Diversity and Phylogeny of Gyrodactylus spp. (Monogenea: Gyrodactylidae) across the Strait of Gibraltar: Parasite Speciation and Historical Biogeography of West Mediterranean Cyprinid Hosts

Rahmouni, Chahrazed; Seifertová, Mária; Benovics, Michal; Šimková, Andrea

doi:10.3390/d15111152

Open AccessEditor’s ChoiceArticle

Diversity and Phylogeny of Gyrodactylus spp. (Monogenea: Gyrodactylidae) across the Strait of Gibraltar: Parasite Speciation and Historical Biogeography of West Mediterranean Cyprinid Hosts

Department of Botany and Zoology, Faculty of Science, Masaryk University, Kotlářská 2, 611 37 Brno, Czech Republic

^*

Author to whom correspondence should be addressed.

Diversity 2023, 15(11), 1152; https://doi.org/10.3390/d15111152

Submission received: 29 September 2023 / Revised: 26 October 2023 / Accepted: 28 October 2023 / Published: 20 November 2023

(This article belongs to the Special Issue Diversity and Phylogenetics of Parasites in Aquatic Animals)

Download

Browse Figures

Review Reports Versions Notes

Abstract

:

Knowledge on the diversity of parasitic flatworms of Western Mediterranean cyprinids is extremely scarce. In the present study, we parasitologically investigated 12 cyprinid species across the Strait of Gibraltar inhabiting watersheds in northwest Africa (Morocco) and Iberia (Portugal and Spain). Taxonomically relevant features of the attachment organ and sequences of the 18S rDNA and ITS regions were used for species delineation and to investigate their phylogenetic relatedness. Among the Gyrodactylus collected from Morocco and Spain, we identified specimens with an unusual T-shaped dorsal bar observed herein for the first time. In contrast, the membranous patch-like structure surrounding the twisted inner roots of hamuli and the median ridge of the ventral bar have been generally observed in Eurasian relatives. Our analyses suggest vicariant speciation of Gyrodactylus across the Strait of Gibraltar. We describe herein G. gibraltarensis sp. nov. from Iberian Luciobarbus graellsii; G. moroccensis sp. nov. from northwest African cyprinids, i.e., L. maghrebensis, L. rabatensis, L. rifensis, L. yahyaouii, and L. zayanensis; and finally, G. pseudomoroccensis sp. nov. from Moroccan L. ksibi, all possessing a new haptoral configuration. The genetic divergence and conservative morphologies in populations of G. moroccensis sp. nov. from five cyprinid species support its ongoing speciation in Northwest Africa. The West Mediterranean lineage was revealed to be monophyletic, with Eurasian species forming a sister group. Morphologically, West Mediterranean Gyrodactylus also appeared to be of Middle Eastern origin. Gyrodactylus spp. possessing an unusual T-shaped dorsal bar have most likely speciated, allowing for the appearance of a haptoral morphology that is restricted to the region across the Strait of Gibraltar. To conclude, viviparous Gyrodactylus reflect parasite speciation across the Strait of Gibraltar and the historical biogeography of cyprinids in the West Mediterranean.

Keywords:

cyprinoids; Morocco; Iberian Peninsula; viviparous Monogenea; haptor morphology; Northwest Africa; Southwest Europe

1. Introduction

Parasitism is one of most successful modes of life, with almost every animal species potentially parasitized by at least one parasite species [1]. This mode has evolved independently in over 200 lineages throughout the animal tree of life alone [2], making parasites one of the best models for studying speciation processes due to their high potential for diversification and specialization [1]. As hosts represent the primary source of life for parasites, both are affected by reciprocal evolutionary interactions, and the diversification processes of one may influence those of the other [3]. From a parasitological perspective, it is generally accepted that sympatric speciation may occur when the isolation of parasite populations is maintained by intrinsic barriers independently of host speciation events [4,5]. Inversely, allopatric speciation may appear when extrinsic barriers prevent parasite reproduction among geographically isolated host populations [5].

Monogenea, a group of over 5500 parasitic flatworm species [6] parasitizing mostly teleost fish, appear to be the most suitable candidates for studying host–parasite speciation patterns due to their direct life cycle that favors fast infection [7,8]. Previous studies devoted to identifying the processes of diversification in monogeneans have focused on fish taxa living in sympatry, which has biased conclusions in favor of sympatric speciation as the most common evolutionary scenario. This was demonstrated for oviparous dactylogyrid monogeneans in particular [5,9,10,11], with allopatric speciation known mainly in viviparous gyrodactylids (Gyrodactylidae van Beneden et Hesse, 1832) [12].

Gyrodactylids are ectoparasitic monogeneans that feed mostly on the epithelial cells of freshwater and marine teleost fish [13,14]. The extremely rare viviparity observed in most gyrodactylids with fully grown daughters in utero have made them the focus of intensive research [15]. A recent study by Boeger et al. [16] supported the monophyly of Gyrodactylidae and summarized the evolutionary features that most members of the family share, such as the loss of the Mehlis gland, the vitellarium, and characters related to the male copulatory organ (MCO) (see exceptions in [17]). Taxonomically, Gyrodactylidae is composed of 25 valid viviparous genera [16,17]. Pugachev et al. [18] classified four subfamilies within Gyrodactylidae for the Palearctic region. Gyrodactylinae include four genera recognized on Eurasian fishes: Gyrodactylus von Nordmann, 1832 (more than 300 spp.), Paragyrodactylus Gvosdev and Martechov, 1953 (3 spp.), Laminiscus Pálsson and Beverley-Burton, 1983 (3 spp.), and Gyrodactyloides Bychowski, 1947 (4 spp.). While the first two genera parasitize a wide range of widespread marine and freshwater fish taxonomically representing different families, the two remaining ones are strictly of marine origin and are, so far, limited to a few fish representatives like herring and salmonids [18,19,20,21]. Seven oviparous gyrodactylid genera are found exclusively on the African continent, of which six are specific to teleost fish [6,17,22].

Gyrodactylus, a cosmopolitan and hyper-diverse genus with an estimated 20,000 species worldwide [23], is one of the most valuable model organisms with respect to investigating continental affinities due to its high ability to switch hosts, a scenario which, however, considerably reduces its usefulness in studying phylogenetic inter-host relationships [24]. Nevertheless, with regards to the time scale and the dispersion routes of the hosts studied, Gyrodactylus monogeneans may provide information on the historical dispersion and/or contemporary contacts of their hosts due to host-switch [25]. Recently, gill-specific monogeneans of the genus Dactylogyrus Diesing, 1850 (Dactylogyridae) parasitizing cyprinoids have been applied to infer the historical biogeographical contacts of their hosts on the intercontinental scale [26,27,28], while Gyrodactylus have received less attention in this regard (e.g., [25]). With respect to Gyrodactylus, the limited number of parasitological surveys, especially in the West Mediterranean area, and the still ambiguous taxonomical status of many fish species in this region suggest the presence of much higher-than-expected diversity regarding species number, morphology, and genetics.

With more than 3000 spp. [29] divided into eleven subfamilies [30] and a pan-African distribution, Cyprinidae, sensu [30,31] form the most widespread fish group, from the Maghreb province of Northwest Africa to the South African coastal streams [32]. Torinae Karaman 1971 and Barbinae Bleeker 1859 are recognized as native to the Afro-European region of the West Mediterranean [33]. In this region, Torinae clusters three hexaploid and large-sized cyprinid genera, of which Labeobarbus Karaman, 1971 (~20 spp.) and the monospecific Pterocapoeta Günther, 1902 are both of the ‘Labeobarbus’ clade (Labeobarbus sensu lato) [34,35,36]. Members of Labeobarbus are endemic to Northwest Africa and Southwestern Asia [37], whereas Pterocapoeta is restricted only to Morocco [34,38]. Members of Torinae are in fact the last invaders of the African continent to have crossed the land bridge between Africa and Asia via the Arabian tectonic plate in the Late Miocene (~13 MYA) [39]. Similarly, Barbinae (Barbus sensu stricto) is highly diversified with three genera including the paraphyletic Luciobarbus Heckel, 1843 (more than 35 spp.) [29,38], representing tetraploid cyprinids [35,40,41]. They are present exclusively throughout the circum-Mediterranean area, including the Middle East, North Africa, the Iberian Peninsula, and the Balkan Peninsula (Greece) [41].

For the present study focused on gyrodactylid monogeneans occurring on both sides of the Strait of Gibraltar (Northwest Africa and Iberia), we targeted a range of cyprinids belonging to Luciobarbus and Pterocapoeta inhabiting West Mediterranean freshwater drainage systems located in Morocco, as well as Luciobarbus from Portugal and Spain. The West Mediterranean has been known for past dramatic geological and climate changes since the Cenozoic Era, like the Messinian Salinity Crisis (5.9–5.3 MYA) [42] and the opening of the Strait of Gibraltar (5.3 MYA) [43]. These events have considerably shaped the faunistic evolutionary history in the regions of North Africa and the Iberian Peninsula. These are separated by only the 13 km long Strait of Gibraltar [44]. Being physiologically intolerant to marine conditions, the present-day, wide distributional range of freshwater fishes in Northwest Africa, on the one hand, and confinement in Iberian watersheds, on the other hand, is the result of the paleogeographical evolution of the river basins, and of the history of hydrogeological networks in this area [41,44,45]. From the upper Miocene and Pliocene, ancient tectonic and paleogeographical crises [42] have had the greatest influence on the diversification of West Mediterranean lineages of Luciobarbus originating in the Middle East [46]. Currently, West Mediterranean provinces show the highest diversity of Luciobarbus species, these forming one of the main components of the freshwater ichthyofauna [41,47]. Interestingly, northwest African Luciobarbus spp. are paraphyletic, as two species from this region clustered with Iberian species [35,44,48,49], and they form the most diverse genus of Moroccan cyprinids, e.g., refs. [11,17]. Remarkably, these comprise both limnetic (abundant in upstream areas) and rheophilic species (abundant in downstream areas), like Luciobarbus ksibi (Boulenger, 1905) and Luciobarbus zayanensis Doadrio, Casal-López & Yahyaoui, 2016, respectively. Luciobarbus ksibi co-occur in the Kasab River Basin, while the presence of Luciobarbus yahyaouii Doadrio, Casal-Lopez & Perea, 2016 and L. zayanensis is limited to the Moulouya and Oum Er-Rbia drainage systems, respectively [38,49]. Luciobarbus massaensis (Valenciennes, 1842), Luciobarbus maghrebensis, Luciobarbus rabatensis Doadrio, Perea & Yahyaoui, 2015, and Luciobarbus rifensis Doadrio, Casal-Lopez & Yahyaoui, 2015, are all endemic to watersheds of Northern and Central Morocco [38,50,51]. From the Iberian ichthyogeographic system and out of at least seven endemic Luciobarbus spp. inhabiting South Mediterranean drainage systems [38], we studied Luciobarbus comizo (Steindachner, 1864), Luciobarbus bocagei (Steindachner, 1864), Luciobarbus graellsii (Steindachner, 1866), and Luciobarbus sclateri (Günther, 1868). Like their Northwest African counterparts, Iberian Luciobarbus were shown to be paraphyletic [44,48] due to the rapid block rotation of this system [52].

Using the phylogenetic reconstruction of dactylogyrid monogeneans, Šimková et al. [28] showed multiple origins of Dactylogyrus spp. parasitizing cyprinids in Northwest Africa, reflecting different historical dispersal routes for Torinae and Barbinae, and revealed the historical northern route of Dactylogyrus spp. to Northwest Africa. The authors also demonstrated the multiple origins of Dactylogyrus spp. parasitizing Iberian Luciobarbus species, suggesting several independent historical contacts between Iberian Luciobarbus and two lineages of Northwest African cyprinids. These contacts were associated with host switches of Dactylogyrus parasites. Likewise, Benovics et al. [26] supported the Middle Eastern origin of Dactylogyrus, and evidenced multiple origins of endemic Southern European Dactylogyrus spp. from Barbinae [53]. So far, these studies remain the only ones using gill-specific monogeneans to elucidate historical contacts between West Mediterranean ichthyofauna. Knowledge on the morphological diversity of gyrodactylids of Northwest African cyprinids [54] and from the Iberian Peninsula [55] remains largely insufficient. To our knowledge, the available literature on gyrodactylid species from Iberian cyprinids is outdated and apparently inaccurate [55], and no genetic data are available for Gyrodactylus spp. from the West Mediterranean area. Meanwhile, Palearctic cyprinids and their Gyrodactylus communities have been extensively studied, and pertinent data about the configuration of the haptoral sclerotized structures are fully available [18]. Additionally, hundreds of DNA sequences are available in the GenBank database.

Accordingly, the aim of this study was to investigate the taxonomic and genetic diversity of gyrodactylid fauna in the West Mediterranean, as well as the phylogenetic position of North African and Iberian Gyrodactylus spp. in relation to their congeners worldwide. Considering past geoclimatic events that were experienced by both sides of the Strait of Gibraltar, and which undoubtedly favored multiple dispersion and speciation events in susceptible freshwater fauna like cyprinids, we hypothesized herein multiple origins for West Mediterranean gyrodactylid monogeneans. In terms of parasite morphology, we expected the presence of the Eurasian morphotype of haptoral sclerites in the Northwest African and Iberian lineages due to the shared evolutionary history between eastern and western cyprinid hosts.

2. Material and Methods

2.1. Collection of Cyprinid Host Specimens and Their Gyrodactylid Monogeneans

A total of 128 fish specimens belonging to six cyprinid species restricted to the West Mediterranean were collected in Morocco, Portugal, and Spain between 2015 and 2017. Fish host species with their sample sizes, sampling locations, and indices of Gyrodactylus infection (prevalence and intensity of infection) are shown in Table 1. The sampling localities in Morocco and Iberia are shown in Figure 1. The fish specimens were identified in situ by scientific collaborators (listed in the acknowledgements). In the present study, the fish host nomenclature follows that of FishBase [38] and Eschmeyer’s Catalog of Fishes [29]. According to FishBase [28], both L. ksibi and L. massaensis are synonyms for L. callensis (Valenciennes, 1842), and P. maroccana is a synonym for Labeobarbus maroccanus (Günther, 1902). The external body surface (scales and skin), fins, and gills of the cyprinid hosts were checked for the presence of viviparous gyrodactylid monogeneans using an MST-130 stereoscopic microscope (PZO Ltd., Warsaw, Poland). When present, parasite specimens were removed using surgical needles and mounted on slides with a mixture of glycerine and ammonium picrate (GAP) [56]. Gyrodactylid specimens were studied morphologically and genetically. A selected number of specimens were fixed only on slides using GAP (for morphology), and a selected number of specimens were bisected. The anterior part of the body containing the reproductive organ was stored in 96% ethanol for DNA extraction, and the posterior part of the body containing the haptoral sclerites was mounted on slides with GAP.

2.2. Morphological Characterization and Multivariate Analysis of West Mediterranean Gyrodactylus

Measurements and microphotographs were taken using an Olympus BX51 phase–contrast microscope and Olympus Stream Image Analysis v. 1.9.3 software (Olympus, Tokyo, Japan). Drawings of the haptoral sclerotized parts of flattened specimens (hamuli, bars, marginal hooks, and MCO) were made using an Olympus BX51 microscope equipped with a drawing tube and edited with a graphic tablet compatible with Adobe Illustrator CS6 v. 16.0.0 and Adobe Photoshop v. 13.0 (Adobe Systems Inc., San Jose, CA, USA). The terminology used for the hard parts of gyrodactylid monogeneans follows refs. [15,18]. Infection indices were calculated for each Gyrodactylus species according to ref. [57] (Table 1). The type-material was deposited in the Helminthological collection of the Institute of Parasitology, Biology Centre of Academy of Sciences of the Czech Republic, České Budějovice (IPCAS) under the accession numbers IPCAS-M779–81. Following Ondračková et al. [58], principal component analysis (PCA) was performed on standardized morphometric data using PAST v. 4.11 [59] in order to visualize the position of the gyrodactylid specimens parasitizing Moroccan and Iberian cyprinid hosts that showed unusual haptoral sclerotized structures in morphological space. Measurements of 21 morphological characters of the haptoral sclerotized structures were considered.

