Tradition or evidence based practice? - World Journal of ...

Indexed and Abstracted in:<br />

W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong><br />

Gastroenterology<br />

Current Contents ® /Clinical Medicine, Science<br />

Citation Index Expanded (also known as<br />

SciSearch ® ) and <strong>Journal</strong> Citation Rep<strong>or</strong>ts/Science<br />

Edition, Index Medicus, MEDLINE and PubMed,<br />

Chemical Abstracts, EMBASE/Excerpta Medica,<br />

Abstracts <strong>Journal</strong>s, Nature Clinical Practice<br />

Gastroenterology and Hepatology, CAB Abstracts<br />

and Global Health.<br />

ISI JCR 2003-2000 IF: 3.318, 2.532, 1.445 and 0.993.<br />

A Weekly <strong>Journal</strong> <strong>of</strong> Gastroenterology and Hepatology<br />

Volume 14 Number 19<br />

May 21, 2008<br />

W<strong>or</strong>ld J Gastroenterol<br />

2008 May 21; 14(19): 2953-3116<br />

Online Submissions<br />

wjg.wjgnet.com<br />

www.wjgnet.com<br />

Printed on Acid-free Paper<br />

ISSN 1007-9327<br />

CN 14-1219/R

---

HONORARY EDITORS-IN-CHIEF<br />

Montgomery Bissell, San Francisco<br />

James L Boyer, New Haven<br />

Chao-Long Chen, Kaohsiung<br />

Ke-Ji Chen, Beijing<br />

Li-Fang Chou, Taipei<br />

Jacques V Dam, Stanf<strong>or</strong>d<br />

Martin H Floch, New Haven<br />

Guadalupe Garcia-Tsao, New Haven<br />

Zhi-Qiang Huang, Beijing<br />

Shinn-Jang Hwang, Taipei<br />

Ira M Jacobson, New Y<strong>or</strong>k<br />

Derek Jewell, Oxf<strong>or</strong>d<br />

Emmet B Keeffe, Palo Alto<br />

Min-Liang Kuo, Taipei<br />

Nicholas F LaRusso, Rochester<br />

Jie-Shou Li, Nanjing<br />

Geng-Tao Liu, Beijing<br />

Lein-Ray Mo, Tainan<br />

Bo-Rong Pan, Xi'an<br />

Fa-Zu Qiu, Wuhan<br />

Eamonn M Quigley, C<strong>or</strong>k<br />

David S Rampton, London<br />

Rafi q A Sheikh, Sacramento<br />

Rudi Schmid, Kentfi eld [1]<br />

Nicholas J Talley, Rochester<br />

Sun-Lung Tsai, Young-Kang City<br />

Guido NJ Tytgat, Amsterdam<br />

Hsiu-Po Wang, Taipei<br />

Jaw-Ching Wu, Taipei<br />

Meng-Chao Wu, Shanghai<br />

Ming-Shiang Wu, Taipei<br />

Jia-Yu Xu, Shanghai<br />

Ta-Sen Yeh, Taoyuan<br />

Ming-Lung Yu, Kaohsiung<br />

W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong><br />

Gastroenterology<br />

Edit<strong>or</strong>ial Board<br />

2007-2009<br />

百世登<br />

Baishideng©<br />

Published by The WJG Press and Baishideng<br />

Room 903, Ocean International Center, Building D<br />

No. 62 Dongsihuan Zhonglu, Chaoyang District, Beijing 100025, China<br />

Fax: +86-10-8538-1893 E-mail: wjg@wjgnet.com http://www.wjgnet.com<br />

The W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology Edit<strong>or</strong>ial Board consists <strong>of</strong> 1208 members, representing a team <strong>of</strong> w<strong>or</strong>ldwide experts in<br />

gastroenterology and hepatology. They are from 60 countries, including Albania (1), Argentina (4), Australia (39), Austria (10),<br />

Belarus (1), Belgium (15), Brazil (2), Bulgaria (1), Canada (28), Chile (1), China (60), Croatia (2), Cuba (1), Czech (2), Denmark (7),<br />

Egypt (4), Estonia (1), Finland (4), France (44), Germany (108), Greece (9), Hungary (2), Iceland (1), India (12), Iran (3), Ireland (4),<br />

Israel (8), Italy (96), Japan (176), Lebanon (3), Lithuania (1), Macedonia (1), Malaysia (3), Mexico (6), Monaco (1), M<strong>or</strong>occo (1), The<br />

Netherlands (26), New Zealand (1), Nigeria (1), N<strong>or</strong>way (3), Pakistan (2), Peru (1), Poland (6), P<strong>or</strong>tugal (1), Russia (3), Saudi Arabia<br />

(2), Serbia (1), Singap<strong>or</strong>e (4), Slovakia (2), Slovenia (1), South Africa (2), South K<strong>or</strong>ea (14), Spain (38), Sweden (15), Switzerland (13),<br />

Turkey (8), United Arab Emirates (1), United Kingdom (83), United States (316) and Uruguay (2).<br />

