and groups 123 Author's personal copy The generic position of Stachys tibetica Vatke Table 1 Comparison of morphological charactersistics between Stachys tibetica and the genera Eriophyton and Stachyopsis Eriophyton s.lat. Stachyopsis Stachys tibetica Number of species 6 4 1 Number of flowers per cyme 1–4 3–10 1–3 Flower length 20–40 15–23 15–24 Quotient: corolla length/calyx length 1.8–4 1.4–2.1 2–3.5 Annulus in corolla tube Absent or sometimes present Mostly [0.5mm or sometimes all \0.5 mm Present Present Mostly [0.5 mm All \0.5 mm Serrate, crenate or subentire Pinnately lobed, crenate, serrate or subentire Length of the hairs of the upper lip of the corolla Leaf shape Serrate, crenate or subentire the backbone branches). Most major, supported clades in the pDNA tree (Fig. 1) are corroborated by the nrITS tree (Fig. 2), except for a few nuclear–plastid incongruent patterns within some genera [e.g., Lamium L. and Stachys; investigated in more detail by Bendiksby et al. (2011b) and Salmaki et al. (2013), respectively]. Monophyly of tribe Lamieae, to which S. tibetica belongs, is inferred by both plastid and nuclear data, but receives less than 50 % support by parsimony jackknifing. Re-examination of morphology supports a closer relationship to genera of tribe Lamieae than the genus Stachys. Morphologically, S. tibetica attains an intermediate position between the genera Eriophyton and Stachyopsis (Table 1). Discussion Our molecular phylogenetic results, based on both plastid (Fig. 1) and nuclear (Fig. 2) genetic data, suggest a phylogenetic position of S. tibetica in the lamioid tribe Lamieae, sister to the genus Stachyopsis, supporting Krestovskaya’s (2006) view that this morphologically distinct species is extraneous in Stachys. As argued in the following paragraph, the suggestion that S. tibetica belong to Lamieae close to Stachyopsis is also supported by morphological data. Lamieae sensu Bendiksby et al. (2011a) contains the three genera Lamium, Eriophyton s.lat. (sensu Bendiksby et al. 2011a) and Stachyopsis. The tribe is best characterized by having the anthers usually hairy and also differs from Stachydeae in having the nutlets apically truncate or subtruncate. Lamium clearly differs from the latter two genera in having the lateral lobes of the lower lip of the corolla acute, reduced or replaced by narrow teeth. There seems to be no consistent differences between Eriophyton and Stachyopsis, but the two genera can be distinguished by a combination of differences in the following four characters: number of flowers per cyme, flower length, relation between corolla length and calyx length, and the presence or absence of an annulus in the corolla tube (Table 1). The only species of Eriophyton that resembles Stachyopsis in having an annulate corolla tube, E. nepalense (Hedge) Ryding, strongly differs from the latter genus in having the corolla c. 30 mm long and c. three times longer than the calyx. Judging from our herbarium studies, we agree with Krestovskaya (2006) that the following characteristics of S. tibetica are rare or unique within Stachys: subsessile flowers, near equally long corolla lips, anterior stamens that do not curve sideward after pollination, hairy anthers and triquetrous and apically truncate nutlets. While most of these features are common in many other lamioid genera, only Stachyopsis and Eriophyton (emend. Bendiksby et al. 2011a) combine all of them. Hairy anthers are comparatively uncommon in Lamioideae and are only known in Galeopsis L. and