2.3. Phylogenetic Reconstruction

To confirm the genus level of the collected gyrodactylid specimens, the nuclear non-coding gene 18S rDNA was amplified, while the internal transcribed spacer composed of the ITS1, 5.8S and ITS2 regions was amplified to confirm the conspecifity of the parasite samples. Indeed, the former marker has repeatedly been shown to be efficient in discriminating among Gyrodactylidae genera, e.g., ref. [57], while the ITS regions permit gyrodactylids to be subdivided into subgenera and species groups while also allowing for accurate species-level delineation [60,61,62]. Genomic DNA was isolated and amplified, and DNA sequences were obtained for the gyrodactylids targeted in this study, including so far undescribed species (Table 1 and Table 2). Each tube containing a single gyrodactylid specimen preserved in 96% ethanol was dried using a vacuum concentrator (Eppendorf concentrator 5301, Hamburg, Germany). The genomic DNA was extracted using the DNeasy^® Blood & Tissue Kit (Qiagen, Hilden, Germany) following the protocol for the purification of total DNA from animal tissues. The partial fragment of 18S rDNA was amplified using the primer pairs PBS18SF (5′–CGCGCAACTTACCCACTCTC–3′) and PBS18SR (5′–ATTCCATGCAAGACTTTTCAGGC–3′) [63]. The fragment spanning ITS1, 5.8S and ITS2 was amplified using the forward primer ITS1F (5′–GTTTCCGTAGGTGAACCT–3′) [64], complementary to the sequence at the 3′ end of the 18S rRNA gene, and the reverse primer ITS2 (5′–TCCTCCGCTTAGTGATA–3′), complementary to the sequence at the 5′ end of the 28S rRNA gene [65]. Polymerase chain reactions (PCRs) for the 18S rDNA and ITS regions were performed in a final volume of 30 μL, containing 1× PCR buffer (Fermentas, Bratislava, Slovakia), 1.5 mM of MgCl₂, 200 μM of each dNTP, 0.5 μM of each primer, 1 U of Taq Polymerase (Fermentas) and 5 μL of template DNA. The PCRs were carried out using a Mastercycler ep gradient S (Eppendorf) in the following steps: (i) for the ITS region: an initial denaturation at 96 °C for 3 min, followed by 39 cycles of denaturation at 95 °C for 50 s, annealing at 52 °C for 50 s, and an extension at 72 °C for 50 s, with a final elongation at 72 °C for 7 min; and (ii) for the 18S region: an initial denaturation at 95 °C for 3 min, followed by 39 cycles of denaturation at 94 °C for 1 min, annealing at 54 °C for 45 s and an extension at 72 °C for 1 min 30 s, with a final elongation at 72 °C for 7 min. The PCR products were electrophoresed on 1.5% agarose gels stained with Good View (SBS Genetech, Bratislava, Slovakia) and then purified using ExoSAP–IT reagents (Thermo Fisher Scientific, Waltham, MA, USA), following the manufacturer’s protocol. The purified PCR products were sequenced directly in both directions using the PCR primers. For sequencing of the ITS region, one additional internal primer, ITSR3A (5′–GAGCCGAGTGATCCACC–3′) [62], was used. Sanger sequencing was carried out using a BigDye^® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems by Life Technologies, Carlsbad, CA, USA; hereinafter Applied Biosystems) and an ABI 3130 Genetic Analyzer (Applied Biosystems). The obtained DNA sequences were assembled and edited using Sequencher software v. 5.0 (Gene Codes Corporation, MI, USA). Newly generated DNA sequences were checked using the NCBI Nucleotide Blast algorithm (nBLAST Search Tool, https://blast.ncbi.nlm.nih.gov/, accessed on 16 July 2023) to assess any similarities to available congeners, then deposited in GenBank under accession numbers (see Table 2). The uncorrected genetic p-distances among the newly generated sequences of the 18S rDNA and ITS regions were calculated separately using MEGA X [66].

The newly obtained sequences of the 18S rDNA and ITS regions were aligned separately using MAFFT v.7 [67], together with already published ones obtained from a representative selection of valid African and European gyrodactylid genera/species according to Boeger et al. [16] (Table 2). The final dataset (18S rDNA: 457 bp, ITS regions: 838 bp) containing a total of 63 DNA sequences from gyrodactylids was concatenated using MEGA 11 [66]. The best-fitting model of molecular evolution was selected for each gene dataset using ModelFinder [68]. According to the Bayesian information criterion (BIC), the TVM + F + I + G model was selected as the most appropriate evolutionary model for the 18S dataset, the TVM + F + I + G model for the ITS1 dataset, the TNe + G model for the 5.8S dataset, and the TVM + F + G model for the ITS2 dataset. Oviparous gyrodactylid species of the Palearctic region, represented by Gyrodactyloides bychowskii Albova, 1948, Ieredactylus rivuli Schelkle et al., 2011 and Laminiscus gussevi (Bychovsky et Polyansky, 1953) were used as outgroups (Table 2). Maximum likelihood (ML) trees were inferred using IQ-TREE v. 2.2.2.6 [69], employing the best fit substitution model (see above) and a sub-tree pruning and re-grafting (SPR) branch-swapping algorithm. Branch support (bootstrap support, BS) was estimated using ultrafast bootstrap approximation [70] with 1000 replicates. Bayesian inference (BI) analysis was performed using MrBayes v. 3.2.1 [71] with two independent Markov chain Monte Carlo (MCMC) simulations (six chains, 10⁶ generations, sampling frequency 100, 25% burn-in). The chain stationarity and parameter convergence were assessed using TRACER v. 1.7.1 [72], with effective sample sizes (ESS) > 200 for all parameters, and via the average standard deviation of split frequencies (<0.01). The post burn-in trees were summarized in a 25% majority rule consensus tree. The ML and BI trees were visualized using FigTree v. 1.4.4 [73].

Finally, clade A (see results section) of the ML tree based on the concatenated sequences of the 18S rDNA and ITS regions was visualized using TreeGraph v. 2.15 [74]. This step was performed in order to show the biogeographical distribution of Gyrodactylus spp. belonging to clade A together with patterns of haptoral sclerotized structures. The Gyrodactylus spp. investigated in this study and additional selected genetically closely related European and Middle East relatives were included. The morphological characters of the different parts of the attachment organ were selected following refs. [15,18].

Table 2. List of gyrodactylid species included in phylogenetic analyses based on sequences of the 18S rDNA gene and ITS regions. Monogenean species are grouped by host species, family, and geographical locality. The sequence indicated by “*” has no reference in the GenBank database. Fish host nomenclature follows FishBase [38] and Eschmeyer’s Catalog of Fishes [29].

Gyrodactylid Species	Host Species	Host Family	Geographical Locality	18S rDNA	ITS Regions	Reference
Afrogyrodactylus girgifae Přikrylová et Luus-Powell, 2014	Brycinus nurse (Rüppell, 1832)	Alestidae	Africa	HF548672	HF548671	[75]
Diplogyrodactylus martini Přikrylová, Matějusová, Musilová, Gelnar and Harris, 2009	Polypterus senegalus Cuvier, 1829	Polypteridae	Africa	HE858426	AM943008	[75]
Gyrodactyloides bychowskii Albova, 1948	Salmo salar Linnaeus, 1758	Salmonidae	Europe	AJ566379	AJ249348	[76]
Gyrodactylus alekosi Prikrylova, Blazek and Vanhove, 2011	Clarias gariepinus (Burchell, 1822)	Clariidae	Africa	FR850683	FR850682	[77]
Gyrodactylus arcuatus Bychowsky, 1933	Gasterosteus aculeatus Linnaeus, 1758	Gasterosteidae	North America	JF836088	AF156668	[61,78]
Gyrodactylus blicensis Glaser, 1974	Gymnocephalus cernua (Linnaeus, 1758)	Percidae	Europe	AJ407896	AJ407869 AJ407919	[62]
Gyrodactylus brachymystacis Ergens, 1978	Brachymystax lenok (Pallas, 1773)	Salmonidae	Asia	JF836109	KP325622 *	[78]
	Carassius auratus (Linnaeus, 1758)	Cyprinidae
	Oncorhynchus mykiss (Walbaum, 1792)	Salmonidae
Gyrodactylus carassii Malmberg, 1957	Alburnus alburnus (Linnaeus, 1758)	Leuciscidae	Europe	AJ566377	AY278033	[62,79]
	Carassius carassius (Linnaeus, 1758)	Cyprinidae
Gyrodactylus cernuae Malmberg, 1957	Gymnocephalus cernua (Linnaeus, 1758)	Percidae	Europe	AJ407897	AJ407869 AJ407919	[62]
Gyrodactylus crysoleucas Mizelle and Kritsky, 1967	Notemigonus crysoleucas (Mitchill, 1814)	Leuciscidae	North America	KT149283	KT149287	[80]
Gyrodactylus derjavinoides Malmberg, Collins, Cunningham and Jalali, 2007	Salmo salar Linnaeus, 1758	Salmonidae	Europe	JF836110	GQ368236	[78]
Gyrodactylus ergensi Přikrylová, Matějusová, Musilová et Gelnar, 2009	Sarotherodon galilaeus (Linnaeus, 1758)	Cichlidae	Africa	HF548668	FN394985	[75]
Gyrodactylus fossilis Lupu and Roman, 1956	Misgurnus fossilis (Linnaeus, 1758)	Cobitidae	Europe	AJ407898	AJ407871 AJ407921	[76]
Gyrodactylus gibraltarensis Rahmouni sp. nov.	Luciobarbus graellsii (Steindachner, 1866)	Cyprinidae	Europe	OR773531	OR773480	This study
Gyrodactylus gobiensis Gloser, 1974	Gobio gobio (Linnaeus, 1758)	Gobionidae	Europe	AJ566375	AY278041	[76]
Gyrodactylus gobii Schulman, 1953	Gobio gobio (Linnaeus, 1758)	Gobionidae	Europe	AJ407900	AJ407873	[62]
Gyrodactylus gracilihamatus Malmberg, 1964	Abramis brama (Linnaeus, 1758) Alburnus alburnus (Linnaeus, 1758)	Leuciscidae	Europe	AJ407901	AF484531	[76,81]
Gyrodactylus azeezsaeedi Rahmouni, 2023	Squalius berak Heckel, 1843	Leuciscidae	Middle East	OR777687	OR773093	[82] this study
Gyrodactylus hronosus Žitňan, 1964	Alburnoides bipunctatus (Bloch, 1782)	Leuciscidae	Europe	AJ407902	AJ407876 AJ407924	[62]
Gyrodactylus jurajdai Rahmouni, 2023	Chondrostoma regium (Heckel, 1843)	Leuciscidae	Middle East	OR777685	OR773088	[82], this study
Gyrodactylus katharineri Malmberg, 1964	Barbus barbus (Linnaeus, 1758)	Cyprinidae	Europe	AJ407903	AJ407878 AJ407926	[62]
Gyrodactylus laevis Malmberg, 1957	Alburnoides bipunctatus (Bloch, 1782)	Leuciscidae	Europe	AJ407904	AY278036	[76]
	Phoxinus phoxinus (Linnaeus, 1758)
Gyrodactylus longoacuminatus Žitňan, 1964	Carassius auratus (Linnaeus, 1758)	Cyprinidae	Europe	AJ407906	AJ407883 AJ407930	[76]
Gyrodactylus luciopercae Gussev, 1962	Perca fluviatilis Linnaeus, 1758	Percidae	Europe	AJ407907	AJ407885	[76]
Gyrodactylus malalai Přikrylová, Blažek et Gelnar, 2012	Oreochromis niloticus (Linnaeus, 1758)	Cichlidae	Africa	FR695485	FR695484	[75]
Gyrodactylus mediotorus King, Marcogliese, Forest, McLaughlin and Bentzen, 2013	Notropis texanus (Girard, 1856)	Gasterosteidae	North America	MW666777	MW666182	[83]
Gyrodactylus moroccensis Rahmouni sp. nov.	Luciobarbus rabatensis Doadrio, Perea and Yahyaoui, 2015	Cyprinidae	North Africa	OR773529	OR773478	This study
	Luciobarbus rifensis Doadrio, Casal-Lopez and Yahyaoui, 2015			OR773528	OR773477
Gyrodactylus mhaiseni Rahmouni, 2023	Alburnus sellal Heckel, 1843	Leuciscidae	Middle East	OR777688	OR773082	[82], this study
Gyrodactylus nigritae Přikrylová, Blažek and Vanhove, 2012	Synodontis nigrita Valenciennes, 1840	Mochokidae	Africa	FR850687	FR850686	[77]
Gyrodactylus pseudomoroccensis Rahmouni sp. nov.	Luciobarbus ksibi (Boulenger, 1905)	Cyprinidae	North Africa	OR773530	OR773479	This study
Gyrodactylus rarus Wegener, 1910	Spinachia spinachia (Linnaeus, 1758)	Gasterosteidae	Europe	AY339776	AY338445	[84]
Gyrodactylus rhodei Žitňan, 1964	Rhodeus sericeus (Pallas, 1776)	Acheilognathidae	Europe	AJ567670	AJ407889 AJ407933	[76]
Gyrodactylus rugiensis Glaser, 1974	Pomatoschistus microps (Krøyer, 1838)	Gobiidae	Europe	AY339762	AY338446	[84]
Gyrodactylus rugiensoides Huyse and Volckaert, 2002	Pomatoschistus minutus (Pallas, 1770)	Gobiidae	Europe	AY339763	AJ427414	[84,85]
Gyrodactylus rutilensis Glaser, 1974	Rutilus rutilus (Linnaeus, 1758)	Leuciscidae	Europe	AJ566376	AJ407890 AJ407934	[76]
Gyrodactylus rysavyi Ergens, 1973	Clarias anguillaris (Linnaeus, 1758)	Clariidae	Africa	FR850680	FR850679	[77]
Gyrodactylus salaris Malmberg, 1957	Salmo salar Linnaeus, 1758	Salmonidae	Europe	JF836111	AJ515912	[86]
	Oncorhynchus mykiss (Walbaum, 1792)
Gyrodactylus salmonis Yin and Sproston, 1948	Oncorhynchus mykiss (Walbaum, 1792)	Salmonidae	Europe	JF836097	MN850542	[78,87]
Gyrodactylus sandai Rahmouni, 2023	Capoeta umbla (Heckel, 1843)	Cyprinidae	Middle East	OR777689	OR773089	[82], this study
Gyrodactylus satanicus Rahmouni, 2023	Garra rufa Heckel, 1843	Cyprinidae	Middle East	OR777686	OR773091	[82], this study
Gyrodactylus sedelnikovi Gvozdev, 1950	Barbatula barbatula (Linnaeus, 1758)	Nemacheilidae	Europe	AJ407911	AJ407891 AJ407935	[62]
Gyrodactylus stephanus Müller, 1937	Fundulus heteroclitus (Linnaeus, 1766)	Gasterosteidae	North America	JF836099	FJ845515	[78,88]
Gyrodactylus synodonti Přikrylová, Blažek, Maarten and Vanhove, 2012	Synodontis nigrita Valenciennes, 1840	Mochokidae	Africa	FR850685	FR850684	[77]
Gyrodactylus teuchis Lautraite, Blanc, Thiery, Daniel and Vigneulle, 1999	Salmo trutta Linnaeus, 1758	Salmonidae	Europe	AJ407912	AJ249350	[76]
Gyrodactylus truttae Gläser, 1974	Salvelinus fontinalis (Mitchill, 1814)	Salmonidae	Europe	JF836112	AJ132260	[65,78]
Gyrodactylus vimbi Shulman, 1954	Squalius cephalus (Linnaeus, 1758)	Leuciscidae	Europe	AJ407914	AJ407892 AJ407936	[62]
Ieredactylus rivuli Schelkle et al., 2011	Anablepsoides hartii (Boulenger, 1890)	Cyprinodontiformes	Neotropical	JX840358	HQ738514	[89,90]
Laminiscus gussevi (Bychovsky et Polyansky, 1953)	Mallotus villosus (Müller, 1776)	Osmeridae	Europe	HF548679	HF548678	[75]
Macrogyrodactylus congolensis (Prodhoe, 1957)	Clarias gariepinus (Burchell, 1822)	Clariidae	Africa	HF548680	GU252716	[75,91]
Macrogyrodactylus polypterid Malmberg, 1957	Polypterus senegalus Cuvier, 1829	Polypteridae	Africa	AJ567671	AJ567672	[76]
Macrogyrodactylus simentiensis Přikrylová and Gelnar, 2008	Polypterus senegalus Cuvier, 1829	Polypteridae	Africa	HF548682	HF548681	[75]
Paragyrodactylus variegatus You, King, Ye and Cone, 2014	Homatula variegata (Dabry de Thiersant, 1874)	Nemacheilidae	Asia	KF680220	KF680221	[19]
Gyrodactylus sp. 1	Luciobarbus bocagei (Steindachner, 1864)	Cyprinidae	Europe	OR807824	OR807835	This study
Gyrodactylus sp. 2	Luciobarbus sclateri (Günther, 1868)	Cyprinidae	Europe	OR807825	OR807836	This study
Gyrodactylus sp. 3	Luciobarbus comizo (Steindachner, 1864)	Cyprinidae	Europe	OR807826	OR807837	This study
Gyrodactylus sp. 4	Luciobarbus bocagei (Steindachner, 1864)	Cyprinidae	Europe	OR807827	OR807838	This study
Gyrodactylus sp. 5	Labeobarbus maroccanus (Günther, 1902)	Cyprinidae	North Africa	OR807828	OR807839	This study
Gyrodactylus sp. 6	Luciobarbus zayanensis Doadrio, Casal-López & Yahyaoui, 2016	Cyprinidae	North Africa	OR807829	OR807840	This study
Gyrodactylus sp. 7	Luciobarbus rabatensis Doadrio, Perea and Yahyaoui, 2015	Cyprinidae	North Africa	OR807830	OR807841	This study
Gyrodactylus sp. 8	Luciobarbus massaensis (Valenciennes, 1842)	Cyprinidae	North Africa	OR807831	OR807842	This study
Gyrodactylus sp. 9	Luciobarbus rifensis Doadrio, Casal-Lopez and Yahyaoui, 2015	Cyprinidae	North Africa	OR807832	OR807843	This study
Gyrodactylus sp. 10	Luciobarbus yahyaouii Doadrio, Casal-Lopez & Perea, 2016	Cyprinidae	North Africa	OR807833	OR807844	This study
Gyrodactylus sp. 11	Luciobarbus massaensis (Valenciennes, 1842)	Cyprinidae	North Africa	OR807834	OR807845	This study

3. Results

The examination of 157 specimens of cyprinid fish hosts sampled in West Mediterranean watersheds revealed the presence of nearly 200 Gyrodactylus specimens. The collected monogenean specimens were identified as members of the genus Gyrodactylus based on the presence of up to two developing embryos in the uterus, 16 marginal hooks of the same type, a single pair of hamuli (anchors), and dorsal and ventral bars. A total of 72 gyrodactylid specimens parasitizing six northwest African cyprinid species of the genus Luciobarbus (L. ksibi, L. maghrebensis, L. rabatensis, L. rifensis, L. yahyaouii, and L. zayanensis) and Iberian L. graellsii exhibited an unusual morphotype of the attachment organ (Figure 2) compared to that observed in the remaining specimens found on the six cyprinid species sampled in Morocco (L. yahyaouii, L. massaensis, L. zayanensis, L. rabatensis, L. rifensis, and P. maroccana), three Luciobarbus spp. collected in Spain (L. bocagei, L. comizo and L. sclateri), and one collected in Portugal (L. bocagei) (see Table 1). Below, a special focus is placed on gyrodactylid specimens with an unusual haptor morphology. We describe G. gibraltarensis sp. Nov. from Iberian L. graellsii, G. moroccensis sp. Nov. from L. yahyaouii, L. maghrebensis, L. zayanensis, L. rabatensis, and L. rifensis, and finally, G. pseudomoroccensis sp. nov. from L. ksibi.