PRESIDENT AND EDITOR-IN-<br />

CHIEF<br />

Lian-Sheng Ma, Beijing<br />

STRATEGY ASSOCIATE<br />

EDITORS-IN-CHIEF<br />

Peter Draganov, Fl<strong>or</strong>ida<br />

Ronnie Fass, Tucson<br />

Hugh J Freeman, Vancouver<br />

John P Geibel, New Haven<br />

Maria Concepción Gutiérrez-Ruiz, México<br />

Kazuhiro Hanazaki, Kochi<br />

Akio Inui, Kagoshima<br />

Kalpesh Jani, Vadodara<br />

Sanaa M Kamal, Cairo<br />

Ioannis E Koutroubakis, Heraklion<br />

Jose JG Marin, Salamanca<br />

Javier S Martin, Punta del Este<br />

Natalia A Osna, Omaha<br />

Jose Sahel, Marseille<br />

Ned Snyder, Galveston<br />

Nathan Subramaniam, Brisbane<br />

Wei Tang, Tokyo<br />

Alan BR Thomson, Edmonton<br />

Paul Joseph Thuluvath, Baltim<strong>or</strong>e<br />

James F Trotter, Denver<br />

Shingo Tsuji, Osaka<br />

Harry HX Xia, Hanover<br />

Yoshio Yamaoka, Houston<br />

Jesue K Yamamoto-Furusho, México<br />

ASSOCIATE EDITORS-IN-CHIEF<br />

Gianfranco D Alpini, Temple<br />

Bruno Annibale, Roma<br />

Roger W Chapman, Oxf<strong>or</strong>d<br />

Chi-Hin Cho, Hong Kong<br />

Alexander L Gerbes, Munich<br />

Shou-Dong Lee, Taipei<br />

Walter E Longo, New Haven<br />

You-Yong Lu, Beijing<br />

Masao Omata, Tokyo<br />

BIOSTATISTICAL EDITOR<br />

Liang-Ping Hu, Beijing<br />

MEMBERS OF THE EDITORIAL<br />

BOARD<br />

Albania<br />

Bashkim Resuli, Tirana<br />

Argentina<br />

Julio H Carri, Córdoba<br />

Carlos J Pirola, Buenos Aires<br />

Silvia Sookoian, Buenos Aires<br />

Adriana M T<strong>or</strong>res, Rosario<br />

Australia<br />

Leon Anton Adams, Nedlands<br />

Minoti V Apte, Liverpool<br />

Richard B Banati, Lidcombe<br />

Michael R Beard, Adelaide<br />

Patrick Bertolino, Sydney<br />

www.wjgnet.com I

---

Andrew V Biankin, Sydney<br />

Filip Braet, Sydney<br />

Andrew D Clouston, Sydney<br />

Graham Cooksley, Queensland<br />

Darrell HG Crawf<strong>or</strong>d, Brisbane<br />

Adrian G Cummins, Woodville South<br />

Guy D Eslick, Sydney<br />

Michael A Fink, Melbourne<br />

Robert JL Fraser, Daw Park<br />

Peter Raymond Gibson, Vict<strong>or</strong>ia<br />

Jacob Ge<strong>or</strong>ge, Westmead<br />

Mark D G<strong>or</strong>rell, Sydney<br />

Yik-Hong Ho, Townsville<br />

Gerald J Holtmann, Adelaide<br />

Michael H<strong>or</strong>owitz, Adelaide<br />

John E Kellow, Sydney<br />

Rupert Leong, Conc<strong>or</strong>d<br />

Ge<strong>of</strong>frey W McCaughan, Sydney<br />

Finlay A Macrae, Vict<strong>or</strong>ia<br />

Daniel Markovich, Brisbane<br />

Phillip S Oates, Perth<br />

Jacqui Richmond, Vict<strong>or</strong>ia<br />

Stephen M Ri<strong>or</strong>dan, Sydney<br />

Ian C Roberts-Thomson, Adelaide<br />

Devanshi Seth, Camperdown<br />

Arthur Shulkes, Melbourne<br />

Ross C Smith, Sydney<br />

Kevin J Spring, Brisbane<br />

Huy A Tran, New South Wales<br />

Debbie Trinder, Fremantle<br />

Martin J Veysey, Gosf<strong>or</strong>d<br />

Daniel L W<strong>or</strong>thley, Bedf<strong>or</strong>d<br />

Austria<br />

Peter Ferenci, Vienna<br />

Valentin Fuhrmann, Vienna<br />

Alfred Gangl, Vienna<br />

Christoph Gasche, Vienna<br />

Kurt Lenz, Linz<br />

Markus Peck-Radosavljevic, Vienna<br />

Rudolf E Stauber, Auenbruggerplatz<br />

Herbert Tilg, Innsbruck<br />

Michael Trauner, Graz<br />

Harald Vogelsang, Vienna<br />

Guenter Weiss, Innsbruck<br />

Belarus<br />

Yury K Marakhouski, Minsk<br />

Rudi Beyaert, Gent<br />

Bart Rik De Geest, Leuven<br />

Inge I Depo<strong>or</strong>tere, Leuven<br />

Olivier Detry, Liège<br />

Benedicte Y De Winter, Antwerp<br />

Karel Geboes, Leuven<br />

Thierry Gustot, Brussels<br />

Yves J H<strong>or</strong>smans, Brussels<br />

Geert G Leroux-Roels, Ghent<br />

Louis Libbrecht, Leuven<br />

Etienne M Sokal, Brussels<br />

Marc Peeters, De Pintelaan<br />

Gert A Van Assche, Leuven<br />

Yvan Vandenplas, Brussels<br />

Eddie Wisse, Keerbergen<br />

Ⅱ<br />

Belgium<br />

Brazil<br />

Heit<strong>or</strong> Rosa, Goiania<br />

Ana Cristina Simões e Silva, Belo H<strong>or</strong>izonte<br />

Bulgaria<br />

Zahariy Krastev, S<strong>of</strong>i a<br />

Canada<br />

Fernando Alvarez, Québec<br />

David Armstrong, Ontario<br />

Jeffrey P Baker, T<strong>or</strong>onto<br />

Olivier Barbier, Québec<br />

Nancy Baxter, T<strong>or</strong>onto<br />

Matthew Bjerknes, T<strong>or</strong>onto<br />

Frank J Burczynski, Manitoba<br />

Michael F Byrne, Vancouver<br />

Wang-Xue Chen, Ottawa<br />

Chantal Guillemette, Québec<br />

Samuel S Lee, Calgary<br />

Gary A Levy, T<strong>or</strong>onto<br />

Andrew L Mason, Alberta<br />

John K Marshall, Ontario<br />

Donna-Marie McCafferty, Calgary<br />

Thomas I Michalak, St. John's<br />

Gerald Y Minuk, Manitoba<br />

Paul Moayyedi, Hamilton<br />

Kostas Pantopoulos, Québec<br />

William G Paterson, Kingston<br />

Eldon Shaffer, Calgary<br />

M<strong>or</strong>ris Sherman, T<strong>or</strong>onto<br />

Martin St<strong>or</strong>r, Calgary<br />

Elena F Verdu, Ontario<br />

John L Wallace, Calgary<br />

Eric M Yoshida, Vancouver<br />

Chile<br />

Silvana Zanlungo, Santiago<br />

China<br />

Henry LY Chan, Hongkong<br />

Xiao-Ping Chen, Wuhan<br />

Zong-Jie Cui, Beijing<br />

Da-Jun Deng, Beijing<br />

Er-Dan Dong, Beijing<br />

Sheung-Tat Fan, Hong Kong<br />

Jin Gu, Beijing<br />

Xin-Yuan Guan, Pokfulam<br />

De-Wu Han, Taiyuan<br />

Ming-Liang He, Hong Kong<br />

Wayne HC Hu, Hong Kong<br />

Chee-Kin Hui, Hong Kong<br />

Ching-Lung Lai, Hong Kong<br />

Kam Chuen Lai, Hong Kong<br />

James YW Lau, Hong Kong<br />

Yuk-Tong Lee, Hong Kong<br />

Suet-Yi Leung, Hong Kong<br />

Wai-Keung Leung, Hong Kong<br />

John M Luk, Pokfulam<br />

Chung-Mau Lo, Hong Kong<br />

Jing-Yun Ma, Beijing<br />

Ronnie Tung Ping Poon, Hong Kong<br />

Lun-Xiu Qin, Shanghai<br />

Yu-Gang Song, Guangzhou<br />

Qin Su, Beijing<br />

Wai-Man Wong, Hong Kong<br />

www.wjgnet.com<br />

Hong Xiao, Shanghai<br />

Dong-Liang Yang, Wuhan<br />

Winnie Yeo, Hong Kong<br />

Yuan Yuan, Shenyang<br />

Man-Fung Yuen, Hong Kong<br />

Jian-Zhong Zhang, Beijing<br />

Xin-Xin Zhang, Shanghai<br />

Bo-Jian Zheng, Hong Kong<br />

Shu Zheng, Hangzhou<br />

Croatia<br />

Tamara Cacev, Zagreb<br />

Marko Duvnjak, Zagreb<br />

Cuba<br />

Damian C Rodriguez, Havana<br />

Czech<br />

Milan Jirsa, Praha<br />

Pavel Trunečka, Prague<br />

Denmark<br />

Peter Bytzer, Copenhagen<br />

Asbjørn M Drewes, Aalb<strong>or</strong>g<br />

Hans Gregersen, Aalb<strong>or</strong>g<br />

Jens H Henriksen, Hvidovre<br />

Claus P Hovendal, Odense<br />

Fin S Larsen, Copenhagen<br />

Søren Møller, Hvidovre<br />

Egypt<br />

Abdel-Rahman El-Zayadi, Giza<br />

Amr M Helmy, Cairo<br />

Ayman Yosry, Cairo<br />

Estonia<br />

Riina Salupere, Tartu<br />

Finland<br />

Irma E Jarvela, Helsinki<br />

Katri M Kaukinen, Tampere<br />

Minna Nyström, Helsinki<br />

Pentti Sipponen, Espoo<br />

France<br />

Bettaieb Ali, Dijon<br />

C<strong>or</strong>lu Anne, Rennes<br />

Denis Ardid, Clermont-Ferrand<br />

Charles P Balabaud, B<strong>or</strong>deaux<br />

Soumeya Bekri, Rouen<br />

Jacques Belghiti, Clichy<br />

Jacques Bernuau, Clichy Cedex<br />

Pierre Brissot, Rennes<br />

Patrice P Cacoub, Paris<br />

Franck Carbonnel, Besancon<br />

Laurent Castera, Pessac<br />

Bruno Clément, Rennes<br />

Benoit C<strong>of</strong>fi n, Colombes<br />

Jacques Cosnes, Paris<br />

Thomas Decaens, Cedex

---

Francoise L Fabiani, Angers<br />

Gérard Feldmann, Paris<br />

Jean Fi<strong>or</strong>amonti, Toulouse<br />

Jean-Noël Freund, Strasbourg<br />

Jean-Paul Galmiche, Nantes<br />

Catherine Guettier, Villejuif<br />

Chantal Housset, Paris<br />

Juan L Iovanna, Marseille<br />

Rene Lambert, Lyon<br />

Patrick Marcellin, Paris<br />

Philippe Mathurin, Lille<br />

Tamara Matysiak–Budnik, Paris<br />

Francis Mégraud, B<strong>or</strong>deaux<br />

Richard M<strong>or</strong>eau, Clichy<br />

Thierry Piche, Nice<br />

Raoul Poupon, Paris<br />

Jean Rosenbaum, B<strong>or</strong>deaux<br />

Dominique Marie Roulot, Bobigny<br />

Thierry Poynard, Paris<br />

Jean-Philippe Salier, Rouen<br />

Didier Samuel, Villejuif<br />

Jean-Yves Scoazec, Lyon<br />

Khalid A Tazi, Clichy<br />

Emmanuel Tiret, Paris<br />

Baumert F Thomas, Strasbourg<br />

Marie-Catherine Vozenin-brotons, Villejuif<br />

Jean-Pierre H Zarski, Grenoble<br />

Jessica Zucman-Rossi, Paris<br />

Germany<br />

Hans-Dieter Allescher, G-Partenkirchen<br />

Martin Anlauf, Kiel<br />

Rudolf Arnold, Marburg<br />

Max G Bachem, Ulm<br />

Thomas F Baumert, Freiburg<br />

Daniel C Baumgart, Berlin<br />

Hubert Blum, Freiburg<br />

Thomas Bock, Tuebingen<br />

Katja Breitkopf, Mannheim<br />

Dunja Bruder, Braunschweig<br />

Markus W Büchler, Heidelberg<br />

Christa Buechler, Regensburg<br />

Reinhard Buettner, Bonn<br />

Elke Cario, Essen<br />

Uta Dahmen, Essen<br />

Christoph F Dietrich, Bad Mergentheim<br />

Arno J D<strong>or</strong>mann, Koeln<br />

Rainer J Duchmann, Berlin<br />

Volker F Eckardt, Wiesbaden<br />

Paul Enck, Tuebingen<br />

Fred Fändrich, Kiel<br />

Ulrich R Fölsch, Kiel<br />

Helmut Friess, Heidelberg<br />

Peter R Galle, Mainz<br />

Nikolaus Gassler, Aachen<br />

Andreas Geier, Aachen<br />

Markus Gerhard, Munich<br />

Wolfram H Gerlich, Giessen<br />

Dieter Glebe, Giessen<br />

Burkhard Göke, Munich<br />

Fl<strong>or</strong>ian Graepler, Tuebingen<br />

Axel M Gressner, Aachen<br />

Veit Gülberg, Munich<br />

Rainer Haas, Munich<br />

Eckhart G Hahn, Erlangen<br />

Stephan Hellmig, Kiel<br />

Martin Hennenberg, Bonn<br />

Johannes Herkel, Hamburg<br />

Klaus R Herrlinger, Stuttgart<br />

Eva Herrmann, Homburg/Saar<br />

Eberhard Hildt, Berlin<br />

Joerg C H<strong>of</strong>fmann, Berlin<br />

Ferdinand H<strong>of</strong>staedter, Regensburg<br />

Werner Hohenberger, Erlangen<br />

Jörg C Kalff, Bonn<br />

Ralf Jakobs, Ludwigshafen<br />

Jutta Keller, Hamburg<br />

Andrej Khandoga, Munich<br />

Sibylle Koletzko, München<br />

Stefan Kubicka, Hannover<br />

Joachim Labenz, Siegen<br />

Frank Lammert, Bonn<br />

Thomas Langmann, Regensburg<br />

Christian Liedtke, Aachen<br />

Matthias Löhr, Mannheim<br />

Christian Maaser, Muenster<br />

Ahmed Madisch, Dresden<br />

Peter Malfertheiner, Magdeburg<br />

Michael P Manns, Hannover<br />

Helmut Messmann, Augsburg<br />

Stephan Miehlke, Dresden<br />

Sabine Mihm, Göttingen<br />

Silvio Nadalin, Essen<br />

Markus F Neurath, Mainz<br />

Johann Ockenga, Berlin<br />

Fl<strong>or</strong>ian Obermeier, Regensburg<br />

Gustav Paumgartner, Munich<br />

Ulrich KS Peitz, Magdeburg<br />

Markus Reiser, Bochum<br />

Emil C Reisinger, Rostock<br />

Steffen Rickes, Magdeburg<br />

Tilman Sauerbruch, Bonn<br />

Dieter Saur, Munich<br />

Hans Scherubl, Berlin<br />

Joerg Schirra, Munich<br />

Roland M Schmid, München<br />

Volker Schmitz, Bonn<br />

Andreas G Schreyer, Regensburg<br />

Tobias Schroeder, Essen<br />

Henning Schulze-Bergkamen, Mainz<br />

Hans Seifert, Oldenburg<br />

N<strong>or</strong>bert Senninger, Muenster<br />

Manfred V Singer, Mannheim<br />

Gisela Sparmann, Rostock<br />

Christian J Steib, München<br />

Jurgen M Stein, Frankfurt<br />

Ulrike S Stein, Berlin<br />

Manfred Stolte, Bayreuth<br />

Christian P Strassburg, Hannover<br />

Wolfgang R Stremmel, Heidelberg<br />

Harald F Teutsch, Ulm<br />

Robert Thimme, Freiburg<br />

Hans L Tillmann, Leipzig<br />

Tung-Yu Tsui, Regensburg<br />

Axel Ulsenheimer, Munich<br />

Patrick Veit-Haibach, Essen<br />

Claudia Veltkamp, Heidelberg<br />

Siegfried Wagner, Deggend<strong>or</strong>f<br />

Henning Walczak, Heidelberg<br />

Heiner Wedemeyer, Hannover<br />

Fritz von Weizsacker, Berlin<br />

Jens Werner, Heidelberg<br />

Bertram Wiedenmann, Berlin<br />

Reiner Wiest, Regensburg<br />

Stefan Wirth, Wuppertal<br />

Stefan JP Zeuzem, Homburg<br />

Greece<br />

Alexandra A Alexopoulou, Athens<br />

Ge<strong>or</strong>ge N Dalekos, Larissa<br />

Christos Dervenis, Athens<br />

Melanie Maria Deutsch, Athens<br />

Tsianos Epameinondas, Ioannina<br />

Elias A Kouroumalis, Heraklion<br />

Ge<strong>or</strong>ge Papatheod<strong>or</strong>idis, Athens<br />

Spiros Sgouros, Athens<br />

www.wjgnet.com<br />

Hungary<br />

Peter L Lakatos, Budapest<br />

Zsuzsa Szondy, Debrecen<br />

Iceland<br />

Hallgrimur Gudjonsson, Reykjavik<br />

India<br />

Philip Abraham, Mumbai<br />

Rakesh Aggarwal, Lucknow<br />

Kunissery A Balasubramanian, Vell<strong>or</strong>e<br />

Deepak Kumar Bhasin, Chandigarh<br />

Sujit K Bhattacharya, Kolkata<br />

Yogesh K Chawla, Chandigarh<br />

Radha K Dhiman, Chandigarh<br />

Sri Prakash Misra, Allahabad<br />

Ramesh Roop Rai, Jaipur<br />

Nageshwar D Reddy, Hyderabad<br />

Rakesh Kumar Tandon, New Delhi<br />

Iran<br />

Seyed-Moayed Alavian, Tehran<br />

Reza Malekzadeh, Tehran<br />

Seyed A Taghavi, Shiraz<br />

Ireland<br />

Billy Bourke, Dublin<br />

Ronan A Cahill, C<strong>or</strong>k<br />

Anthony P M<strong>or</strong>an, Galway<br />

Israel<br />

Simon Bar-Meir, Hashomer<br />

Abraham R Eliakim, Haifa<br />

Zvi Fireman, Hadera<br />

Yaron Ilan, Jerusalem<br />

Avidan U Neumann, Ramat-Gan<br />

Yaron Niv, Pardesia<br />

Ran Oren, Tel Aviv<br />

Ami D Sperber, Beer-Sheva<br />

Italy<br />

Giovanni Addol<strong>or</strong>ato, Roma<br />

Luigi E Adinolfi , Naples<br />

Domenico Alvaro,<br />

Mario Angelico, Rome<br />

Vito Annese, San Giovanni Rotond<br />

Filippo Ansaldi, Genoa<br />

Adolfo F Attili, Roma<br />

Giovanni Barbara, Bologna<br />

Claudio Bassi, Verona<br />

Gabrio Bassotti, Perugia<br />

Pier M Battezzati, Milan<br />

Stefano Bellentani, Carpi<br />

Antomio Benedetti, Ancona<br />

Mauro Bernardi, Bologna<br />

Livia Biancone, Rome<br />

Luigi Bonavina, Milano<br />

Flavia B<strong>or</strong>tolotti, Padova<br />

Giuseppe Brisinda, Rome<br />

Elisabetta Buscarini, Crema<br />

Giovanni Cammarota, Roma<br />

Ⅲ

---

Antonino Cavallari, Bologna<br />

Giuseppe Chiarioni, Valeggio<br />

Michele Cicala, Rome<br />

Massimo Colombo, Milan<br />

Amedeo Columbano, Cagliari<br />

Massimo Conio, Sanremo<br />

Dario Conte, Milano<br />

Gino R C<strong>or</strong>azza, Pavia<br />

Francesco Costa, Pisa<br />

Antonio Craxi, Palermo<br />

Silvio Danese, Milan<br />

Roberto de Franchis, Milano<br />

Roberto De Gi<strong>or</strong>gio, Bologna<br />

Maria Stella De Mitri, Bologna<br />

Giovanni D De Palma, Naples<br />

Fabio Farinati, Padua<br />

Giammarco Fava, Ancona<br />

Francesco Feo, Sassari<br />

Fi<strong>or</strong>ucci Stefano, Perugia<br />

Andrea Galli, Firenze<br />

Valeria Ghisett, Turin<br />

Gianluigi Giannelli, Bari<br />

Edoardo G Giannini, Genoa<br />

Paolo Gionchetti, Bologna<br />

Fabio Grizzi, Milan<br />

Salvat<strong>or</strong>e Gruttadauria, Palermo<br />

Mario Guslandi, Milano<br />

Pietro Invernizzi, Milan<br />

Ezio Laconi, Cagliari<br />

Giacomo Laffi , Firenze<br />

Giovanni Maconi, Milan<br />

Lucia Malaguarnera, Catania<br />

Emanuele D Mangoni, Napoli<br />

Paolo Manzoni, T<strong>or</strong>ino<br />

Giulio Marchesini, Bologna<br />

Fabio Marra, Fl<strong>or</strong>ence<br />

Marco Marzioni, Ancona<br />

Giuseppe Mazzella, Bologna<br />

Mario U Mondelli, Pavia<br />

Giuseppe Montalto, Palermo<br />

Giovanni Monteleone, Rome<br />

Giovanni Musso, T<strong>or</strong>ino<br />

Gerardo Nardone, Napoli<br />

Valerio Nobili, Rome<br />

Fabio Pace, Milano<br />

Luisi Pagliaro, Palermo<br />

Francesco Pallone, Rome<br />

Fabrizio R Parente, Milan<br />

Maurizio Parola, T<strong>or</strong>ino<br />

Francesco Perri, San Giovanni Rotondo<br />

Raffaele Pezzilli, Bologna<br />

Alberto Pilotto, San Giovanni Rotondo<br />

Alberto Piperno, Monza<br />

Mario Pirisi, Novara<br />

Anna C Piscaglia, Roma<br />

Paolo Del Poggio, Treviglio<br />

Gabriele B P<strong>or</strong>ro, Milano<br />

Piero P<strong>or</strong>tincasa, Bari<br />

Cosimo Prantera, Roma<br />

Bernardino Rampone, Siena<br />

Oliviero Riggio, Rome<br />

Claudio Romano, Messina<br />

Marco Romano, Napoli<br />

Gerardo Rosati, Potenza<br />

Mario Del Tacca, Pisa<br />

Gl<strong>or</strong>ia Taliani, Rome<br />

Pier A Testoni, Milan<br />

Enrico Roda, Bologna<br />

Domenico Sansonno, Bari<br />

Vincenzo Savarino, Genova<br />

Vincenzo Stanghellini, Bologna<br />

Giovanni Tarantino, Naples<br />

Roberto Testa, Genoa<br />

Dino Vaira, Bologna<br />

Anna Linda Zignego, Fl<strong>or</strong>ence<br />

IV<br />

Kyoichi Adachi, Izumo<br />

Yasushi Adachi, Sapp<strong>or</strong>o<br />

Taiji Akamatsu, Matsumoto<br />

Sk Md Fazle Akbar, Ehime<br />

Takafumi Ando, Nagoya<br />

Akira Andoh, Otsu<br />

Taku Aoki, Tokyo<br />

Masahiro Arai, Tokyo<br />

Tetsuo Arakawa, Osaka<br />

Yasuji Arase, Tokyo<br />

Masahiro Asaka, Sapp<strong>or</strong>o<br />

Hitoshi Asakura, Tokyo<br />

Takeshi Azuma, Fukui<br />

Yoichi Chida, Fukuoka<br />

Takahiro Fujim<strong>or</strong>i, Tochigi<br />

Jiro Fujimoto, Hyogo<br />

Kazuma Fujimoto, Saga<br />

Mitsuhiro Fujishiro, Tokyo<br />

Yoshihide Fujiyama, Otsu<br />

Hiroyuki Fukui, Tochigi<br />

Hiroyuki Hanai, Hamamatsu<br />

Naohiko Harada, Fukuoka<br />

Makoto Hashizume, Fukuoka<br />

Tetsuo Hayakawa, Nagoya<br />

T<strong>or</strong>u Hiyama, Higashihiroshima<br />

Kazuhide Higuchi, Osaka<br />

Keisuke Hino, Ube<br />

Keiji Hirata, Kitakyushu<br />

Yuji Iimuro, Nishinomiya<br />

Kenji Ikeda, Tokyo<br />

T<strong>or</strong>u Ikegami, Fukuoka<br />

Kenichi Ikejima, Bunkyo-ku<br />

Fumio Imazeki, Chiba<br />

Yutaka Inagaki, Kanagawa<br />

Yasuhiro Inokuchi, Yokohama<br />

Haruhiro Inoue, Yokohama<br />

Masayasu Inoue, Osaka<br />

Hiromi Ishibashi, Nagasaki<br />

Shunji Ishihara, Izumo<br />

T<strong>or</strong>u Ishikawa, Niigata<br />

Kei Ito, Sendai<br />

Masayoshi Ito, Tokyo<br />

Hiroaki Itoh, Akita<br />

Ryuichi Iwakiri, Saga<br />

Yoshiaki Iwasaki, Okayama<br />

Terumi Kamisawa, Tokyo<br />

Hiroshi Kaneko, Aichi-Gun<br />

Shuichi Kaneko, Kanazawa<br />

Takashi Kanematsu, Nagasaki<br />

Mitsuo Katano, Fukuoka<br />

Junji Kato, Sapp<strong>or</strong>o<br />

Mototsugu Kato, Sapp<strong>or</strong>o<br />

Shinzo Kato, Tokyo<br />

N<strong>or</strong>ifumi Kawada, Osaka<br />

Sunao Kawano, Osaka<br />

Mitsuhiro Kida, Kanagawa<br />

Yoshikazu Kinoshita, Izumo<br />

Tsuneo Kitamura, Chiba<br />

Seigo Kitano, Oita<br />

Kazuhiko Koike, Tokyo<br />

N<strong>or</strong>ihiro Kokudo, Tokyo<br />

Satoshi Kondo, Sapp<strong>or</strong>o<br />

Shoji Kubo, Osaka<br />

Shigeki Kuriyama, Kagawa [2]<br />

Japan<br />

Katsun<strong>or</strong>i Iijima, Sendai<br />

Masato Kusunoki, Tsu Mie<br />

Shin Maeda, Tokyo<br />

Shigeru Marubashi, Suita<br />

Masatoshi Makuuchi, Tokyo<br />

Osamu Matsui, Kanazawa<br />

Yasuhiro Matsumura, Chiba<br />

Yasushi Matsuzaki, Tsukuba<br />

Kiyoshi Migita, Omura<br />

www.wjgnet.com<br />

Kenji Miki, Tokyo<br />

Tetsuya Mine, Kanagawa<br />

Hiroto Miwa, Hyogo<br />

Masashi Mizokami, Nagoya<br />

Yoshiaki Mizuguchi, Tokyo<br />

Motowo Mizuno, Hiroshima<br />

M<strong>or</strong>ito Monden, Suita<br />

Hisataka S M<strong>or</strong>iwaki, Gifu<br />

Yasuaki Motomura, Iizuka<br />

Yoshiharu Motoo, Kanazawa<br />

Na<strong>of</strong>umi Mukaida, Kanazawa<br />

Kazunari Murakami, Oita<br />

Kunihiko Murase, Tusima<br />

Hiroaki Nagano, Suita<br />

Masahito Nagaki, Gifu<br />

Masaki Nagaya, Kawasaki<br />

Yujl Naito, Kyoto<br />

Atsushi Nakajima, Yokohama<br />

Hisato Nakajima, Tokyo<br />

Hiroki Nakamura, Yamaguchi<br />

Shotaro Nakamura, Fukuoka<br />

Mikio Nishioka, Niihama<br />

Shuji Nomoto, Nagoya<br />

Susumu Ohmada, Maebashi<br />

Hirohide Ohnishi, Akita<br />

Masayuki Ohta, Oita<br />

Tetsuo Ohta, Kanazawa<br />

Kazuichi Okazaki, Osaka<br />

Katsuhisa Omagari, Nagasaki<br />

Saburo Onishi, Nankoku<br />

M<strong>or</strong>ikazu Onji, Ehime<br />

Satoshi Osawa, Hamamatsu<br />

Masanobu Oshima, Kanazawa<br />

Hiromitsu Saisho, Chiba<br />

Hidetsugu Saito, Tokyo<br />

Yutaka Saito, Tokyo<br />

Isao Sakaida, Yamaguchi<br />

Michiie Sakamoto, Tokyo<br />

Yasushi Sano, Chiba<br />

Hiroki Sasaki, Tokyo<br />

Iwao Sasaki, Sendai<br />

Motoko Sasaki, Kanazawa<br />

Chifumi Sato, Tokyo<br />

Shuichi Seki, Osaka<br />

Hiroshi Shimada, Yokohama<br />

Mitsuo Shimada, Tokushima<br />

Tomohiko Shimatan, Hiroshima<br />

Hiroaki Shimizu, Chiba<br />

Ichiro Shimizu, Tokushima<br />

Yukihiro Shimizu, Kyoto<br />

Shinji Shimoda, Fukuoka<br />

To<strong>or</strong>u Shimosegawa, Sendai<br />

Tadashi Shimoyama, Hirosaki<br />

Ken Shirabe, Iizuka City<br />

Yoshio Shirai, Niigata<br />

Katsuya Shiraki, Mie<br />

Yasushi Shirat<strong>or</strong>i, Okayama<br />

Masayuki Sho, Nara<br />

Yasuhiko Sugawara, Tokyo<br />

Hidekazu Suzuki, Tokyo<br />

Min<strong>or</strong>u Tada, Tokyo<br />

Tadatoshi Takayama, Tokyo<br />

Tadashi Takeda, Osaka<br />

Koji Takeuchi, Kyoto<br />

Kiichi Tamada, Tochigi<br />

Akira Tanaka, Kyoto<br />

Eiji Tanaka, Matsumoto<br />

N<strong>or</strong>iaki Tanaka, Okayama<br />

Shinji Tanaka, Hiroshima<br />

Hideki Taniguchi, Yokohama<br />

Kyuichi Tanikawa, Kurume<br />

Akira Terano, Shimotsugagun<br />

Hitoshi Togash, Yamagata<br />

Shinji Togo, Yokohama<br />

Kazunari Tominaga, Osaka<br />

Takuji T<strong>or</strong>imura, Fukuoka

---

Min<strong>or</strong>u Toyota, Sapp<strong>or</strong>o<br />

Akihito Tsubota, Chiba<br />

Takato Ueno, Kurume<br />

Naomi Uemura, Tokyo<br />

Shinichi Wada, Tochigi<br />

Hiroyuki Watanabe, Kanazawa<br />

Toshio Watanabe, Osaka<br />

Yuji Watanabe, Ehime<br />

Toshiaki Watanabe, Tokyo<br />

Chun-Yang Wen, Nagasaki<br />

Satoshi Yamagiwa, Niigata<br />

Koji Yamaguchi, Fukuoka<br />

Takayuki Yamamoto, Yokkaichi<br />

Takashi Yao, Fukuoka<br />

Masashi Yoneda, Tochigi<br />

Hiroshi Yoshida, Tokyo<br />

Masashi Yoshida, Tokyo<br />

N<strong>or</strong>imasa Yoshida, Kyoto<br />

Hitoshi Yoshiji, Nara<br />

Kentaro Yoshika, Toyoake<br />

Yasunobu Yoshikai, Fukuoka<br />

Masahide Yoshikawa, Kashihara<br />

Katsutoshi Yoshizato, Higashihiroshima<br />

Lebanon<br />

Bassam N Abboud, Beirut<br />

Ala I Sharara, Beirut<br />

Joseph D Boujaoude, Beirut<br />

Lithuania<br />

Limas Kupcinskas, Kaunas<br />

Macedonia<br />

Vladimir C Serafi moski, Skopje<br />

Malaysia<br />

Andrew Seng Boon Chua, Ipoh<br />

Khean-Lee Goh, Kuala Lumpur<br />

Jayaram Menon, Sabah<br />

Mexico<br />

Diego Garcia-Compean, Monterrey<br />

Eduardo R Marin-Lopez, Jesús García<br />

Nahum Méndez-Sánchez, Mexico<br />

Saúl Villa-Treviño, México<br />

Monaco<br />

Patrick Rampal, Monaco<br />

M<strong>or</strong>occo<br />

Abdellah Essaid, Rabat<br />

The Netherlands<br />

Ulrich Beuers, Amsterdam<br />

Gerd Bouma, Amsterdam<br />

Lee Bouwman, Leiden<br />

J Bart A Crusius, Amsterdam<br />

NKH de Boer, Amsterdam<br />

Koert P de Jong, Groningen<br />

Henrike Hamer, Maastricht<br />

Frank Hoentjen, Haarlem<br />

Janine K Kruit, Groningen<br />

Ernst J Kuipers, Rotterdam<br />

CBHW Lamers, Leiden<br />

Ton Lisman, Utrecht<br />

Yi Liu, Amsterdam<br />

Jeroen Maljaars, Maastricht<br />

Servaas M<strong>or</strong>ré, Amsterdam<br />

Chris JJ Mulder, Amsterdam<br />

Michael Müller, Wageningen<br />

Amado S Peña, Amsterdam<br />

Robert J P<strong>or</strong>te, Groningen<br />

Ingrid B Renes, Rotterdam<br />

Andreas Smout, Utrecht<br />

Paul E Sijens, Groningen<br />

Reinhold W Stockbrugger, Maastricht<br />

Luc JW van der Laan, Rotterdam<br />

Karel van Erpecum, Utrecht<br />

Gerard P VanBerge-Henegouwen,Utrecht<br />

New Zealand<br />

Ian D Wallace, Auckland<br />

Nigeria<br />

Samuel B Olaleye, Ibadan<br />

N<strong>or</strong>way<br />

Trond Berg, Oslo<br />

Tom H Karlsen, Oslo<br />

Helge L Waldum, Trondheim<br />

Pakistan<br />

Muhammad S Khokhar, Lah<strong>or</strong>e<br />

Syed MW Jafri, Karachi<br />

Peru<br />

Hect<strong>or</strong> H Garcia, Lima<br />

Poland<br />

Tomasz Brzozowski, Cracow<br />

Robert Flisiak, Bialystok<br />

Hanna Greg<strong>or</strong>ek, Warsaw<br />

Dariusz M Lebensztejn, Bialystok<br />