the three genera of the tribe Lamieae. Stachys tibetica clearly differs from Galeopsis in having triquetrous, apically truncate nutlets and clearly differs from Lamium in having the lateral lobes of the lower lip of the corolla prominent and rounded. Stachys tibetica is almost equally similar to the remaining two genera of Lamieae, Stachyopsis and Eriophyton. In the five characters mentioned in Table 1, the species agrees better with Stachyopsis in having the corollas short and annulate in the tube. On the other hand, the species agrees better with Eriophyton in having the corolla much longer than the calyx, the hairs on the upper corolla lip short and only few flowers in the cymes (Table 1). Stachys tibetica should obviously be excluded from Stachys as proposed by Krestovskaya (2006). We see three alternatives of classifying the species. The first alternative is to resurrect Krestovskaya (2006) genus Menitskia that accommodates S. tibetica as the single species. Adopting her classification will not require new nomenclatorial combinations. The genus can be distinguished from both Eriophyton and Stachyopsis in having a narrower posterior corolla lip, stiffer bracteoles and often deeply crenate to lobed leaves (Table 1). However, we do not find it informative to place the species in a monotypic genus. Monotypic taxa are redundant in classification as they do not communicate information on the relationship. 123 Author's personal copy M. Bendiksby et al. The second alternative is to include S. tibetica in Stachyopsis, the most closely related genus according to our molecular phylogenetic results (Figs. 1, 2). Stachyopsis has a western to central Asian distribution, adjacent to, but not overlapping with the more eastern distribution of S. tibetica. Eriophyton has a wider distribution that overlaps entirely with the distributions of S. tibetica and most of the distribution of Stachyopsis (Govaerts et al. 2013). Introgression seems to be common among co-occurring outcrossing species of the same or closely related genera in the Lamiaceae and is often detected by incompatible plastid versus nuclear DNA-based tree topologies (see Bräuchler et al. 2010 for an overview). In such cases, nuclear data often correlate better with morphology, while plastid data contain a strong geographical signal (Albaladejo et al. 2005). Our nuclear data support a phylogenetic sister relationship between S. tibetica and Stachyopsis. The morphological data suggest that S. tibetica is about as closely related to Eriophyton as to Stachyopsis. The four species of Stachyopsis (S. lamiiflora [Rupr.] Popov & Vved., S. maleolens [Rech.f.] Hedge, S. marrubioides [Regel] Ikonn.-Gal. and S. oblongata) are more similar to each other than to S. tibetica. Hence, inclusion of S. tibetica would render the genus more variable and increase the distribution area to a moderate extent. It is more problematic as the distinction between Stachyopsis and Eriophyton is rather weak and would be further diminished by inclusion of S. tibetica which is intermediate in several differential characters (Table 1). This problem with distinguishing and defining the two genera provides reasons to question their status as separate genera. The third alternative, to include both Stachyopsis and S. tibetica in Eriophyton, is the least problematic. The group is supported as monophyletic in both the plastid tree (Fig. 1) and the nuclear tree (Fig. 2). An expanded genus Eriophyton will contain 11 species and can be defined by having the following combination of characters: usually hairy anthers, prominent and apically rounded to slightly emarginate lateral lobes of the lower lip of the corolla and apically truncate or subtruncate nutlets. For the above given reasons, favoring the latter option, we propose the corresponding five nomenclatural changes. Taxonomic conclusions Eriophyton Benth. in N. Wallich, Pl. Asiat. Rar. 1:63. 