3.1. Systematics and Molecular Characterization

The Life Science Identifier (LSID) for this publication is: urn:lsid:zoobank.org:pub:E55D7363-D7FD-4150-9EC5-1F3EB2926E46.

Gyrodactylus gibraltarensis Rahmouni sp. nov. (Figure 3)

Figure 3. Illustrations of haptoral parts of Gyrodactylus gibraltarensis sp. nov. from the Iberian barbel Luciobarbus graellsii (Steindachner, 1866) (type–host) (MCO not observed).

Zoobank registration: urn:lsid:zoobank.org:act:88464789-AB95-4F25-99D2-44EA94E81F59
Type–host: Iberian barbel Luciobarbus graellsii (Steindachner, 1866) (Cyprinidae)
Type–locality: upstream Mella, tributary of Materraña, Spain (Table 1, Figure 1)
Type–material: one holotype and one paratype under the accession number IPCAS M-779
Site on the host: gill filaments
Etymology: The epithet “gibraltarensis” of the type species refers to the Strait of Gibraltar, which played an important role in the dispersal of freshwater fish to the Iberian Peninsula
DNA sequences: 18S rDNA: OR773531, ITS regions: OR773480Description (morphometric measurements are given in Table 3)

Table 3. Morphometric parameters (in μm) obtained from specimens of Gyrodactylus moroccensis Rahmouni sp. nov., G. gibraltarensis Rahmouni sp. nov. and G. pseudomoroccensis Rahmouni sp. nov. Meristic data are presented as mean (min–max) with the number of specimens as subscripts. (*) refers to the type–host.

	Gyrodactylus moroccensis sp. nov.					Gyrodactylus gibraltarensis sp. nov.	Gyrodactylus pseudomoroccensis sp. nov.
Cyprinid fish hosts	Luciobarbus maghrebensis	Luciobarbus yahyaouii	Luciobarbus zayanensis	Luciobarbus rabatensis *	Luciobarbus rifensis	Luciobarbus graellsii *	Luciobarbus ksibi *
Hamuli
Length	47.6 (45.9–50.9)₁₀	48 (45.1–49.7)₃	51.8 (49.9–54)₃	47.6 (45.9–50.9)₁₀	44.9 (43.8–46)₂	36.9 (35.3–40.8)₄	37.1 (36.1–38.2)₅
Outer root length	10.6 (8.8–12.5)₁₀	11.7 (9.5–13.9)₃	12.3 (11.1–13.4)₃	10.6 (8.8–12.5)₁₀	8.4 (8–8.9)₂	8.5 (7.6–9.8)₄	11.4 (10.6–12)₅
Shaft length	37.6 (35.5–39)₁₀	37.2 (36.5–37.9)₃	40.5 (38.6–41.9)₃	37.6 (35.5–39)₁₀	36.7 (35.7–37.6)₂	28.5 (27.1–30.7)₄	27.3 (26–28.9)₅
Point length	23 (20.1–25.1)₁₀	22.5 (21.9–23.4)₃	23.2 (22.6–23.6)₃	23 (20.1–25.1)₁₀	24.2 (22.8–25.5)₂	17.4 (15.5–19.3)₄	14.9 (14.3–15.4)₅
Ventral bar
Length	28.8 (28.6–29.4)₁₀	29.5 (27.6–31.9)₃	30.9 (29.1–33.6) ₃	28.8 (28.6–29.4)₁₀	27.9 (27.6–28.3)₂	21.2 (19.2–25.6)₄	15.3 (14.7–16)₅
Width	29.7 (27.7–31)₁₀	26.7 (26.1–27.2)₃	32 (31–32.5)₃	29.7 (27.7–31)₁₀	26.8 (26.2–27.3)₂	21.6 (19.8–24.6)₄	17.4 (16.5–18.4)₅
Tips length	8 (6.3–9.4)₁₀	6.1 (5.7–6.5)₃	7.2 (6.9–7.6)₃	8 (6.3–9.4)₁₀	7.1 (5.9–8.3)₂	2.9 (2.7–3.2)₄	3.2 (2.4–4.1)₅
Distance between tips	31.1 (29.2–32.4)₁₀	27.9 (26.7–28.8)₃	31.5 (30.8–32.2)₃	31.1 (29.2–32.4)₁₀	27.3 (26.7–27.9)₂	23.2 (21.9–24)₄	17.4 (16–18.1)₅
Median width	7.5 (6.5–8.2)₁₀	5.9 (5.4–6.2)₃	7.5 (7–7.9)₃	7.5 (6.5–8.2)₁₀	5.3 (4.8–5.8)₂	4.2 (3.6–5.4)₄	5.3 (5.1–5.6)₅
Membrane length	12.3 (11.1–13.5)₁₀	14.7 (14.1–15.6)₃	14.2 (13.7–14.5)₃	12.3 (11.1–13.5)₁₀	13 (12.5–13.5)₂	11.6 (10.6–12.8)₄	9 (8.3–9.6)₅
Membrane width	15.3 (14.1–16.6)₁₀	13.3 (11.2–15.2) ₃	18.7 (17.2–20.3)₃	15.3 (14.1–16.6)₁₀	15.8 (15.1–16.4)₂	13.7 (13–15.2)₄	10.4 (9.4–11.2)₅
Dorsal bar
Length	27.9 (26.7–28.5)₁₀	27.9 (26.8–29.1)₃	31.5 (31.2–32)₃	27.9 (26.7–28.5)₁₀	27.3 (25.4–29.1)₂	22.3 (20.5–24.2)₄	19.9 (18.7–21.5)₅
Median width	17.9 (16–19.4)₁₀	16.9 (15.8–17.7)₃	20 (19.7–20.6)₃	17.9 (16–19.4)₁₀	15.4 (14.3–16.5)₂	10.8 (8.6–14)₄	16.2 (15–17)₅
Marginal hooks
Length	29.5 (28.1–31.8)₁₀	27.1 (26.7–27.5)₃	31.3 (30.5–32)₃	29.5 (28.1–31.8)₁₀	25.5 (25.3–25.7)₂	22.8 (21.5–23.4)₄	22.1 (20.5–23.6)₅
Filament loop length	10.6 (9.2–12.7)₁₀	8.9 (8.3–10)₃	13.2 (12.4–14.3)₃	10.6 (9.2–12.7)₁₀	11.5 (10.9–12)₂	10.1 (9.6–10.6)₄	8.2 (7.5–8.8)₅
Handle length	24.1 (22.6–26.6)₁₀	21.2 (20.4–21.8)₃	24.9 (24.2–25.4)₃	24.1 (22.6–26.6)₁₀	20.4 (20.4–20.5)₂	17.8 (17.3–18.6)₄	17.6 (16.8–18.6)₅
Sickle length to shaft attachment	6 (5–6.9)₁₀	5.4 (5.2–5.5)₃	6.2 (5.9–6.4)₃	6 (5–6.9)₁₀	5.1 (5–5.2)₂	4.6 (4.2–5) ₄	4.6 (4.4–4.8)₅
Sickle proximal width	5.1 (4.6–5.5)₁₀	4.5 (4.2–4.8)₃	5.1 (4.7–5.4)₃	5.1 (4.6–5.5)₁₀	4.2 (4.1–4.3)₂	3.8 (3.3–4.5)₄	3.7 (3.5–4)₅
Sickle distal width	4.9 (4.4–5.2)₁₀	5.3 (4.7–5.6)₃	6.1 (5.6–6.4)₃	4.9 (4.4–5.2)₁₀	4.3 (4.2–4.4)₂	4.2 (3.9–4.4)₄	4.1 (4–4.4)₅
Shaft length of sickle	4.9 (4.6–5.1)₁₀	4.7 (4.1–5.2)₃	5.3 (4.7–5.8)₃	4.9 (4.6–5.1)₁₀	4 (3.9–4.1)₂	4.4 (3.7–5.5)₄	3.7 (3.5–3.8)₅
Point length of sickle	2.5 (2.1–2.7)₁₀	2.6 (2.4–2.8)₃	3.7 (3.4–3.9)₃	2.5 (2.1–2.7)₁₀	2.2 (2.2–2.3)₂	1.8 (1.3–2.8)₄	1.9 (1.8–2)₅
Male copulatory organ (MCO)
Length	16 (14.7–19.4)₆	Not observed	17.7₁	16 (14.7–19.4)₁₀	12.7₁	Not observed	Not observed
Width	17.2 (15.9–19.2)₆	Not observed	17.6₁	17.2 (15.9–19.2)₁₀	13.5₁	Not observed	Not observed
Pharynx
Length	46.8 (43.5–54.9)₁₀	38.8 (35.2–44.2)₃	40.1 (38.6–42.9)₁₀	40.1 (38.6–42.9)₁₀	36.1 (35.7–36.5)₂	–	–
Width	39.3 (37.6–44.5)₁₀	38.7 (36–41.8)₃	36.5 (30.6–40.3)₁₀	36.5 (30.6–40.3)₁₀	27 (25–4–28.7)₂	–	–

The body fusiform has four main parts: a cephalic region, trunk, peduncle forming the anterior part, and the attachment organ (opisthaptor) located posteriorly. The body wall is thin and smooth. The cephalic region is bilobed, and each lobe has a visible sensillum and gland. There are no eyespots. The mouth (oral opening) is located ventrally. There is a large spherical pharynx with eight long, finger-like pharyngeal processes projecting forward in the anterior part. The esophagus is visible, branching into two simple blind-ended intestinal crura that extend beyond the uterus. There are excretory bladders present. They are viviparous, with up to two embryos in utero positioned ventrally. There is no vagina, and the MCO is not visible. The attachment organ is delineated from the rest of the body, bearing a single pair of well-developed hamuli. The anterior part of the hamuli has an additional arched, patch-like, membranous structure that is not connected and slightly sclerotized at the extremities, covering the twisted inner root edges inward, and there are folds present in the posterior part of the base. The hamuli shaft is slightly bowed and point long. The ventral (superficial) bar is of medium size, with blunt, well-developed lateral processes extending out of bar. The median part is relatively thick, with a membrane (shield) of medium size that is slightly trapezoid and almost 1/3 the length of the hamuli shaft, with a median ridge. The dorsal (deep) bar is T-shaped, lying between the hamuli, with the straight anterior part associated with attenuated extremities that are inserted into terminal plates. The dorsal bar is medially prolonged and narrower at the halfway point, ending in a swollen elongated portion positioned above the median ridge of the ventral bar. There are eight pairs of marginal hooks (sixteen units) of equal size, composed of a sickle associated with a filament loop (lamella). The sickle proper has a relatively robust shaft, rising forward from base and curving gradually. The point of the marginal hook sickle is positioned above the edge of the sickle toe. The sickle foot has a rounded heel. There is a well-developed sickle toe, which is finger-like and positioned downward, with a visible shelf leading to the toe at the same level of the hook heel. MCO is not observed.

Diagnosis

The gyrodactylid specimens found herein to parasitize L. graellsii were assigned to the newly described G. gibraltarensis sp. nov (Figure 3). The hamuli of G. gibraltarensis sp. nov., with a distinctive patch-like structure around the inner roots, are reminiscent of Gyrodactylus malmbergi Ergens 1961, parasitizing a range of Barbus spp. [18,92,93]. The representatives of Paragyrodactylus are also known mainly from Asian loaches (Nemacheilidae Regan, 1911), with additional membrane-like structures surrounding the hamuli roots [18]. Yet, G. gibraltarensis sp. nov. is easily distinguishable by the T-shaped dorsal bar and median ridge in the ventral bar membrane; features grouped in the newly described species only. The accessory portion around the hamuli and the T-shape of the dorsal bar differentiate G. gibraltarensis sp. nov. from a single gyrodactylid species found on the opposite side of the Strait of Gibraltar (Maghreb), namely Gyrodactylus nyingiae Shigoley, Rahmouni, Louizi, Pariselle and Vanhove, 2023, described from Luciobarbus pallaryi Pellegrin, 1919 and L. ksibi [54]. The median ridge of the ventral bar and its long lateral processes are characters which seem to be restricted to some Gyrodactylus spp. from Eurasian cyprinids [18]. More specifically, the median ridge was previously considered by Malmberg (1970) to define the G. katharineri group (subgenus G. Limnonephrotus Malmberg, 1964), with Gyrodactylus katharineri as the former species of the group. Furthermore, the marginal hooks of G. gibraltarensis sp. nov. seem to possess a similar shape to that exhibited by species of the G. katharineri group. With regard to the ventral bar, the above-described morphotype can be found, for instance, in Gyrodactylus barbi Ergens 1976, Gyrodactylus gobii Shulman, 1954, Gyrodactylus gobiensis Glaser, 1974 and Gyrodactylus tokobaevi Ergens & Karabekova, 1980 within the G. katharineri group in the Palearctic region [18]. Gyrodactylus gibraltarensis sp. nov. differs from members of the G. katharineri group by the T-shaped dorsal bar, as this structure in its congeners is of a common shape.

Molecular taxonomy

Fragments covering the ITS regions (ITS1 (455 bp), 5.8S (157 bp), ITS2 (420 bp)) and 18S rDNA (440 bp) were successfully sequenced for a single specimen of G. gibraltarensis sp. Nov. parasitizing L. graellsii sampled in Iberia (Spain). While no close hit to G. gibraltarensis sp. Nov. was found using sequences of the ITS regions, an nBLAST search indicated G. gobiensis (AJ566375) from Gobio gobio (Linnaeus, 1758) (Morava River, Czech Republic) [76], a member of the G. katharineri group [15] (see above), as its closest hit, with a 99% similarity based on sequences of 18S rDNA. According to sequences of the ITS regions, G. gibraltarensis sp. nov. from L. graellsii exhibited the smallest p-distances from its below-described northwest African congeners, G. moroccensis sp. nov. from L. rabatensis and L. rifensis (p-distance = 1.3%), and G. pseudomoroccensis sp. nov. from L. ksibi (p-distance = 5%). On the basis of sequences of 18S rDNA, G. gibraltarensis sp. nov. exhibited the smallest p-distances from each of G. moroccensis sp. nov. from L. rifensis and G. pseudomoroccensis sp. nov. from L. ksibi (p-distance = 0.4%), followed by that from G. moroccensis sp. nov. from L. rabatensis (p-distance = 0.8%) (see p-distances in Supplementary Material Table S1 in supplementary material and the phylogenetic section below).