Wojciech G Polak, Wroclaw<br />

Marek Hartleb, Katowice<br />

P<strong>or</strong>tugal<br />

Miguel C De Moura, Lisbon<br />

Russia<br />

Vladimir T Ivashkin, Moscow<br />

Leonid Lazebnik, Moscow<br />

Vasiliy I Reshetnyak, Moscow<br />

Saudi Arabia<br />

Ibrahim A Al M<strong>of</strong>l eh, Riyadh<br />

Ahmed Helmy, Riyadh<br />

Serbia<br />

Dusan M Jovanovic, Sremska Kamenica<br />

Singap<strong>or</strong>e<br />

Bow Ho, Singap<strong>or</strong>e<br />

Khek-Yu Ho, Singap<strong>or</strong>e<br />

Fock Kwong Ming, Singap<strong>or</strong>e<br />

Francis Seow-Choen, Singap<strong>or</strong>e<br />

Slovakia<br />

Silvia Past<strong>or</strong>ekova, Bratislava<br />

Anton Vavrecka, Bratislava<br />

Slovenia<br />

Sasa Markovic, Ljubljana<br />

South Africa<br />

Rosemar Joyce Burnett, Pret<strong>or</strong>ia<br />

Michael C Kew, Parktown<br />

South K<strong>or</strong>ea<br />

Byung Ihn Choi, Seoul<br />

Ho Soon Choi, Seoul<br />

Marie Yeo, Suwon<br />

Sun Pyo Hong, Gyeonggi-do<br />

Jae J Kim, Seoul<br />

Jin-Hong Kim, Suwon<br />

Myung-Hwan Kim, Seoul<br />

Chang Hong Lee, Seoul<br />

Jong Kyun Lee, Seoul<br />

Eun-Yi Moon, Seoul<br />

Jae-Gahb Park, Seoul<br />

Dong Wan Seo, Seoul<br />

Dong Jin Suh, Seoul<br />

Byung Chul Yoo, Seoul<br />

Spain<br />

Juan G Abraldes, Barcelona<br />

Agustin Albillos, Madrid<br />

Raul J Andrade, Málaga<br />

Luis Aparisi, Valencia<br />

Fernando Azpiroz, Barcelona<br />

Ramon Bataller, Barcelona<br />

Josep M B<strong>or</strong>das, Barcelona<br />

Xavier Calvet, Sabadell<br />

J<strong>or</strong>di Camps, Catalunya<br />

Andres Cardenas, Barcelona<br />

Vicente Carreño, Madrid<br />

Jose Castellote, Barcelona<br />

Antoni Castells, Barcelona<br />

Vicente Felipo, Valencia<br />

Juan C Garcia-Pagán, Barcelona<br />

Jaime B Genover, Barcelona<br />

Javier P Gisbert, Madrid<br />

Jaime Guardia, Barcelona<br />

Isabel Fabregat, Barcelona<br />

Mercedes Fernandez, Barcelona<br />

Angel Lanas, Zaragoza<br />

Juan-Ramón Larrubia, Guadalajara<br />

Laura Lladóa, Barcelona<br />

María IT López, Jaén<br />

Juan R Malagelada, Barcelona<br />

José M Mato, Derio<br />

Juan F Medina, Pamplona<br />

Miguel A Muñoz-Navas, Pamplona<br />

Julian Panes, Barcelona<br />

Miguel M Perez, Valencia<br />

Miguel Perez-Mateo, Alicante<br />

www.wjgnet.com Ⅴ

---

Josep M Pique, Barcelona<br />

Jesús M Prieto, Pamplona<br />

Sabino Riestra, Pola De Siero<br />

Luis Rodrigo, Oviedo<br />

Manuel Romero-Gómez, Sevilla<br />

Joan Roselló-Catafau, Barcelona<br />

Sweden<br />

Einar S Björnsson, Gothenburg<br />

Curt Einarsson, Huddinge<br />

Per M Hellström, Stockholm<br />

Ulf Hind<strong>or</strong>f, Lund<br />

Elisabeth Hultgren-Hörnquist, Örebro<br />

Anders E Lehmann, Mölndal<br />

Hanns-Ulrich Marschall, Stockholm<br />

Lars C Olbe, Molndal<br />

Lars A Pahlman, Uppsala<br />

Matti Sallberg, Stockholm<br />

Magnus Simrén, Göteb<strong>or</strong>g<br />

Xiao-Feng Sun, Linköping<br />

Ervin Tóth, Malmö<br />

Weimin Ye, Stockholm<br />

Christer S von Holstein, Lund<br />

Switzerland<br />

Chrish Beglinger, Basel<br />

Pierre A Clavien, Zurich<br />

Jean-Francois Dufour, Bern<br />

Franco F<strong>or</strong>tunato, Zürich<br />

Jean L Frossard, Geneva<br />

Gerd A Kullak-Ublick, Zurich<br />

Pierre Michetti, Lausanne<br />

Francesco Negro, Genève<br />

Bruno Stieger, Zurich<br />

Radu Tutuian, Zurich<br />

Stephan R Vavricka, Zurich<br />

Gerhard Rogler, Zurich<br />

Arthur Zimmermann, Berne<br />

Turkey<br />

Yusuf Bayraktar, Ankara<br />

Figen Gurakan, Ankara<br />

Aydin Karabacakoglu, Konya<br />

Serdar Karakose, Konya<br />

Hizir Kurtel, Istanbul<br />

Osman C Ozdogan, Istanbul<br />

Özlem Yilmaz, Izmir<br />

Cihan Yurdaydin, Ankara<br />

United Arab Emirates<br />

Sherif M Karam, Al-Ain<br />

United Kingdom<br />

David H Adams, Birmingham<br />

Simon Aff<strong>or</strong>d, Birmingham<br />

Navneet K Ahluwalia, Stockp<strong>or</strong>t<br />

Ahmed Alzaraa, Manchester<br />

Lesley A Anderson, Belfast<br />

Charalambos G Antoniades, London<br />

Anthony TR Axon, Leeds<br />

Qasim Aziz, Manchester<br />

Nicholas M Barnes, Birmingham<br />

Jim D Bell, London<br />

Mairi Brittan, London<br />

Alastair D Burt, Newcastle<br />

Simon S Campbell, Manchester<br />

Ⅵ<br />

Simon R Carding, Leeds<br />

Paul J Ciclitira, London<br />

Eithne Costello, Liverpool<br />

Tatjana Crnog<strong>or</strong>ac-Jurcevic, London<br />

Harry Dalton, Truro<br />

Amar P Dhillon, London<br />

William Dickey, Londonderry<br />

James E East, London<br />

Emad M El-Omar, Aberdeen<br />

Ahmed M Elsharkawy, Newcastle Upon Tyne<br />

Annette Fristscher-Ravens, London<br />

Elizabeth Furrie, Dundee<br />

Daniel R Gaya, Edinburgh<br />

Subrata Ghosh, London<br />

William Greenhalf, Liverpool<br />

Indra N Guha, Southampton<br />

Peter C Hayes, Edinburgh<br />

Gwo-Tzer Ho, Edinburgh<br />

Anthony R Hobson, Salf<strong>or</strong>d<br />

Lesley A Houghton, Manchester<br />

Stefan G Hübscher, Birmingham<br />

Robin Hughes, London<br />

Pali Hungin, Stockton<br />

David P Hurlstone, Sheffi eld<br />

Rajiv Jalan, London<br />

Janusz AZ Jankowski, Oxf<strong>or</strong>d<br />

Brian T Johnston, Belfast<br />

David EJ Jones, Newcastle<br />

Roger Jones, London<br />

Michael A Kamm, Harrow<br />

Peter Karayiannis, London<br />

Laurens Kruidenier, Harlow<br />

Patricia F Lal<strong>or</strong>, Birmingham<br />

Chee Hooi Lim, Midlands<br />

Hong-Xiang Liu, Cambridge<br />

Yun Ma, London<br />

Kenneth E L McColl, Glasgow<br />

Stuart AC McDonald, London<br />

Dermot P Mcgovern, Oxf<strong>or</strong>d<br />

Gi<strong>or</strong>gina Mieli-Vergani, London<br />

Nikolai V Naoumov, London<br />

John P Neoptolemos, Liverpool<br />

James Neuberger, Birmingham<br />

Philip Noel Newsome, Birmingham<br />

Mark S Pearce, Newcastle Upon Tyne<br />

Stephen P Pereira, London<br />

D Mark Pritchard, Liverpool<br />

Sakhawat Rahman, London<br />

Stephen E Roberts, Swansea<br />

Marco Senzolo, Padova<br />

S<strong>or</strong>aya Shirazi-Beechey, Liverpool<br />

Robert Sutton, Liverpool<br />

Simon D Tayl<strong>or</strong>-Robinson, London<br />

Paris P Tekkis, London<br />

Ulrich Thalheimer, London<br />

David G Thompson, Salf<strong>or</strong>d<br />

Nick P Thompson, Newcastle<br />

David Tosh, Bath<br />

Frank I Tovey, London<br />

Chris Tselepis, Birmingham<br />

Diego Vergani, London<br />

Ge<strong>of</strong>frey Warhurst, Salf<strong>or</strong>d<br />

Alastair John Watson, Liverpool<br />

Peter J Wh<strong>or</strong>well, Manchester<br />

Roger Williams, London<br />

Karen L Wright, Bath<br />

Min Zhao, F<strong>or</strong>esterhill<br />

United States<br />

Manal F Abdelmalek, Durham<br />

Gary A Abrams, Birmingham<br />

Maria T Abreu, New Y<strong>or</strong>k<br />

Reid B Adams, Virginia<br />

www.wjgnet.com<br />

Golo Ahlenstiel, Bethesda<br />

BS Anand, Houston<br />

Frank A Anania, Atlanta<br />

M Ananthanarayanan, New Y<strong>or</strong>k<br />

Gavin E Arteel, Louisville<br />

Jasmohan S Bajaj, Milwaukee<br />

Subhas Banerjee, Palo Alto<br />

Peter A Banks, Boston<br />

Jamie S Barkin, Miami Beach<br />

Kim E Barrett, San Diego<br />

Marc D Basson, Detroit<br />

Anthony J Bauer, Pittsburgh<br />

Wallace F Berman, Durham<br />

Timothy R Billiar, Pittsburgh<br />

Edmund J Bini, New Y<strong>or</strong>k<br />

David G Binion, Milwaukee<br />

Jennifer D Black, Buffalo<br />

Herbert L Bonkovsky, Charlotte<br />

Carla W Brady, Durham<br />

Andrea D Branch, New Y<strong>or</strong>k<br />

Robert S Bresalier, Houston<br />

Alan L Buchman, Chicago<br />

Ronald W Busuttil, Los Angeles<br />

Alan Cahill, Philadelphia<br />

John M Carethers, San Diego<br />

David L Carr-Locke, Boston<br />

Maurice A Cerulli, New Y<strong>or</strong>k<br />

Ravi S Chari, Nashville<br />

Jiande Chen, Galveston<br />

Xian-Ming Chen, Omaha<br />

Xin Chen, San Francisco<br />

Ramsey Chi-man Cheung, Palo Alto<br />

William D Chey, Ann Arb<strong>or</strong><br />

John Y Chiang, Rootstown<br />

Parimal Chowdhury, Arkansas<br />

Raymond T Chung, Boston<br />

James M Church, Cleveland<br />

Ram Chuttani, Boston<br />

Mark G Clemens, Charlotte<br />

Ana J Coito, Los Angeles<br />

Vincent Coghlan, Beaverton<br />

David Cronin II, New Haven<br />

John Cuppoletti, Cincinnati<br />

Mark J Czaja, New Y<strong>or</strong>k<br />

Peter V Danenberg, Los Angeles<br />

Kiron M Das, New Brunswick<br />

Con<strong>or</strong> P Delaney, Cleveland<br />

Jose L del Pozo, Rochester<br />

Sharon DeM<strong>or</strong>row, Temple<br />

Deb<strong>or</strong>ah L Diamond, Seattle<br />

Douglas A Drossman, Chapel Hill<br />

Katerina Dv<strong>or</strong>ak, Tucson<br />

Bijan Eghtesad, Cleveland<br />

Hala El-Zimaity, Houston<br />

Michelle Embree-Ku, Providence<br />

Sukru Emre, New Haven<br />

Douglas G Farmer, Los Angeles<br />

Alessio Fasano, Baltim<strong>or</strong>e<br />

Mark A Feitelson, Philadelphia<br />

Ariel E Feldstein, Cleveland<br />

Alessandro Fichera, Chicago<br />

Robert L Fine, New Y<strong>or</strong>k<br />

Magali Fontaine, Stanf<strong>or</strong>d<br />

Chris E F<strong>or</strong>smark, Gainesville<br />

Glenn T Furuta, Aur<strong>or</strong>a<br />

Chandrashekhar R Gandhi, Pittsburgh<br />

Susan L Gearhart, Baltim<strong>or</strong>e<br />

Xupeng Ge, Boston<br />

Xin Geng, New Brunswick<br />

M Eric Gershwin, Suite<br />

Jean-Francois Geschwind, Baltim<strong>or</strong>e<br />

Ignacio Gil-Bazo, New Y<strong>or</strong>k<br />

Shannon S Glaser, Temple<br />

Ajay Goel, Dallas<br />

Richard M Green, Chicago<br />

Julia B Greer, Pittsburgh

---

James H Grendell, New Y<strong>or</strong>k<br />

David R Gretch, Seattle<br />

Stefano Guandalini, Chicago<br />

Anna S Gukovskaya, Los Angeles<br />

Sanjeev Gupta, Bronx<br />

David J Hackam, Pittsburgh<br />

Stephen B Hanauer, Chicago<br />

Gavin Harewood, Rochester<br />

Margaret M Heitkemper, Washington<br />

Alan W Hemming, Gainesville<br />

Samuel B Ho, San Diego<br />

Peter R Holt, New Y<strong>or</strong>k<br />

Colin W Howden, Chicago<br />

Hongjin Huang, Alameda<br />

Jamal A Ibdah, Columbia<br />

Atif Iqbal, Omaha<br />

Hajime Isomoto, Rochester<br />

Hartmut Jaeschke, Tucson<br />

Dennis M Jensen, Los Angeles<br />

Cheng Ji, Los Angeles<br />

Leonard R Johnson, Memphis<br />

Michael P Jones, Chicago<br />

Peter J Kahrilas, Chicago<br />

Anthony N Kalloo, Baltim<strong>or</strong>e<br />

Marshall M Kaplan, Boston<br />

Neil Kaplowitz, Los Angeles<br />

Serhan Karvar, Los Angeles<br />

Rashmi Kaul, Tulsa<br />

Jonathan D Kaunitz, Los Angeles<br />

Ali Keshavarzian, Chicago<br />

Miran Kim, Providence<br />

Joseph B Kirsner, Chicago<br />

Leonidas G Koniaris, Miami<br />

Burton I K<strong>or</strong>elitz, New Y<strong>or</strong>k<br />

Robert J K<strong>or</strong>st, New Y<strong>or</strong>k<br />

Richard A Kozarek, Seattle<br />

Alyssa M Krasinskas, Pittsburgh<br />

Michael Kremer, Chapel Hill<br />

Shiu-Ming Kuo, Buffalo<br />

Paul Y Kwo, Indianapolis<br />

Daryl Tan Yeung Lau, Galvesto<br />

Stephen J Lanspa, Omaha<br />

Joel E Lavine, San Diego<br />

Bret Lashner, Cleveland<br />

Dirk J van Leeuwen, Lebanon<br />

Glen A Lehman, Indianapolis<br />

Alex B Lentsch, Cincinnati<br />

Andreas Leodolter, La Jolla<br />

Gene LeSage, Houston<br />

Josh Levitsky, Chicago<br />

Cynthia Levy, Gainesville<br />

Ming Li, New Orleans<br />

Zhiping Li, Baltim<strong>or</strong>e<br />

Zhe-Xiong Lian, Davis<br />

Lenard M Lichtenberger, Houston<br />

Gary R Lichtenstein, Philadelphia<br />

Otto Schiueh-Tzang Lin, Seattle<br />

Martin Lipkin, New Y<strong>or</strong>k<br />

Chen Liu, Gainesville<br />

Edward V L<strong>of</strong>tus, Rocheste<br />

Robin G L<strong>or</strong>enz, Birmingham<br />

Michael R Lucey, Madison<br />

James D Luketich, Pittsburgh<br />

Guangbin Luo, Cheveland<br />

Henry T Lynch, Omaha<br />

Patrick M Lynch, Houston<br />

John S Macdonald, New Y<strong>or</strong>k<br />

Bruce V MacFadyen, Augusta<br />

Willis C Maddrey, Dallas<br />

Ashok Malani, Los Angeles<br />

Mercedes Susan Mandell, Aur<strong>or</strong>a<br />

Peter J Mannon, Bethesda<br />

Charles M Mansbach, Tennessee<br />

John F Di Mari, Texas<br />

John M Mariadason, Bronx<br />

J<strong>or</strong>ge A Marrero, Ann Arb<strong>or</strong><br />

Paul Martin, New Y<strong>or</strong>k<br />

Paulo Ney Aguiar Martins, Boston<br />

Wendy M Mars, Pittsburgh<br />

Laura E Matarese, Pittsburgh<br />

Richard W McCallum, Kansas<br />

Beth A McC<strong>or</strong>mick, Charlestown<br />

Lynne V McFarland, Washington<br />

Kevin McGrath, Pittsburgh<br />

Harihara Mehendale, Monroe<br />

Ali Mencin, New Y<strong>or</strong>k<br />

Fanyin Meng, Ohio<br />

Stephan Menne, New Y<strong>or</strong>k<br />

Didier Merlin, Atlanta<br />

Howard Mertz, Nashville<br />

Ge<strong>or</strong>ge W Meyer, Sacramento<br />

Ge<strong>or</strong>ge Michalopoulos, Pittsburgh<br />

James M Millis, Chicago<br />

Fabrizio Michelassi, New Y<strong>or</strong>k<br />

Albert D Min, New Y<strong>or</strong>k<br />

Pramod K Mistry, New Haven<br />

Emiko Mizoguchi, Boston<br />

Smruti R Mohanty, Chicago<br />

Satdarshan S Monga, Pittsburgh<br />

Timothy H M<strong>or</strong>an, Baltim<strong>or</strong>e<br />

Peter L Moses, Burlington<br />

Steven F Moss, Providence<br />

Andrew J Muir, Durham<br />

Milton G Mutchnick, Detroit<br />

Masaki Nagaya, Boston<br />

Vict<strong>or</strong> Navarro, Philadelphia<br />

Laura E Nagy, Cleveland<br />

Hiroshi Nakagawa, Philadelphia<br />

Douglas B Nelson, Minneapolis<br />

Justin H Nguyen, Fl<strong>or</strong>ida<br />

Patrick G N<strong>or</strong>thup, Charlottesville<br />

Christopher O'Brien, Miami<br />

Robert D Odze, Boston<br />

Brant K Oelschlager, Washington<br />

Curtis T Okamoto, Los Angeles<br />

Stephen JD O’Keefe, Pittsburgh<br />

Dimitry Oleynikov, Omaha<br />

Stephen J Pandol, Los Angeles<br />

Ge<strong>or</strong>gios Papachristou, Pittsburgh<br />

Pankaj J Pasricha, Galveston<br />

Zhiheng Pei, New Y<strong>or</strong>k<br />

Michael A Pezzone, Pittsburgh<br />

CS Pitchumoni, New Brunswiuc<br />

Paul J Pockros, La Jolla<br />

Jay Pravda, Gainesville<br />

Massimo Raimondo, Jacksonville<br />

GS Raju, Galveston<br />

Raymund R Razonable, Minnesota<br />

Murray B Resnick, Providence<br />

Adrian Reuben, Charleston<br />

Douglas K Rex, Indianapolis<br />

Vict<strong>or</strong> E Reyes, Galveston<br />

Basil Rigas, New Y<strong>or</strong>k<br />

Yehuda Ringel, Chapel Hill<br />

Richard A Rippe, Chapel Hill<br />

Maribel Rodriguez-T<strong>or</strong>res, Santurce<br />

Marcos Rojkind, Washington<br />

Philip Rosenthal, San Francisco<br />

Barry Rosser, Jacksonville Fl<strong>or</strong>ida<br />

Hemant K Roy, Evanston<br />

Sammy Saab, Los Angeles<br />

Shawn D Saff<strong>or</strong>d, N<strong>or</strong>folk<br />

Dushyant V Sahani, Boston<br />

Bruce E Sands, Boston<br />

James M Scheiman, Ann Arb<strong>or</strong><br />

Eugene R Schiff, Miami<br />

Nicholas J Shaheen, Chapel Hill<br />

Vanessa M Shami, Charlottesville<br />

Prateek Sharma, Kansas City<br />

Harvey L Sharp, Minneapolis<br />

Stuart Sherman, Indianapolis<br />

Shivendra Shukla, Columbia<br />

Alphonse E Sirica, Virginia<br />

Shanthi V Sitaraman, Atlanta<br />

Stuart J Spechler, Dallas<br />

Shanthi Srinivasan, Atlanta<br />

Michael Steer, Boston<br />

Peter D Stevens, New Y<strong>or</strong>k<br />

Charmaine A Stewart, Rochester<br />

Christian D Stone, Saint Louis<br />

Gary D Stoner, Columbus<br />

R Todd Stravitz, Richmond<br />

Liping Su, Chicago<br />

Christina Surawicz, Seattle<br />

Robert W Summers, Iowa City<br />

Wing-Kin Syn, Durham<br />

Gyongyi Szabo, W<strong>or</strong>cester<br />

Yvette Taché, Los Angeles<br />

Seng-Lai Tan, Seattle<br />

Andrzej S Tarnawski, Orange<br />

K-M Tchou-Wong, New Y<strong>or</strong>k<br />

Jonathan P Terdiman, San Francisco<br />

Neil D Theise, New Y<strong>or</strong>k<br />

Christopher C Thompson, Boston<br />

Swan N Thung, New Y<strong>or</strong>k<br />

Michael T<strong>or</strong>benson, Baltim<strong>or</strong>e<br />

Natalie J T<strong>or</strong>ok, Sacramento<br />

RA Travagli, Baton Rouge<br />

Ge<strong>or</strong>ge Triadafi lopoulos, Stanf<strong>or</strong>d<br />

Chung-Jyi Tsai, Lexington<br />

Janet Elizabeth Tuttle-Newhall, Durham<br />

Andrew Ukleja, Fl<strong>or</strong>ida<br />

Michael F Vaezi, Nashville<br />

Hugo E Vargas, Scottsdale<br />

Arnold Wald, Wisconsin<br />

Scott A Waldman, Philadelphia<br />

Jian-Ying Wang, Baltim<strong>or</strong>e<br />

Timothy C Wang, New Y<strong>or</strong>k<br />

Irving Waxman, Chicago<br />

Steven A Weinman, Galveston<br />

Steven D Wexner, Weston<br />

Keith T Wilson, Baltim<strong>or</strong>e<br />

Jacqueline L Wolf, Boston<br />

Jackie Wood, Ohio<br />

Ge<strong>or</strong>ge Y Wu, Farmington<br />

Jian Wu, Sacramento<br />

Samuel Wyllie, Houston<br />

Wen Xie, Pittsburgh<br />

Vijay Yajnik, Boston<br />

Vincent W Yang, Atlanta<br />

Francis Y Yao, San Francisco<br />

Hal F Yee, San Francisco<br />

Xiao-Ming Yin, Pittsburgh<br />

Min You, Tampa<br />

Zobair M Younossi, Virginia<br />

Liqing Yu, Winston-Salem<br />

David Yule, Rochester<br />

Ruben Zam<strong>or</strong>a, Pittsburgh<br />

Michael E Zenilman, New Y<strong>or</strong>k<br />

Zhi Zhong, Chapel Hill<br />

Michael A Zimmerman, Col<strong>or</strong>ado<br />

Stephen D Zucker, Cincinnati<br />

Uruguay<br />

Henry Cohen, Montevideo<br />

[1] Passed away on October 20, 2007<br />

[2] Passed away on June 11, 2007<br />

www.wjgnet.com Ⅶ

---

National <strong>Journal</strong> Award<br />

2005<br />

Contents<br />

EDITORIAL<br />

CLINICAL PRACTICE<br />

GUIDELINES<br />

OBSERVER<br />

REVIEW<br />

TOPIC HIGHLIGHTS<br />

GASTRIC CANCER<br />

LIVER CANCER<br />

H pyl<strong>or</strong>i<br />

CLINICAL RESEARCH<br />

W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong><br />

Gastroenterology ®<br />

Weekly Established in October 1995<br />

Volume 14 Number 19<br />

May 21, 2008<br />

2953 Chronic intestinal pseudo-obstruction<br />

Antonucci A, Fronzoni L, Cogliandro L, Cogliandro RF, Caputo C, De Gi<strong>or</strong>gio R,<br />

Pallotti F, Barbara G, C<strong>or</strong>inaldesi R, Stanghellini V<br />

2962 Endoscopic submucosal dissection f<strong>or</strong> gastrointestinal neoplasms<br />

Kakushima N, Fujishiro M<br />

2968 Pharmacological approach to acute pancreatitis<br />

Bang UC, Semb S, Nøjgaard C, Bendtsen F<br />

2977 Intraductal papillary mucinous neoplasms and other pancreatic cystic lesions<br />

Freeman HJ<br />

2980 Proton pump inhibit<strong>or</strong>s in cirrhosis: <strong>Tradition</strong> <strong>or</strong> <strong>evidence</strong> <strong>based</strong> <strong>practice</strong>?<br />

Lodato F, Azzaroli F, Di Girolamo M, Feletti V, Cecinato P, Lisotti A, Festi D, Roda E,<br />

Mazzella G<br />

2986 Mechanisms <strong>of</strong> biliary carcinogenesis and growth<br />

Wise C, Pilanthananond M, Perry BF, Alpini G, McNeal M, Glaser SS<br />

2990 c-Met targeted therapy <strong>of</strong> cholangiocarcinoma<br />

Socoteanu MP, Mott F, Alpini G, Frankel AE<br />

2995 Review <strong>of</strong> endoscopic techniques in the diagnosis and management <strong>of</strong><br />

cholangiocarcinoma<br />

Nguyen K, Sing JT Jr<br />

3000 Diagnosis and initial management <strong>of</strong> cholangiocarcinoma with obstructive<br />

jaundice<br />

Tajiri T, Yoshida H, Mamada Y, Taniai N, Yokomuro S, Mizuguchi Y<br />

3006 Investigation <strong>of</strong> transcriptional gene silencing and mechanism induced by<br />

shRNAs targeted to RUNX3 in vitro<br />

Feng XZ, He XS, Zhuang YZ, Luo Q, Jiang JH, Yang S, Tang XF, Liu JL, Chen T<br />

3015 Transplanted bone marrow stromal cells are not cellular <strong>or</strong>igin <strong>of</strong><br />

hepatocellular carcinomas in a mouse model <strong>of</strong> carcinogenesis<br />

Zheng JF, Liang LJ<br />

3021 Cost effectiveness analysis <strong>of</strong> popu-lation-<strong>based</strong> serology screening and<br />

13 C-Urea breath test f<strong>or</strong> H pyl<strong>or</strong>i to prevent gastric cancer: A markov model<br />

Xie F, Luo N, Lee HP<br />

3028 Endoscopic ultrasound: It's accuracy in evaluating mediastinal<br />

lymphadenopathy? A meta-analysis and systematic review<br />

Puli SR, Batapati Krishna Reddy J, Bechtold ML, Ibdah JA, Antillon D, Singh S, Olyaee M,<br />

Antillon MR<br />

www.wjgnet.com<br />

©

---

Contents<br />

RAPID COMMUNICATION<br />

3038 Sh<strong>or</strong>t-term intravenous interferon therapy f<strong>or</strong> chronic hepatitis B<br />

CASE REPORT<br />

Okushin H, Ohnishi T, M<strong>or</strong>ii K, Uesaka K, Yuasa S<br />

3044 Discrepancies between the responses to skin prick test to food and<br />

respirat<strong>or</strong>y antigens in two subtypes <strong>of</strong> patients with irritable bowel syndrome<br />

Soares RLS, Figueiredo HN, Santos JM, Oliveira RF, Godoy RL, Mendonça FAP<br />

3049 Managing injuries <strong>of</strong> hepatic duct confl uence variants after maj<strong>or</strong><br />

hepatobiliary surgery: An alg<strong>or</strong>ithmic approach<br />

Fragulidis G, Marinis A, Polyd<strong>or</strong>ou A, Konstantinidis C, Anastasopoulos G, Contis J, V<strong>or</strong>os D,<br />

Smyrniotis V<br />

3054 Inhibit<strong>or</strong>y effect <strong>of</strong> dimeric β peptide on the recurrence and metastasis <strong>of</strong><br />

hepatocellular carcinoma in vitro and in mice<br />

Wang SM, Zhu J, Pan LF, Liu YK<br />

3059 A case-control study <strong>of</strong> the relationship between hepatitis B virus DNA level<br />

and risk <strong>of</strong> hepatocellular carcinoma in Qidong, China<br />

Liu TT, Fang Y, Xiong H, Chen TY, Ni ZP, Luo JF, Zhao NQ, Shen XZ<br />

3064 Predictive value <strong>of</strong> MTT assay as an in vitro chemosensitivity testing f<strong>or</strong><br />

gastric cancer: One institution’s experience<br />

Wu B, Zhu JS, Zhang Y, Shen WM, Zhang Q<br />

3069 Signifi cance <strong>of</strong> Bcl-xL in human colon carcinoma<br />

Zhang YL, Pang LQ, Wu Y, Wang XY, Wang CQ, Fan Y<br />

3074 Detection <strong>of</strong> RASSF1A promoter hypermethylation in serum from gastric and<br />

col<strong>or</strong>ectal adenocarcinoma patients<br />

Wang YC, Yu ZH, Liu C, Xu LZ, Yu W, Lu J, Zhu RM, Li GL, Xia XY, Wei XW, Ji HZ, Lu H, Gao Y,<br />

Gao WM, Chen LB<br />

3081 Reoperation <strong>of</strong> biliary tract by laparoscopy: Experiences with 39 cases<br />

Li LB, Cai XJ, Mou YP, Wei Q<br />

3085 Is infl iximab safe to use while breastfeeding?<br />

Stengel JZ, Arnold HL<br />

3088 Abscesses <strong>of</strong> the spleen: Rep<strong>or</strong>t <strong>of</strong> three cases<br />

Fotiadis C, Lavranos G, Patapis P, Karatzas G<br />

3092 Hepatic cyst misdiagnosed as a gastric submucosal tum<strong>or</strong>: A case rep<strong>or</strong>t<br />

Park JM, Kim J, Kim HI, Kim CS<br />

3095 A<strong>or</strong>toduodenal fi stula and a<strong>or</strong>tic aneurysm secondary to biliary stent-induced<br />

retroperitoneal perf<strong>or</strong>ation<br />

Lee TH, Park DH, Park JY, Lee SH, Chung IK, Kim HS, Park SH, Kim SJ<br />

3098 Tuberculous lymphadenitis as a cause <strong>of</strong> obstructive jaundice: A case rep<strong>or</strong>t<br />

and literature review<br />

Colovic R, Grub<strong>or</strong> N, Jesic R, Micev M, Jovanovic T, Colovic N, Atkinson HD<br />

www.wjgnet.com<br />

W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology<br />

Volume 14 Number 19 May 21, 2008

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 2953-2961<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

Chronic intestinal pseudo-obstruction<br />

Research Unit, University Hospital Vall d’Hebron, Paseo Vall d’<br />

Hebron, 119-129, Barcelona 08035, Spain<br />

Antonucci A, Fronzoni L, Cogliandro L, Cogliandro RF, Caputo C,<br />

De Gi<strong>or</strong>gio R, Pallotti F, Barbara G, C<strong>or</strong>inaldesi R, Stanghellini<br />