1830. –Type: E. wallichii Benth. = Erianthera Benth., Hooker’s J. Bot. Kew Gard. Misc. 3:880. 1833, nom illeg., non Nees 1832 : Alajja Ikonn., Novosti Sist. Vyssh. Rast. 8:274. 1971 : Susilkumara Bennet, Indian Forester 107:432. 1981. –Type: E. rhomboidea Benth. 123 = Stachyopsis Popov & Vved., Trudy Turkestansk. Nauchn. Obshch. 1:120 (1923), syn. nov. –Type: S. oblongata (Schrenk) Popov & Vved., designated here. = Menitskia (Krestovsk.) Krestovsk., Bot. Zhurn. (Moscow & Leningrad) 91:1893 (2006), syn. nov. –Type: M. tibetica (Vatke) Krestovsk. Bendiksby et al. (2011a) presented a revised version of the genus description in Harley et al. (2004). After the inclusion of S. tibetica and the genus Stachyopsis, this description has to be modified again: Perennial herbs with a woody root and unbranched hairs. Leaves crenate or sometimes shallowly pinnately lobed. Calyx actinomorphic or slightly zymomorphic, subequally 5-lobed. Corolla 15–40 mm long, tube longer or shorter than the calyx, exannulate or annulate, upper lip hairy above, not bearded along the margin, lower lip 3-lobed, mid-lobe slightly to much larger than the lateral lobes, emarginate to almost entire and lateral lobes prominent, rounded or sometimes emarginate. Anthers usually hairy. Nutlets apically truncate or subtruncate. Eleven species growing in alpine area at 2,000–5,000 m in Kazakhstan, Uzbekistan, Kyrgyzstan, Tadzhikistan, Afghanistan, N Pakistan, N India, China (Xinjiang, Tibet, Yunnan) and Nepal. Eriophyton lamiflorum (Rupr.) Bräuchler, comb. nov. : Stachys lamiiflora Rupr. in F.von der Osten-Saken & F.J.Ruprecht, Sert. Tianschan.: 67 (1869) : Stachyopsis lamiiflora (Rupr.) Popov & Vved., Trudy Turkestansk. Nauchn. Obshch. 1:122 (1923). –Type: Kyrgyzstan, Tien Shan, ‘‘Kastek-schlucht’’, ‘‘Sary-dschasyk’’ 6 July 1867 (18 July 1867), Osten-Saken s.n. (holotype in LE?). Eriophyton maleolens (Rech.f.) Salmaki, comb. nov. : Stachys maleolens Rech.f., Biol. Skr. 8(1): 60 (1955); Stachyopsis maleolens (Rech.f.) Hedge, Notes Roy. Bot. Gard. Edinburgh 28:142 (1968). –Type: Afghanistan, Badakhshan Province, Khash District, 9 Aug. 1937, Koelz 13014 (holotype in W; isotype in US). Eriophyton marrubioides (Regel) Ryding, comb. nov. : Phlomis marrubioides Regel, Trudy Imp. S.-Peterburgsk. Bot. Sada 6:375 (1879) : Stachyopsis marrubioides (Regel) Ikonn.-Gal., Izv. Glavn. Bot. Sada S.S.S.R. 26:72 (1927). –Type: China, Xinjiang Uyghur A.R. (Sinkiang), ‘‘in Turkestaniae orientalis trajectu Tschubaty 9-100000 alt.’’, Regel s.n. (syntype in LE?, isotype in P?); ‘‘ad lacum Sairam’’, Fetissof s.n. (syntype in LE?). = Phlomis oblongata var. canescens Regel, Trudy Imp. S.Peterburgsk. Bot. Sada 9:593 (1886) : Stachyopsis oblongata var. canescens (Regel) Popov & Vved., Trudy Turkestansk. Nauchn. Obshch. 1:122 (1923) : Stachyopsis canescens (Regel) Adylov & Tulyag., Opred. Rast. Sred. Azii 9:114 (1987). –Type: China, Xinjiang Uyghur A.R. (Sinkiang), ‘‘in alpium Dschungariae iliensis Author's personal copy The generic position of Stachys tibetica Vatke orientalis trajectu montium Tschubaty a lacu Sairam ad fl. Borotalam ducente ad alt. 9-100000 ’’, Aug 1878, Regel s.n. (holotype in LE?). Eriophyton oblongatum (Schrenk) Bendiksby, comb. nov. : Phlomis oblongata Schrenk in F.E.L.von Fischer & C.A.von Meyer, Enum. Pl. Nov. 1:29 (1841) : Stachyopsis oblongata (Schrenk) Popov & Vved., Trudy Turkestansk. Nauchn. Obshch. 