Gyrodactylus moroccensis Rahmouni sp. nov. (Figure 4)

Figure 4. Illustrations of the haptoral parts (A) and male copulatory organ (MCO) with six (B) and eight spinelets (C) of Gyrodactylus moroccensis sp. nov. from the Rabat barbel Luciobarbus rabatensis Doadrio, Perea & Yahyaoui, 2015 (type–host).

Zoobank registration: urn:lsid:zoobank.org:act:D58EB381-CAB9-4DF5-9157-FCC55EB0EE18
Type–host: Rabat barbel Luciobarbus rabatensis Doadrio, Perea and Yahyaoui, 2015 (Cyprinidae)
Type–locality: Maleh River, Morocco (Table 1, Figure 1)
Additional hosts: Yahyaoui barbel Luciobarbus yahyaouii Doadrio, Casal-Lopez & Perea, 2016, Zayan Barbel Luciobarbus zayanensis Doadrio, Casal-López & Yahyaoui, 2016, Maghreb barbel Luciobarbus maghrebensis Doadrio, Perea and Yahyaoui, 2015, and Rifian barbel Luciobarbus rifensis Doadrio, Casal-Lopez & Yahyaoui, 2015 (all Cyprinidae)
Additional localities: Sebou River, Lahdar and Sebou drainage for L. maghrebensis, Za and Meloulou Rivers for L. yahyaouii, Oum Er-Rbia River for L. zayanensis, tributary of Loukkos for L. rifensis, all in Morocco (Table 2, Figure 1)
Type–material: one holotype and three paratypes under the accession number IPCAS M-779
Site on the host: fins for L. maghrebensis, L. yahyaouii, L. zayanensis and L. rifensis; gill filaments for L. rabatensis
Etymology: The epithet “moroccensis” of the type–species refers to its country of origin (Morocco)
DNA sequences: 18S rDNA: OR773528-29, ITS regions: OR773477-78
Description (morphometric measurements are given in Table 3)

The body fusiform has four main parts: a cephalic region, trunk, peduncle forming the anterior part, and an attachment organ (opisthaptor) located posteriorly. The body wall is thin and smooth. The cephalic region is bilobed, and each lobe has a visible sensillum and gland. There are no eyespots. The mouth (oral opening) is located ventrally. There is a large spherical pharynx with eight long, finger-like pharyngeal processes projecting forward in the anterior part. The esophagus is visible, branching into two simple blind-ended intestinal crura that extend beyond the uterus. Excretory bladders are present. It is viviparous, with up to two embryos in utero positioned ventrally. A vagina is absent. The MCO is visible in all the G. moroccensis sp. nov. specimens except in those collected from L. yahyaouii. The MCO is bulbous with a visible opening. It is positioned ventrally, close to the bifurcation of intestinal crura and garnished with a single large terminal spine followed by a row of six to eight spines of medium size. The attachment organ is delineated from rest of the body, bearing a single pair of well-developed hamuli. The anterior part of the hamuli has visible tendons and an additional arched, patch-like, membranous structure. This structure is not connected and slightly sclerotized at the extremities, covering twisted inner root edges inward, with folds present in the posterior part the of base. The hamuli shaft is slightly bowed and point long. The ventral (superficial) bar is of medium size, with blunt, well-developed lateral processes extending out of the bar. The median part is relatively thick, large in the sides, and can show a hollow membrane (shield) that is relatively short, slightly trapezoid, and almost 1/3 the length of the hamuli shaft, with striations and a median ridge. The dorsal (deep) bar is T-shaped, lying between the hamuli, with a straight anterior part, hollow medial part, and bifurcations near the attenuated extremities inserted into the terminal plates. It is medially prolonged with a constricted portion near the anterior branch, ending in a swollen elongated portion positioned above the median ridge of the ventral bar. There are eight pairs of marginal hooks (sixteen units) of equal size composed of a sickle associated with a filament loop (lamella). There is a sickle proper with a robust shaft rising forward from the base and curving gradually. The point of the marginal hook sickle is positioned above the edge of the sickle toe. The sickle foot has a rounded heel. There is a well-developed sickle toe, which is finger-like and positioned downward with a visible shelf leading to a toe at the same level the of hook heel.

Diagnosis

Although it is morphologically highly reminiscent of G. gibraltarensis sp. nov., Northwest African G. moroccensis sp. nov. (Figure 4), identified on five endemic Moroccan cyprinids, is distinguishable from the former Iberian species by the size of the haptoral sclerites, mainly the hamuli, which is comparatively shorter in G. gibraltarensis sp. nov. (Table 3, Figure 3). No obvious variability in the shape of the haptoral structures was evidenced between these two species. As a member of the G. katharineri group [15], G. moroccensis sp. nov. shares all of the morphological features characterizing this group, just like G. gibraltarensis sp. nov. (see above). It should be noted that, according to Shigoley et al. [54], the inner roots of hamuli exhibited by the former described species, G. nyingiae from L. pallaryi, are not twisted. Conversely, the hamuli of G. moroccensis sp. nov. seem similar to those in the Gyrodactylus specimen from L. ksibi assigned by Shigoley et al. [54] to G. nyingiae. The specimen included in [54], which was identified as G. nyingiae on L. ksibi, may thus be either G. moroccensis sp. nov. or a so-far-undescribed species, but it definitely does not represent the same species as that found on L. pallaryi. We suspect the former possibility; Shigoley et al. [54] likely overlooked the T-shape of the dorsal bar due to the weak sample size they examined (or the structure of this character was damaged during fixation). The main difference between G. moroccensis sp. nov. and G. nyingiae is, indeed, the T-shaped dorsal bar in the former newly described species. Furthermore, the median ridge of the ventral bar was not mentioned in the description of G. nyingiae, but we believe that this structure was present, as illustrated by the micrographs provided by Shigoley et al. [54], which show a kind of fold in the posterior edge of the ventral bar.

Molecular taxonomy

Fragments covering the ITS regions (ITS1 (477 bp), 5.8S (157 bp), ITS2 (422 bp) were successfully sequenced for two specimens of G. moroccensis sp. nov. isolated from each of L. rabatensis and L. rifensis, and for a single specimen from L. maghrebensis, all sampled across Northwest African freshwater habitats (Morocco). The ITS sequences obtained from G. moroccensis sp. Nov. from L. rabatensis and L. maghrebensis were identical. However, a degree of weak intraspecific variability below the limit value usually considered for discriminating Gyrodactylus spp. [60,94,95] was found between the sequences representing G. moroccensis sp. Nov. from L. rabatensis and from L. rifensis (p-distance = 0.8%). We failed to obtain ITS sequences for G. moroccensis sp. Nov. from L. yahyaouii and L. zayanensis. No close hit to G. moroccensis sp. Nov. was found using the nBLAST search tool for ITS regions. Fragments of the 18S rDNA region (456 bp) were successfully sequenced for two specimens of G. moroccensis sp. Nov. isolated from each of L. rifensis and L. rabatensis. We failed to obtain 18S rDNA sequences for specimens of G. moroccensis sp. Nov. from L. yahyaouii, L. zayanensis, and L. maghrebensis. As obtained for the ITS regions, a level of weak intraspecific variability in the sequences of 18S rDNA representing G. moroccensis sp. Nov. was found at the cyprinid host level (L. rabatensis vs. L. rifensis, p-distance = 0.4%). The nBLAST search revealed G. katharineri (AJ407903) from Barbus barbus (Linnaeus, 1758) (Morava River, Czech Republic) [62] as the closest known hit to G. moroccensis sp. Nov. from L. rabatensis and L. rifensis, with a 95.06% similarity. Sequences of the ITS regions supported the distinction between G. gibraltarensis sp. nov. from Iberia and G. moroccensis sp. nov. from Northwest Africa, with the genetic divergence exceeding the limit value [60,94,95] (p-distance = 1.3%, see above, Table S1 in supplementary material and the phylogenetic section below).

Gyrodactylus pseudomoroccensis Rahmouni sp. nov. (Figure 5)

Figure 5. Illustrations of the haptoral parts of Gyrodactylus pseudomoroccensis sp. nov. from the Rabat barbel Luciobarbus rabatensis Doadrio, Perea & Yahyaoui, 2015 (type–host) (MCO not observed).

Zoobank registration: urn:lsid:zoobank.org:act:45ED3EAA-7F91-4370-ACDE-7B5AEA155363
Type–host: Luciobarbus ksibi (Boulenger, 1905) (Cyprinidae) (synonym of Luciobarbus callensis (Valenciennes, 1842) according to Fishbase [38] but considered as a valid species on Eschmeyer’s Catalog of Fishes [29])
Type–locality: Ksob River, Morocco (Table 1, Figure 1)
Type–material: one holotype and one paratype under the accession number IPCAS M-781Site on the host: fins
Etymology: The epithet “pseudomoroccensis” of the type–species refers to the morphological similarity to specific elements of the attachment organ (T-shaped dorsal bar) in the two new Gyrodactylus spp. described from Morocco.
DNA sequences: 18S rDNA: OR773530, ITS regions: OR773479
Description (morphometric measurements are given in Table 3)

The body fusiform has four main parts: a cephalic region, trunk, a peduncle forming the anterior part, and an attachment organ (opisthaptor) located posteriorly. The body wall is thin and smooth. The cephalic region is bilobed, and each lobe has a visible sensillum and gland. There are no eyespots. The mouth (oral opening) is located ventrally. There is a large spherical pharynx with eight long, finger-like pharyngeal processes projecting forward in the anterior part. The esophagus is visible, branching into two simple blind-ended intestinal crura that extend beyond the uterus. Excretory bladders are present. It is viviparous, with up to two embryos in utero positioned ventrally. A vagina is absent. The MCO is not visible. The attachment organ is delineated from the rest of the body, bearing a single pair of well-developed hamuli. The hamuli lack the chitinous patch-like structure of the inner roots, and the tips of the inner roots are straight with a hat-like cover and a groove-like portion present in the posterior part of the base. The hamuli shaft is slightly bowed and point long. The ventral bar has a relatively short lateral processes extending out of the bar, with a membrane of medium width ending in the median ridge. There is a dorsal T-shaped bar with median excavation, posteriorly traversing the ventral bar to end in an inflated portion. There are sixteen similar marginal hooks with a sickle proper attached to a filament that extends almost 2/3 of the handle length. There is a sickle proper base with a globous heel and a finger-like downward toe positioned perpendicular to the short point formed by a curved shaft of medium thickness. MCO is not observed.

Diagnosis

Gyrodactylus pseudomoroccensis sp. nov. (Figure 5) is the third species of Gyrodactylus recognized in Northwest Africa, and is thus the fourth species to be found in the West Mediterranean region. Gyrodactylus pseudomoroccensis sp. nov. highly resembles the above-described congeners, G. gibraltarensis sp. nov. from Iberia and Northwest African G. moroccensis sp. nov., due to the T-shaped dorsal bar and ventral bar with a median ridge. The latter feature places G. pseudomoroccensis sp. nov. in the G. katharineri group [15]. Compared to G. gibraltarensis sp. nov. and G. moroccensis sp. nov., G. pseudomoroccensis sp. nov. exhibits shorter hamuli lacking the membranous patch-like structure and shorter lateral processes of the ventral bar. It also exhibits straight inner roots covered by a hat posteriorly with a groove-like portion in the base; a feature that is missing in the two former species (see descriptions of G. gibraltarensis sp. nov. and G. moroccensis sp. nov.). The morphology of the hamuli in G. pseudomoroccensis sp. nov. described herein from L. ksibi is surprisingly different from that reported by Shigoley et al. [54] in a single specimen identified as G. nyingiae collected from L. ksibi inhabiting a nearby (almost identical) locality in Western Morocco. The main differences between these two species are in the shape of the inner roots of the hamuli, which are straight in G. pseudomoroccensis sp. nov. but appear rather twisted in G. nyingiae. The marginal hooks in the specimens of both species are of a common shape.

3.2. Morphological Delineation among Northwest African and Iberian Gyrodactylus

A principle component analysis (Figure 6A–C) was performed using the morphometric data obtained from the haptoral structures of the gyrodactylid specimens possessing unusual shapes of the haptoral sclerites. A total of 89.4% of the variation was explained by the first two PC axes (85.04% and 4.36%, respectively). The first PC axis (Figure 6A) mostly separated Gyrodactylus specimens from L. rabatensis and L. zayanensis (corresponding to different populations of G. moroccensis sp. nov.), as well as those from L. ksibi (corresponding to G. pseudomoroccensis sp. nov.) from Gyrodactylus specimens from each of L. maghrebensis (corresponding to G. moroccensis sp.) nov. and L. graellsii (corresponding to G. gibraltarensis sp. nov.). Along this axis, the gyrodactylid specimens from L. rifensis (corresponding to G. moroccensis sp. nov.) were well separated from the Gyrodactylus specimens from L. ksibi (corresponding to G. pseudomoroccensis sp. nov.) and from the two populations designated as G. moroccensis sp. nov. (from L. zayanensis and L. rabatensis). However, the population of G. moroccensis sp. nov. from L. rifensis was represented by only two specimens in our data set. At the cyprinid host level within Northwest Africa, the PC1 axis further allowed us to discriminate among the Gyrodactylus specimens from different hosts; however, there was an overlap between the specimens from L. yahyaouii, L. maghrebensis, and L. rifensis. The main morphometric changes along PC1 were associated with the total length of the hamuli and the length of their shafts, the length and width of the ventral bars, the distance between lateral processes, the total length of the dorsal bars, and finally the length of the marginal hooks and their handles (Figure 6B). The second PC axis (Figure 6A) differentiated Gyrodactylus populations corresponding to G. moroccensis sp. nov. from the specimens representing each of G. pseudomoroccensis sp. nov. and G. gibraltarensis sp. nov. The overall changes along PC2 were mostly related to the total length of the hamuli and the length of their roots, the length of each ventral bar, and the median of the dorsal bar (Figure 6C).

3.3. Phylogenetic Relationships

The phylogenetic tree based on the concatenated dataset of the 18S rDNA and ITS regions comprised a total of 64 sequences, of which 15 obtained from the West Mediterranean Gyrodactylus spp. were newly generated. These comprised ten sequences from Northwest African (Morocco) Gyrodactylus and five sequences from Iberian Gyrodactylus, with two and three sequences from Portugal and Spain, respectively. The phylogenetic tree was rooted with three gyrodactylid species from Europe and the Neotropics. The ML and BI trees showed identical topologies when considering the well-supported nodes, and the trees obtained through both analyses were fully resolved. The ML tree is presented in Figure 7, including the bootstrap values and posterior probabilities resulting from the ML and BI analyses, respectively. Overall, the phylogenetic reconstruction revealed a total of seven well-to-moderately supported clades (A–G). With regard to outgroups, clades A–C were restricted to Gyrodactylus spp., with long ITS1 sequences, in contrast to clades D–G, which clustered gyrodactylid representatives from distinct genera worldwide with short ITS sequences, in agreement with Cable et al. [96]. Clade A (BS = 99, PP = 1) included Gyrodactylus spp. studied herein from the West Mediterranean, Middle Eastern Gyrodactylus mhaiseni and Gyrodactylus sandai, and European G. katharineri. The West Mediterranean lineage of Gyrodactylus, including all the representatives from the Northwest African and Iberian regions (i.e., G. gibraltarensis sp. nov., G. moroccensis sp. nov., G. pseudomoroccensis sp. nov., and Gyrodactylus sp. 1–11) was monophyletic, whereas the Gyrodactylus from the two sides of the Strait of Gibraltar, i.e., from Northwest Africa and Iberia, were polyphyletic. The phylogenetic reconstruction showed a well-supported monophyletic group, including G. moroccensis sp. Nov. from L. rabatensis, G. moroccensis sp. Nov. from L. rifensis, and Iberian G. gibraltarensis sp. nov. from L. graellsii. Their congener G. pseudomoroccensis sp. nov. from Moroccan L. ksibi was at the basal position to the well-supported group (BS = 99, PP = 1) of undescribed Gyrodactylus species from Iberia. The well-supported clade B (BS = 100, PP = 1) grouped Gyrodactylus spp. parasitizing European freshwater, brackish, and marine gobids, and had a basal position to Gyrodactylus species in Clade A. Clade C showed moderate to high support values (BS = 87, PP = 0.91) and included Eurasian and Middle Eastern Gyrodactylus spp. from a range of teleost fish taxa. The well-supported clade D (BS = 100, PP = 1) included the Gyrodactylus spp. found on gasterosteid fish in the Nearctic region and from brackish environments in the North-eastern Atlantic Ocean, and it had a basal position to clades A, B, and C. Clade E was similarly well-supported (BS = 100, PP = 1), grouping Gyrodactylus spp. from African cichlids. The well-supported clade F (BS = 92, PP =0.95) was composed of a group of Gyrodactylus spp. parasitizing African siluriforms and a group of European Gyrodactylus spp. from cyprinids. The position of East Asian Paragyrodactylus variegatus as a sister species to the European Gyrodactylus spp. was only weakly supported by the ML analyses (BS = 76). Finally, clade G included three African gyrodactylid genera with high support values (BS = 100, PP = 1), keeping two African gyrodactylid representatives without support values in the basal position of the tree (Figure 7).