V. Chronic intestinal pseudo-obstruction. W<strong>or</strong>ld J Gastroenterol<br />

2008; 14(19): 2953-2961 Available from: URL: http://www.wjgnet.com/1007-9327/14/2953.asp<br />

DOI: http://dx.doi.<strong>or</strong>g/10.3748/<br />

wjg.14.2953<br />

INTRODUCTION<br />

Chronic intestinal pseudo-obstruction (CIPO) is a rare,<br />

severe disease characterized by the failure <strong>of</strong> the intestinal<br />

tract to propel its contents which results in a clinical<br />

picture mimicking mechanical obstruction in the absence<br />

<strong>of</strong> any lesion occluding the gut. CIPO is one <strong>of</strong> the most<br />

imp<strong>or</strong>tant causes <strong>of</strong> chronic intestinal failure both in<br />

pediatric (15%) and adult cases (20%) [1-5] , since affected<br />

individuals are <strong>of</strong>ten unable to maintain n<strong>or</strong>mal body<br />

weight and/<strong>or</strong> n<strong>or</strong>mal <strong>or</strong>al nutrition. The severity <strong>of</strong> clinical<br />

picture, generally characterized by disabling digestive<br />

symptoms even between sub-occlusive episodes, contributes<br />

to deteri<strong>or</strong>ation <strong>of</strong> quality <strong>of</strong> life <strong>of</strong> the patients. Furtherm<strong>or</strong>e,<br />

CIPO <strong>of</strong>ten passes unrecognized f<strong>or</strong> long time,<br />

so that patients almost invariably undergo repeated, useless<br />

and potentially dangerous surgical procedures.<br />

This article is aimed at reviewing the current knowledge<br />

on pathophysiology, clinical features and management <strong>of</strong><br />

patients affected by CIPO.<br />

ETIOLOGY AND PATHOPHYSIOLOGY<br />

EDITORIAL<br />

Alexandra Antonucci, Lucia Fronzoni, Laura Cogliandro, Rosanna F Cogliandro, Carla Caputo, Roberto De Gi<strong>or</strong>gio,<br />

Francesca Pallotti, Giovanni Barbara, Roberto C<strong>or</strong>inaldesi, Vincenzo Stanghellini<br />

Alexandra Antonucci, Lucia Fronzoni, Laura Cogliandro,<br />

Rosanna F Cogliandro, Carla Caputo, Roberto De Gi<strong>or</strong>gio,<br />

Francesca Pallotti, Giovanni Barbara, Roberto C<strong>or</strong>inaldesi,<br />

Vincenzo Stanghellini, Department <strong>of</strong> Internal Medicine and<br />

Gastroenterology, University <strong>of</strong> Bologna, Bologna I-40138, Italy<br />

Auth<strong>or</strong> contributions: Antonucci A, Fronzoni L perf<strong>or</strong>med<br />

PubMed and Medline searches pertinent to the objective <strong>of</strong><br />

the present article and reviewed the literature; Cogliandro L<br />

contributed analyzing the text, reviewing literature; Caputo C and<br />

Pallotti F perf<strong>or</strong>med PubMed and Medline searches particularly<br />

focusing on previously published articles on pathophysiology <strong>of</strong><br />

chronic intestinal pseudo-obstruction; Cogliandro RF, De Gi<strong>or</strong>gio<br />

R, Barbara G, C<strong>or</strong>inaldesi R and Stanghellini V contributed to the<br />

writing manuscript, section co<strong>or</strong>dination and English editing.<br />

C<strong>or</strong>respondence to: Vincenzo Stanghellini, MD, Department<br />

<strong>of</strong> Internal Medicine & Gastroenterology, St. Orsola-Malpighi<br />

Hospital, Via Massarenti 9, Bologna I-40138,<br />

Italy. v.stanghellini@unibo.it<br />

Telephone: +39-51-6364101 Fax: +39-51-345864<br />

Received: January 15, 2008 Revised: March 23, 2008<br />

Abstract<br />

Chronic intestinal pseudo-obstruction (CIPO) is a severe<br />

digestive syndrome characterized by derangement<br />

<strong>of</strong> gut propulsive motility which resembles mechanical<br />

obstruction, in the absence <strong>of</strong> any obstructive process.<br />

Although uncommon in clinical <strong>practice</strong>, this syndrome<br />

represents one <strong>of</strong> the main causes <strong>of</strong> intestinal failure<br />

and is characterized by high m<strong>or</strong>bidity and m<strong>or</strong>tality. It<br />

may be idiopathic <strong>or</strong> secondary to a variety <strong>of</strong> diseases.<br />

Most cases are sp<strong>or</strong>adic, even though familial f<strong>or</strong>ms<br />

with either dominant <strong>or</strong> recessive autosomal inheritance<br />

have been described. Based on histological features intestinal<br />

pseudo-obstruction can be classified into three<br />

main categ<strong>or</strong>ies: neuropathies, mesenchymopathies, and<br />

myopathies, acc<strong>or</strong>ding on the predominant involvement<br />

<strong>of</strong> enteric neurones, interstitial cells <strong>of</strong> Cajal <strong>or</strong> smooth<br />

muscle cells, respectively. Treatment <strong>of</strong> intestinal pseudo-obstruction<br />

involves nutritional, pharmacological and<br />

surgical therapies, but it is <strong>of</strong>ten unsatisfact<strong>or</strong>y and the<br />

long-term outcome is generally po<strong>or</strong> in the maj<strong>or</strong>ity <strong>of</strong><br />

cases.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Chronic intestinal pseudo-obstruction; Small<br />

bowel manometry; Immunohistochemistry; Prokinetics;<br />

Intestinal transplantation<br />

Peer reviewer: Fernando Azpiroz, MD, Digestive System<br />

CIPO is idiopathic in the maj<strong>or</strong>ity <strong>of</strong> cases. In our experience<br />

<strong>or</strong>ganic, systemic <strong>or</strong> metabolic causes <strong>of</strong> the disease<br />

were identified in only 4 patients <strong>of</strong> 77 CIPO patients consecutively<br />

referred in our lab<strong>or</strong>at<strong>or</strong>y (5%) [2] . Nevertheless, it<br />

is mandat<strong>or</strong>y to investigate affected individuals by traditional<br />

diagnostic procedures (radiology, endoscopy, lab tests, etc) in<br />

<strong>or</strong>der to exclude every possible cause <strong>of</strong> secondary CIPO.<br />

The main secondary causes <strong>of</strong> CIPO are specified in Table 1.<br />

In fact, every disease that affects one <strong>of</strong> the control<br />

mechanisms <strong>of</strong> intestinal functioning, including intrinsic<br />

and extrinsic neural supplies as well as muscle cells, can be<br />

responsible f<strong>or</strong> secondary and potentially curable f<strong>or</strong>ms<br />

<strong>of</strong> CIPO. The extrinsic autonomic nervous system can<br />

be affected both centrally (i.e. Parkinson syndrome, Shy-<br />

Drager syndrome, stroke, encephalitis, neoplasm and any<br />

www.wjgnet.com

---

2954 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

Table 1 Main causes <strong>of</strong> secondary chronic idiopathic pseudo-obstruction and relative gut tissue that is predominantly involved<br />

Underlying disease Main causes<br />

Diseases <strong>of</strong> central autonomic and enteric<br />

nervous systems<br />

other disease that could affect the encephalic autonomous<br />

centres), and peripherally (i.e. diabetic neuropathy, <strong>or</strong> other<br />

neuropathies potentially involving the enteric nervous<br />

system including Hirschsprung, Chagas, Von Recklinghausen,<br />

as well as non-specific diseases, like paraneoplastic<br />

syndromes, autoimmune diseases, viral infections). Enteric<br />

smooth muscle cells can be markedly damaged in patients<br />

affected by myotonic dystrophy <strong>or</strong> progressive systemic<br />

sclerosis. Collagenosis, Ehlers-Danlos syndrome, jejunal<br />

diverticulosis and radiation enteritis can be responsible f<strong>or</strong><br />

both a neuronal and myogenic impairment.<br />

Nonetheless, diseases like hypothyroidism, hypoparathyroidism,<br />

and celiac disease have been described to be<br />

responsible f<strong>or</strong> some cases <strong>of</strong> secondary CIPO, even if the<br />

underlying mechanism remains undetermined [1,4] .<br />

CIIPO is generally sp<strong>or</strong>adic, but familial f<strong>or</strong>ms have also<br />

been described both with autosomal dominant, autosomal<br />

recessive and X-linked transmission [1,6,7] . Some genes and<br />

loci have been identified in syndromic f<strong>or</strong>ms <strong>of</strong> CIIPO,<br />

including the transcription fact<strong>or</strong> SOX10 on chromosome<br />

22 (22p12), the DNA polymerase gamma gene (POLG) on<br />

chromosome 21 (21q17) and a locus on chromosome 8 [7-9] .<br />

In terms <strong>of</strong> X-linked transmission, recently Gargiulo et al<br />

have identified a 2-base pair deletion in exon 2 <strong>of</strong> the filamin<br />

A gene (encoding f<strong>or</strong> a large cytoskeletal protein involved<br />

in the modulation <strong>of</strong> the cellular response to chemical and<br />

mechanical environmental fact<strong>or</strong>s) that is present at the<br />

heterozygous state in the carrier females <strong>of</strong> a family with<br />

syndromic CIPO [10] . Familial cases are m<strong>or</strong>e frequent in<br />

mitochondrial neurogastrointestinal encephalomyopathy<br />

(MNGIE), which is characterized by subocclusive episodes<br />

and lactic acidosis, skeletal muscle abn<strong>or</strong>malities (i.e. “ragged<br />

red fiber”) and specific mitochondrial changes at the<br />

ultrastructural level [11,12] . Mutations <strong>of</strong> the gene encoding<br />

the thymidine phosph<strong>or</strong>ylase gene (TP <strong>or</strong> endothelial cell<br />

growth fact<strong>or</strong>-1, ECGF1), mapped to locus 22q13.32qter<br />

have a pathogenic role and are responsible f<strong>or</strong> MNGIE [11-15] .<br />

The biochemical dysfunctions underlying MNGIE consists<br />

<strong>of</strong> decreased TP activity leading to accumulation <strong>of</strong><br />

thymidine (dThd) and deoxyuridine (dUrd) in blood and<br />

tissues [16,17] .<br />

Toxic levels <strong>of</strong> dThd and dUrd induce nucleotide pool<br />

imbalance that, in turn, leads to mitochondrial DNA abn<strong>or</strong>malities<br />

including point mutations, multiple deletions<br />

and depletion [16,18] .<br />

Histopathology and putative pathogenic mechanisms<br />

Examination <strong>of</strong> full-thickness biopsies <strong>of</strong> the intestinal<br />

Stroke, encephalitis, calcification <strong>of</strong> basal ganglia, <strong>or</strong>thostatic hypotension, Von Recklinghausen, Hirschsprung<br />

Immune-mediated and collagen diseases Paraneoplastic (CNS neoplasms, lung microstoma, bronchial carcinoid, leyomyosarcomas), scleroderma,<br />

dermatomyositis, amyloidosis, Ehlers-Danlos, LES<br />

Endocrine and metabolic diseases Diabetes, hypothyroidism, hypoparathyroidism, phaeochromocytoma<br />

Other Iatrogenic (radiation enteritis, clonidine, phenothiazines, antidepressants, antiparkinsonians, antineoplastics,<br />

bronchodilat<strong>or</strong>s, anthraquinones) jejunal diverticulosis, chagas<br />

www.wjgnet.com<br />

wall may help in establishing a c<strong>or</strong>rect diagnosis, revealing<br />

pathological abn<strong>or</strong>malities underlying the neuromuscular<br />

impairment. Histolopathic features <strong>of</strong> CIPO include neuropathic,<br />

mesenchymopathic and myopathic f<strong>or</strong>ms <strong>based</strong><br />

on abn<strong>or</strong>malities affecting the integrity <strong>of</strong> nerve pathways<br />

supplying the gut (either intrinsic <strong>or</strong> extrinsic), interstitial<br />

cells <strong>of</strong> Cajal (ICC) and smooth muscle cells, respectively.<br />

Neuropathic, mesenchymopathic and myopathic changes<br />

may contribute to gut dysmotility either individually <strong>or</strong> in<br />

combination (e.g. neuro-myopathies <strong>or</strong> neuro-ICC alterations)<br />

(Table 2) [1,6,7] .<br />

Enteric neuropathies and enteroglial cell abn<strong>or</strong>malities<br />

Enteric neurodegenerative abn<strong>or</strong>malities and immunemediated<br />

changes may occur in gut specimens <strong>of</strong> patients<br />

with neuropathic CIPO. Inflammat<strong>or</strong>y neuropathies<br />

are characterized by a dense inflammat<strong>or</strong>y infiltrate<br />

characterized by CD3 positive (composed <strong>of</strong> both CD4<br />

and CD8) lymphocytes almost invariably confined to the<br />

myenteric plexus (hence the term <strong>of</strong> lymphocytic myenteric<br />

ganglionitis) [7-9,19] . The close apposition <strong>of</strong> CD3 lymphocytes<br />

to myenteric neurons provides the basis to neuro-immune<br />

interactions targeting and affecting ganglion cell structure<br />

and survival [20,21] . Indeed, experimental <strong>evidence</strong> indicates<br />

that inflammation/immune activation in the gastrointestinal<br />

tract can pr<strong>of</strong>oundly affect both m<strong>or</strong>phology and function<br />

<strong>of</strong> the enteric nervous system (ENS).<br />

The <strong>evidence</strong> that patients with inflammat<strong>or</strong>y<br />

neuropathy have circulating anti-neuronal auto-antibodies<br />

(e.g. anti-Hu anti-neuronal antibodies) also suggests the role<br />

<strong>of</strong> the immune system in neuronal dysfunction [19] . Previous<br />

results indicated that these autoantibodies alter ascending<br />

reflex pathway <strong>of</strong> peristalsis in in vitro preparations [22] and<br />

elicit neuronal hyperexcitability as demonstrated by Ca 2+ -<br />

imaging technique [23] . In addition, anti-HuD neuronal<br />

antibodies evoked activation <strong>of</strong> caspase-3 and apaf-1 along<br />

with apoptosis when incubated with primary culture <strong>of</strong><br />

myenteric neurons [24] . Taken together, these experimental<br />

data suggest that anti-Hu antibodies may exert either a<br />

direct pathogenic role <strong>or</strong> contribute in association with the<br />

lymphocytic infiltrate in ENS dysfunction in patients with<br />

CIPO related to an inflammat<strong>or</strong>y neuropathy. Although<br />

the etiology <strong>of</strong> inflammat<strong>or</strong>y neuropathies remains<br />

undetermined, the demonstration showing herpes virus<br />

DNA in the myenteric plexus <strong>of</strong> patients with CIPO [25]<br />

raises the exciting possibility that infectious agents can be<br />

involved in the pathogenic cascade leading to inflammat<strong>or</strong>y<br />

damage <strong>of</strong> the ENS.

---

Antonucci A et al. Pseudo-obstruction 2955<br />

Table 2 Immunohistochemical markers to analyze full thickness biopsy <strong>of</strong> patients with CIPO<br />

Markers Cell targets and sites Description<br />

PGP9.5, NSE, MAP-2, NFs, tubulins, Hu C/D Neurons: Membrane/Cytoplasmic Identification <strong>of</strong> the general structure <strong>of</strong> the ENS<br />

b-S-100, GFAP Glial cells: Cytoplasmic Detection <strong>of</strong> enteroglial cells<br />

Kit Interstitial cells <strong>of</strong> Cajal: Membrane/Cytoplasmic Different ICC netw<strong>or</strong>ks<br />

SP, VIP, PACAP, CGRP, NPY, Galanin, 5-HT,<br />

NOS, ChAT, somatostatin, Calbindin, NeuN,<br />

NK1, NK2 and NK3<br />

Subclasses <strong>of</strong> enteric neurons; interstitial<br />

cells <strong>of</strong> Cajal: Membrane/Cytoplasmic<br />

Bcl-2, TUNEL, Caspase-3, Caspase-8, Apaf-1 Apoptosis and related mechanisms:<br />

Nuclear/Cytoplasmic<br />

Bcl-2: B cell lymphoma-2 protein; ChAT: Choline acetyltransferase; CGRP: Calcitonin gene-related peptide; ENS: Enteric nervous system; GFAP: Glial fibrillary<br />

acidic protein; Hu C/D: Hu C/D molecular antigen; IFN-g: Interferon g; MAP-2: Microtubule associated protein-2; MIP1-α: Macrophage inflammat<strong>or</strong>y protein-1α;<br />

NeuN: Neuronal-specific nuclear protein; NFs: Neur<strong>of</strong>ilaments; NK1, NK2, NK3: Neurokinin1, neurokinin2, neurokinin3; NOS: Nitric oxide synthase;<br />

NPY: Neuropeptide Y; NSE: Neuron-specific enolase; PACAP: Pituitary adenylate cyclase activating polypeptide; PGP9.5: Protein gene product 9.5; 5-HT:<br />

5-hydroxytryptamine (serotonin); SP: Substance P; TNF-α: Tum<strong>or</strong> necrosis fact<strong>or</strong> α; Tubulins: Cytoskeletal proteins; TUNEL: Terminal deoxynucleotidyl<br />

transferase-mediated deoxyuridine triphosphate nick-end labeling; VIP: Vasoactive intestinal polypeptide.<br />

Further to lymphocytic ganglionitis, Schappi et al have<br />

rep<strong>or</strong>ted on eosinophilic ganglionitis characterized by<br />

eosinophils infiltrating the myenteric plexus <strong>of</strong> pediatric<br />

patients with CIPO [26] . In contrast to lymphocytic, the<br />

eosinophilic ganglionitis does not appear to evoke neuronal<br />

degeneration and loss and, theref<strong>or</strong>e, gut dysmotility<br />

may be interpreted as a functional impairment <strong>of</strong> the<br />

ENS due to the infiltrate per se <strong>or</strong> hum<strong>or</strong>al messengers<br />

released by eosinophils. Recently, mast cell predominant<br />

ganglionitis has been described in patients with severe gut<br />

dysmotility (including CIPO) [27] . The mast cells detected<br />

within myenteric ganglia in these patients were associated<br />

with markedly reduced neuronal nitric oxide synthase expression<br />

identified at molecular and immunohistochemical<br />

level. These findings suggest an impaired enteric inhibit<strong>or</strong>y<br />

innervation in these peculiar subsets <strong>of</strong> CIPO.<br />

Degenerative (<strong>or</strong> non inflammat<strong>or</strong>y) neuropathies<br />

may be regarded as the end result <strong>of</strong> several putative<br />

pathogenic mechanisms, such as altered calcium signaling,<br />

mitochondrial dysfunction and production <strong>of</strong> free<br />

radicals, leading to degeneration and loss <strong>of</strong> the intrinsic<br />

neurons <strong>of</strong> the gut [28] . Degenerative neuropathies can<br />

be familial (related to a genetic background-see above)<br />

<strong>or</strong> sp<strong>or</strong>adic and classified into primary (idiopathic) <strong>or</strong><br />

secondary f<strong>or</strong>ms to a variety <strong>of</strong> causes, such as radiations,<br />

vinka alkaloids, myxedema, diabetes mellitus, muscular<br />

dystrophy and amyloidosis. Typical neuropathological<br />

findings rep<strong>or</strong>ted in neurodegenerative CIPO include<br />

various qualitative (neuronal swelling, intranuclear<br />

inclusions, axonal degeneration and other lesions) and<br />

quantitative (especially hypoganglionosis) abn<strong>or</strong>malities<br />

<strong>of</strong> the ENS. Sp<strong>or</strong>adic cases <strong>of</strong> visceral neuropathies are<br />

associated with two maj<strong>or</strong> patterns <strong>of</strong> alterations: (1) A<br />

marked reduction <strong>of</strong> intramural (especially myenteric)<br />

neural cells mainly associated with swollen neural cell<br />

bodies and processes, fragmentation and loss <strong>of</strong> axons<br />

and proliferation <strong>of</strong> glial cells; (2) A loss <strong>of</strong> the n<strong>or</strong>mal<br />

staining in subsets <strong>of</strong> enteric neurons, in the absence <strong>of</strong><br />

Characterization <strong>of</strong> neurochemical coding and enteric<br />

neuron subclasses; subsets <strong>of</strong> interstitial cells <strong>of</strong> Cajal<br />

Assessment <strong>of</strong> apoptosis and related pathways<br />

Actin, myosin, desmin, smoothelin Smooth muscle cells: Cytoplasmic Assessment <strong>of</strong> smooth muscle integrity<br />

CD3, CD4, CD8, CD79α, CD68;<br />

MIP-1α, TNF-α, IFN-g<br />

Immune cells, chemokines and cytokines:<br />

Membrane/Cytoplasmic<br />

Evaluation <strong>of</strong> B (CD79α) and T-lymphocytes (CD3),<br />

T-helper (CD4), T-suppress<strong>or</strong> (CD8), macrophages (CD68)<br />

in enteric ganglionitis; MIP-1α is a chemokine; TNF-α and<br />

IFN-g are inflammat<strong>or</strong>y cytokines<br />

dendritic swelling <strong>or</strong> glial proliferation [6,20,21] . Since no<br />

reliable models <strong>of</strong> degenerative neuropathies exist, the<br />

mechanisms through which exogenous noxae <strong>or</strong> other<br />

triggering fact<strong>or</strong>s initiate degenerative processes in enteric<br />

neurons remain obscure. Enteric neurons <strong>of</strong> patients with<br />

severe f<strong>or</strong>ms <strong>of</strong> idiopathic intrinsic neuropathy display a<br />

decreased expression <strong>of</strong> the protein encoded by Bcl-2, a<br />

gene related to one <strong>of</strong> the intracellular pathways leading to<br />

programmed cell death [4,29,30] . Indeed, this finding has been<br />

associated with an increased number <strong>of</strong> neurons displaying<br />

TUNEL, a marker <strong>of</strong> apoptosis [31] .<br />

Abn<strong>or</strong>malities <strong>of</strong> enteric glia may also contribute to<br />

intrinsic neuropathy either attracting immune cells to the<br />

ENS <strong>or</strong> resulting in insufficient supp<strong>or</strong>t/trophism to<br />

enteric neurons and thus eliciting neurodegenerative events<br />

in the absence <strong>of</strong> inflammation [32] .<br />

Enteric mesenchymopathies<br />

Abn<strong>or</strong>malities to ICCs have been detected in gut tissues <strong>of</strong><br />

patients with CIPO. These include decreased ICC density,<br />

loss <strong>of</strong> processes and damaged intracellular cytoskeleton<br />

and <strong>or</strong>ganelles as revealed by immunohistochemical<br />

analysis and electron microscopy [33-37] . As a result, it<br />

has been proposed that the impairment <strong>of</strong> the maj<strong>or</strong><br />

functional subclasses <strong>of</strong> ICC (i.e. those involved in pacemaker<br />

activity and neurotransmission to smooth muscle)<br />

may contribute to enteric motility abn<strong>or</strong>malities detectable<br />

in patients with CIPO.<br />

Enteric myopathies<br />

Histopathological analysis <strong>of</strong> the enteric muscle layer<br />

may reveal the existence <strong>of</strong> muscular abn<strong>or</strong>malities (i.e.<br />

smooth muscle fibrosis and vacuolization) <strong>of</strong> the circular<br />

and longitudinal layers in patients with primary visceral<br />

myopathy [38,39] . A controlled multinational study conducted<br />

by Knowles et al has proposed that a selective decrease<br />

<strong>or</strong> even absence <strong>of</strong> α-actin in the circular muscle <strong>of</strong> the<br />

small bowel wall can be regarded as biological markers <strong>of</strong><br />

www.wjgnet.com

---

2956 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

CIPO [40] . Although exciting, the possibility that a defective<br />

expression/localization <strong>of</strong> α-actin may be a biomarker<br />

<strong>of</strong> a heterogeneous disease such as CIPO awaits solid<br />

confirmat<strong>or</strong>y <strong>evidence</strong>.<br />

The histopathological details concerning other segments<br />

<strong>of</strong> the gut as well as extra-digestive systems (i.e. urinary<br />

tract, gall-bladder) is po<strong>or</strong>ly characterized and further studies<br />

are awaited to elucidate this imp<strong>or</strong>tant aspect.<br />

CLINICAL FEATURES<br />

Subocclusive episodes can strike in apparently healthy<br />

people, but the onset <strong>of</strong> CIPO is generally insidious, with<br />

gastrointestinal symptoms which precede the first acute<br />

episode.<br />

The typical clinical manifestation <strong>of</strong> CIPO is<br />

characterized by recurrent episodes <strong>of</strong> abdominal pain,<br />

abdominal distension and inability to defecate (flatus may<br />

not be completely suppressed), with <strong>or</strong> without vomiting,<br />

mimicking a mechanical sub-occlusion. During acute<br />

episodes radiological <strong>evidence</strong> <strong>of</strong> distended bowel loops<br />

and air-fluid levels in the upright position is an imp<strong>or</strong>tant<br />

diagnostic marker <strong>of</strong> this pathological condition. Acute<br />

episodes can last only a few hours, but in the most severe<br />

cases intestinal loops are chronically distended and airfluid<br />

levels are invariably detected. Due to this misleading<br />

clinical manifestation, a hist<strong>or</strong>y <strong>of</strong> multiple, useless<br />

surgeries are typical <strong>of</strong> the syndrome. Thus, many patients<br />

have abdominal adhesions and the concomitant presence<br />

<strong>of</strong> functional and mechanical (secondary to adhesions)<br />

obstruction is <strong>of</strong>ten impossible to rule out despite extensive<br />

investigations.<br />

Between subocclusive episodes patients are very rarely<br />

asymptomatic, and almost invariably complain <strong>of</strong> severe<br />

digestive symptoms [1,2] suggestive <strong>of</strong> delayed transit in<br />

the proximal and/<strong>or</strong> distal p<strong>or</strong>tions <strong>of</strong> the alimentary<br />

canal. Nausea, vomiting and weight loss are predominant<br />

symptoms when the functional derangement primarily<br />

affects the upper gastrointestinal tract, while diffuse<br />

abdominal pain, abdominal distension and constipation<br />

are suggestive <strong>of</strong> a m<strong>or</strong>e distal involvement <strong>of</strong> the gut.<br />