1:121 (1923). –Type: Tajikistan, ‘‘in vallibus graminosis montim Dschillkaragai (Dzhilkaragai)’’, Schenk s.n. (holotype in LE). = Leonurus dschungaricus Regel, Trudy Imp. S.-Peterburgsk. Bot. Sada 6:367 (1879). –Types: China, Xinjiang Uyghur A.R (Sinkiang), ‘‘in alpium lacum Sairam cingentium valle fluvii Chorgos, 5-60000 alt.’’, Regel s.n. (syntype in LE?); China, Xinjiang Uyghur A.R. (Sinkiang), ‘‘in angustis fluvii Talki’’, Regel s.n. (syntype in LE?); China, Xinjiang Uyghur A.R. (Sinkiang), ‘‘in alpibus dschungaricus lacum Sairam adjacentibus’’, Regel s.n. (syntype in LE?); Kazakhstan, ‘‘ad fluvium Almatinka majore prope Wernoje’’, Regel s.n. (syntype in LE?). = Stachyopsis ovata Diugaeva, Novosti Sist. Vyssh. Rast. 1968:180 (1968). –Type: Asia Media, Pamiro-Alaj, jugum Hissaricum, declive austro-orientale, in loco Darja-Sary, pratum subalpinum, 2,500 m s. m., 25 VII 1965, fl., n° 44, A. Aschirmuchamedov et R. Saprunova (LE). Eriophyton tibeticum (Vatke) Ryding, comb. nov. : S. tibetica Vatke, Bot. Zeitung (Berlin) 33:447 (1875) : Menitskia tibetica (Vatke) Krestovsk., Bot. Zhurn. (Moscow & Leningrad) 91:1894 (2006). –Type: India?, Kashmir?, ‘‘in Tibetiae occidentalis alt. 10-140000 ’’, T. Thomson s.n. (types in E, K, C, PH?). Acknowledgments We thank the NRC (Norwegian Research Council: grant no 154145) and the Natural History Museum (University of Oslo, Norway) for financial support to M.B., the DAAD (Deutscher Akademischer Austausch Dienst) for a grant to Y.S. and the EU for a SYNTHESYS-II grant to C.B. (DK-TAF-2392). We also appreciate the help and support of Prof. Dr. Günther Heubl and kind assistance from Tanja Ernst (Munich) in Heubl’s laboratory of plant molecular systematics, Prof. Shahin Zarre (Tehran, Iran) and Charlotte Lindqvist (Buffalo, USA). Appendix See Table 2. Table 2 Alphabetical list of specimens used in the present study including voucher information, country of origin and GenBank accession numbers Taxon Voucher information Origin nrITS GenBank accession no. trnL intron trnL-F spacer rps16 intron matK Acanthoprasium integrifolium (Benth.) Ryding H. Lindberg s.n. 11.06.1939 (sS) Cyprus N/A FJ854263 FJ854150 FJ854016 HQ911486 Achyrospermum fruticosum Benth. P. Phillipson 2082 (S) Madagascar N/A FJ854250 FJ854137 FJ854003 HQ911420 Acrotome hispida Benth. P. Herman 1990 (C) South Africa N/A EU138376 EU138299 EU138224 HQ911530 Ajugoides humilis (Miq.) Makino J. Ohwi & K. Okamoto 1401 (UPS) Japan N/A HQ911678 HQ911746 HQ911609 HQ911452 Anisomeles indica (L.) Kuntze E. Emanuelsson 2027 (S) Pakistan KF769017* FJ854259 FJ854146 FJ854012 HQ911395 Ballota hirsuta Benth. Podlech 53328 (M) Morokko JN680359 N/A N/A N/A N/A B. hispanica (L.) Benth. ASG s.n. (ORT) N/A AF335641 N/A N/A N/A N/A B. nigra L. subsp. ruderalis (Sw.) Briq. M. Bendiksby & A.-C. Scheen 0431 (O) Greece N/A FJ854264 FJ854151 FJ854017 HQ911497 Betonica alopecuros L. S. Vautier 2661390 (US) Italy KF769018* FJ854308 FJ854203 FJ854088 HQ911446 B. officinalis L. 1. C. Lindqvist & V.A. Albert 357 (UNA) Cultivated N/A AF502056 FJ854224 FJ854109 N/A 2. Schuhwerk 09-150 N/A JN680360 N/A N/A N/A N/A Bostrychanthera deflexa Benth. Sino-American Guizhou Bot. Exped. 