3.4. Morphological Evolution of Gyrodactylus in the West Mediterranean Region

The maximum likelihood tree including only West Mediterranean Gyrodactylus spp. with their genetically closely related congeners G. mhaiseni and G. sandai from the Middle East and G. katharineri from Europe (i.e., members of clade A) was used to illustrate the structural evolution of the different parts of the haptoral sclerites in Gyrodactylus of the West Mediterranean (Figure 8). The projection of the geographical distribution onto the phylogenetic tree revealed two potential contacts between the North African and Iberian cyprinoids associated with the host switch of Gyrodactylus spp. In terms of morphology, we evidenced three main features found exclusively together in the West Mediterranean lineage, in addition to the median ridge of the ventral bar (character 1) found in all the species of clade A from Eurasia and the West Mediterranean. Conversely, the morphology related to the ventral bar was of two origins. While most of the Gyrodactylus spp. included in the analysis exhibited relatively short lateral processes of the ventral bar, G. katharineri from Europe and G. sandai from the Middle East possessed well-developed structures of the ventral bar (character 2); a feature found to characterize two newly described northwest African and Iberian congeners, G. moroccensis sp. nov. and G. gibraltarensis sp. nov. The anterior part of the hamuli with twisted inner roots (character 3) was found in the Gyrodactylus spp. from West Mediterranean cyprinids, but not in the G. pseudomoroccensis sp. nov. from Northwest African L. ksibi, nor in the undescribed Gyrodactylus sp. 3 and Gyrodactylus sp. 4 from Iberia (Portugal). As already stated above (see species descriptions), the membranous, patch-like structure surrounding the tips of the hamuli (character 4) exclusively characterized G. moroccensis sp. nov. and G. gibraltarensis sp. nov. from the West Mediterranean. The dorsal bar with its typical T-shape (character 5) was reported for the first time in Gyrodactylus. This structure was found to characterize the three newly described West Mediterranean species only. No clear evolutionary pattern was noted for the other haptoral parts of the studied Gyrodactylus spp., such as the cup-like structure covering the anterior part of the hamuli, the presence of folds in the hamuli base, or the shape of the posterior part of the dorsal bar.

4. Discussion

The present study focused on gyrodactylid communities found in West Mediterranean cyprinids and covering the freshwater of two distinct continents separated by the Strait of Gibraltar. The West European part, i.e., the Iberian Peninsula, is known for its relatively low species diversity of freshwater ichthyofauna compared to Eastern Europe due to its historical isolation [48]. Previous studies on parasites of endemic cyprinid hosts in the West Mediterranean [28,98,99,100] have documented the presence of endemic and host-specific dactylogyrid monogeneans in the North African and South European (Iberian) parts of the Mediterranean. In line with those studies and considering the historical dispersal routes of cyprinids to the West Mediterranean, we hypothesized that the Northwest African and Iberian cyprinids studied herein may also harbor distinctive gyrodactylid communities, and we expected that at least some Gyrodactylus spp. from the West Mediterranean would share their morphological characters with potential Eurasian ancestors. In terms of the diversity of Gyrodactylus, the most cosmopolitan and speciose ectoparasitic group in the Palearctic region thus far [18], the West Mediterranean region has not been extensively studied. To date, knowledge on Gyrodactylus spp. parasitizing African cyprinids is quite limited. Only a few Gyrodactylus species have been described—specifically, G. nyingiae from L. pallaryi and L. ksibi [54] from North African (Morocco) watersheds, and three species, namely Gyrodactylus ivindoensis Price and Gery, 1968, Gyrodactylus kyogae Paperna, 1973, and Gyrodactylus paludinosus Truter, Smit, Malherbe and Přikrylová, 2021, from cyprinids of the genus Enteromius Cope, 1867 have been found in the more southerly freshwaters in Africa [6,101]. Similarly, little is known about the parasite fauna of Iberian cyprinid hosts, and the data available so far can be considered old and most probably unreliable [55].

In this study, gyrodactylid monogeneans belonging to the genus Gyrodactylus were found to parasitize eight Northwest African and four Iberian cyprinid species belonging to West Mediterranean Torinae and Barbinae. All the Gyrodactylus specimens exhibited up to two developing embryos in the uterus, a single type of marginal hook, a single pair of hamuli, and dorsal and ventral bars. Moreover, a typical Gyrodactylus-like MCO of bulbous form garnished with a single apical spine and a row of spinelets was recognized in some specimens. Overall, the attachment organ in most of the gyrodactylid genera found in European freshwaters exhibited additional structures associated with the hamuli (Gyrodactyloides, Laminiscus, and Paragyrodactylus), and the hamuli further exhibited well-developed outer and inner roots (Gyrodactyloides, Laminiscus). The dorsal bar was missing in some genera (Laminiscus). Interestingly, the MCO retained its bulbous form, with a single apical spine supplemented by one or more rows of spinelets in the species from all the above-listed genera, as well as in Gyrodactylus [18,102]. The bulbous form of MCO also characterized other genera, like the Nearctic Gyrocerviceanseris Cone, Abbott, Gilmore & Burt, 2010, Fundulotrema Kritsky & Thatcher, 1977, and the African Macrogyrodactylus Malmberg, 1957. The marginal hooks have been shown to be highly diverse in the African continent, where species can harbor either a single type of marginal hook, as in the genera Afrogyrodactylus Paperna, 1968, Citharodactylus Přikrylová, Shinn et Paladini, 2017, and Gyrodactylus, or hooks with distinct morphologies, as in Diplogyrodactylus Přikrylová, Matějusová, Musilová, Gelnar and Harris, 2009, Macrogyrodactylus, Mormyrogyrodactylus Luus-Powell, Mashego et Khalil, 2003, and Tresuncinidactylus Přikrylová, Barson and Shinn, 2021 (see summary in [102]).

In this study, morphological characterization based on informative haptoral features combined with sequences of the 18S rDNA and ITS regions allowed for the identification of a total of 14 Gyrodactylus spp. on a range of West Mediterranean Barbinae and Torinae. These include a single species from P. maroccana, while the remaining thirteen species were recovered from Luciobarbus spp. across the Strait of Gibraltar, with five in Iberia and eight in Northwest Africa. Using an integrative approach combining morphological diagnoses and genetic data has become a common practice in monogenean species identification [60,100,103,104]. Such an approach also provides more accurate taxonomic support for Gyrodactylus spp., though each analysis separately has specific limitations [83]. DNA segments such as the ITS regions and, to a lesser degree, the 18S rDNA region have been shown to be successful markers for Gyrodactylus species delineation, and for assessing intraspecific variability [59,60,61,105]. Moreover, in our study, the integrative approach mentioned above was supplemented using multivariate analyses of morphological data on the haptoral parts to discriminate between Gyrodactylus specimens of three newly described species and between populations of G. maroccensis sp. nov. found on five Northwest African cyprinids. The most relevant morphological traits for Gyrodactylus spp. delimitation are the shape, size, and proportions of the haptoral sclerites [15]. With regard to the impressive species richness of Gyrodactylus [23], weak morphological variability may confuse taxonomic identification [106].

In our study, microscopic examination of the collected Gyrodactylus specimens from Northwest Africa and Iberia revealed the presence of two distinct haptoral morphotypes. Surprisingly, one of these morphotypes was unusual and had not been documented in Gyrodactylus so far. This morphotype was found in Gyrodactylus specimens collected from Northwest African L. yahyaouii, L. maghrebensis, L. zayanensis, L. rabatensis, L. rifensis (described as G. maroceensis sp. nov.), and L. ksibi (described as G. pseudomoroceensis sp. nov.), and from Iberian L. graellsii (described as G. gibraltarensis sp. nov.). The first remarkable feature which was common to this morphotype was the T-shaped dorsal bar, with a prolonged portion lying between the shafts of the hamuli. The second character was the shape of the hamuli, which were supplemented by a membranous patch-like structure surrounding the twisted inner roots. This character was missing, however, in the Gyrodactylus specimens from L. ksibi corresponding to G. pseudomoroceensis sp. nov., where the hamuli roots were relatively strait and of the usual form commonly documented in Gyrodactylus species. The combination of a T-shaped dorsal bar with hamuli presenting with accessory portions was not previously observed in Gyrodactylus, and to our knowledge, this morphotype is so far limited to the West Mediterranean. Meanwhile, all of the Gyrodactylus specimens studied herein from opposite parts of the Strait of Gibraltar possessed a median ridge in the posterior edge of the ventral bar.

Regarding the West Mediterranean Gyrodactylus specimens with an unusual morphology, the p-distances calculated using sequences of the 18S rDNA and ITS regions supported the existence of three species, described herein as G. gibraltarensis sp. nov., G. moroccensis sp. nov.m and G. pseudomoroccensis sp. nov., since the genetic divergences in the sequences of the ITS regions were above the conventional limit value (≥1%) that is usually considered for delineating Gyrodactylus spp. [60,94,95]. Moreover, morphometrical analyses also supported the genetic evidence for three Gyrodactylus spp. with an unusual morphology across the Strait of Gibraltar, with a single species distributed in Iberia and two species distributed in Northwest Africa. However, our morphometrical analyses also revealed a certain degree of population differentiation for generalist G. moroccensis sp. Nov. from L. maghrebensis, L. zayanensis, L. rabatensis, L. rifensis, and L. yahyaouii. The presence of distinct Gyrodactylus spp. across the Strait of Gibraltar since the reopening of the Strait at the beginning of the Pliocene and the refilling of the Mediterranean accounts for allopatric speciation driven by vicariance events, as already attributed to Mediterranean ichthyofauna [48]. Considering the endemism of the studied cyprinid hosts across the Strait of Gibraltar, we can assume a cospeciation scenario in the cyprinid–Gyrodactylus system, followed by diversification events in Northwest Africa and Iberia, as hypothesized for Balkan dactylogyrids [26]. Within the North African region, morphological and genetic divergences between G. moroccensis sp. nov. from L. rabatensis and G. pseudomoroccensis sp. nov. from L. ksibi indicate the successful coexistence of these two gyrodactylid species in overlapped niches in neighboring freshwater systems like the Oum Er-Rbia and Tensift basins [38,107]. Yet, past and current Gyrodactylus records from L. ksibi occurring in the Tensift basin in West Morocco are contradictory. Shigoley et al. [54] recently classified as G. nyingiae a single Gyrodactylus parasite from L. ksibi collected in a West Moroccan river (Oued Ksob, Tensift basin), together with visibly differentiated Gyrodactylus specimens from L. pallaryi sampled on the opposite side in Eastern Morocco (Oued Guir, Sud Atlas basin). The haptoral morphology exhibited by our specimens described as G. pseudomoroccensis sp. nov. from West Moroccan L. ksibi was likewise different from that found in the previously collected Gyrodactylus specimen from L. ksibi, despite the fact that they came from adjacent locations in the Ksob River. Micrographs provided by Shigoley et al. [54] clearly illustrate hamuli with twisted inner roots in Gyrodactylus specimens from L. ksibi; a feature which we found in G. moroccensis sp. nov. from five cyprinid species dispersed in most Moroccan drainage systems but not in in its congener G. pseudomoroccensis sp. nov. described from L. ksibi. This may indicate that, first, the previous assignment of Gyrodactylus of L. ksibi to G. nyingiae was most likely a mistake. Second, the generalist G. moroccensis sp. nov. can also parasitize L. ksibi in extended ecological niches. The lack of information regarding the morphology of the remaining haptoral parts of the parasite of L. ksibi studied by Shigoley et al. [54] makes further investigations necessary. The generalist G. moroccensis sp. nov. was found on a range of Northwest African Luciobarbus spp. This could be the result of host switching. The low intraspecific variability found in sequences of the ITS regions of G. moroccensis sp. nov. from L. rabatensis and L. rifensis and in the phylogenetically more conservative and slowly evolving 18S rDNA region, however, may indicate ongoing speciation in the North African freshwater systems. Unfortunately, genetic data for the populations of G. moroccensis sp. nov. collected from the remaining host species are still missing. Using PCA on the morphometric data, we also revealed at least the partial morphological differentiation of G. moroccensis sp. nov. populations. However, future sampling to obtain representative sample sizes for G. moroccensis sp. nov. populations from different cyprinid hosts and from different drainage systems in North Africa is necessary to investigate the potential ongoing speciation across Northwestern Africa. Interestingly, the intrapopulation variability in the 18S rDNA between the genetic variants of G. moroccensis sp. nov. was the same as the interspecific variability between G. gibraltarensis sp. nov. and one of the genetic variants of G. moroccensis sp. nov. or G. pseudomoroccensis sp. nov. The sequences of the ITS regions showed the highest similarity between the two analyzed genetic variants of G. moroccensis sp. nov. DNA sequences of the ITS regions also indicated a low variability (1.3%) between the morphologically similar and geographically isolated G. moroccensis sp. nov. and G. gibraltarensis sp. nov. on their respective cyprinid hosts currently living in allopatry in the North African and Southern European parts of the Mediterranean, respectively.

In this study, we investigated the phylogenetic positions of West Mediterranean Gyrodactylus and their relationships with representatives of several gyrodactylid genera worldwide. We included in the analyses DNA sequence data of Gyrodactylus from the Middle East, since it represents a putative region of the ancestral diversification of cyprinids prior to their dispersion into Europe and North Africa [35]. Overall, Gyrodactylus was shown to be paraphyletic in our study; a finding previously documented in refs. [75,76,78,108]. Herein, Gyrodactylus spp. from the West Mediterranean formed a monophyletic group, and two Gyrodactylus spp. from the Middle East and European G. katharineri had a basal position. This is in accordance with the phylogeography of their respective tetraploid and hexaploid hosts of Barbinae and Torinae, respectively, which reached Northwest Africa through independent dispersal events from Eurasia [35]. This also implies a Eurasian origin for the West Mediterranean lineage of Gyrodactylus spp., as previously suggested for one lineage of gill-specific dactylogyrid monogeneans [28]. However, in contrast to the multiple origins for each of the following: (i) Dactylogyrus spp. parasitizing North African cyprinids and (ii) Dactylogyrus spp. parasitizing Iberian Luciobarbus, the West Mediterranean Gyrodactylus lineage seems to have a single origin, which is likely Middle Eastern. Yet, our phylogenetic analyses indicated that within the West Mediterranean Gyrodactylus, species parasitizing Iberian Luciobarbus have a North African origin, and that the diversification of Gyrodactylus spp. in Iberian Luciobarbus seems to be related to historical contacts between West Mediterranean cyprinids (currently separated by the Strait of Gibraltar). On the basis of the phylogenetic relationships among Gyrodactylus spp. with unusual morphology of the haptor, those historical contacts of cyprinids were likely associated with the North African–Iberian host switching of Gyrodactylus, followed by parasite speciation in Iberian Luciobarbus (especially concerning G. gibraltarensis sp. nov., which was morphologically highly similar to Northwest African G. moroceensis sp. nov., two species currently geographically isolated by the Strait of Gibraltar). Our phylogenetic study also indicated that the monophyletic group including four Gyrodactylus spp. (Gyrodactylus sp. 1–4) parasitizing Iberian Luciobarbus originated from historical contacts between West Mediterranean cyprinids currently living on each side of the Strait of Gibraltar. We further evidenced that Gyrodactylus spp. from European marine Pomatoschistus spp. (Gobiidae) form a sister group to the West Mediterranean lineage. This may support the ancestral freshwater lifestyle of soma gobiid populations during the opening of the Strait of Gibraltar (5.3 MYA) and the subsequent re-flooding of the Mediterranean basins during the Messinian salinity crisis [43].

We focused on the morphological characters of the haptor of Gyrodactylus spp. of the West Mediterranean lineage and their closest relatives (clade A). The presence of specific morphological characters of the haptor representing a new morphotype in Gyrodactylus spp. found in Northwest Africa and Iberia was positioned on the phylogenetic tree of clade A. Since the studied Gyrodactylus spp. were collected only from Morocco and Spain, and because this morphotype has not so far been reported in the Middle East, where parasitological data are still insufficient, future extensive parasite sampling is necessary to cover a larger geographical range in order to investigate the potential boundaries of the distribution of the unusual Gyrodactylus morphotype. All the Gyrodactylus spp. from West Mediterranean cyprinids, mostly represented by Luciobarbus spp., possessed the median ridge in their ventral bar membranes (character 1). The widespread European G. katharineri, known from a range of cyprinids including B. barbus and G. sandai from the cyprinid Capoeta umbla (Heckel, 1843) endemic to the Middle East, showed well-developed lateral processes of the ventral bar (character 2), while the next species, G. mhaiseni, parasitizing the leuciscid Alburnus sellal Heckel, 1843 from the same latter region, showed poorly developed lateral processes. Thus, the former character of the ventral bar appeared twice in clade A and was found in two newly described Gyrodactylus spp. from the West Mediterranean. In contrast, G. pseudomoroccensis sp. nov. possessed short lateral processes of the ventral bar. This finding may suggest that well-developed lateral processes are ancestral characters of the ventral bar originating in Gyrodactylus parasitizing cyprinids occurring in the Middle East. A large sample size is, however, necessary to re-examine this hypothesis.