Dysphagia is present in a low prop<strong>or</strong>tion <strong>of</strong> CIIPO patients<br />

although it is relatively frequent in f<strong>or</strong>ms secondary to<br />

progressive systemic sclerosis.<br />

Diarrhea and steat<strong>or</strong>rhoea <strong>of</strong>ten occur as a consequence<br />

to small bowel bacterial overgrowth.<br />

This pathologically accelerated transit is <strong>of</strong>ten well<br />

accepted by patients since it is associated with partial<br />

relief <strong>of</strong> other digestive symptoms, but it contributes<br />

to determine intestinal malabs<strong>or</strong>ption and deteri<strong>or</strong>ate<br />

nutritional conditions. Indeed, many patients are afflicted by<br />

inability to maintain a n<strong>or</strong>mal body weight, despite dietary<br />

manipulations, both because <strong>of</strong> the deranged digestive<br />

functions and because food ingestion <strong>of</strong>ten exacerbates<br />

digestive symptoms and consequently patients tend to avoid<br />

a n<strong>or</strong>mal <strong>or</strong>al nutrition.<br />

Urinary symptoms, generally associated with <strong>evidence</strong><br />

<strong>of</strong> urinary tract distension, are also frequent.<br />

Depression <strong>or</strong> other psychological disturbances are<br />

<strong>of</strong>ten secondary to the disabling digestive problems and<br />

the disappointing quality <strong>of</strong> healthcare received.<br />

www.wjgnet.com<br />

DIAGNOSTIC PROCEDURES<br />

The diagnosis <strong>of</strong> CIPO is mainly clinical, supp<strong>or</strong>ted by<br />

radiographic documentation <strong>of</strong> dilated bowel with airfluid<br />

level, after exclusion <strong>of</strong> <strong>or</strong>ganic lesions occluding the<br />

gut lumen, as detected by radiologic and/<strong>or</strong> endoscopic<br />

investigations. Thus, diagnostic tests in patients with<br />

suspected CIPO are necessary to exclude mechanical<br />

occlusion, identify possible causes <strong>of</strong> secondary f<strong>or</strong>ms,<br />

expl<strong>or</strong>e underlying pathophysiological mechanisms and<br />

disclose possible complications.<br />

Radiology<br />

Radiology is one <strong>of</strong> the most imp<strong>or</strong>tant examinations in<br />

the diagnosis <strong>of</strong> CIPO. Plain abdominal films identify typical<br />

signs <strong>of</strong> intestinal occlusion such as distended bowel<br />

loops with air-fluid levels, the latter obtained with the patients<br />

in the upright position (as specified above). Contrast<br />

studies are necessary to exclude the presence <strong>of</strong> <strong>or</strong>ganic lesions<br />

responsible f<strong>or</strong> the occlusion. Entero-CT scan allows<br />

simultaneous internal and external views <strong>of</strong> the gut wall,<br />

abdominal CT and MR scans are imp<strong>or</strong>tant in investigating<br />

possible causes <strong>of</strong> gut compression, while MR angiography<br />

may non-invasively identify congenital <strong>or</strong> acquired vascular<br />

abn<strong>or</strong>malities. Excret<strong>or</strong>y urograms should be perf<strong>or</strong>med<br />

in patients with urinary symptoms.<br />

Symptoms suggestive <strong>of</strong> a subocclusive state in the<br />

absence <strong>of</strong> dilated bowel with air fluid levels at radiology<br />

have been defined by some auth<strong>or</strong>s as a “mild f<strong>or</strong>ms <strong>of</strong><br />

CIPO” [41] . Nonetheless, this definition has been criticized [4] .<br />

In fact, preliminary studies suggest that patients with extremely<br />

severe digestive symptoms and malnutrition, but<br />

no radiological <strong>evidence</strong> <strong>of</strong> intestinal occlusion, have a<br />

significantly reduced probability <strong>of</strong> undergoing abdominal<br />

surgery and present less severe motility dis<strong>or</strong>ders [42] .<br />

Endoscopy<br />

The main indication <strong>of</strong> upper gastrointestinal endoscopy<br />

is exclusion <strong>of</strong> mechanical occlusions in the gastro-jejunal<br />

and ileo-colonic regions. It allows to exclusion <strong>of</strong> false<br />

positive radiologic diagnoses <strong>of</strong> mechanical occlusion<br />

in the duodenum and proximal small bowel, as in many<br />

cases <strong>of</strong> the so-called “a<strong>or</strong>to-mesenteric compression<br />

syndrome” [43] . Mucosal biopsies <strong>of</strong> the small bowel should<br />

be taken to rule out celiac disease. Colonoscopy also<br />

has a therapeutic potential, since it can be used to try to<br />

decompress the large bowel [44] .<br />

Lab<strong>or</strong>at<strong>or</strong>y tests<br />

Lab<strong>or</strong>at<strong>or</strong>y tests are useful to identify the presence <strong>of</strong><br />

potentially curable diseases responsible f<strong>or</strong> secondary f<strong>or</strong>ms,<br />

but also to monit<strong>or</strong> hydro-electrolyte balance and circulating<br />

levels <strong>of</strong> essential elements in patients on parenteral<br />

nutrition <strong>or</strong>, in general, with a severe malnutrition.<br />

Manometry<br />

Small bowel manometry is invariably abn<strong>or</strong>mal in CIPO<br />

patients [2,3,45] ; however, the test is not <strong>of</strong> diagnostic value<br />

due to its low specificity. At best, it can play a supp<strong>or</strong>tive<br />

role in defining the diagnosis, since it can contribute to<br />

differentiate mechanical from functional obstruction and

---

Antonucci A et al. Pseudo-obstruction 2957<br />

to recognize the underlying pathophysiological mechanism<br />

[2,3,45] .<br />

Describing in detail small bowel manometric abn<strong>or</strong>malities<br />

<strong>of</strong> CIPO goes beyond the scope <strong>of</strong> the present<br />

review. They can be summarized as follows: unco<strong>or</strong>dinated<br />

bursts <strong>of</strong> powerful contractions with variable duration are<br />

suggestive <strong>of</strong> an underlying intrinsic neuropathy [1-4,45-48]<br />

conversely, n<strong>or</strong>mally co<strong>or</strong>dinated mot<strong>or</strong> patterns with low<br />

amplitude have been rep<strong>or</strong>ted in patients with a myogenic<br />

dis<strong>or</strong>der [1-4,45-48] . Nonetheless, low amplitude contractions<br />

may merely reflect the inability <strong>of</strong> the manometric technique<br />

to rec<strong>or</strong>d non-occlusive contractions, such as in the<br />

case <strong>of</strong> dilated bowel loops [1-4,45-48] .<br />

Unlike what is observed in pseudo-obstruction, the<br />

manometric pattern <strong>of</strong> mechanical occlusion is characterized<br />

by giant contractions (prolonged contractions lasting<br />

at least 10 s and can be either propagated <strong>or</strong> non propagated)<br />

<strong>or</strong> clustered contractions (3-10 regular contractions,<br />

occurring 1 per 5 s preceded and followed by ≥ 1 min <strong>of</strong><br />

absent mot<strong>or</strong> activity lasting at least 20 min and can be either<br />

propagated <strong>or</strong> non propagated) [1-4,45-49] .<br />

Esophageal manometry generally adds very little to the<br />

diagnostic w<strong>or</strong>k-up <strong>of</strong> CIPO, but it plays an imp<strong>or</strong>tant diagnostic<br />

and prognostic role if the disease is secondary to<br />

scleroderma. Ano-rectal manometry is imp<strong>or</strong>tant to rule<br />

out Hirschsprung’s disease, particularly in patients with intractable<br />

constipation and a marked distension <strong>of</strong> the large<br />

intestine.<br />

Biopsy and pathologic examination<br />

Full thickness biopsies should be obtained from dilated<br />

and n<strong>or</strong> dilated tracts <strong>of</strong> the alimentary canal in all<br />

patients with suspected CIPO who undergo surgery<br />

f<strong>or</strong> unexplained occlusive episodes. Biopsies should be<br />

processed f<strong>or</strong> in depth pathological evaluation by both<br />

traditional staining and immunohistochemistry techniques<br />

in dedicated lab<strong>or</strong>at<strong>or</strong>ies with a specific interest in this<br />

area, as specified above.<br />

NATURAL HISTORY<br />

Even if clinical experience shows that CIPO is a<br />

progressive disease that <strong>of</strong>ten leads to death, only few<br />

studies have precisely described the natural hist<strong>or</strong>y <strong>of</strong> this<br />

pathology and its symptoms prognostic values, especially<br />

in the adult age. Children generally present the first<br />

manifestations <strong>of</strong> CIPO at birth <strong>or</strong> during the first years<br />

<strong>of</strong> age [50-53] . The pediatric expression <strong>of</strong> the disease is <strong>of</strong>ten<br />

characterized by a particularly severe course, with m<strong>or</strong>tality<br />

rates extremely high within the first year <strong>of</strong> age, mainly<br />

due to surgical and parenteral nutrition complications [52,53] .<br />

Several predict<strong>or</strong>s <strong>of</strong> po<strong>or</strong> outcome have been identified<br />

in children including myopathic f<strong>or</strong>ms, malrotation, sh<strong>or</strong>t<br />

bowel syndrome, and urinary tract involvement [50,51] .<br />

In the adult population, the first sub-occlusive episode<br />

is <strong>of</strong>ten preceded by a long hist<strong>or</strong>y <strong>of</strong> non-specific,<br />

progressively m<strong>or</strong>e severe digestive symptoms. An acute<br />

onset <strong>of</strong> the disease occurs in only one-fourth <strong>of</strong> the<br />

cases [2] .<br />

After diagnosis is established the frequency <strong>of</strong> sub-<br />

occlusive episodes and, consequently, also <strong>of</strong> surgical<br />

procedures tend to decrease. Nevertheless, the clinical<br />

course <strong>of</strong> CIPO is almost invariably severe [1,2,52-54] with<br />

progressive deteri<strong>or</strong>ation <strong>of</strong> bowel function and digestive<br />

symptoms. In <strong>or</strong>der to control both the body weight and<br />

the abdominal pain most patients progressively limit <strong>or</strong>al<br />

nutrition and end up on long-term parenteral nutrition.<br />

The main causes <strong>of</strong> death are TPN-related complications,<br />

surgery-related complications, and post-transplantation<br />

complication, together with septic shock <strong>of</strong> GI <strong>or</strong>igin. A<br />

variety <strong>of</strong> clinical, histological and manometric parameters<br />

have been found to be predictive <strong>of</strong> a po<strong>or</strong> clinical outcome<br />

in adult patients, including myopathy and decreased<br />

contractile activity [2,50,52,53,55-60] . MNGIE has a particularly<br />

po<strong>or</strong> prognosis with slowly progressive evolution and death<br />

around 40 years <strong>of</strong> age [11] .<br />

THERAPY<br />

The treatment <strong>of</strong> CIPO is difficult and <strong>of</strong>ten provides<br />

unsatisfact<strong>or</strong>y results. Of course, treatment <strong>of</strong> the<br />

underlying disease is mandat<strong>or</strong>y in secondary f<strong>or</strong>ms<br />

whenever available [57] .<br />

Treatment <strong>of</strong> the acute phase<br />

During acute phases patients should be treated as those<br />

with acute mechanical obstruction. Fluid and electrolytes<br />

balance should be maintained via IV infusions; abdominal<br />

decompression should be attempted by positioning<br />

<strong>of</strong> nasogastric and rectal tubes. The f<strong>or</strong>mer generally<br />

prevents vomiting and ab ingestis while the latter is<br />

generally ineffective and colonic decompression can be<br />

attempted by colonoscopy <strong>or</strong> cecostomy (see below).<br />

In case <strong>of</strong> prolonged subocclusive episodes systemic <strong>or</strong><br />

po<strong>or</strong>ly abs<strong>or</strong>bable antibiotics are necessary to prevent<br />

bacterial overgrowth. Appropriate cal<strong>or</strong>ic supp<strong>or</strong>t must be<br />

provided by IV infusion. Erythromycin, somatostatin and<br />

neostigmine can be used to promote transit and decrease<br />

the duration <strong>of</strong> acute episodes [61-63] .<br />

Nutritional supp<strong>or</strong>t<br />

The nutritional status <strong>of</strong> patients with CIPO is generally<br />

po<strong>or</strong>. Frequent small meals with liquid <strong>or</strong> homogenized<br />

foods, with <strong>or</strong> without <strong>or</strong>al nutritional supplements, may<br />

help patients with sufficient residual digestive functions.<br />

Enteral nutrition is an option f<strong>or</strong> patients whose motility<br />

dis<strong>or</strong>der is mainly localized in the stomach and duodenum.<br />

It presents fewer complications than parenteral nutrition,<br />

but clinical experience suggests that enteral feeding is<br />

rarely tolerated by patients. In the most severe cases,<br />

when small bowel function is diffusely affected, parenteral<br />

nutrition is necessary to satisfy nutritional requirements.<br />

The main limitations <strong>of</strong> this nutritional supp<strong>or</strong>t include<br />

liver insufficiency, pancreatitis, glomerulonephritis and<br />

catheter-related complications (i.e. thrombosis and<br />

septicemia) [58,59] .<br />

Pharmacological therapy<br />

The pharmacological treatment <strong>of</strong> CIPO is aimed at<br />

controlling symptoms and avoiding complications. Co-<br />

www.wjgnet.com

---

2958 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

prescription <strong>of</strong> antiemetics, antisecret<strong>or</strong>y, antispasmodics,<br />

laxatives <strong>or</strong> antidiarrheal and analgesic drugs is <strong>of</strong>ten<br />

necessary. Prokinetics are <strong>of</strong>ten prescribed, with the<br />

intention to improve gastrointestinal motility and to<br />

control visceral sensitivity [2,54] .<br />

Some prokinetics seem to be m<strong>or</strong>e effective than<br />

others: metoclopramide, domperidone, bethanechol<br />

<strong>or</strong> neostigmine are <strong>of</strong>ten used, but with only limited<br />

success, while cisapride, that is currently available only<br />

in some parts <strong>of</strong> the w<strong>or</strong>ld, has been rep<strong>or</strong>ted to exert<br />

positive effects [60,64-67] . Two controlled trials including<br />

CIPO patients described positive effects <strong>of</strong> cisapride<br />

in accelerating gastric emptying [60] and improving<br />

symptoms [66] . Erythromycin is a macrolide antibiotic<br />

with a specific agonist action on the motilin recept<strong>or</strong>s<br />

<strong>of</strong> the proximal gastrointestinal tract. It increases antral<br />

contraction and promotes gastric emptying, while its<br />

effects on colonic motility are controversial: at low doses it<br />

stimulates intestinal contractions, but doses n<strong>or</strong>mally used<br />

to enhance gastric emptying decrease motility <strong>of</strong> the small<br />

intestine [61] . Octreotide is a long-acting somatostatin analog<br />

which increases intestinal mot<strong>or</strong> activity and decreases<br />

bacterial overgrowth [62] . Co-prescription <strong>of</strong> erythromycin<br />

and octreotide can be useful to control both the gastric<br />

emptying and the intestinal motility [68] . Anticholinesterase<br />

drugs have been described as effective in autoimmune<br />

gastrointestinal mot<strong>or</strong> dis<strong>or</strong>ders [69] . Tegaserod, a m<strong>or</strong>e<br />

recent 5-HT4 agonist, was also recommended f<strong>or</strong> the<br />

treatment <strong>of</strong> subocclusive episodes in CIPO, but the drug<br />

has been withdrawn from the market [70] . A preliminary<br />

open study describes encouraging results exerted gastric<br />

electrical stimulation on nausea and vomiting in a small<br />

number <strong>of</strong> CIPO patients [71] .<br />

Opioids are required in patients with intractable<br />

pain, but their constipating effect can further deteri<strong>or</strong>ate<br />

digestive functions [72,73] .<br />

Antibiotics are <strong>of</strong>ten useful to contrast bacterial overgrowth.<br />

Po<strong>or</strong>ly abs<strong>or</strong>bable antibiotics such as paramomicine<br />

and rifaximine should be preferred, but alternating<br />

cycles with metronidazole and tetracycline are necessary to<br />

limit resistances [74] .<br />

Steroids <strong>or</strong> other immunosuppressive treatments are<br />

recommended when CIPO is related to an underlying inflammat<strong>or</strong>y<br />

neuropathy. These cases have to be selected<br />

through tissue analysis <strong>or</strong> at least suspected by the identification<br />

<strong>of</strong> circulating anti-neuronal antibodies [6] . Treatment<br />

<strong>of</strong> MNGIE is largely supp<strong>or</strong>tive, being <strong>based</strong> on parenteral<br />

nutrition and/<strong>or</strong> supplementation with coenzyme Q, rib<strong>of</strong>lavin<br />

and other vitamins (vitamin C, vitamin K3, carnitine).<br />

Prompt treatment <strong>of</strong> fever and infections and avoidance<br />

<strong>of</strong> extremes in temperature, over exercise, drugs known to<br />

interfere with mitochondrial functions (phenytoin, chl<strong>or</strong>amphenicol,<br />

tetracycline, macrolides, and aminoglycosides), are<br />

also recommended. Infusion platelets to reduce thymidine<br />

level have been rep<strong>or</strong>ted to exert some positive effect in<br />

preliminary study in MNGIE patients [75] .<br />

Surgical therapy<br />

Even if CIPO patients <strong>of</strong>ten undergo surgical procedures,<br />

this kind <strong>of</strong> approach has only a limited role in the<br />

www.wjgnet.com<br />

management <strong>of</strong> the disease and has to be considered only<br />

in some carefully selected patients. Specifically, since CIPO<br />

generally involves the whole alimentary canal, only rare<br />

cases can benefit from surgical resections. Indeed surgery<br />

can precipitate deteri<strong>or</strong>ation <strong>of</strong> the clinical conditions<br />

and should be perf<strong>or</strong>med only if strictly necessary. Full<br />

thickness biopsies should be obtained whenever possible<br />

f<strong>or</strong> pathological examination as stated above. In particular,<br />

surgery can be considered in patients having what appears<br />

to be localized involvement <strong>of</strong> the gastrointestinal tract,<br />

but CIPO is <strong>of</strong>ten a progressive disease and the benefit is<br />

likely temp<strong>or</strong>ary [41,76] .<br />

Gastrostomies and enterostomies can effectively<br />

decrease retching, vomiting and abdominal distension and<br />

represent a possible option in patients who can be fed by<br />

enteral nutrition. Furtherm<strong>or</strong>e, decompression <strong>of</strong> distended<br />

bowel loops can exert a positive effect on the transp<strong>or</strong>t<br />

capacities <strong>of</strong> the alimentary canal which, in turn, results in<br />

a decreased frequency <strong>of</strong> further hospital admissions and<br />

surgeries.<br />

Small bowel <strong>or</strong>, when needed, multivisceral<br />

transplantation is available only in a few highly specialized<br />

centers. The general outcome <strong>of</strong> this surgical procedure has<br />

markedly improved with the use <strong>of</strong> the immunosuppressive<br />

agent tacrolimus associated with steroid and together<br />

a number <strong>of</strong> induction agents such as alemtuzumab,<br />

antithymocyte globulins and daclizumab [77] . However, the<br />

need f<strong>or</strong> long-term parenteral nutrition, re-laparotomies,<br />

<strong>or</strong>gan rejection and, especially, bacterial infections are<br />

frequent complications and the procedure still have<br />

m<strong>or</strong>tality rates approaching 50% at 5 years. Predict<strong>or</strong>s<br />

<strong>of</strong> post-transplant complications are: concomitant<br />

neuromuscular dis<strong>or</strong>ders <strong>of</strong> the urinary tract, chronic use<br />

<strong>of</strong> opioids and technical problems determined by previous<br />

multiple laparotomies and/<strong>or</strong> the need <strong>of</strong> gastrectomy<br />

f<strong>or</strong> gastroparesis. Nonetheless, transplantation should be<br />

considered when all other therapeutic options have failed<br />

acc<strong>or</strong>ding to the following indications: chronic intestinal<br />

failure with a high risk <strong>of</strong> m<strong>or</strong>tality, life-threatening<br />

complications <strong>of</strong> parenteral nutrition, lack <strong>of</strong> venous access,<br />

disease-related po<strong>or</strong> quality <strong>of</strong> life despite optimal parenteral<br />

nutrition [58] .<br />

CONCLUSION<br />

CIPO is a rare and <strong>of</strong>ten misdiagnosed pathological<br />

condition. Even if the acute phases can be hardly<br />

differentiated by mechanical occlusions and the inter-crisis<br />

digestive symptoms can mimic other severe functional<br />

digestive syndromes, the syndrome should be recognized<br />

<strong>based</strong> on the typical combination <strong>of</strong> clinical features, natural<br />

course and radiological signs. The diagnostic suspicion<br />

should be then confirmed by m<strong>or</strong>e accurate examinations,<br />

in <strong>or</strong>der to identify possible causes <strong>of</strong> secondary f<strong>or</strong>ms and<br />

underlying pathophysiological mechanisms.<br />

Management <strong>of</strong> CIPO remains extremely challenging<br />

and <strong>of</strong>ten disappointing.<br />

A greater awareness <strong>of</strong> the clinical features <strong>of</strong> CIPO<br />

would help to limit surgical procedures to a minimum and,<br />

even m<strong>or</strong>e imp<strong>or</strong>tantly, to collect full-thickness biopsies