1923 (A) China N/A FJ854267 FJ854154 FJ854020 HQ911423 Brazoria truncata (Benth.) Engelm. & A.Gray D. S. Corell 16051 (DH, TEX) Texas N/A EF546969 EF546892 HQ911601 HQ911433 Chaiturus marrubiastrum (L.) Ehrh. ex Rchb. A. Pedersen 14 (C) Germany N/A FJ854268 FJ854155 FJ854022 HQ911464 123 Author's personal copy M. Bendiksby et al. Table 2 continued Taxon Voucher information Origin nrITS GenBank accession no. trnL intron trnL-F spacer rps16 intron matK Chamaesphacos ilicifolius Schrenk K. H. Rechinger 50961 (C) Iran KF529540* FJ854269 FJ854156 FJ854023 HQ911549 Chelonopsis longipes Makino S. Okuyama & N. Maruyama s.n. Nov. 1951 (UPS) Japan N/A EF546938 EF546861 FJ854024 HQ911424 Colebrookea oppositifolia Sm. B. Hansen & T. Smitinand 12747 (C) Thailand KF769019* HQ911655 HQ911723 HQ911585 HQ911389 Colquhounia elegans Wall. C. F. van Beusekom & C. Phengklai 3008 (C) Thailand KF769020* EF546937 EF546859 FJ854027 HQ911422 Comanthosphace japonica (Miq.) S.Moore M. Ono & S. Kobayashi 45908 (S) Japan N/A FJ854272 FJ854159 FJ854029 HQ911407 Craniotome furcata (Link) Kuntze O. Polunin & al. 5638 (UPS) Nepal KF769021* FJ854275 FJ854162 FJ854032 HQ911392 Cymaria dichotoma Benth. C. Wang 33150 (US) China N/A FJ854245 FJ854132 FJ853998 HQ911388 Eremostachys laevigata Bunge 1. J. Frödin 202 (UPS) Kurdistan KF769022* GU993260 GU993069 GU993165 HQ911484 2. Salmaki & Siadati 39152 (TUH) Iran JN680397 N/A N/A N/A N/A 1. Dr. J.E.T. Aitchison 831 (C) Afghanistan N/A HQ911683 HQ911753 HQ911614 HQ911460 Eriophyton rhomboideum (Benth.) Ikonn. 2. T. Thomson (C) Typus Tibet N/A HQ911684 HQ911754 HQ911615 HQ911461 E. wallichii Benth. 1. Stainton & al. 7748 (UPS) 2. D990 Nepal China KF769023* JF976304 FJ854277 N/A FJ854164 N/A FJ854034 N/A HQ911462 N/A Eurysolen gracilis Prain. E. Hennipman 3215 (C) Thailand N/A HQ911664 HQ911732 HQ911593 HQ911402 Galeopsis angustifolia Hoffm. E. Dahl s.n. 26.08.1979 (O) France KF529535* EF546939 EF546862 FJ854035 HQ911441 Galeopsis pubescens Besser T. Tacik & M. Sychowa 366 (O) Poland KF529536* EF546940 EF546863 FJ854036 HQ911444 Gomphostemma javanicum (Blume) Benth. G.E. Juan s.n. 17.08.1945 (US) Myanmar N/A HQ911667 HQ911735 HQ911595 N/A Haplostachys haplostachya (A.Gray) H.St.John S. Perlman 14328 (NY) Hawaii KF529541* AF502029 FJ854166 FJ854039 HQ911565 Hypogomphia turkestana Bunge O. Paulsen 275 (C) C Asia KF529543* HQ911703 HQ911774 HQ911634 HQ911551 Isoleucas arabica O. Schwartz M. Thulin & al. 8402 (UPS) Yemen N/A EU138380 EU138303 EU138227 HQ911508 Lagochilus cabulicus Benth. 1. E. Emanuelsson 2456 (S) Pakistan N/A FJ854279 FJ854167 FJ854040 HQ911468 2. Rechinger 56201 (M) Iran JN680362 N/A N/A N/A N/A Lagopsis marrubiastrum (Stephan) Ikonn.-Gal. T. Thomson s.n. no date (C) Tibet N/A HQ911690 HQ911761 HQ911619 HQ911472 Lamium album L. M. Bendiksby 05-014 (O) Norway KF529537* JF779961 JF779961 JF780035 JF779864 L. amplexicaule L. 1. J. I. Båtvik 102 (O) 2. Jap 06/79 (BO) Norway Japan N/A AB266245 JF779969 N/A JF779969 N/A JF780043 N/A N/A N/A L. galeobdolon (L.) L. subsp. galeobdolon M. Bendiksby 05-016 (O) Norway KF529538* JF779994 JF779994 JF780068 JF779869 L. multifidum L. J. & F. Bornmüller 14536 (S) Turkey KF769024* FJ854335 FJ854241 FJ854128 HQ911457 L. purpureum L. 1. N. Orderud s.n. 18.7.1999 (O) Russia N/A JF780027 JF780027 JF780100 N/A 2. Jap 06/78 (BO) Japan AB266244 N/A N/A N/A N/A 123 Author's personal copy The generic position of Stachys tibetica Vatke Table 2 continued Taxon Voucher information Origin nrITS GenBank accession no. trnL intron trnL-F spacer rps16 intron matK Leonotis leonurus (L.) R. Br. F. Venter & P. Vorster 171 (US) S Africa N/A EU138382 EU138305 EU138229 HQ911521 Leonurus chaituroides C.Y. Wu & H.W. Li Z. Chao 030730001 (SHMU) N/A DQ903316 N/A N/A N/A EF395813 L. glaucescens Bunge Z. Chao 060728002 (SHMU) N/A EF395808 N/A N/A N/A EF395811 L. sibiricus L. 1. H. Xie 050619003 (SHMU) N/A EF395806 N/A N/A N/A N/A 2. T. M. Pedersen 16317 (UPS) Argentina N/A EF546930 EF546852 FJ854045 HQ911471 1. I. Roldugin & V. Fissjun 5393 (S) Kazakhstan N/A EF546931 EF546853 FJ854046 HQ911466 2. Z. Chao 060728003 (SHMU) N/A EF395809 N/A N/A N/A N/A Leucas inflata Benth. M. Thulin & al. 3869 (UPS) Ethiopia N/A EU138410 EU138333 EU138257 HQ911518 L. lavandulifolia Sm. C.A. Salsedo 164 (US) Palau, N/A EU138414 EU138337 EU138261 HQ911505 L. spiculifolia (Balf.f.) Gürke M. Thulin & A.N. Gifri 8688 (UPS) Yemen, Socotra N/A EU138425 EU138348 EU138272 HQ911517 Leucosceptrum canum Sm. C.T. Mason Jr. & P.B. Mason 3963 (US) Nepal N/A FJ854283 FJ854171 FJ854047 HQ911404 Loxocalyx ambiguus (Makino) Makino G. Murata & T. Shimizu 1233 (S) Japan N/A HQ911680 HQ911750 HQ911611 N/A Macbridea alba Chapm. E. S. Ford & E. West s.n. 14.06.1955 (GH) USA N/A EF546962 EF546885 HQ911598 HQ911428 L. turkestanicus V.I. Krecz. & Kuprian. Marrubium supinum L. J. Barber 203 (TEX) Spain AF335642 AF335681 N/A N/A N/A M. vulgare L. I. & O. Hedberg 92075 (UPS) Saudi Arabia d* EU138443 EU138366 EU138294 HQ911499 Matsumurella tuberifera (Makino) Makino C-C. Liao 1125 (GH) Taiwan N/A HQ911679 HQ911747 HQ911610 HQ911453 Melittis melissophyllum L. 1. M. Bendiksby 09-010 (O) Cultivated KF529544* HQ911702 HQ911773 HQ911633 HQ911534 2. M. E. Steiner & al. 1127 (UPS) Hungary KF529545* EF546929 EF54849 FJ854051 HQ911535 H. Y. Liang 66028 (US) China N/A FJ854287 FJ854174 FJ854052 HQ911393 Microtoena patchoulii (Hook.f.) C.Y. Wu & S.J. Hsuan Moluccella laevis L. W. C. Brumbach 7249 (S) USA N/A EU138444 EU138367 FJ854055 N/A Otostegia modesta S. Moore M. G. Gilbert & D. Sebsebe 8631 (UPS) Ethiopia N/A EU138437 EU138360 EU138283 XXXX Panzerina lanata (L.) Soják T. Norlindh & T. Ahti 10044 (S) Mongolia N/A FJ854290 FJ854177 FJ854059 XXXX Paraphlomis javanica (Blume) Prain 1. J. F. Rock 1097 (US) Thailand N/A FJ854292 FJ854178 FJ854061 XXXX 2. Fang 091066 (KUN) N/A EU827095 N/A N/A N/A N/A 3. Liu & Chen 67 (E) Taiwan JN680357 N/A N/A N/A N/A P. hispida C. Y. Wu Fang 091058 (KUN) N/A EU827112 N/A N/A N/A N/A Phlomidoschema parviflorum (Benth.) Vved. J. S. Andersen & I.C. Petersen 394 (C) Afghanistan KF529546* FJ854293 FJ854179 FJ854062 HQ911546 Phlomis fruticosa L. 1. E. Julin s.n. 19.04.1985 (UPS) Greece KF529539* FJ854294 FJ854180 FJ854063 HQ911475 2. Roessler 6880 (MSB) Montenegro JN680364 N/A N/A N/A N/A Phlomoides rotata (Benth. ex Hook.f.) Mathiesen 1. Dikore 3537 (MSB) China JN680371 N/A N/A N/A N/A 2. Fang 091022 (KUN) N/A EU827099 N/A N/A N/A N/A 3. Ludlow & al. 15600 (US) Tibet N/A GU993241 GU993050 HQ911620 HQ911479 123 Author's personal copy M. Bendiksby et al. Table 2 continued Taxon P. tuberosa (L.) Moench Phyllostegia velutina (Sherff) H.St.John Physostegia virginiana (L.) Benth. Pogostemon cablin (Blanco) Benth. P. heyneanus Benth. Prasium majus L. Rostrinucula dependens (Rehder) Kudô Roylea cinerea (D.Don) Baill. Rydingia integrifolia (Benth.) Scheen & V.A. Albert Sideritis hyssopifolia L. Stachyopsis oblongata (Schrenk) Popov & Vved. Stachys alpigena T.C.E.Fr. S. byzantina K.Koch S. debilis Kunth S. hyssopoides Burch. ex Benth. S. spinosa L. S. sylvatica L. S. tibetica Vatke. Stenogyne sessilis Benth. S. bifida