Other West Mediterranean Gyrodactylus spp., including Moroccan as well as Iberian species, possessed short or poorly developed lateral processes of the ventral bar. In contrast to the evolution of the ventral bar, the twisted inner roots of the hamuli (character 3) were found in Iberian Gyrodactylus sp. 1–2, as well as in G. gibraltarensis sp. nov. and Moroccan G. moroccensis sp. nov., evolving through allopatric speciation across the Strait of Gibraltar. Likewise, the membranous structure associated with the hamuli (character 4) was present only in G. gibraltarensis sp. nov. and G. moroccensis sp. nov. To our knowledge, this character associated with the hamuli has never been recognized in West Mediterranean Gyrodactylus, while it has already been found in European Gyrodactylus, mainly from Barbus spp. [18,92,93]. Furthermore, we identified a morphological character of the haptor which was common to all three newly described Gyrodactylus spp. Specifically, the T-shaped dorsal bar (character 5) was present in Iberian G. gibraltarensis sp. nov. and Northwest African G. moroccensis sp. nov. and G. pseudomoroccensis sp. nov. The Lago Mare phase, which followed the Messinian salinity crisis, resulted in a close phylogenetic relationship between North African and Iberian Luciobarbus spp. [46]. Our study showed that Moroccan and Iberian Gyrodactylus from West Mediterranean cyprinids formed a well-supported lineage that is phylogenetically closely related to Gyrodactylus representatives in the Middle East. Considering the morphological characters of the haptor, we suggest that the median ridge of the ventral bar (character 1) might be an ancestral character differentiating Palearctic Gyrodactylus from lineages occurring outside of this geographical range—for example, those occurring in the Nearctic region, where this feature has never been reported [60]. This character preassembly evolved before Palearctic Gyrodactylus diverged from their Middle East ancestor and before they reached the West Mediterranean. The morphological homologies associated with the well-developed lateral processes of the ventral bar (character 2), as well as the structures of the inner roots of the hamuli (characters 3–4), and the T-shaped dorsal bar (character 5), may suggest either an inheritance from a common ancestor or an instance of convergent evolution. The former hypothesis is in line with the historical biogeography of Eurasian, African, and Iberian cyprinid hosts [39]. This can be supported by the fact that the accessory portion found in the hamuli (character 4) in the West Mediterranean lineage is also present in G. malmbergi of European Barbinae [18,92,93]. Unfortunately, genetic data are not available for G. malmbergi; therefore, this species was not included in the phylogenetic reconstruction.

The inheritance of morphological features from a common ancestor was previously suggested in gill flatworms of the genus Cichlidogyrus Paperna, 1960 (Dactylogyridae), parasitizing fast-radiating ichthyofauna of the African Great Lakes [3]. In the peri-Mediterranean and the Middle East, convergent evolution of the haptoral sclerites (ventral bar) has been documented in dactylogyrid monogeneans [26,53]. From an evolutionary perspective, the T-shaped dorsal bar (character 5) we recovered in West Mediterranean Gyrodactylus spp. most probably evolved in North Africa by means of prolongation of the median part of the dorsal bar, leading to an additional branch positioned between the hamuli. Then, historical contacts between cyprinids crossing the land bridge between North Africa and Iberia likely allowed for the successful host switch of ancestral Gyrodactylus with the unusual morphology from North African cyprinids to Iberian Luciobarbus and subsequent speciation (according to the morphology and genetic distances, ongoing speciation seems to have played a role after geographical isolation). Similar evolution of the membranous structure associated with the hamuli (character 4) can also be proposed; however, this character likely became lost during the evolutionary history of Gyrodactylus in Moroccan Luciobarbus spp., as evidenced in G. pseudomoroccensis sp. nov. Overall, we emphasize that the evolution of the morphological characters of the attachment organ needs to be more thoroughly investigated by adding genetic data from a wider range of Palearctic Gyrodactylus spp.

5. Conclusions

The Strait of Gibraltar and its neighboring freshwater realms have experienced drastic climate and geological changes that have shaped the present distribution of cyprinid fish in this region and have favored a high rate of endemism. To the best of our knowledge, little was previously known about the composition of the parasite fauna of cyprinids in the West Mediterranean, mainly that of viviparous monogeneans, and genetic information was still missing until now. The present research is the first to reveal the taxonomic and genetic diversity of Gyrodactylus communities in the West Mediterranean, as well as their phylogenetic position within congeners worldwide. Morpho-genetic characterization of monogenean specimens parasitizing a set of cyprinid hosts endemic to two regions separated by the Strait of Gibraltar supported the Eurasian origin of West Mediterranean Gyrodactylus lineages and indicated vicariant speciation across the Strait, as well as ongoing speciation in Northwest Africa. Nevertheless, we emphasize that the haptoral characters of Gyrodactylus should be meticulously featured, since the species are known for their inconspicuous morphological diversity, and that a wide range of Gyrodactylus members are required to resolve phylogenetic uncertainties and elucidate the evolutionary history of Gyrodactylus.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/d15111152/s1, Table S1: Matrix of pairwise genetic distances (p–distance) based on alignments of the 18S rDNA (457 bp) and ITS regions (838 bp). West Mediterranean Gyrodactylus spp. investigated in this study are indicated in bold.

Author Contributions

A.Š. designed and supervised the study, co-organized the field trip, participated in parasite collection and the preparation of specimens, and provided scientific background in the field of monogenean fauna of North African cyprinid fish. C.R. designed the study, performed microscopical observations, identified the new species, and drew the hard parts. M.S. and M.B. isolated, amplified, and sequenced the DNA samples. M.S. and C.R. performed the phylogenetic analyses. C.R. wrote the manuscript. A.Š., C.R., M.S. and M.B. revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the Czech Science Foundation, projects n. GA15-19382S (realization of field trips) and project n. GA20-13539S (DNA sequencing and data analyses).

Institutional Review Board Statement

Field sampling was approved by the Haut Commissairiat aux Eaux et Forêts et à la Lutte contre la Désertification (Ministèr de l’Agriculture, de la Pêche Maritime, du Développement Rural et des Eaux et Forêts, Royaume du Maroc) (N° 62 HCEFLCD/DLCDPN/CPC/PPC). People holding the permission are listed in the acknowledgments.

Data Availability Statement

The data supporting the conclusions of this paper are included within the article. The type-material of the new species described in this study was deposited in the Helminthological collection of the Institute of Parasitology, Biology Centre of Academy of Sciences of the Czech Republic, České Budějovice (IPCAS) under the accession numbers IPCAS-M779–81. The genetic sequence data have been deposited in the GenBank database (see Table 2 for the accession numbers). Uncorrected p-distances from the DNA sequences associated with this manuscript are provided online as electronic supplementary materials.

Acknowledgments

The authors are deeply grateful to the dedicated support of Antoine Pariselle, Abdelaziz Benhoussa, and Imane Rahmouni from Mohamed V University, Rabat, Morocco; Ignacio Doadrio from Museo Nacional de Ciencias Naturales, Spain; and Carla Sousa-Santos from the Marine and Environmental Sciences Centre, Portugal, who shared with us information about fish distribution and partially contributed to fish sampling. The authors would also like to thank Jasna Vukić from Charles University, Prague, Czech Republic and Radek Šanda from the National Museum, Prague, Czech Republic for fish sampling and identification and for the clarification of cyprinid host nomenclature, and Eva Řehulková, Maria Lujza Červenka Kičinja, Jaroslav Červenka, and Tomáš Pakosta from Masaryk University, Brno, Czech Republic for their kind help with fish dissection, parasite isolation, and fixation. The authors would like to thank Matthew Nicholls for the English language revision of the manuscript, and the anonymous reviewers. The authors express a deep gratitude to Blanka Škoríková (Institute of Parasitology, Biology Centre of the Czech Academy of Sciences, České Budějovice, Czech Republic) for her kind help with the deposition of the type-material at IPCAS.

Conflicts of Interest

The authors declare no conflict of interest.