---

Antonucci A et al. Pseudo-obstruction 2959<br />

f<strong>or</strong> analysis <strong>of</strong> the gut neuromuscular layer at an early and<br />

potentially curable stage <strong>of</strong> the disease.<br />

REFERENCES<br />

1 Stanghellini V, Camilleri M, Malagelada JR. Chronic<br />

idiopathic intestinal pseudo-obstruction: clinical and intestinal<br />

manometric findings. Gut 1987; 28: 5-12<br />

2 Stanghellini V, Cogliandro RF, De Gi<strong>or</strong>gio R, Barbara G,<br />

M<strong>or</strong>selli-Labate AM, Cogliandro L, C<strong>or</strong>inaldesi R. Natural<br />

hist<strong>or</strong>y <strong>of</strong> chronic idiopathic intestinal pseudo-obstruction in<br />

adults: a single center study. Clin Gastroenterol Hepatol 2005; 3:<br />

449-458<br />

3 Cogliandro RF, De Gi<strong>or</strong>gio R, Barbara G, Cogliandro L,<br />

Conc<strong>or</strong>dia A, C<strong>or</strong>inaldesi R, Stanghellini V. Chronic intestinal<br />

pseudo-obstruction. Best Pract Res Clin Gastroenterol 2007; 21:<br />

657-669<br />

4 Stanghellini V, Cogliandro RF, de Gi<strong>or</strong>gio R, Barbara<br />

G, Salvioli B, C<strong>or</strong>inaldesi R. Chronic intestinal pseudoobstruction:<br />

manifestations, natural hist<strong>or</strong>y and management.<br />

Neurogastroenterol Motil 2007; 19: 440-452<br />

5 Di L<strong>or</strong>enzo C. Pseudo-obstruction: current approaches.<br />

Gastroenterology 1999; 116: 980-987<br />

6 De Gi<strong>or</strong>gio R, Camilleri M. Human enteric neuropathies:<br />

m<strong>or</strong>phology and molecular pathology. Neurogastroenterol Motil<br />

2004; 16: 515-531<br />

7 De Gi<strong>or</strong>gio R, Sarnelli G, C<strong>or</strong>inaldesi R, Stanghellini V.<br />

Advances in our understanding <strong>of</strong> the pathology <strong>of</strong> chronic<br />

intestinal pseudo-obstruction. Gut 2004; 53: 1549-1552<br />

8 De Gi<strong>or</strong>gio R, Seri M, Cogliandro R, Cusano R, Fava M, Caroli<br />

F, Panetta D, F<strong>or</strong>abosco P, Barbara G, Ravazzolo R, Ceccherini<br />

I, C<strong>or</strong>inaldesi R, Stanghellini V. Analysis <strong>of</strong> candidate genes<br />

f<strong>or</strong> intrinsic neuropathy in a family with chronic idiopathic<br />

intestinal pseudo-obstruction. Clin Genet 2001; 59: 131-133<br />

9 Deglincerti A, De Gi<strong>or</strong>gio R, Cefle K, Devoto M, Pippucci T,<br />

Castegnaro G, Panza E, Barbara G, Cogliandro RF, Mungan<br />

Z, Palanduz S, C<strong>or</strong>inaldesi R, Romeo G, Seri M, Stanghellini<br />

V. A novel locus f<strong>or</strong> syndromic chronic idiopathic intestinal<br />

pseudo-obstruction maps to chromosome 8q23-q24. Eur J Hum<br />

Genet 2007; 15: 889-897<br />

10 Gargiulo A, Auricchio R, Barone MV, Cotugno G, Reardon<br />

W, Milla PJ, Ballabio A, Ciccodicola A, Auricchio A. Filamin<br />

A is mutated in X-linked chronic idiopathic intestinal pseudoobstruction<br />

with central nervous system involvement. Am J<br />

Hum Genet 2007; 80: 751-758<br />

11 Finsterer J. Mitochondriopathies. Eur J Neurol 2004; 11: 163-186<br />

12 Hirano M, Silvestri G, Blake DM, Lombes A, Minetti C, Bonilla<br />

E, Hays AP, Lovelace RE, Butler I, Bert<strong>or</strong>ini TE. Mitochondrial<br />

neurogastrointestinal encephalomyopathy (MNGIE): clinical,<br />

biochemical, and genetic features <strong>of</strong> an autosomal recessive<br />

mitochondrial dis<strong>or</strong>der. Neurology 1994; 44: 721-727<br />

13 Nishino I, Spinazzola A, Papadimitriou A, Hammans S, Steiner<br />

I, Hahn CD, Connolly AM, Verloes A, Guimaraes J, Maillard I,<br />

Hamano H, Donati MA, Semrad CE, Russell JA, Andreu AL,<br />

Hadjige<strong>or</strong>giou GM, Vu TH, Tadesse S, Nygaard TG, Nonaka<br />

I, Hirano I, Bonilla E, Rowland LP, DiMauro S, Hirano M.<br />

Mitochondrial neurogastrointestinal encephalomyopathy: an<br />

autosomal recessive dis<strong>or</strong>der due to thymidine phosph<strong>or</strong>ylase<br />

mutations. Ann Neurol 2000; 47: 792-800<br />

14 Gillis L, Kaye E. Diagnosis and management <strong>of</strong> mitochondrial<br />

diseases. Pediatr Clin N<strong>or</strong>th Am 2002; 49: 203-219<br />

15 Marti R, Spinazzola A, Tadesse S, Nishino I, Nishigaki<br />

Y, Hirano M. Definitive diagnosis <strong>of</strong> mitochondrial<br />

neurogastrointestinal encephalomyopathy by biochemical<br />

assays. Clin Chem 2004; 50: 120-124<br />

16 Spinazzola A, Marti R, Nishino I, Andreu AL, Naini A,<br />

Tadesse S, Pela I, Zammarchi E, Donati MA, Oliver JA, Hirano<br />

M. Altered thymidine metabolism due to defects <strong>of</strong> thymidine<br />

phosph<strong>or</strong>ylase. J Biol Chem 2002; 277: 4128-4133<br />

17 Valentino ML, Marti R, Tadesse S, Lopez LC, Manes JL, Lyzak<br />

J, Hahn A, Carelli V, Hirano M. Thymidine and deoxyuridine<br />

accumulate in tissues <strong>of</strong> patients with mitochondrial<br />

neurogastrointestinal encephalomyopathy (MNGIE). FEBS<br />

Lett 2007; 581: 3410-3414<br />

18 Nishigaki Y, Marti R, Hirano M. ND5 is a hot-spot f<strong>or</strong> multiple<br />

atypical mitochondrial DNA deletions in mitochondrial<br />

neurogastrointestinal encephalomyopathy. Hum Mol Genet<br />

2004; 13: 91-101<br />

19 King PH, Redden D, Palmgren JS, Nab<strong>or</strong>s LB, Lennon<br />

VA. Hu antigen specificities <strong>of</strong> ANNA-I autoantibodies in<br />

paraneoplastic neurological disease. J Autoimmun 1999; 13:<br />

435-443<br />

20 Krishnamurthy S, Schuffler MD. Pathology <strong>of</strong> neuromuscular<br />

dis<strong>or</strong>ders <strong>of</strong> the small intestine and colon. Gastroenterology<br />

1987; 93: 610-639<br />

21 De Gi<strong>or</strong>gio R, Guerrini S, Barbara G, Cremon C, Stanghellini V,<br />

C<strong>or</strong>inaldesi R. New insights into human enteric neuropathies.<br />

Neurogastroenterol Motil 2004; 16 Suppl 1: 143-147<br />

22 Caras SD, McCallum HR, Brashear HR, Smith TK. The<br />

effect <strong>of</strong> human antineuronal antibodies on the ascending<br />

excitat<strong>or</strong>y reflex and peristalsis in isolated guinea pig ileum:<br />

“Is the paraneoplastc syndrome a mot<strong>or</strong> neuron dis<strong>or</strong>der?”.<br />

Gastroenterology 1996; 110: A643<br />

23 Talamonti L, Li Q, Beyak M, Trevisani M, Michel K, Campi B,<br />

Barbara G, Stanghellini V, C<strong>or</strong>inaldesi R, Geppetti P, Grundy D,<br />

Schemann M, De Gi<strong>or</strong>gio R. Sens<strong>or</strong>y. mot<strong>or</strong> abn<strong>or</strong>malities in<br />

severe gut dysmotility: role <strong>of</strong> anti-HuD neuronal antibodies.<br />

Neurogastroenterol Motil 2006; 18: 669<br />

24 De Gi<strong>or</strong>gio R, Bovara M, Barbara G, Canossa M, Sarnelli G,<br />

De Ponti F, Stanghellini V, Tonini M, Cappello S, Pagnotta E,<br />

Nobile-Orazio E, C<strong>or</strong>inaldesi R. Anti-HuD-induced neuronal<br />

apoptosis underlying paraneoplastic gut dysmotility.<br />

Gastroenterology 2003; 125: 70-79<br />

25 Debinski HS, Kamm MA, Talbot IC, Khan G, Kangro HO,<br />

Jeffries DJ. DNA viruses in the pathogenesis <strong>of</strong> sp<strong>or</strong>adic<br />

chronic idiopathic intestinal pseudo-obstruction. Gut 1997; 41:<br />

100-106<br />

26 Schappi MG, Smith VV, Milla PJ, Lindley KJ. Eosinophilic<br />

myenteric ganglionitis is associated with functional intestinal<br />

obstruction. Gut 2003; 52: 752-755<br />

27 Accarino A, Colucci R, Barbara G, Malagelada C, G<strong>or</strong>i A,<br />

Vera G, Cogliandro RF, Ghisu N, Bernardini N, Blandizzi<br />

C, Stanghellini V, C<strong>or</strong>inaldesi R, Azpiroz F, Del Tacca M,<br />

Malagelada JR, De Gi<strong>or</strong>gio R. Mast cell neuromuscular<br />

involvement in patients with severe gastrointestinal motility<br />

dis<strong>or</strong>ders. Gut 2007; 39: A18<br />

28 Hall KE, Wiley JW. Neural injury, repair and adaptation in<br />

the GI tract. I. New insights into neuronal injury: a cautionary<br />

tale. Am J Physiol 1998; 274: G978-G983<br />

29 Hockenbery D, Nunez G, Milliman C, Schreiber RD,<br />

K<strong>or</strong>smeyer SJ. Bcl-2 is an inner mitochondrial membrane<br />

protein that blocks programmed cell death. Nature 1990; 348:<br />

334-336<br />

30 De Gi<strong>or</strong>gio R, Barbara G, Stanghellini V, De Ponti F, Guerrini S,<br />

Cogliandro L, Ceccarelli C, Salvioli B, Adamo C, Cogliandro R,<br />

Tonini M, C<strong>or</strong>inaldesi R. Reduced bcl-2 expression in<br />

the enteric nervous system (ENS) as a marker f<strong>or</strong> neural<br />

degeneration in patients with gastrointestinal mot<strong>or</strong> dis<strong>or</strong>ders<br />

(GIMD). Gastroenterology 2000; 118: A867<br />

31 Sarnelli G, Stanghellini V, Barbara G, Pasquinelli G, Di<br />

Nardo G, Cremon C, Cogliandro RF, Salvioli B, G<strong>or</strong>i A,<br />

Cuomo R, C<strong>or</strong>inaldesi R, De Gi<strong>or</strong>gio R. Reduced Bcl-2<br />

expression and increased myenteric neuron apoptosis in<br />

patients with idiopathic enteric neuropathy. Gastroenterology<br />

2005; 128: A23<br />

32 Ruhl A. Glial cells in the gut. Neurogastroenterol Motil 2005; 17:<br />

777-790<br />

33 Boeckxstaens GE, Rumessen JJ, de Wit L, Tytgat GN,<br />

Vanderwinden JM. Abn<strong>or</strong>mal distribution <strong>of</strong> the interstitial<br />

cells <strong>of</strong> cajal in an adult patient with pseudo-obstruction and<br />

megaduodenum. Am J Gastroenterol 2002; 97: 2120-2126<br />

34 Isozaki K, Hirota S, Miyagawa J, Taniguchi M, Shinomura<br />

Y, Matsuzawa Y. Deficiency <strong>of</strong> c-kit+ cells in patients with<br />

www.wjgnet.com

---

2960 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

a myopathic f<strong>or</strong>m <strong>of</strong> chronic idiopathic intestinal pseudoobstruction.<br />

Am J Gastroenterol 1997; 92: 332-334<br />

35 Huizinga JD, Thuneberg L, Vanderwinden JM, Rumessen<br />

JJ. Interstitial cells <strong>of</strong> Cajal as targets f<strong>or</strong> pharmacological<br />

intervention in gastrointestinal mot<strong>or</strong> dis<strong>or</strong>ders. Trends<br />

Pharmacol Sci 1997; 18: 393-403<br />

36 Feldstein AE, Miller SM, El-Youssef M, Rodeberg D, Lind<strong>or</strong><br />

NM, Burgart LJ, Szurszewski JH, Farrugia G. Chronic<br />

intestinal pseudoobstruction associated with altered interstitial<br />

cells <strong>of</strong> cajal netw<strong>or</strong>ks. J Pediatr Gastroenterol Nutr 2003; 36:<br />

492-497<br />

37 S a n d e r s K M , O r d o g T , W a r d S M . P h y s i o l o g y a n d<br />

pathophysiology <strong>of</strong> the interstitial cells <strong>of</strong> Cajal: from bench<br />

to bedside. IV. Genetic and animal models <strong>of</strong> GI motility<br />

dis<strong>or</strong>ders caused by loss <strong>of</strong> interstitial cells <strong>of</strong> Cajal. Am J<br />

Physiol Gastrointest Liver Physiol 2002; 282: G747-G756<br />

38 De Gi<strong>or</strong>gio R, Guerrini S, Barbara G, Stanghellini V, De<br />

Ponti F, C<strong>or</strong>inaldesi R, Moses PL, Sharkey KA, Mawe GM.<br />

Inflammat<strong>or</strong>y neuropathies <strong>of</strong> the enteric nervous system.<br />

Gastroenterology 2004; 126: 1872-1883<br />

39 Smith VV, Gregson N, Foggensteiner L, Neale G, Milla<br />

PJ. Acquired intestinal aganglionosis and circulating<br />

autoantibodies without neoplasia <strong>or</strong> other neural involvement.<br />

Gastroenterology 1997; 112: 1366-1371<br />

40 Knowles CH, Silk DB, Darzi A, Veress B, Feakins R, Raimundo<br />

AH, Crompton T, Browning EC, Lindberg G, Martin JE.<br />

Deranged smooth muscle alpha-actin as a biomarker <strong>of</strong><br />

intestinal pseudo-obstruction: a controlled multinational case<br />

series. Gut 2004; 53: 1583-1589<br />

41 Murr MM, Sarr MG, Camilleri M. The surgeon‘s role in<br />

the treatment <strong>of</strong> chronic intestinal pseudoobstruction. Am J<br />

Gastroenterol 1995; 90: 2147-2151<br />

42 Cogliandro R, Stanghellini V, Cogliandro L, Guidi M, Bini L,<br />

Barbara G, De Gi<strong>or</strong>gio R, M<strong>or</strong>selli Labate AM, C<strong>or</strong>inaldesi R.<br />

Small Bowel manometric findings in different f<strong>or</strong>ms <strong>of</strong> severe<br />

digestive syndromes. Neurogastroenterol Motil 2004; 16: A838<br />

43 Malagelada JR, Stanghellini V. Manometric evaluation <strong>of</strong><br />

functional upper gut symptoms. Gastroenterology 1985; 88:<br />

1223-1231<br />

44 Attar A, Kuoch V, Ducreux M, Benamouzig R, Malka D.<br />

Simultaneous decompression colonoscopy and radiologic<br />

G-tube insertion in a patient with megacolon because <strong>of</strong><br />

chronic colonic pseudo-obstruction. Gastrointest Endosc 2005;<br />

62: 975-976; discussion 976<br />

45 Kellow JE. Small intestine: n<strong>or</strong>mal function and clinical<br />

dis<strong>or</strong>ders. Manometry. In: Schuster MM, Crowell MD, Koch<br />

KL, edit<strong>or</strong>s. Schuster atlas <strong>of</strong> gastrointestinal motility in health<br />

and disease. Hamilton-London: BC Decker, 2002: 219-236<br />

46 Hyman PE, McDiarmid SV, Napolitano J, Abrams CE,<br />

Tomomasa T. Antroduodenal motility in children with chronic<br />

intestinal pseudo-obstruction. J Pediatr 1988; 112: 899-905<br />

47 Boige N, Faure C, Cargill G, Mashako LM, C<strong>or</strong>deiro-Ferreira<br />

G, Viarme F, Cezard JP, Navarro J. Manometrical evaluation<br />

in visceral neuropathies in children. J Pediatr Gastroenterol Nutr<br />

1994; 19: 71-77<br />

48 Cucchiara S, Annese V, Minella R, Franco MT, Iervolino C,<br />

Emiliano M, Auricchio S. Antroduodenojejunal manometry in<br />

the diagnosis <strong>of</strong> chronic idiopathic intestinal pseudoobstruction<br />

in children. J Pediatr Gastroenterol Nutr 1994; 18: 294-305<br />

49 Camilleri M. Jejunal manometry in distal subacute mechanical<br />

obstruction: significance <strong>of</strong> prolonged simultaneous<br />

contractions. Gut 1989; 30: 468-475<br />

50 Fell JM, Smith VV, Milla PJ. Infantile chronic idiopathic<br />

intestinal pseudo-obstruction: the role <strong>of</strong> small intestinal<br />

manometry as a diagnostic tool and prognostic indicat<strong>or</strong>. Gut<br />

1996; 39: 306-311<br />

51 Heneyke S, Smith VV, Spitz L, Milla PJ. Chronic intestinal<br />

pseudo-obstruction: treatment and long term follow up <strong>of</strong> 44<br />

patients. Arch Dis Child 1999; 81: 21-27<br />

52 Mousa H, Hyman PE, Cocjin J, Fl<strong>or</strong>es AF, Di L<strong>or</strong>enzo C. Longterm<br />

outcome <strong>of</strong> congenital intestinal pseudoobstruction. Dig<br />

Dis Sci 2002; 47: 2298-2305<br />

www.wjgnet.com<br />

53 Faure C, Goulet O, Ategbo S, Breton A, Tounian P, Ginies<br />

JL, Roquelaure B, Despres C, Scaillon M, Maurage C, Paquot<br />

I, Hermier M, De Napoli S, Dabadie A, Huet F, Baudon JJ,<br />

Larchet M. Chronic intestinal pseudoobstruction syndrome:<br />

clinical analysis, outcome, and prognosis in 105 children.<br />

French-Speaking Group <strong>of</strong> Pediatric Gastroenterology. Dig Dis<br />

Sci 1999; 44: 953-959<br />

54 Mann SD, Debinski HS, Kamm MA. Clinical characteristics <strong>of</strong><br />

chronic idiopathic intestinal pseudo-obstruction in adults. Gut<br />

1997; 41: 675-681<br />

55 Hyman PE, Di L<strong>or</strong>enzo C, McAdams L, Fl<strong>or</strong>es AF, Tomomasa<br />

T, Garvey TQ 3rd. Predicting the clinical response to cisapride<br />

in children with chronic intestinal pseudo-obstruction. Am J<br />

Gastroenterol 1993; 88: 832-836<br />

56 Di L<strong>or</strong>enzo C, Fl<strong>or</strong>es AF, Buie T, Hyman PE. Intestinal<br />

motility and jejunal feeding in children with chronic intestinal<br />

pseudo-obstruction. Gastroenterology 1995; 108: 1379-1385<br />

57 Stanghellini V, C<strong>or</strong>inaldesi R, Ghidini C, Ricci Maccarini<br />

M, De Gi<strong>or</strong>gio R, Biasco G, Brillanti S, Paparo GF, Barbara L.<br />

Reversibility <strong>of</strong> gastrointestinal mot<strong>or</strong> abn<strong>or</strong>malities in chronic<br />

intestinal pseudo-obstruction. Hepatogastroenterology 1992; 39:<br />

34-38<br />

58 Pironi L, Spinucci G, Paganelli F, Merli C, Masetti M, Miglioli<br />

M, Pinna AD. Italian guidelines f<strong>or</strong> intestinal transplantation:<br />

potential candidates among the adult patients managed by a<br />

medical referral center f<strong>or</strong> chronic intestinal failure. Transplant<br />

Proc 2004; 36: 659-661<br />

59 Guglielmi FW, Boggio-Bertinet D, Federico A, F<strong>or</strong>te GB,<br />

Guglielmi A, Loguercio C, Mazzuoli S, Merli M, Palmo A,<br />

Panella C, Pironi L, Francavilla A. Total parenteral nutritionrelated<br />

gastroenterological complications. Dig Liver Dis 2006;<br />

38: 623-642<br />

60 Camilleri M, Malagelada JR, Abell TL, Brown ML, Hench<br />

V, Zinsmeister AR. Effect <strong>of</strong> six weeks <strong>of</strong> treatment with<br />

cisapride in gastroparesis and intestinal pseudoobstruction.<br />

Gastroenterology 1989; 96: 704-712<br />

61 Emmanuel AV, Shand AG, Kamm MA. Erythromycin f<strong>or</strong> the<br />

treatment <strong>of</strong> chronic intestinal pseudo-obstruction: description<br />

<strong>of</strong> six cases with a positive response. Aliment Pharmacol Ther<br />

2004; 19: 687-694<br />

62 Soudah HC, Hasler WL, Owyang C. Effect <strong>of</strong> octreotide on<br />

intestinal motility and bacterial overgrowth in scleroderma. N<br />

Engl J Med 1991; 325: 1461-1467<br />

63 De Gi<strong>or</strong>gio R, Barbara G, Stanghellini V, Tonini M, Vasina<br />

V, Cola B, C<strong>or</strong>inaldesi R, Biagi G, De Ponti F. Review article:<br />

the pharmacological treatment <strong>of</strong> acute colonic pseudoobstruction.<br />

Aliment Pharmacol Ther 2001; 15: 1717-1727<br />

64 Di L<strong>or</strong>enzo C, Reddy SN, Villanueva-Meyer J, Mena I, Martin<br />

S, Hyman PE. Cisapride in children with chronic intestinal<br />

pseudoobstruction. An acute, double-blind, crossover, placebocontrolled<br />

trial. Gastroenterology 1991; 101: 1564-1570<br />

65 Camilleri M, Balm RK, Zinsmeister AR. Determinants <strong>of</strong><br />

response to a prokinetic agent in neuropathic chronic intestinal<br />

motility dis<strong>or</strong>der. Gastroenterology 1994; 106: 916-923<br />

66 Camilleri M, Balm RK, Zinsmeister AR. Symptomatic<br />

improvement with one-year cisapride treatment in neuropathic<br />

chronic intestinal dysmotility. Aliment Pharmacol Ther 1996; 10:<br />

403-409<br />

67 Cogliandro R, Stanghellini V, Cogliandro L, Tosetti C, Salvioli<br />

B, Zamboni PF, Barbara G, De Gi<strong>or</strong>gio R, C<strong>or</strong>inaldesi R.<br />