Hillebr. Suzukia shikikunensis Kudô Synandra hispidula (Michx.) Baill. Thuspeinanta persica (Boiss.) Briq. Warnockia scutellarioides (Engelm. & A. Gray) M.W. Turner Voucher information Origin nrITS GenBank accession no. trnL intron trnL-F spacer rps16 intron matK M. Bendiksby 09-001 (O) V. A. Albert & al. HI03-061 (O) M. Bendiksby 09-011 (O) Cult. Hawaii KF769025* KF529547* HQ911691 HQ911704 HQ911762 HQ911775 HQ911621 HQ911635 HQ911481 HQ911566 Cult. N/A HQ911671 HQ911738 HQ911602 HQ911437 PS0119MT02 N/A FJ980282 N/A N/A N/A N/A J. Klackenberg 100 (S) M. Thulin 5752 (UPS) D.E. Boufford & al. 24415 (A) 1. O. Polunin & al. 837 (UPS) 2. W. Koeltz 4651 (US) M. Thulin & al. 8161 (UPS) Sri Lanka Spain China KF769026* KF529550* N/A FJ854297 FJ854300 FJ854302 FJ854184 FJ854187 FJ854189 FJ854069 FJ854072 FJ854074 HQ911401 HQ911541 HQ911405 Nepal KF769027* EU138450 EU138373 EU138290 HQ911454 India Yemen KF769028* N/A HQ911682 EU138435 HQ911752 EU138358 HQ911613 EU138282 HQ911455 HQ911502 J. Barber 202 (TEX) 1. I. Roldugin & V. Fissjun 3006795 (US) 2. I. Roldugin & V. Fissjun 5394 (C) 3. M. Popov & A. Vvedensky s.n. (H) O. Ryding 2133 (UPS) C. Lindqvist and V.A. Albert 356 (UNA) C. Jativa and C. Epling 242 (US) E. Retief 1080 (US) M. Bendiksby & A.-C. Scheen 04-022 (O) M. Bendiksby & A. Tribsch 06-011 (O) Dikore 13712 (MSB) V. A. Albert & al. HI03-067 (O) V. A. Albert & al. HI03–032 (O) C–C. Liao & al. 564 (A) V. E. McNeilus 97-143 (GH) Spain Kazachstan AF335633 KF769029* AF502037 N/A FJ854193 N/A FJ854078 N/A N/A N/A Kazachstan KF769030* HQ911686 HQ911757 HQ911616 HQ911463 Uzbekistan N/A HQ911687 HQ911758 N/A N/A Ethiopia Cult. KF529561* KF529577* FJ854309 AF502046 FJ854204 FJ854211 FJ854089 FJ854096 HQ911555 N/A Ecuador KF529584* FJ854317 FJ854216 FJ854101 HQ911563 South Africa Greece KF529600* KF529639* FJ854319 FJ854329 FJ854218 FJ854232 FJ854103 FJ854117 HQ911544 HQ911537 Italy KF529643* AF502063 FJ854235 FJ854120 N/A Pakistan Hawaii KF769031* N/A KF769032* HQ911705 KF769033* HQ911776 KF769034* HQ911636 N/A HQ911567 Hawaii KF529652* N/A N/A N/A N/A Taiwan USA KF529655* N/A FJ854332 EF546970 FJ854238 EF546893 FJ854123 FJ854124 HQ911562 HQ911427 K. H. Rechinger 9604 (S) Iraq KF529657* FJ854334 FJ854240 FJ854126 HQ911550 M. H. Mayfield & G. Nesom 1970 (US) USA N/A EF546971 EF546894 FJ854127 HQ911430 Multiple accessions from the same species are numbered. Missing data are indicated with N/A * Sequence data generated for this study are indicated with an asterisk behind the accession number d Sequence shorter than 200 bp: L. multifidum L, Turkey,. J. & F. Bornmüller 14536 (S), ITS2, partial CACCTCCGCGCGCGGCCGGCCCAAATGCCAATCCGCCGTCGACTCACGTCGCGACCAGTGGTGGTTGAACTATCAACTCGCGTGCTGTCGCGCTCCACGGCGTCGTCGGTCCGGAAACAK CAACGCAACCCAACGGCGCGAGCACGCATCGTGCCCACGACCGCGACCCC 123 Author's personal copy The generic position of Stachys tibetica Vatke References Albaladejo RG, Fuertes Aguilar J, Aparicio A, Nieto Feliner G (2005) Contrasting nuclear–plastidial phylogenetic patterns in the recently diverged Iberian Phlomis crinita and P. lychnitis lineages (Lamiaceae). Taxon 54:987–998 Bendiksby M, Thorbek L, Scheen A-C, Lindqvist C, Ryding O (2011a) An updated phylogeny and classification of Lamiaceae subfamily Lamioideae. Taxon 60:471–484 Bendiksby M, Brysting AK, Thorbek L, Gussarova G, Ryding O (2011b) Molecular phylogeny and taxonomy of the genus Lamium L. (Lamiaceae), Disentangling origins of presumed allotetraploids. Taxon 60:986–1000 Bräuchler C, Meimberg H, Heubl G (2010) Molecular