References

Huyse, T.; Poulin, R.; Théron, A. Speciation in parasites: A population genetics approach. Trends Parasitol. 2005, 21, 469–475. [Google Scholar] [CrossRef] [PubMed]
Weinstein, S.B.; Kuris, A.M. Independent origins of parasitism in Animalia. Biol. Lett. 2016, 12, 20160324. [Google Scholar] [CrossRef] [PubMed]
Rahmouni, C.; Vanhove, M.P.M.; Šimková, A.; Van Steenberge, M. Morphological and genetic divergence in a gill monogenean parasitizing distant cichlid lineages of Lake Tanganyika: Cichlidogyrus nshomboi (Monogenea: Dactylogyridae) from representatives of Boulengerochromini and Perissodini. Evol. Biol. 2022, 49, 221–238. [Google Scholar] [CrossRef]
McCoy, K.D. Sympatric speciation in parasites—What is sympatry? Trends Parasitol. 2003, 19, 400–404. [Google Scholar] [CrossRef] [PubMed]
Šimková, A.; Serbielle, C.; Pariselle, A.; Vanhove, M.P.M.; Morand, S. Speciation in Thaparocleidus (Monogenea: Dactylogyridae) parasitizing Asian Pangasiid catfishes. Biomed Res. Int. 2013, 2013, 353956. [Google Scholar] [CrossRef]
Řehulková, E.; Seifertová, M.; Přikrylová, I.; Francová, K. Monogenea. In A Guide to the Parasites of African Freshwater Fishes; Scholz, T., Vanhove, M.P.M., Smit, N., Jayasundera, Z., Gelnar, M., Eds.; AbcTaxa: Brussels, Belgium, 2018; pp. 185–243. [Google Scholar]
Poulin, R.; Morand, S. The diversity of parasites. Q Rev. Biol. 2000, 75, 277–293. [Google Scholar] [CrossRef]
Šimková, A.; Morand, S.; Jobet, E.; Gelnar, M.; Verneau, O. Molecular phylogeny of congeneric monogenean parasites (Dactylogyrus): A case of intrahost speciation. Evolution 2004, 58, 1001–1018. [Google Scholar] [CrossRef]
Vanhove, M.P.M.; Pariselle, A.; Van Steenberge, M.; Raeymaekers, J.A.M.; Hablützel, P.I.; Gillardin, C.; Hellemans, B.; Breman, F.C.; Koblmüller, S.; Sturmbauer, C.; et al. Hidden biodiversity in an ancient lake: Phylogenetic congruence between Lake Tanganyika tropheine cichlids and their monogenean flatworm parasites. Sci. Rep. 2015, 5, 13669. [Google Scholar] [CrossRef]
Rahmouni, C.; Vanhove, M.P.M.; Šimková, A. Underexplored diversity of gill monogeneans in cichlids from Lake Tanganyika: Eight new species of Cichlidogyrus Paperna, 1960 (Monogenea: Dactylogyridae) from the northern basin of the lake, with remarks on the vagina and the heel of the male copulatory. Parasite Vectors 2017, 10, 591. [Google Scholar] [CrossRef]
Rahmouni, C.; Vanhove, M.P.M.; Koblmüller, S.; Šimková, A. Molecular phylogeny and speciation patterns in host-specific monogeneans (Cichlidogyrus, Dactylogyridae) parasitizing cichlid fishes (Cichliformes, Cichlidae) in Lake Tanganyika. Int. J. Parasitol. 2022, 52, 359–375. [Google Scholar] [CrossRef]
Meinilä, M.; Kuusela, J.; Ziȩtara, M.S.; Lumme, J. Initial steps of speciation by geographic isolation and host switch in salmonid pathogen Gyrodactylus salaris (Monogenea: Gyrodactylidae). Int. J. Parasitol. 2004, 34, 515–526. [Google Scholar] [CrossRef] [PubMed]
Bakke, T.A.; Cable, J.; Harris, P.D. The biology of gyrodactylid monogeneans: The “Russian-doll killers”. Adv. Parasitol. 2007, 64, 161–376. [Google Scholar] [CrossRef] [PubMed]
Cable, J.; Harris, P.D.; Tinsley, R.C. Melanin deposition in the gut of the monogenean Macrogyrodactylus polypteri Malmberg 1957. Int. J. Parasitol. 1997, 27, 1323–1331. [Google Scholar] [CrossRef] [PubMed]
Malmberg, G. The excretory systems and the marginal hooks as a basis for the systematics of Gyrodactylus (Trematoda, Monogenea). Ark. Zool. 1970, 23, 1–235. [Google Scholar]
Boeger, W.A.; Kritsky, D.C.; Patella, L.; Bueno-Silva, M. Phylogenetic status and historical origins of the oviparous and viviparous gyrodactylids (Monogenoidea, Gyrodactylidea). Zool. Scr. 2021, 50, 112–124. [Google Scholar] [CrossRef]
Přikrylová, I.; Barson, M.; Shinn, A.P. Description of Tresuncinidactylus wilmienae gen. et sp. n. (Monogenea: Gyrodactylidae), from the gills of the bulldog, Marcusenius macrolepidotus (Peters) from Lake Kariba, Zimbabwe. Folia Parasitol. 2021, 68, 25. [Google Scholar] [CrossRef]
Pugachev, O.N.; Gerasev, P.I.; Gussev, A.V.; Ergens, R.; Khotenowsky, I. Guide to Monogenoidea of Freshwater Fish of Palaearctic and Amur Regions; Ledizioni: Milan, Italy, 2010; pp. 361–363. [Google Scholar]
You, P.; King, S.D.; Ye, F.; Cone, D.K. Paragyrodactylus variegatus n. sp. (Gyrodactylidae) from Homatula variegata (Dabry De Thiersant, 1874) (Nemacheilidae) in central China. J. Parasitol. 2014, 100, 350–355. [Google Scholar] [CrossRef]
Pálsson, J.; Beverley-Burton, M. Laminiscus n.g. (Monogenea: Gyrodactylidae) from capelin, Mallotus villosus (Müller), (Pisces: Osmeridae) in the northwest Atlantic with redescriptions of L. gussevi n. comb., Gyrodactyloides petruschewskii, and G. andriaschewi. Can. J. Zool. 1983, 61, 298–306. [Google Scholar] [CrossRef]
Ahyong, S.; Boyko, C.B.; Bailly, N.; Bernot, J.; Bieler, R.; Brandão, S.N.; Daly, M.; De Grave, S.; Gofas, S.; Hernandez, F.; et al. World Register of Marine Species (WoRMS). Available online: https://www.marinespecies.org/ (accessed on 12 March 2023).
Vercammen Grandjean, P.H. Les trematodes du Lac Kivu Sud (Vermes). Ann. Mus. R. Afr. Centr. Scien. Zool. 1960, 5, 1–171. [Google Scholar]
Bakke, T.A.; Harris, P.D.; Cable, J. Host specificity dynamics: Observations on gyrodactylid monogeneans. Int. J. Parasitol. 2002, 32, 281–308. [Google Scholar] [CrossRef]
Boeger, W.A.; Kritsky, D.C.; Pie, M.R. Context of diversification of the viviparous Gyrodactylidae (Platyhelminthes, Monogenoidea). Zool. Scr. 2003, 32, 437–448. [Google Scholar] [CrossRef] [PubMed]
Vanhove, M.P.M.; Boeger, W.; Bukinga, F.; Volckaert, F.; Huyse, T.; Pariselle, A. A new species of Gyrodactylus (Monogenea, Gyrodactylidae), an ectoparasite from the endemic Iranocichla hormuzensis (Teleostei, Cichlidae), the only Iranian cichlid. Eur. J. Taxon. 2012, 30, 1–10. [Google Scholar] [CrossRef]
Benovics, M.; Nejat, F.; Abdoli, A.; Šimková, A. Molecular and morphological phylogeny of host-specific Dactylogyrus parasites (Monogenea) sheds new light on the puzzling Middle Eastern origin of European and African lineages. Parasite Vectors 2021, 14, 372. [Google Scholar] [CrossRef] [PubMed]
Šimková, A.; Řehulková, E.; Choudhury, A.; Seifertová, M. Host-specific parasites reveal the history and biogeographical contacts of their hosts: The Monogenea of Nearctic cyprinoid fishes. Biology 2022, 11, 229. [Google Scholar] [CrossRef]
Šimková, A.; Benovics, M.; Rahmouni, I.; Vukić, J. Host-specific Dactylogyrus parasites revealing new insights on the historical biogeography of Northwest African and Iberian cyprinid fish. Parasite Vectors 2017, 10, 589. [Google Scholar] [CrossRef]
Fricke, R.; Eschmeyer, W.; Fong, J.D. Eschmeyer’s Catalog of Fishes: Genera, species, references Electronic Version. Available online: https://researcharchive.calacademy.org/ (accessed on 12 March 2023).
Tan, M.; Armbruster, J.W. Phylogenetic classification of extant genera of fishes of the order Cypriniformes (Teleostei: Ostariophysi). Zootaxa 2018, 4476, 6–39. [Google Scholar] [CrossRef]
Stout, C.C.; Tan, M.; Lemmon, A.R.; Lemmon, E.M.; Armbruster, J.W. Resolving Cypriniformes relationships using an anchored enrichment approach. BMC Evol. Biol. 2016, 16, 244. [Google Scholar] [CrossRef]
Skelton, P.H.; Tweddle, D.; Jackson, P.B.N. Cyprinids of Africa. In Cyprinid Fishes: Systematics, Biology and Exploitation; Winfield, I.J., Nelson, J.S., Eds.; Springer: Dordrecht, The Netherlands, 1991; pp. 211–239. ISBN 978-94-011-3092-9. [Google Scholar]
Nelson, J.S.; Grande, T.C.; Wilson, M.V.H. Fishes of the World, 5th ed.; John Wiley & Sons: Hoboken, NJ, USA, 2016; p. 601, ISBN 9781119174844. [Google Scholar]
Vreven, E.J.W.M.N.; Musschoot, T.; Snoeks, J.; Schliewen, U.K. The African hexaploid Torini (Cypriniformes: Cyprinidae): Review of a tumultuous history. Zool. J. Linn. Soc. 2016, 177, 231–305. [Google Scholar] [CrossRef]
Yang, L.; Sado, T.; Vincent Hirt, M.; Pasco-Viel, E.; Arunachalam, M.; Li, J.; Wang, X.; Freyhof, J.; Saitoh, K.; Simons, A.M.; et al. Phylogeny and polyploidy: Resolving the classification of cyprinine fishes (Teleostei: Cypriniformes). Mol. Phylogenet. Evol. 2015, 85, 97–116. [Google Scholar] [CrossRef]
Borkenhagen, K.; Esmaeili, H.R.; Mohsenzadeh, S.; Shahryari, F.; Gholamifard, A. The molecular systematics of the Carasobarbus species from Iran and adjacent areas, with comments on Carasobarbus albus (Heckel, 1843). Environ. Biol. Fishes 2011, 91, 327–335. [Google Scholar] [CrossRef]
Borkenhagen, K.; Krupp, F. Taxonomic revision of the genus Carasobarbus Karaman, 1971 (Actinopterygii, Cyprinidae). Zookeys 2013, 339, 1–53. [Google Scholar] [CrossRef] [PubMed]
Froese, R.; Pauly, D. FishBase World Wide Web Electronic Publication. Available online: http://www.fishbase.org/search.php (accessed on 20 March 2023).
Tsigenopoulos, C.S.; Kasapidis, P.; Berrebi, P. Phylogenetic relationships of hexaploid large-sized barbs (genus Labeobarbus, Cyprinidae) based on mtDNA data. Mol. Phylogenet. Evol. 2010, 56, 851–856. [Google Scholar] [CrossRef] [PubMed]
Tsigenopoulos, C.; Durand, J.-D.; Unlu, E.; Berrebi, P. Rapid radiation of the Mediterranean Luciobarbus species (Cyprinidae) after the Messinian salinity crisis of the Mediterranean Sea, inferred from mitochondrial phylogenetic analysis. Biol. J. Linn. Soc. 2003, 80, 207–222. [Google Scholar] [CrossRef]
Doadrio, I. Freshwater fish fauna of North Africa and its biogeography. Ann. Mus. R. Cent. Afr. Zool. 1994, 275, 21–34. [Google Scholar]
Krijgsman, W.; Hilgen, F.J.; Raffi, I.; Sierro, F.J.; Wilson, D.S. Chronology, causes and progression of the Messinian salinity crisis. Nature 1999, 400, 652–655. [Google Scholar] [CrossRef]
Rosenbaum, G.; Lister, G.; Duboz, C. Reconstruction of the tectonic evolution of the Western Mediterranean since the Oligocene. J. Virtual Explor. 2001, 8, 107–130. [Google Scholar] [CrossRef]
Machordom, A.; Doadrio, I. Evidence of a Cenozoic Betic–Kabilian connection based on freshwater fish phylogeography (Luciobarbus, Cyprinidae). Mol. Phylogenet. Evol. 2001, 18, 252–263. [Google Scholar] [CrossRef]
Mesquita, N.; Cunha, C.; Carvalho, G.R.; Coelho, M.M. Comparative phylogeography of endemic cyprinids in the south-west Iberian Peninsula: Evidence for a new ichthyogeographic area. J. Fish Biol. 2007, 71, 45–75. [Google Scholar] [CrossRef]
Casal-López, M.; Doadrio, I. The Messinian imprint on the evolution of freshwater fishes of the genus Luciobarbus Heckel, 1843 (Teleostei, Cyprinidae) in the western Mediterranean. J. Biogeogr. 2018, 45, 1593–1603. [Google Scholar] [CrossRef]
Machordom, A.; Doadrio, I.; Berrebi, P. Phylogeny and evolution of the genus Barbus in the Iberian Peninsula as revealed by allozyme electrophoresis. J. Fish Biol. 1995, 47, 211–236. [Google Scholar] [CrossRef]
Zardoya, R.; Doadrio, I. Phylogenetic relationships of Iberian cyprinids: Systematic and biogeographical implications. Proc. Biol. Sci. 1998, 265, 1365–1372. [Google Scholar] [CrossRef] [PubMed]
Doadrio, I.; Casal-López, M.; Perea, S.; Yahyaoui, A. Taxonomy of rheophilic Luciobarbus Heckel, 1842 (Actinopterygii, Cyprinidae) from Morocco with the description of two new species. Graellsia 2016, 72, e039. [Google Scholar] [CrossRef]
Casal-López, M.; Perea, S.; Yahyaoui, A.; Doadrio, I. Taxonomic review of the genus Luciobarbus Heckel, 1843 (Actinopterygii, Cyprinidae) from Northwestern Morocco with the description of three new species. Graellsia 2015, 71, e027. [Google Scholar] [CrossRef]
Brahimi, A.; Libois, R.; Henrard, A.; Freyhof, J. Luciobarbus Lanigarensis and L. Numidiensis, two new species of barbels from the Mediterranean Sea Basin in North Africa (Teostei: Cyprinidae). Zootaxa 2018, 4433, 542–560. [Google Scholar] [CrossRef]
Crespo-Blanc, A.; Comas, M.; Balanyá, J. Clues for a Tortonian reconstruction of the Gibraltar Arc: Structural pattern, deformation, diachronism and block rotations. Tectonophysics 2016, 683, 308–324. [Google Scholar] [CrossRef]
Benovics, M.; Vukić, J.; Šanda, R.; Rahmouni, I.; Šimková, A. Disentangling the evolutionary history of peri-Mediterranean cyprinids using host-specific gill monogeneans. Int. J. Parasitol. 2020, 50, 969–984. [Google Scholar] [CrossRef]
Shigoley, M.; Rahmouni, I.; Louizi, H.; Pariselle, A.; Vanhove, M.P.M. First study on Gyrodactylus (Monogenea: Gyrodactylidae) in Morocco, with description of a New species from cyprinids (Actinopterygii: Cyprinidae). Animals 2023, 13, 1624. [Google Scholar] [CrossRef]
Gutiérrez-Galindo, J.F.; Lacasa-Millán, M.I. Study of the Monogenea of Cyprinidae in the Llobregat River, Northeastern Spain. 11. Species composition on Barbus graellsii Steindachner, 1866. Rev. Ibérica Parasitol. 2001, 61, 91–96. [Google Scholar]
Malmberg, G. On the Occurrence of Gyrodactylus on Swedish Fishes. Skr. Utgivna Av Södra Sver. Fisk (In Swedish). 1957, 19–76. [Google Scholar]
Bush, A.O.; Lafferty, K.D.; Lotz, J.M.; Shostak, A.W. Parasitology meets ecology on its own terms: Margolis et al. revisited. J. Parasitol. 1997, 83, 575–583. [Google Scholar] [CrossRef] [PubMed]
Ondračková, M.; Seifertová, M.; Bryjová, A.; Leis, E.; Jurajda, P. Morphometric and genetic evidence for cryptic diversity in Gyrodactylus (Monogenea) infecting non-native European populations of Ameiurus nebulosus and A. melas. Parasitology 2020, 147, 1700–1711. [Google Scholar] [CrossRef] [PubMed]
Hammer, Ø.; Harper, D.; Ryan, P. Past: Paleontological statistics software package for education and data analysis. Paleontol. Electron. 2001, 4, 9. [Google Scholar] [CrossRef]
Rahmouni, C.; Seifertová, M.; Simková, A. Revealing the hidden diversity of Gyrodactylus communities (Monogenea: Gyrodactylidae) from Nearctic Catostomidae and Leuciscidae fish hosts (Teleostei: Cypriniformes), with description of ten new species. Parasite 2023, 30, 40. [Google Scholar] [CrossRef]
Ziętara, M.S.; Arndt, A.; Geets, A.; Hellemans, B.; Volckaert, F.A.M. The Nuclear rDNA Region of Gyrodactylus arcuatus and G. branchicus (Monogenea: Gyrodactylidae). J. Parasitol. 2000, 86, 1368–1373. [Google Scholar] [CrossRef]
Matějusova, I.; Gelnar, M.; McBeath, A.J.; Collins, C.M.; Cunningham, C.O. Molecular markers for gyrodactylids (Gyrodactylidae: Monogenea) from five fish families (Teleostei). Int. J. Parasitol. 2001, 31, 738–745. [Google Scholar] [CrossRef]
Cone, D.; Abbott, C.; Gilmore, S.; Burt, M. A new genus and species of gyrodactylid (Monogenea) from silver hake, Merluccius bilinearis, in the bay of fundy, New Brunswick, Canada. J. Parasitol. 2010, 96, 681–684. [Google Scholar] [CrossRef]
Rokicka, M.; Lumme, J.; Ziętara, M.S. Identification of Gyrodactylus ectoparasites in Polish salmonid farms by PCR-RFLP of the nuclear ITS segment of ribosomal DNA (Monogenea, Gyrodactylidae). Acta Parasitol. 2007, 52, 185–195. [Google Scholar] [CrossRef]
Cunningham, C.O. Species variation within the internal transcribed spacer (ITS) Region of Gyrodactylus (Monogenea:Gyrodactylidae) ribosomal RNA genes. J. Parasitol. 1997, 83, 215–219. [Google Scholar] [CrossRef]
Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef] [PubMed]
Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [PubMed]
Nguyen, L.T.; Schmidt, H.A.; Von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
Minh, B.Q.; Nguyen, M.A.T.; Von Haeseler, A. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef]
Ronquist, F.; Teslenko, M.; Van Der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. Mrbayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef]
Rambaut, A.; Drummond, A.J.; Xie, D.; Baele, G.; Suchard, M.A. Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Syst. Biol. 2018, 67, 901–904. [Google Scholar] [CrossRef]
Rambaut, A. FigTree v1.4.4. Molecular Evolution, Phylogenetetics and Epidemiology. Available online: https://tree.bio.ed.ac.uk/ (accessed on 16 July 2023).
Müller, J.; Müller, K. TREEGRAPH: Automated drawing of complex tree figures using an extensible tree description format. Mol. Ecol. Notes 2004, 4, 786–788. [Google Scholar] [CrossRef]
Přikrylová, I.; Vanhove, M.P.M.; Janssens, S.B.; Billeter, P.A.; Huyse, T. Tiny worms from a mighty continent: High diversity and new phylogenetic lineages of African monogeneans. Mol. Phylogenet. Evol. 2013, 67, 43–52. [Google Scholar] [CrossRef]
Matějusová, I.; Gelnar, M.; Verneau, O.; Cunningham, C.O.; Littlewood, D.T.J. Molecular phylogenetic analysis of the genus Gyrodactylus (Platyhelminthes: Monogenea) inferred from rDNA ITS region: Subgenera versus species groups. Parasitology 2003, 127, 603–611. [Google Scholar] [CrossRef]
Přikrylová, I.; Blažek, R.; Vanhove, M.P.M. An overview of the Gyrodactylus (Monogenea: Gyrodactylidae) species parasitizing African catfishes, and their morphological and molecular diversity. Parasitol. Res. 2012, 110, 1185–1200. [Google Scholar] [CrossRef]
Gilmore, S.R.; Cone, D.K.; Lowe, G.; King, S.K.; Jones, S.R.M.; Abbott, C.L. Molecular phylogeny of Gyrodactylus (Monogenea) parasitizing fishes in fresh water, estuarine, and marine habitats in Canada. Can. J. Zool. 2012, 90, 776–786. [Google Scholar] [CrossRef]
Ziętara, M.; Lumme, J. Comparison of molecular phylogeny and morphological systematics in fish parasite genus Gyrodactylus Nordmann, 1832 (Monogenea, Gyrodactylidae). Zool. Pol. 2004, 49, 5–28. [Google Scholar]
Leis, E.; King, S.; Leis, S.; Cone, D. Infections of Gyrodactylus Crysoleucas and Gyrodactylus sp. (Monogenea) at a Golden Shiner (Notemigonus Crysoleucas) Farm in Minnesota. Comp. Parasitol. 2016, 83, 105–110. [Google Scholar] [CrossRef]
Ziętara, M.S.; Lumme, J. Speciation by host switch and adaptive radiation in a fish parasite genus Gyrodactylus (Monogenea, Gyrodactylidae). Evolution 2002, 56, 2445–2458. [Google Scholar] [CrossRef] [PubMed]
Benovics, M.; Rahmouni, C.; Rehulková, E.; Nejat, F.; Simková, A. Uncovering the monogenean species diversity of cyprinoid fish (Cypriniformes: Cyprinidae) in Iraq using integrative approach. Parasitology 2023, in press. [Google Scholar]
Leis, E.; Easy, R.; Cone, D. A variant of Gyrodactylus mediotorus King, Marcogliese, Forest, McLaughlin and Bentzen, 2013 (Monogenea) identified from weed shiner (Notropis texanus) in Wisconsin portions of the upper Mississippi River. Syst. Parasitol. 2021, 98, 247–253. [Google Scholar] [CrossRef]
Huyse, T.; Audenaert, V.; Volckaert, F.A.M. Speciation and host-parasite relationships in the parasite genus Gyrodactylus (Monogenea, Platyhelminthes) infecting gobies of the genus Pomatoschistus (Gobiidae, Teleostei). Int. J. Parasitol. 2003, 33, 1679–1689. [Google Scholar] [CrossRef]
Huyse, T.; Volckaert, F.A.M. Identification of a host-associated species complex using molecular and morphometric analyses, with the description of Gyrodactylus Rugiensoides n. sp. (Gyrodactylidae, Monogenea). Int. J. Parasitol. 2002, 32, 907–919. [Google Scholar] [CrossRef]
Cunningham, C.O.; McGillivray, D.M.; MacKenzie, K.; Melvin, W.T. Discrimination between Gyrodactylus Salaris, G. Derjavini and G. Truttae (Platyhelminthes: Monogenea) using restriction fragment length polymorphisms and an oligonucleotide probe within the small subunit ribosomal RNA gene. Parasitology 1995, 111, 87–94. [Google Scholar] [CrossRef]
Leis, E.; Chi, T.K.; Lumme, J. Global phylogeography of salmonid ectoparasites of the genus Gyrodactylus, with an emphasis on the origin of the circumpolar Gyrodactylus Salmonis (Platyhelminthes: Monogenea). Comp. Parasitol. 2021, 88, 130–143. [Google Scholar] [CrossRef]
King, S.D.; Cone, D.K. Morphological and molecular taxonomy of a new species of Fundulotrema and comments on Gyrodactylus Stephanus (Monogenea: Gyrodactylidae) from Fundulus Heteroclitus (Actinopterygii: Cyprinodontiformes) in Nova Scotia, Canada. J. Parasitol. 2009, 95, 846–849. [Google Scholar] [CrossRef] [PubMed]
Kritsky, D.C.; Boeger, W.A.; Mendoza-Franco, E.F.; Vianna, R.T. Neotropical Monogenoidea. 57. Revision and phylogenetic position of Scleroductus Jara & Cone, 1989 (Gyrodactylidae), with descriptions of new species from the Guatemalan chulin Rhamdia Guatemalensis (Günther) (Siluriformes: Heptapteridae) in Mexico and the barred sorubim Pseudoplatystoma fasciatum (Linnaeus) (Siluriformes: Pimelodidae) in Brazil. Syst. Parasitol. 2013, 84, 1–15. [Google Scholar] [CrossRef]
Schelkle, B.; Paladini, G.; Shinn, A.P.; King, S.; Johnson, M.; van Oosterhout, C.; Mohammed, R.S.; Cable, J. Ieredactylus Rivuli Gen. et Sp. Nov. (Monogenea, Gyrodactylidae) from Rivulus Hartii (Cyprinodontiformes, Rivulidae) in Trinidad. Acta Parasitol. 2011, 56, 360–370. [Google Scholar] [CrossRef]
Barson, M.; Přikrylová, I.; Vanhove, M.P.M.; Huyse, T. Parasite hybridization in African Macrogyrodactylus spp. (Monogenea, Platyhelminthes) signals historical host distribution. Parasitology 2010, 137, 1585–1595. [Google Scholar] [CrossRef]
Harris, P.D.; Shinn, A.P.; Cable, J.; Bakke, T.A. Nominal species of the genus Gyrodactylus von Nordmann 1832 (Monogenea: Gyrodactylidae), with a list of principal host species. Syst. Parasitol. 2004, 59, 1–27. [Google Scholar] [CrossRef] [PubMed]
Ergens, R. Zwei weitere befunde der Gyrodactylus-Art (Monogenoidea) aus der Tschechoslowakei. Věstník Ceskoslov. Společnosti Zool. 1961, 25, 25–27. [Google Scholar]
Ziȩtara, M.S.; Lumme, J. The crossroads of molecular, typological and biological species concepts: Two new species of Gyrodactylus Nordmann, 1832 (Monogenea: Gyrodactylidae). Syst. Parasitol. 2003, 55, 39–52. [Google Scholar] [CrossRef]
Huyse, T.; Malmberg, G.; Volckaert, F.A.M. Four new species of Gyrodactylus von Nordmann, 1832 (Monogenea, Gyrodactylidae) on gobiid fishes: Combined DNA and morphological analyses. Syst. Parasitol. 2004, 59, 103–120. [Google Scholar] [CrossRef]
Cable, J.; Harris, P.D.; Tinsley, R.C.; Lazarus, C.M. Phylogenetic analysis of Gyrodactylus spp. (Platyhelminthes: Monogenea) using ribosomal DNA sequences. Can. J. Zool. 1999, 77, 1439–1449. [Google Scholar] [CrossRef]
Gettová, L.; Gilles, A.; Šimková, A. Metazoan parasite communities: Support for the biological invasion of Barbus Barbus and its hybridization with the endemic Barbus meridionalis. Parasit. Vectors 2016, 9, 588. [Google Scholar] [CrossRef]
Rahmouni, I.; Řehulková, E.; Pariselle, A.; Rkhami, O.B.; Šimková, A. Four new species of Dactylogyrus Diesing, 1850 (Monogenea: Dactylogyridae) parasitising the gills of northern Moroccan Luciobarbus Heckel (Cyprinidae): Morphological and molecular characterisation. Syst. Parasitol. 2017, 94, 575–591. [Google Scholar] [CrossRef] [PubMed]
Benovics, M.; Desdevises, Y.; Šanda, R.; Vukić, J.; Scheifler, M.; Doadrio, I.; Sousa-Santos, C.; Šimková, A. High diversity of fish ectoparasitic monogeneans (Dactylogyrus) in the Iberian Peninsula: A case of adaptive radiation? Parasitology 2020, 147, 418–430. [Google Scholar] [CrossRef] [PubMed]
Řehulková, E.; Rahmouni, I.; Pariselle, A.; Šimková, A. Integrating morphological and molecular approaches for characterizing four species of Dactylogyrus (Monogenea: Dactylogyridae) from Moroccan cyprinids, with comments on their host specificity and phylogenetic relationships. PeerJ 2021, 9, e10867. [Google Scholar] [CrossRef] [PubMed]
Truter, M.; Smit, N.J.; Malherbe, W.; Přikrylová, I. Description of Gyrodactylus paludinosus sp. nov. (Monogenea: Gyrodactylidae) from the Straightfin Barb, Enteromius paludinosus (Peters, 1852), in South Africa. Acta Parasitol. 2021, 67, 446–453. [Google Scholar] [CrossRef]
Přikrylová, I.; Shinn, A.P.; Paladini, G. Description of Citharodactylus gagei n. gen. et n. sp. (Monogenea: Gyrodactylidae) from the moon fish, Citharinus citharus (Geoffroy Saint-Hilaire), from Lake Turkana. Parasitol. Res. 2016, 116, 281–292. [Google Scholar] [CrossRef]
Bueno-Silva, M.; Boeger, W.A.; Pie, M.R. Choice matters: Incipient speciation in Gyrodactylus corydori (Monogenoidea: Gyrodactylidae). Int. J. Parasitol. 2011, 41, 657–667. [Google Scholar] [CrossRef]
Benovics, M.; Vukić, J.; Šanda, R.; Nejat, F.; Charmpila, E.A.; Buj, I.; Shumka, S.; Porcelloti, S.; Tarkan, S.A.; Aksu, S.; et al. Monogeneans and chubs: Ancient host-parasite system under the looking glass. Mol. Phylogenet. Evol. 2023, 179, 107667. [Google Scholar] [CrossRef]
Cunningham, C.O.; Mo, T.A.; Collins, C.M.; Buchmann, K.; Thiery, R.; Blanc, G.; Lautraite, A. Redescription of Gyrodactylus teuchis Lautraite, Blanc, Thiery, Daniel & Vigneulle, 1999 (Monogenea: Gyrodactylidae); a species identified by ribosomal RNA sequence. Syst. Parasitol. 2001, 48, 141–150. [Google Scholar] [CrossRef]
Dmitrieva, E.; Sanna, D.; Vodiasova, E.; Prokhorova, D.; Casu, M.; Burreddu, C.; Piras, M.C.; Garippa, G.; Merella, P. Morphological and genetic variability of the cryptic Gyrodactylus sphinx and Gyrodactylus gerasevi n. sp. (Platyhelminthes: Monogenea) from the Mediterranean Sea and Black Sea: Two new members of the cross-ocean distributed Gyrodactylus orecchiae species. J. Helminthol. 2022, 96, e9. [Google Scholar] [CrossRef]
Ouassal, K.; Doadrio, I.; Perea, S.; Casal-López, M.; Yahyaoui, A.; Jaziri, H. Mitochondrial genetic diversity, phylogeography and historical demography of Moroccan native freshwater fishes: A case study of the genus Luciobarbus Heckel, 1843. Biologia 2022, 77, 2183–2205. [Google Scholar] [CrossRef]
Vanhove, M.P.M.; Briscoe, A.G.; Jorissen, M.W.P.; Littlewood, D.T.J.; Huyse, T. The first next-generation sequencing approach to the mitochondrial phylogeny of African monogenean parasites (Platyhelminthes: Gyrodactylidae and Dactylogyridae). BMC Genom. 2018, 19, 520. [Google Scholar] [CrossRef] [PubMed]