Symptomatic response to sh<strong>or</strong>t-term treatment with cisapride<br />

but not small bowel manometry predicts a positive outcome<br />

in adult patients with chronic idiopathic intestinal pseudoobstruction<br />

(CIIP). Gastroenterology 1999; 116: A1087<br />

68 Verne GN, Eaker EY, Hardy E, Sninsky CA. Effect <strong>of</strong><br />

octreotide and erythromycin on idiopathic and sclerodermaassociated<br />

intestinal pseudoobstruction. Dig Dis Sci 1995; 40:<br />

1892-1901<br />

69 Pasha SF, Lunsf<strong>or</strong>d TN, Lennon VA. Autoimmune<br />

gastrointestinal dysmotility treated successfully with<br />

pyridostigmine. Gastroenterology 2006; 131: 1592-1596<br />

70 Lyf<strong>or</strong>d G, Foxx-Orenstein A. Chronic Intestinal Pseudoo-

---

Antonucci A et al. Pseudo-obstruction 2961<br />

bstruction. Curr Treat Options Gastroenterol 2004; 7: 317-325<br />

71 Andersson S, Lonroth H, Simren M, Ringstrom G, Elfvin A,<br />

Abrahamsson H. Gastric electrical stimulation f<strong>or</strong> intractable<br />

vomiting in patients with chronic intestinal pseudoobstruction.<br />

Neurogastroenterol Motil 2006; 18: 823-830<br />

72 Zimmerman DM, Gidda JS, Cantrell BE, Schoepp DD,<br />

Johnson BG, Leander JD. Discovery <strong>of</strong> a potent, peripherally<br />

selective trans-3,4-dimethyl-4-(3-hydroxyphenyl)piperidine<br />

opioid antagonist f<strong>or</strong> the treatment <strong>of</strong> gastrointestinal motility<br />

dis<strong>or</strong>ders. J Med Chem 1994; 37: 2262-2265<br />

73 Wolff BG, Michelassi F, Gerkin TM, Techner L, Gabriel K,<br />

Du W, Wallin BA. Alvimopan, a novel, peripherally acting<br />

mu opioid antagonist: results <strong>of</strong> a multicenter, randomized,<br />

double-blind, placebo-controlled, phase III trial <strong>of</strong> maj<strong>or</strong><br />

abdominal surgery and postoperative ileus. Ann Surg 2004;<br />

240: 728-734; discussion 734-735<br />

74 Barbara G, Stanghellini V, Brandi G, Cremon C, Di Nardo G,<br />

De Gi<strong>or</strong>gio R, C<strong>or</strong>inaldesi R. Interactions between commensal<br />

bacteria and gut sens<strong>or</strong>imot<strong>or</strong> function in health and disease.<br />

Am J Gastroenterol 2005; 100: 2560-2568<br />

75 Lara MC, Weiss B, Illa I, Madoz P, Massuet L, Andreu AL,<br />

Valentino ML, Anikster Y, Hirano M, Marti R. Infusion <strong>of</strong><br />

platelets transiently reduces nucleoside overload in MNGIE.<br />

Neurology 2006; 67: 1461-1463<br />

76 Kim HY, Kim JH, Jung SE, Lee SC, Park KW, Kim WK.<br />

Surgical treatment and prognosis <strong>of</strong> chronic intestinal pseudoobstruction<br />

in children. J Pediatr Surg 2005; 40: 1753-1759<br />

77 Masetti M, Di Benedetto F, Cautero N, Stanghellini V, De<br />

Gi<strong>or</strong>gio R, Lauro A, Begliomini B, Siniscalchi A, Pironi L,<br />

Cogliandro R, Pinna AD. Intestinal transplantation f<strong>or</strong> chronic<br />

intestinal pseudo-obstruction in adult patients. Am J Transplant<br />

2004; 4: 826-829<br />

S- Edit<strong>or</strong> Li DL L- Edit<strong>or</strong> Rippe RA E- Edit<strong>or</strong> Ma WH<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 2962-2967<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

EDITORIAL<br />

Endoscopic submucosal dissection f<strong>or</strong> gastrointestinal<br />

neoplasms<br />

Naomi Kakushima, Mitsuhiro Fujishiro<br />

Naomi Kakushima, Mitsuhiro Fujishiro, Department <strong>of</strong><br />

Gastroenterology, The University <strong>of</strong> Tokyo, Graduate School <strong>of</strong><br />

Medicine, Tokyo 113-8655, Japan<br />

Auth<strong>or</strong> contributions: Kakushima N and Fujishiro M contributed<br />

equally to this w<strong>or</strong>k; Kakushima N and Fujishiro M perfomed<br />

research, and wrote the paper.<br />

C<strong>or</strong>respondence to: Naomi Kakushima, MD, PhD, Department<br />

<strong>of</strong> Gastroenterology, The University <strong>of</strong> Tokyo, Graduate School <strong>of</strong><br />

Medicine, 7-3-1 Hongo, Bunkyoku, Tokyo 113-8655,<br />

Japan. kakushin-tky@umin.ac.jp<br />

Telephone: +81-3-38155411 Fax: +81-3-58008806<br />

Received: February 22, 2008 Revised: March 26, 2008<br />

Abstract<br />

Endoscopic submucosal dissection (ESD) is an advanced<br />

technique <strong>of</strong> therapeutic endoscopy f<strong>or</strong> superficial<br />

gastrointestinal neoplasms. Three steps characterize it:<br />

injecting fluid into the submucosa to elevate the lesion,<br />

cutting the surrounding mucosa <strong>of</strong> the lesion, and<br />

dissecting the submucosa beneath the lesion. The ESD<br />

technique has rapidly permeated in Japan f<strong>or</strong> treatment<br />

<strong>of</strong> early gastric cancer, due to its excellent results <strong>of</strong> enbloc<br />

resection compared to endoscopic mucosal resection<br />

(EMR). Although there is still room f<strong>or</strong> improvement<br />

to lessen its technical difficulty, ESD has recently<br />

been applied to esophageal and col<strong>or</strong>ectal neoplasms.<br />

Fav<strong>or</strong>able sh<strong>or</strong>t-term results have been rep<strong>or</strong>ted, but the<br />

application <strong>of</strong> ESD should be well considered by three<br />

aspects: (1) the possibility <strong>of</strong> nodal metastases <strong>of</strong> the<br />

lesion, (2) technical difficulty such as location, ulceration<br />

and operat<strong>or</strong>’s skill, and (3) <strong>or</strong>gan characteristics.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Endoscopic submucosal dissection;<br />

Gastric cancer; Esophageal cancer; Col<strong>or</strong>ectal cancer;<br />

Endoscopic mucosal resection; Therapeutic endoscopy<br />

Peer reviewers: Zvi Fireman, Pr<strong>of</strong>ess<strong>or</strong>, Department <strong>of</strong><br />

Gastroenterology, Hillel- yaffe Medical Center, Hadera 38100,<br />

Israel; Chee Lim, Dr, Department <strong>of</strong> Gastroenterology, Good<br />

Hope Hospital, Heart <strong>of</strong> England Foundation NHS Trust, W<br />

Midlands B75 7RR, United Kingdom<br />

Kakushima N, Fujishiro M. Endoscopic submucosal dissection<br />

f<strong>or</strong> gastrointestinal neoplasms. W<strong>or</strong>ld J Gastroenterol 2008;<br />

14(19): 2962-2967 Available from: URL: http://www.wjgnet.<br />

com/1007-9327/14/2962.asp DOI: http://dx.doi.<strong>or</strong>g/10.3748/<br />

wjg.14.2962<br />

www.wjgnet.com<br />

INTRODUCTION<br />

Application <strong>of</strong> endoscopic resection (ER) to gastrointestinal<br />

(GI) neoplasms is limited to lesions with no risk <strong>of</strong> nodal<br />

metastasis. Either polypectomy <strong>or</strong> endoscopic mucosal<br />

resection (EMR) is beneficial f<strong>or</strong> patients because <strong>of</strong><br />

its low level <strong>of</strong> invasiveness. However, to ensure the<br />

curative potential <strong>of</strong> these treatment modalities, accurate<br />

histopathologic assessment <strong>of</strong> the resected specimens is<br />

essential because the depth <strong>of</strong> invasion and lymphovascular<br />

infiltration <strong>of</strong> the tum<strong>or</strong> is associated with considerable<br />

risk f<strong>or</strong> lymph node metastasis. F<strong>or</strong> accurate assessment<br />

<strong>of</strong> the appropriateness <strong>of</strong> the therapy, en bloc resection<br />

is m<strong>or</strong>e desirable than piecemeal resection. F<strong>or</strong> a reliable<br />

en bloc resection <strong>of</strong> GI neoplasms, a new method <strong>of</strong> ER<br />

called endoscopic submucosal dissection (ESD) has been<br />

developed. In this article, an outline <strong>of</strong> the current status <strong>of</strong><br />

ESD will be discussed.<br />

DEVELOPMENT OF ESD<br />

The ESD technique has developed from one <strong>of</strong> the<br />

EMR techniques, namely endoscopic resection after local<br />

injection <strong>of</strong> a solution <strong>of</strong> hypertonic saline-epinephrine<br />

(ERHSE) [1] . Initially, the ESD technique was called by<br />

various names such as cutting EMR, exfoliating EMR,<br />

EMR with circumferential incision etc. However, a new<br />

name was proposed to this technique in 2003, as a<br />

treatment positioned between EMR and laparoscopic<br />

surgery, since this technique is innovative and enables<br />

complete resection <strong>of</strong> neoplasms that were impossible to<br />

resect en bloc by EMR.<br />

At present, numerous electrosurgical knives such as<br />

insulation-tipped diathermic knife (IT-knife) [2-6] , needle<br />

knife [7] , hook knife [8] , flex knife [9-11] , triangle-tipped knife [12] ,<br />

flush knife [13] , mucosectomy [14] , splash needle [15] and a<br />

special device called a small-caliber tip transparent (ST)<br />

hood [7] are available f<strong>or</strong> this technique. One <strong>or</strong> two <strong>of</strong><br />

these electrosurgical knives are used in combination with a<br />

high frequency electrosurgical current (HFEC) generat<strong>or</strong><br />

with an automatically controlled system (Endocut mode,<br />

Erbotom ICC200, ICC350, VIO300D, ERBE, Tubingen,<br />

Germany) (PSD-60, Olympus, Tokyo, Japan). New types<br />

<strong>of</strong> endoscopes are available f<strong>or</strong> ESD, such as an endoscope<br />

with a water jet system (EG-2931, Pentax, Tokyo, Japan,<br />

GIF-Q260J, Olympus, Tokyo, Japan), an endoscope with a<br />

multi-bending system (M-scope: XGIF-Q240M, R-scope:<br />

XGIF-2TQ240R, Olympus, Tokyo, Japan) to facilitate the<br />

ESD procedure [16-19] . As another approach to successful

---

Kakushima N et al . ESD f<strong>or</strong> GI neoplasms 2963<br />

ESD, investigations <strong>of</strong> submucosal injection solutions have<br />

been actively done. It was rep<strong>or</strong>ted that a hyaluronic acid<br />

solution makes a better long-lasting submucosal cushion<br />

without tissue damage than other available solutions [7,20-23] .<br />

As a further improvement <strong>of</strong> hyaluronic acid solution,<br />

usefulness <strong>of</strong> a mixture <strong>of</strong> high-molecular-weight hyaluronic<br />

acid, glycerin, and sugar has also been rep<strong>or</strong>ted [24,25] .<br />

ESD is characterized by three steps: injecting fluid into<br />

the submucosa to elevate the lesion from the muscle layer,<br />

circumferential cutting <strong>of</strong> the surrounding mucosa <strong>of</strong> the<br />

lesion, and subsequent dissection <strong>of</strong> the connective tissue<br />

<strong>of</strong> the submucosa beneath the lesion. Maj<strong>or</strong> advantages<br />

<strong>of</strong> this technique in comparison with polypectomy <strong>or</strong><br />

EMR are as follows. The resected size and shape can be<br />

controlled, en bloc resection is possible even in a large<br />

neoplasm, and neoplasms with submucosal fibrosis are<br />

also resectable. So this technique can be applied to the<br />

resection <strong>of</strong> complex neoplasms such as large neoplasms,<br />

ulcerative non-lifting neoplasms, and recurrent neoplasms.<br />

The disadvantages <strong>of</strong> this technique are the requirement<br />

<strong>of</strong> two <strong>or</strong> m<strong>or</strong>e assistants, it is time-consuming, there is<br />

a higher risk <strong>of</strong> bleeding and perf<strong>or</strong>ation than EMR. In<br />

Japan, ESD is now gaining acceptance as the standard<br />

endoscopic resection technique f<strong>or</strong> stomach neoplasms in<br />

an early stage, especially f<strong>or</strong> large <strong>or</strong> ulcerative neoplasms.<br />

Recently, the ESD technique is applied to esophageal <strong>or</strong><br />

col<strong>or</strong>ectal neoplasms in some institutions, although it<br />

is still controversial considering the technical difficulty,<br />

associated risks, and fav<strong>or</strong>able outcomes by EMR.<br />

INDICATION FOR ENDOSCOPIC<br />

RESECTION<br />

Gastric cancer<br />

Early gastric cancer (EGC) is defined to a mucosal <strong>or</strong><br />

submucosal invasive cancer (T1 cancer) irrespective <strong>of</strong><br />

the presence <strong>of</strong> lymph node metastasis. Lesions indicated<br />

f<strong>or</strong> ER should be EGC with no risk <strong>of</strong> nodal metastasis<br />

and that can be resected in a single fragment. Using a<br />

large database <strong>of</strong> m<strong>or</strong>e than 5000 EGC patients who<br />

underwent gastrectomy with D2 lymph node dissection,<br />

a criteria <strong>of</strong> node negative cancer has been defined [26] . At<br />

present, lesions with preoperative endoscopic diagnosis<br />

<strong>of</strong> differentiated type intramucosal cancer without<br />

ulcer findings, differentiated type intramucosal cancer<br />

no larger than 3 cm in diameter with ulcer findings,<br />

differentiated type minute invasive submucosal (less than<br />

500 micrometers below muscularis mucosa) cancer no<br />

larger than 3 cm in diameter are considered as expanding<br />

indication f<strong>or</strong> ER [27] . Undifferentiated type cancer lesions,<br />

and preoperative diagnosis <strong>of</strong> ulcerative findings is<br />

difficult, so that ER f<strong>or</strong> these lesions should be carefully<br />

considered.<br />

Esophageal cancer<br />

Early esophageal cancer (EEC) involving the epithelium<br />

(m1: carcinoma in situ) <strong>or</strong> the lamina propria (m2) are<br />

candidates f<strong>or</strong> ER because no lymph node metastasis have<br />

been rep<strong>or</strong>ted in cancers limited to these two layers [28] .<br />

F<strong>or</strong> EEC invading the muscularis mucosa (m3), the lymph<br />

node metastasis rate is rep<strong>or</strong>ted as 9%, and f<strong>or</strong> cancer<br />

with minute submucosal invasion (< 200 micrometers<br />

below the muscularis mucosa; sm1) the rate is 19% [29] .<br />

The lymph node metastasis rate <strong>of</strong> m3 <strong>or</strong> sm1 cancer<br />

without lymphovascular infiltration <strong>of</strong> the tum<strong>or</strong> is<br />

rep<strong>or</strong>ted as 4.7% [29] . Theref<strong>or</strong>e, f<strong>or</strong> patients unwilling f<strong>or</strong><br />

esophagectomy <strong>or</strong> patients with com<strong>or</strong>bid diseases not<br />

suited f<strong>or</strong> surgery, ER may be a relative indication f<strong>or</strong> m3<br />

<strong>or</strong> sm1 cancer. Also, f<strong>or</strong> lesions spreading m<strong>or</strong>e than threequarter<br />

<strong>of</strong> circumference <strong>of</strong> the esophagus are considered<br />

as relative indication f<strong>or</strong> ER because post-operative<br />

stricture occurs in a high rate.<br />

Col<strong>or</strong>ectal cancer<br />

Early col<strong>or</strong>ectal cancer (ECC) limited to the mucosa <strong>or</strong> with<br />

slight submucosal invasion (< 1000 micrometers below the<br />

muscularis mucosa; sm1) are candidates f<strong>or</strong> ER [30] . However,<br />

even f<strong>or</strong> lesions that meet the criteria above, laparoscopic<br />

<strong>or</strong> open surgery may be selected in some institutions<br />

considering the location and size <strong>of</strong> the lesion. In<br />

institutions actively perf<strong>or</strong>ming ESD f<strong>or</strong> col<strong>or</strong>ectal lesions,<br />

depressed lesions and laterally spreading tum<strong>or</strong>s <strong>of</strong> nongranular<br />

type (LST-NG) are considered as good candidates<br />

f<strong>or</strong> ESD because these lesions have a high possibility <strong>of</strong><br />

submucosal invasion which may be difficult to diagnose<br />

preoperatively, and a th<strong>or</strong>ough histopathological assessment<br />

<strong>of</strong> the resected specimen is essential.<br />

Preoperative evaluation f<strong>or</strong> candidates <strong>of</strong> ER<br />

Endoscopy with chromoendoscopy is essential to define<br />

the lesion. To evaluate the depth <strong>of</strong> the lesion, size, redness,<br />

presence <strong>or</strong> absence <strong>of</strong> ulceration, superficial structure<br />

<strong>of</strong> the lesion, and def<strong>or</strong>mity <strong>of</strong> the wall <strong>of</strong> the <strong>or</strong>gan in<br />

compliance with air-flow rate are carefully observed by<br />

endoscopy and chromoendoscopy. Magnification endoscopy<br />

with narrow band imaging technique (NBI) has been<br />

rep<strong>or</strong>ted as a promising new modality to evaluate the depth<br />

<strong>of</strong> EEC. Magnification endoscopy with NBI is also useful<br />

to distinguish the b<strong>or</strong>der <strong>of</strong> EGC in case <strong>of</strong> lack <strong>of</strong> utility<br />

<strong>of</strong> chromoendoscopy with indigocarmine. Magnification<br />

endoscopy with crystal violet staining <strong>or</strong> NBI is useful in<br />

estimating the depth <strong>of</strong> col<strong>or</strong>ectal lesions. Endoscopic<br />

ultrasonography is <strong>of</strong>ten perf<strong>or</strong>med to evaluate the depth<br />

<strong>of</strong> invasion, and computed tomography may be perf<strong>or</strong>med<br />

to detect lymph node metastasis if any, if the diagnosis <strong>of</strong><br />

node negative cancer is difficult to judge even with multiple<br />

diagnostic modalities.<br />

Pathological evaluation <strong>of</strong> the removed specimen<br />

Whether a lesion may be included into the criteria <strong>of</strong><br />

node-negative neoplasms is considered bef<strong>or</strong>e treatment.<br />

However, at present, it is impossible to make a definite<br />

diagnosis <strong>of</strong> a neoplasm regarding depth, histological<br />

type and lymphatic vessel invasion bef<strong>or</strong>e treatment. It is<br />

<strong>of</strong>ten experienced that although a biopsy specimen shows<br />

adenoma/dysplasia <strong>of</strong> a lesion, a diagnosis <strong>of</strong> cancer<br />

is made after total resection <strong>of</strong> the lesion. Theref<strong>or</strong>e, a<br />

precise pathological evaluation <strong>of</strong> the resected specimen is<br />

essential, and an en bloc resection <strong>of</strong> the lesion is desirable<br />

in this respect.<br />

www.wjgnet.com

---

2964 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

After removal, the specimen should be <strong>or</strong>iented<br />

immediately bef<strong>or</strong>e it is immersed in f<strong>or</strong>malin. Orientation<br />

<strong>of</strong> the specimen is accomplished by fixing the periphery<br />

with thin needles on a plate <strong>of</strong> rubber <strong>or</strong> wood. The<br />

submucosal side <strong>of</strong> the specimen is faced to the plate.<br />

After fixation, the specimen is sectioned serially at 2 mm<br />

intervals parallel to a line that includes the closest part<br />

between the margin <strong>of</strong> the specimen and <strong>of</strong> the neoplasm,<br />

so that both lateral and vertical margins are assessed. The<br />

depth <strong>of</strong> invasion is then evaluated microscopically along<br />

with the degree <strong>of</strong> differentiation and lymphovascular<br />

infiltration, if any.<br />

In result <strong>of</strong> th<strong>or</strong>ough pathological assessment, if<br />

the lesion is resected en bloc with negative margins<br />

<strong>of</strong> neoplasm and fulfills the criteria <strong>of</strong> node-negative<br />

neoplasms with no lymphovascular infiltration, the<br />

treatment is judged as curative resection. F<strong>or</strong> lesions with<br />

piecemeal resection but being judged as node-negative<br />

neoplasms, <strong>or</strong> lesions with histologically non-evaluable<br />

areas due to artifact <strong>or</strong> tissue burning, a periodical<br />

endoscopic follow-up should be perf<strong>or</strong>med to detect<br />

residual neoplasm <strong>or</strong> local recurrence. On the other hand,<br />

f<strong>or</strong> lesions that do not fulfill the criteria <strong>of</strong> node-negative<br />

neoplasms, additional surgery with nodal dissection should<br />

be strongly recommended.<br />

OUTCOMES OF ESD<br />

En bloc resection rate<br />

Recent results <strong>of</strong> en bloc resection rate and local recurrence<br />

<strong>of</strong> ESD f<strong>or</strong> neoplasms in the stomach, esophagus and<br />

col<strong>or</strong>ectum are described in Table 1. F<strong>or</strong> gastric neoplasms<br />

larger than 20 mm, en bloc resection rate is extremely low<br />

among conventional EMR methods, and local recurrence<br />

rates are around 10% [44] . Although ESD was considered<br />

as a difficult and complicated technique when it was first<br />

described in the stomach, after maturity <strong>of</strong> the techniques<br />

<strong>of</strong> ESD, en bloc resection rates became greater than 90%,<br />

regardless <strong>of</strong> size, and local recurrence rates became almost<br />

zero. Technical feasibility and fav<strong>or</strong>able results <strong>of</strong> ESD have<br />

also been rep<strong>or</strong>ted in recurrent neoplasms [45-47] , neoplasms<br />

<strong>of</strong> the esophago-gastric junction [48] , and duodenal neoplasms<br />

although the number <strong>of</strong> cases is small. Few rep<strong>or</strong>ts <strong>of</strong><br />

ESD f<strong>or</strong> resection <strong>of</strong> subepithelial tum<strong>or</strong>s have also been<br />

published [49] .<br />

Complication<br />

Complications <strong>of</strong> ESD include pain, bleeding, perf<strong>or</strong>ation,<br />

and stricture. Pain after ESD is <strong>of</strong>ten mild and lasts one <strong>or</strong><br />

two days after the procedure although the frequency is low.<br />

Patients <strong>of</strong> esophageal ESD are m<strong>or</strong>e likely to develop<br />

pain than gastric <strong>or</strong> col<strong>or</strong>ectal ESD.<br />

Complications <strong>of</strong> post-operative bleeding and<br />

perf<strong>or</strong>ation among various ESD methods in the stomach,<br />

esophagus and col<strong>or</strong>ectum are described in Table 2.<br />

Bleeding is m<strong>or</strong>e frequent in the stomach cases, whereas<br />

perf<strong>or</strong>ation is m<strong>or</strong>e frequent in the col<strong>or</strong>ectal cases. To<br />

prevent post-procedural bleeding, hemostasis <strong>of</strong> appearing<br />

vessels on the artificial ulcer after removing the specimen is<br />

essential. Hemostasis is perf<strong>or</strong>med by hemostatic f<strong>or</strong>ceps<br />

(HDB2422/HDB2418, Pentax), coagrasper (FD-410LR,<br />

www.wjgnet.com<br />

Table 1 Recent outcomes <strong>of</strong> various endoscopic submucosal<br />

dissection methods f<strong>or</strong> stomach, esophagus and col<strong>or</strong>ectum<br />

Site Auth<strong>or</strong> Yr Method En bloc<br />

resection<br />

rate (%)<br />

Olympus), hot biopsy f<strong>or</strong>ceps, argon plasma coagulation<br />

<strong>or</strong> endoclips. Acc<strong>or</strong>ding to perf<strong>or</strong>ation, recent case series<br />

suggest that small perf<strong>or</strong>ation immediately recognized<br />

can be successfully sealed with endoclips and treated<br />

conservatively by nasogastric suction, fasting and antibiotics<br />

without emergency laparotomy [51,52] . However, there are<br />

rare cases <strong>of</strong> delayed perf<strong>or</strong>ation, which requires surgical<br />

rescue. Delayed perf<strong>or</strong>ation may occur in the esophagus,<br />

stomach, duodenum and col<strong>or</strong>ectum [31,53-56] , mostly at two<br />