phylogeny of Menthinae (Lamiaceae, Nepetoideae, Mentheae)—Taxonomy, biogeography and conflicts. Mol Phylogenet Evol 55:501–523 Dickoré WB (2013) The Himalayan Uplands Plant database (HUP Version 1). Global Mountain Biodiversity Assessment GMBA. http://data.gbif.org/datasets/resource/14158. Accessed 26 Feb 2013 Goloboff P (1999) NONA (ver. 1.9). Software published by the author, San Miguel de Tucumán, Argentina. Available at http:// www.cladistics.com Govaerts R, Paton AJ, Harvey Y, Navarro T (2013) World checklist of lamiaceae & verbenaceae. The Board of Trustees of the Royal Botanic Gardens, Kew, Richmond. http://www.kew.org/wcsp/ lamiaceae. Accessed 25 May 2013 Harley RM, Atkins S, Budantsev AL, Cantino PD, Conn BJ, Grayer R, Harley MM, de Kok R, Krestovskaya T, Morales R, Paton AJ, Ryding O, Upson T (2004) Labiatae. In: Kubitzki K, Kadereit JW (eds) The Families and genera of vascular plants 7. Springer, Berlin & Heidelberg, pp 167–275 Hedge IC (1990) Labiatae. In: Ali SI, Nasir YJ (eds) Flora of Pakistan 192. Royal Botanic Gardens, Edinburgh Hooker JD (1885) Labiatae. In: Hooker JD (ed) Flora of British India 4.L. Reeve & CO., London, pp 604–705 Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17:754–755 Jobb G, von Haeseler A, Strimmer K (2004) TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics. BMC Evol Biol 4:9 JSTOR plant science (2013) Herbarium sheets published on the internet at http://www.plants.jstor.org. Accessed 20 Oct 2013 Krestovskaya TV (2003) New subgenus of the genus Stachys (Lamiaceae). Bot Zhurn (Moscow & Leningrad) 88:94–97 Krestovskaya TV (2006) Menitskia, a new genus of the Labiatae family. Bot Zhurn (Moscow & Leningrad) 91:1892–1894 Kumar D, Bhat ZA, Kumar V, Khan NA, Chashoo IA, Zargar MI, Shah MY (2012) Effects of Stachys tibetica essential oil in anxiety. Eur J Integr Med 4:169–176 Nixon KC (1999) WINCLADA (Beta), v. 0.9.9. Software published by the author, Ithaca, NY. Available at http://www.cladistics. com Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574 Salmaki Y, Jamzad Z, Zarre S, Bräuchler C (2008) Pollen morphology of Stachys (Lamiaceae) in Iran and its systematic implication. Flora 203:617–626 Salmaki Y, Zarre S, Jamzad Z, Bräuchler C (2009) Trichome micromorphology of Iranian Stachys (Lamiaceae) with emphasis on its systematic implication. Flora 204:371–381 Salmaki Y, Zarre S, Lindqvist C, Heubl G, Bräuchler C (2011) Comparative leaf anatomy of Stachys (Lamiaceae: Lamioideae) in Iran with a discussion on its subgeneric classification. Plant Syst Evol 294:109–125 Salmaki Y, Zarre S, Ryding O, Lindqvist C, Scheunert A, Bräuchler C, Heubl G (2012a) Phylogeny of the tribe Phlomideae (Lamioideae: Lamiaceae) with special focus on Eremostachys and Phlomoides: New insights from nuclear and chloroplast sequences. Taxon 61:161–179 Salmaki Y, Zarré S, Govaerts R, Bräuchler C (2012b) A taxonomic revision of the genus Stachys (Lamiaceae: Lamioideae) in Iran. Bot J Linn Soc 170:573–617 Salmaki Y, Zarre S, Ryding O, Lindqvist C, Bräuchler C, Heubl G, Barber J, Bendiksby M (2013) Molecular phylogeny of the tribe Stachydeae (Lamiaceae subfamily Lamioideae). Mol Phylogenet Evol 69:535–551 Scheen A-C, Bendiksby M, Ryding O, Mathiesen C, Albert VA, Lindqvist C (2010) Molecular phylogenetics, character evolution and suprageneric classification of Lamioideae (Lamiaceae). Ann Missouri Bot Gard 97:191–219 Vatke W (1875) Notulae criticae in Stachydis generis species, quae adsunt in herbario regio berolinensi. Bot Zeit (Berlin) 33:446–450 123