Figure 1. Map of sampling localities of cyprinoid fish hosts in Northwest Africa (Morocco) and the Iberian Peninsula (Portugal and Spain). Map was created using the simple Mapper tool (www.simplemapper.com, accessed on 30 April 2023) and manually edited (see details in Table 1).

Figure 2. Micrographs showing the unusual morphology of haptoral sclerotized structures recovered in Gyrodactylus specimens found to parasitize Northwest African cyprinid fish hosts across the Strait of Gibraltar. Micrographs were taken from a parasite specimen of Gyrodactylus moroccensis sp. nov. parasitizing the Rabat barbel Luciobarbus rabatensis Doadrio, Perea & Yahyaoui, 2015 (type–host). (A) Haptoral part, general view; (B) detailed morphology of hamuli (H), dorsal (DB) and ventral bars (VB); (C) detailed morphology of marginal hooks.

Figure 6. Principal component analysis (PCA) based on 21 morphological characters of the haptoral sclerotized structures supporting the taxonomical differentiation of Gyrodactylus gibraltarensis sp. nov. from Iberia, Gyrodactylus moroccensis sp. nov., and Gyrodactylus pseudomoroccensis sp. nov. from Northwest Africa. (A) Plot of the PCA (two first axes) illustrating the distribution of Gyrodactylus gibraltarensis sp. nov. specimens (triangles), Gyrodactylus moroccensis sp. nov. (circles), and Gyrodactylus pseudomoroccensis sp. nov. (diamonds). Histograms of the factor loading of the characters contributing most to the variation along PC1 (B) and PC2 (C). Characters 1–4 are for hamuli, 5–11 are for the ventral bar, 12–13 are for the dorsal bar, and 14–21 are for marginal hooks: (1) anchor total length; (2) outer root length; (3) shaft length; (4) point length; (5) ventral bar total length; (6) ventral bar total width; (7) lateral processes length; (8) distance between lateral processes; (9) median width; (10) membrane length; (11) membrane width; (12) dorsal bar total length; (13) dorsal bar width at midpoint; (14) marginal hooks total length; (15) sickle length to shaft attachment; (16) sickle proximal width; (17) sickle distal width; (18) shaft length of sickle; (19) point length of sickle; (20) handle length; (21) filament loop length (terminology follows refs. [15,18]).

Figure 7. Maximum likelihood (ML) phylogram of Gyrodactylus spp. parasitizing distinct fish hosts worldwide based on sequences of the V4 region of the 18S rDNA (457 bp) and ITS regions (838 bp). Values above branches indicate bootstrap support (BS) from ML and posterior probabilities (PP) from BI analyses. Values below 60 (ML) and 0.80 (BI) are shown as dashes. Clades (A–G) refer to different Gyrodactylus spp. lineages.

Figure 8. Schematic representation of the haptoral sclerotized structures of Gyrodactylus spp. parasitizing Eurasian and West Mediterranean species that formed clade A in Figure 7 along the ML phylogram obtained using sequences of the 18S rDNA and ITS regions. The geographical (continental) distribution is mapped onto the ML tree. The drawings were edited using Adobe Illustrator CS6 (see methodology above). A specimen of G. katharineri was collected from B. barbus from France (see [97]). The specimens are not uniformly scaled. Yellow: Asia, including the Middle East; blue: Europe; red: Africa. Character 1: median ridge in the ventral bar; character 2: long lateral processes of the ventral bar; character 3: twisted inner roots of the hamuli; character 4: accessory portion of the hamuli, i.e., the membranous patch-like structure surrounding the inner roots; character 5: T-shaped dorsal bar.

Table 1. List of West Mediterranean cyprinoid hosts collected between 2015 and 2017 and investigated in the present study.

Host Subfamily	Host Species	Total Hosts	Total Worms	Sampling Locality	Abbreviation on the Map	GPS Coordinates	Country	Gyrodactylus spp.	Prevalence (%)	Intensity of Infection
Torinae Karaman, 1971	Pterocapoeta maroccana Günther, 1902	03	14	Oum Er-Rbia River (El Borj)	M3	33°00′58.07″ N 05°37′48.06″ W	Morocco	Gyrodactylus sp. 5	33	1–6
Barbinae Bleeker, 1859	Luciobarbus bocagei (Steindachner, 1864)	15	03	Colares	P1	38°47′53.37″ N 09°26′14.16″ W	Portugal	Gyrodactylus sp. 1	7	3
			05					Gyrodactylus sp. 4	13	2–3
		10	08	Rio Ucera	S2	41°32′49.11″ N 03°04′32.50″ W	Spain	Gyrodactylus sp. 1	30	2–4
			11					Gyrodactylus sp. 4	60	1–3
	Luciobarbus comizo (Steindachner, 1864)	11	25	Peraleda de Zancejo, Rio Zujar	S1	38°27′12.02″ N 05°31′59.67″ W	Spain	Gyrodactylus sp. 3	27	5–14
	Luciobarbus graellsii (Steindachner, 1866)	12	10	upstream Mella, tributary of Materraña	S3	41°06′41.00″ N 00°08′05.00″ E	Spain	G. gibraltarensis sp. nov.	16	1–9
	Luciobarbus yahyaouii Doadrio, Casal-Lopez & Perea, 2016	09	04	Za River	M1	34°24′38.09″ N 02°52′29.1″ W	Morocco	G. moroccensis sp. nov.	11	1–2
		05	04	Meloulou River	M2	34°10′51.07″ N 03°31′59.06″ W		Gyrodactylus sp. 10	60	1–2
	Luciobarbus sclateri (Günther, 1868)	10	0	Torgal river, Mira basin	P2	37°38′16.76″ N 08°37′10.58″ W	Portugal	-	-	-
		10	10	Benahavis, Rio Guadalmina	S4	36°31′03.45″ N 05°02′25.07″ W	Spain	Gyrodactylus sp. 2	20	4–6
	Luciobarbus ksibi Doadrio, Perea and Yahyaoui, 2015	6	5	Ksob	M4	31°27′50.07″ N 09°45′25.03″ W	Morocco	G. pseudomoroccensis sp. nov.	45	1–3
		9	0	Oum Er-Rbia River (Chakouba)	M5	32°51′32.09″ N 05°37′18.09″ W		-	-	-
	Luciobarbus maghrebensis Doadrio, Perea and Yahyaoui,	05	02	Lahdar River	M6	34°15′30.01″ N 04°03′52.01″ W	Morocco	G. moroccensis sp. nov.	20	2
		05	28	Sebou River	M7	34°17′14.2″ N 06°33′14.08″ W			20	1–23
	Luciobarbus massaensis (Pellegrin, 1922)	11	4	Tamrhakht	M8	30°31′33.06″ N 09°38′53.06″ W	Morocco	Gyrodactylus sp. 11	45	2
			4					Gyrodactylus sp. 8	75	2
	Luciobarbus rabatensis Doadrio, Perea and Yahyaoui, 2015	11	18	Maleh River	M11	33°31′58.00″ N 06°37′39.06″ W	Morocco	G. moroccensis sp. nov.	72	1–9
			22					Gyrodactylus sp. 7	27	1–17
	Luciobarbus rifensis Doadrio, Casal-Lopez & Yahyaoui, 2015	10	02	Tributary of Loukkos	M12	34°54′57.02″ N 05°32′17.02″ W	Morocco	G. moroccensis sp. nov.	10	2
			06					Gyrodactylus sp. 9	50	2
	Luciobarbus zayanensis Doadrio, Casal-López & Yahyaoui, 2016	06	03	Oum Er-Rbia River (El Borj)	M9	33°00′58.07″ N 05°37′48.06″ W	Morocco	G. moroccensis sp. nov.	13	2
			04	Oum Er-Rbia River (El Borj)	M9	33°00′58.07″ N 05°37′48.06″ W		Gyrodactylus sp. 6	50	2
		09	0	Oum Er-Rbia River (Dar Oul Zidouh)	M10	32°18′54.00″ N 06°54′28.07″ W		-	-	-

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Share and Cite

MDPI and ACS Style

Rahmouni, C.; Seifertová, M.; Benovics, M.; Šimková, A. Diversity and Phylogeny of Gyrodactylus spp. (Monogenea: Gyrodactylidae) across the Strait of Gibraltar: Parasite Speciation and Historical Biogeography of West Mediterranean Cyprinid Hosts. Diversity 2023, 15, 1152. https://doi.org/10.3390/d15111152

AMA Style

Rahmouni C, Seifertová M, Benovics M, Šimková A. Diversity and Phylogeny of Gyrodactylus spp. (Monogenea: Gyrodactylidae) across the Strait of Gibraltar: Parasite Speciation and Historical Biogeography of West Mediterranean Cyprinid Hosts. Diversity. 2023; 15(11):1152. https://doi.org/10.3390/d15111152

Chicago/Turabian Style

Rahmouni, Chahrazed, Mária Seifertová, Michal Benovics, and Andrea Šimková. 2023. "Diversity and Phylogeny of Gyrodactylus spp. (Monogenea: Gyrodactylidae) across the Strait of Gibraltar: Parasite Speciation and Historical Biogeography of West Mediterranean Cyprinid Hosts" Diversity 15, no. 11: 1152. https://doi.org/10.3390/d15111152

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Menu

Diversity and Phylogeny of Gyrodactylus spp. (Monogenea: Gyrodactylidae) across the Strait of Gibraltar: Parasite Speciation and Historical Biogeography of West Mediterranean Cyprinid Hosts

Abstract

1. Introduction

2. Material and Methods

2.1. Collection of Cyprinid Host Specimens and Their Gyrodactylid Monogeneans

2.2. Morphological Characterization and Multivariate Analysis of West Mediterranean Gyrodactylus

2.3. Phylogenetic Reconstruction

3. Results

3.1. Systematics and Molecular Characterization

3.2. Morphological Delineation among Northwest African and Iberian Gyrodactylus

3.3. Phylogenetic Relationships

3.4. Morphological Evolution of Gyrodactylus in the West Mediterranean Region

4. Discussion

5. Conclusions

Supplementary Materials

Author Contributions

Funding

Institutional Review Board Statement

Data Availability Statement

Acknowledgments

Conflicts of Interest

References

Share and Cite

Article Metrics

Article Access Statistics

Further Information

Guidelines

MDPI Initiatives

Follow MDPI