<strong>or</strong> m<strong>or</strong>e days after a successful ESD. The reason f<strong>or</strong> delayed<br />

perf<strong>or</strong>ation is unknown, however patients with uncontrolled<br />

diabetes mellitus, patients on permanent hemodialysis,<br />

lesions located on surgical anastomosis, and too much<br />

coagulation are considered as possible risk fact<strong>or</strong>s.<br />

Stricture after ESD may occur in esophageal ESD when<br />

the ESD ulcer is larger than two-third <strong>of</strong> circumference<br />

<strong>of</strong> the esophageal lumen, <strong>or</strong> in gastric ESD when the ESD<br />

ulcer involves m<strong>or</strong>e than three quarter <strong>of</strong> the pyl<strong>or</strong>us <strong>or</strong><br />

pre-pyl<strong>or</strong>us area. In these cases, early intervention to avoid<br />

passage obstruction is required. Dilation using bougie<br />

<strong>or</strong> balloon are <strong>of</strong>ten applied one week after ESD and<br />

repeated several times until healing <strong>of</strong> the ESD ulcer [8,11,57] .<br />

MANAGEMENTS AFTER ESD<br />

Local<br />

recurrence<br />

rate (%)<br />

Stomach Yamamoto [33] 2002 EMRSH 76 3<br />

(53/70) (2/67)<br />

Ishigooka [34]<br />

2004 s-ERHSE 79 0<br />

(27/34) (0/34)<br />

Oda [35]<br />

2005 ESD-IT knife 93 1<br />

(957/1033)<br />

-<br />

Kakushima [32] 2006 ESD-Flex knife 91 1<br />

(347/383)<br />

-<br />

Imagawa [36]<br />

2006 ESD-Flex knife 84 1<br />

0<br />

(181/195) (0/164)<br />

Oyama [37]<br />

2006 ESD-Hook knife 94 0<br />

(104/111) (0/111)<br />

Onozato [38]<br />

2006 ESD-Flex knife 94 1<br />

0<br />

(161/171) (0/99)<br />

Hirasaki [39]<br />

2007 ESD-IT knife 96 -<br />

Esophagus Oyama [8]<br />

2005 ESD-Hook knife 95 0<br />

(95/102) (0/102)<br />

Fujishiro [11]<br />

2006 ESD-Flex knife 100 2.5<br />

(58/58) (1/40)<br />

Col<strong>or</strong>ectum Fujishiro [31]<br />

2007 ESD-Flex knife 91.5 1.8<br />

(183/200) (2/111)<br />

Saito [40]<br />

2007 ESD several knives 84 0.5<br />

Tanaka [41]<br />

Tamegai [42]<br />

Onozato [43]<br />

1 En bloc resection + R0 resection rate.<br />

(168/200) (1/180)<br />

2007 ESD several knives 80 0<br />

(56/70) (0/62)<br />

2007 ESD-Hook knife 98.6 11<br />

(33/42) (4/36)<br />

2007 ESD-Flex knife 77 0<br />

(27/35) (0/23)<br />

In Japan, ESD is perf<strong>or</strong>med on hospitalized patients.<br />

After ESD, eating is usually started on the next <strong>or</strong> 2 d<br />

after ESD if there is no complication, and the patient

---

Kakushima N et al . ESD f<strong>or</strong> GI neoplasms 2965<br />

Table 2 Bleeding and perf<strong>or</strong>ation rate <strong>of</strong> various endoscopic submucosal dissection<br />

methods f<strong>or</strong> stomach, esophagus and col<strong>or</strong>ectum<br />

Site Auth<strong>or</strong> Year Method Total cases Bleeding (%) Perf<strong>or</strong>ation (%)<br />

Stomach Yamamoto [33]<br />

2002 EMRSH 70 4 0<br />

Ishigooka [34]<br />

2004 s-ERHSE 34 0 12<br />

Oda [35]<br />

2005 ESD-IT knife 1 033 6 4<br />

Kakushima [32] 2006 ESD-Flex knife 383 3.4 3.9<br />

Imagawa [36]<br />

2006 ESD-Flex knife 159 0 6.1<br />

Oyama [37]<br />

2006 ESD-Hook knife 111 - 1<br />

Onozato [38]<br />

2006 ESD-Flex knife 171 7.6 3.5<br />

Hirasaki [39]<br />

2007 ESD-IT knife 112 4 1<br />

Esophagus Oyama [8]<br />

2005 ESD-Hook knife 102 - 0<br />

Fujishiro [11]<br />

2006 ESD-Flex knife 58 0 6.9<br />

Col<strong>or</strong>ectum Fujishiro [31]<br />

2007 ESD-Flex knife 200 1 6<br />

Saito [40]<br />

2007 ESD-several knives 200 2 5<br />

Tanaka [41]<br />

2007 ESD-several knives 70 1.4 10<br />

Tamegai [42]<br />

2007 ESD-Hook knife 74 - 1.4<br />

Hurlstone [50]<br />

2007 ESD-Flex knife 42 12 2.4<br />

Onozato [43]<br />

2007 ESD-Flex knife 35 0 2.9<br />

may be discharged within a few days. Antacids are usually<br />

administered to gastric and esophageal ESD patients to<br />

relieve pain, prevent postoperative bleeding and promote<br />

ulcer healing. A recent study showed that proton pump<br />

inhibit<strong>or</strong>s m<strong>or</strong>e effectively prevented bleeding from the<br />

gastric ulcer created after ESD than did H2-recept<strong>or</strong><br />

antagonists [58] . Ulcers after ESD are rep<strong>or</strong>ted to heal within<br />

6 to 8 wk in the esophagus, stomach and col<strong>or</strong>ectum [59-63] .<br />

Endoscopic surveillance should be carried out in<br />

patients after ESD not only to detect local recurrence but<br />

also metachronous cancer especially in the esophagus and<br />

stomach. A recent study showed that the average time to<br />

detect a first metachronous gastric cancer (MGC) was 3.1<br />

± 1.7 years after EMR/ESD, and the cumulative 3-year<br />

incidence was 5.9% [64] . In <strong>or</strong>der to detect MGC at an early<br />

stage to perf<strong>or</strong>m a successful ER, annual endoscopic<br />

surveillance program may be practical f<strong>or</strong> post-ER<br />

patients.<br />

LONG-TERM OUTCOMES AFTER ESD<br />

Long-term outcomes after ESD f<strong>or</strong> gastric cancers within<br />

the expanded indication are currently under investigation.<br />

Survival data is still lacking in the literature, however in<br />

the 2007 annual meeting <strong>of</strong> Japanese gastroenterological<br />

endoscopy society (JGES), a symposium was held upon<br />

long-term outcomes after gastric and esophageal ESD. F<strong>or</strong><br />

gastric ESD, 3-year disease free survival rate was rep<strong>or</strong>ted as<br />

90%-92%, local recurrence rate was rep<strong>or</strong>ted as 0.8%-12%.<br />

F<strong>or</strong> lesions within the criteria <strong>of</strong> node negative cancers,<br />

there were no rep<strong>or</strong>ts <strong>of</strong> distant metastasis. Metachronous<br />

gastric cancer detection rate during follow-up was rep<strong>or</strong>ted<br />

as 3.4%-10.2%. In comparison, long-term outcomes after<br />

EMR f<strong>or</strong> small differentiated mucosal EGC less than<br />

20 mm in diameter have been rep<strong>or</strong>ted as comparable to<br />

those after gastrectomy. The disease-specific 5- and 10-year<br />

survival rates were 99% and 99% [65] . F<strong>or</strong> esophageal ESD, in<br />

the 2007 JGES meeting, 3-year survival rate f<strong>or</strong> m1-2 cancer<br />

and m3-sm1 cancer were 95.1% and 86.7%, respectively.<br />

Acc<strong>or</strong>ding to col<strong>or</strong>ectal ESD, there is still no long-term data<br />

at present.<br />

FUTURE PERSPECTIVES<br />

With the development <strong>of</strong> ESD, m<strong>or</strong>e than half <strong>of</strong> GI<br />

cancers in the early stage are removed by ER in advanced<br />

institutions in Japan. En bloc retrieval <strong>of</strong> lesions is essential<br />

f<strong>or</strong> detailed histopathologic studies, which f<strong>or</strong>m the basis f<strong>or</strong><br />

stratification <strong>of</strong> treatment outcomes and patient’s prognosis.<br />

ESD the<strong>or</strong>etically <strong>of</strong>fers greater histopathological accuracy<br />

than conventional EMR methods <strong>or</strong> piecemeal resection.<br />

However, ESD requires highly skilled endoscopists, and a<br />

suitable training program is demanded f<strong>or</strong> permeation <strong>of</strong><br />

this technique. F<strong>or</strong> trainees starting ESD, skills <strong>of</strong> routine<br />

endoscopy and colonoscopy, target biopsy, endoscopic<br />

hemostasis techniques and simple EMR techniques should<br />

be required. A trainee would gain early pr<strong>of</strong>iciency <strong>of</strong><br />

ESD after 30 cases under supervision <strong>of</strong> a ment<strong>or</strong> [32,66] .<br />

On the other hand, serious complications such as delayed<br />

perf<strong>or</strong>ation have been rep<strong>or</strong>ted, and a th<strong>or</strong>ough patient<br />

care bef<strong>or</strong>e and after ESD is essential. At present, selection<br />

<strong>of</strong> a lesion within the criteria f<strong>or</strong> ER, selection <strong>of</strong> the<br />

patient with adequate general function should be well<br />

considered. It is imp<strong>or</strong>tant to share the inf<strong>or</strong>mation and<br />

experience among endoscopists to skill up and avoid serious<br />

complications. The ESD technique is still not a treatment at<br />

ease, and further refinements <strong>of</strong> the technique is required to<br />

popularize ESD as a safe and reliable, less invasive treatment<br />

f<strong>or</strong> patients with GI neoplasms.<br />

REFERENCES<br />

1 Hirao M, Masuda K, Asanuma T, Naka H, Noda K, Matsuura<br />

K, Yamaguchi O, Ueda N. Endoscopic resection <strong>of</strong> early gastric<br />

cancer and other tum<strong>or</strong>s with local injection <strong>of</strong> hypertonic<br />

saline-epinephrine. Gastrointest Endosc 1988; 34: 264-269<br />

2 Ono H, Kondo H, Gotoda T, Shirao K, Yamaguchi H, Saito<br />

D, Hosokawa K, Shimoda T, Yoshida S. Endoscopic mucosal<br />

resection f<strong>or</strong> treatment <strong>of</strong> early gastric cancer. Gut 2001; 48:<br />

225-229<br />

3 Ohkuwa M, Hosokawa K, Boku N, Ohtu A, Tajiri H, Yoshida<br />

S. New endoscopic treatment f<strong>or</strong> intramucosal gastric tum<strong>or</strong>s<br />

using an insulated-tip diathermic knife. Endoscopy 2001; 33:<br />

221-226<br />

4 Miyamoto S, Muto M, Hamamoto Y, Boku N, Ohtsu A, Baba<br />

S, Yoshida M, Ohkuwa M, Hosokawa K, Tajiri H, Yoshida S.<br />

www.wjgnet.com

---

2966 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

A new technique f<strong>or</strong> endoscopic mucosal resection with an<br />

insulated-tip electrosurgical knife improves the completeness<br />

<strong>of</strong> resection <strong>of</strong> intramucosal gastric neoplasms. Gastrointest<br />

Endosc 2002; 55: 576-581<br />

5 Rosch T, Sarbia M, Schumacher B, Deinert K, Frimberger<br />

E, Toermer T, Stolte M, Neuhaus H. Attempted endoscopic<br />

en bloc resection <strong>of</strong> mucosal and submucosal tum<strong>or</strong>s using<br />

insulated-tip knives: a pilot series. Endoscopy 2004; 36: 788-801<br />

6 Gotoda T. A large endoscopic resection by endoscopic<br />

submucosal dissection procedure f<strong>or</strong> early gastric cancer. Clin<br />

Gastroenterol Hepatol 2005; 3: S71-S73<br />

7 Yamamoto H, Kawata H, Sunada K, Sasaki A, Nakazawa<br />

K, Miyata T, Sekine Y, Yano T, Satoh K, Ido K, Sugano K.<br />

Successful en-bloc resection <strong>of</strong> large superficial tum<strong>or</strong>s in<br />

the stomach and colon using sodium hyaluronate and smallcaliber-tip<br />

transparent hood. Endoscopy 2003; 35: 690-694<br />

8 Oyama T, Tom<strong>or</strong>i A, Hotta K, M<strong>or</strong>ita S, Kominato K, Tanaka<br />

M, Miyata Y. Endoscopic submucosal dissection <strong>of</strong> early<br />

esophageal cancer. Clin Gastroenterol Hepatol 2005; 3: S67-S70<br />

9 Yahagi N, Fujishiro M, Kakushima N, Kobayashi K,<br />

Hashimoto T, Oka M, Iguchi M, Enomoto S, Ichinose M, Niwa<br />

H, Omata M. Endoscopic submucosal dissection f<strong>or</strong> early<br />

gastric cancer using the tip <strong>of</strong> an electrosurgical snare (thin<br />

type). Dig Endosc 2004; 16: 34–38<br />

10 Fujishiro M, Yahagi N, Nakamura M, Kakushima N,<br />

Kodashima S, Ono S, Kobayashi K, Hashimoto T, Yamamichi<br />

N, Tateishi A, Shimizu Y, Oka M, Ogura K, Kawabe T,<br />

Ichinose M, Omata M. Endoscopic submucosal dissection f<strong>or</strong><br />

rectal epithelial neoplasia. Endoscopy 2006; 38: 493-497<br />

11 Fujishiro M, Yahagi N, Kakushima N, Kodashima S, Muraki<br />

Y, Ono S, Yamamichi N, Tateishi A, Shimizu Y, Oka M, Ogura<br />

K, Kawabe T, Ichinose M, Omata M. Endoscopic submucosal<br />

dissection <strong>of</strong> esophageal squamous cell neoplasms. Clin<br />

Gastroenterol Hepatol 2006; 4: 688-694<br />

12 Inoue H, Kudo S. A novel procedure <strong>of</strong> en bloc EMR using<br />

triangle-tipped knife (abstract). Gastrointest Endosc 2003; 57:<br />

AB86<br />

13 Toyonaga T, Nishino E, Hirooka T, Dozaiku T, Sujiyama T,<br />

Iwata Y, Ono W, Ueda C, Tomita M, Hirooka T, Makimoto<br />

S, Hayashibe A, Sonomura T. Use <strong>of</strong> sh<strong>or</strong>t needle knife f<strong>or</strong><br />

esophageal endoscopic submucosal dissection. Dig Endosc<br />

2005; 17: 246-252<br />

14 Kawahara Y, Takenaka R, Okada H. Risk management to<br />

prevent perf<strong>or</strong>ation during endoscopic submucosal dissection.<br />

Dig Endosc 2007; 19: S9-S13<br />

15 Fujishiro M, Kodashima S, Goto O, Ono S, Muraki Y,<br />

Kakushima N, Omata M. Successful en bloc resection<br />

<strong>of</strong> superficial esophageal cancer treated by endoscopic<br />

submucosal dissection with a splash-needle (with video).<br />

Endoscopy 2007 Available from: URL: http://www.thiemeconnect.de/ejournals/html/endoscopy/doi/10.1055/<br />

s-2007-995538<br />

16 Yahagi N, Fujishiro M, Imagawa A, Kakushima N, Iguchi M,<br />

Omata M. Endoscopic submucosal dissection f<strong>or</strong> the reliable<br />

en bloc resection <strong>of</strong> col<strong>or</strong>ectal mucosal tum<strong>or</strong>s. Dig Endosc<br />

2004; 16: S89-S92<br />

17 Yahagi N, Fujishiro M, Kakushima N, Kodashima S,<br />

Nakamura M, Omata M. Clinical evaluation <strong>of</strong> the multibending<br />

scope in various endoscopic procedures <strong>of</strong> the upper<br />

GI tract. Dig Endosc 2005; 17: S94-S96<br />

18 Yonezawa J, Kaise M, Sumiyama K, Goda K, Arakawa H,<br />

Tajiri H. A novel double-channel therapeutic endoscope<br />

("R-scope") facilitates endoscopic submucosal dissection <strong>of</strong><br />

superficial gastric neoplasms. Endoscopy 2006; 38: 1011-1015<br />

19 Neuhaus H, Costamagna G, Deviere J, Fockens P, Ponchon<br />

T, Rosch T. Endoscopic submucosal dissection (ESD) <strong>of</strong><br />

early neoplastic gastric lesions using a new double-channel<br />

endoscope (the "R-scope"). Endoscopy 2006; 38: 1016-1023<br />

20 Yamamoto H, Yube T, Isoda N, Sato Y, Sekine Y, Higashizawa<br />

T, Ido K, Kimura K, Kanai N. A novel method <strong>of</strong> endoscopic<br />

mucosal resection using sodium hyaluronate. Gastrointest<br />

Endosc 1999; 50: 251-256<br />

21 Conio M, Rajan E, S<strong>or</strong>bi D, N<strong>or</strong>ton I, Herman L, Filiberti<br />

www.wjgnet.com<br />

R, Gostout CJ. Comparative perf<strong>or</strong>mance in the p<strong>or</strong>cine<br />

esophagus <strong>of</strong> different solutions used f<strong>or</strong> submucosal<br />

injection. Gastrointest Endosc 2002; 56: 513-516<br />

22 Fujishiro M, Yahagi N, Kashimura K, Mizushima Y, Oka M,<br />

Enomoto S, Kakushima N, Kobayashi K, Hashimoto T, Iguchi<br />

M, Shimizu Y, Ichinose M, Omata M. Comparison <strong>of</strong> various<br />

submucosal injection solutions f<strong>or</strong> maintaining mucosal<br />

elevation during endoscopic mucosal resection. Endoscopy<br />

2004; 36: 579-583<br />

23 Fujishiro M, Yahagi N, Kashimura K, Matsuura T, Nakamura<br />

M, Kakushima N, Kodashima S, Ono S, Kobayashi K,<br />

Hashimoto T, Yamamichi N, Tateishi A, Shimizu Y, Oka M,<br />

Ichinose M, Omata M. Tissue damage <strong>of</strong> different submucosal<br />

injection solutions f<strong>or</strong> EMR. Gastrointest Endosc 2005; 62:<br />

933-942<br />

24 Fujishiro M, Yahagi N, Kashimura K, Mizushima Y, Oka<br />

M, Matsuura T, Enomoto S, Kakushima N, Imagawa A,<br />

Kobayashi K, Hashimoto T, Iguchi M, Shimizu Y, Ichinose M,<br />

Omata M. Different mixtures <strong>of</strong> sodium hyaluronate and their<br />

ability to create submucosal fluid cushions f<strong>or</strong> endoscopic<br />

mucosal resection. Endoscopy 2004; 36: 584-589<br />

25 Fujishiro M, Yahagi N, Nakamura M, Kakushima N,<br />

Kodashima S, Ono S, Kobayashi K, Hashimoto T, Yamamichi<br />

N, Tateishi A, Shimizu Y, Oka M, Ogura K, Kawabe T,<br />

Ichinose M, Omata M. Successful outcomes <strong>of</strong> a novel<br />

endoscopic treatment f<strong>or</strong> GI tum<strong>or</strong>s: endoscopic submucosal<br />

dissection with a mixture <strong>of</strong> high-molecular-weight hyaluronic<br />

acid, glycerin, and sugar. Gastrointest Endosc 2006; 63: 243-249<br />

26 Gotoda T, Yanagisawa A, Sasako M, Ono H, Nakanishi Y,<br />

Shimoda T, Kato Y. Incidence <strong>of</strong> lymph node metastasis from<br />

early gastric cancer: estimation with a large number <strong>of</strong> cases at<br />

two large centers. Gastric Cancer 2000; 3: 219-225<br />

27 Soetikno R, Kaltenbach T, Yeh R, Gotoda T. Endoscopic<br />

mucosal resection f<strong>or</strong> early cancers <strong>of</strong> the upper gastrointestinal<br />

tract. J Clin Oncol 2005; 23: 4490-4498<br />

28 The Japan Esophageal Society. Guidelines f<strong>or</strong> the clinical<br />

and pathologic studies on carcinoma <strong>of</strong> the esophagus [in<br />

Japanese]. 10th ed. Tokyo: Kanehara Shuppan, 2007<br />

29 Oyama T, Miyata Y, Shimaya S. Lymph nodal metastasis <strong>of</strong><br />

m3, sm1 esophageal cancer [in Japanese]. Stomach Intestine<br />

2002; 37: 71-74<br />

30 Yokoyama J, Ajioka Y, Watanabe H, Asakura H. Lymph<br />

node metastasis and micrometastasis <strong>of</strong> submucosal invasive<br />

col<strong>or</strong>ectal carcinoma: an indicat<strong>or</strong> <strong>of</strong> the curative potential <strong>of</strong><br />

endoscopic treatment. Acta Medica Biologica 2002; 50: 1-8<br />

31 Fujishiro M, Yahagi N, Kakushima N, Kodashima S, Muraki<br />

Y, Ono S, Yamamichi N, Tateishi A, Oka M, Ogura K, Kawabe<br />

T, Ichinose M, Omata M. Outcomes <strong>of</strong> endoscopic submucosal<br />

dissection f<strong>or</strong> col<strong>or</strong>ectal epithelial neoplasms in 200 consecutive<br />

cases. Clin Gastroenterol Hepatol 2007; 5: 678-683; quiz<br />

645<br />

32 Kakushima N, Fujishiro M, Kodashima S, Muraki Y, Tateishi<br />

A, Omata M. A learning curve f<strong>or</strong> endoscopic submucosal<br />

dissection <strong>of</strong> gastric epithelial neoplasms. Endoscopy 2006; 38:<br />

991-995<br />

33 Yamamoto H, Kawata H, Sunada K, Satoh K, Kaneko Y, Ido<br />

K, Sugano K. Success rate <strong>of</strong> curative endoscopic mucosal<br />

resection with circumferential mucosal incision assisted by<br />

submucosal injection <strong>of</strong> sodium hyaluronate. Gastrointest<br />

Endosc 2002; 56: 507-512<br />

34 Ishigooka M, Uchisawa M, Kusama K, Furuyama J, M<strong>or</strong>izono<br />

R, Takahasi B. Endoscopic resection f<strong>or</strong> early gastric cancer by<br />

direct incision <strong>of</strong> the submucosa, with local injection <strong>of</strong> HSE<br />

solution (in Japanese with English abstract). Stomach Intest<br />

2002; 37: 1163-1168<br />

35 Oda I, Gotoda T, Hamanaka H, Eguchi T, Saito Y, Matsuda T,<br />

Bhandari P, Emura F, Saito D, Ono H. Endoscopic submucosal<br />

dissection f<strong>or</strong> early gastric cancer: technical feasibility,<br />

operation time and complications from a large consecutive<br />

series. Dig Endosc 2005; 17: 54-58<br />

36 Imagawa A, Okada H, Kawahara Y, Takenaka R, Kato J,<br />

Kawamoto H, Fujiki S, Takata R, Yoshino T, Shirat<strong>or</strong>i Y.<br />

Endoscopic submucosal dissection f<strong>or</strong> early gastric cancer:

---

Kakushima N et al . ESD f<strong>or</strong> GI neoplasms 2967<br />

results and degrees <strong>of</strong> technical difficulty as well as success.<br />

Endoscopy 2006; 38: 987-990<br />

37 Oyama T, Tanaka M, Tom<strong>or</strong>i A, Hotta K, M<strong>or</strong>ita S, Furutachi S,<br />

Takahashi A, Miyata Y. Prognosis <strong>of</strong> endoscopic submucosal<br />

dissection f<strong>or</strong> early gastric cancer, results <strong>of</strong> 3 years <strong>or</strong> m<strong>or</strong>e<br />

after treatment. (in Japanese with English abstract) Stomach<br />

Intest 2006; 41: 87-90<br />

38 Onozato Y, Ishihara H, Iizuka H, Sohara N, Kakizaki S,<br />

Okamura S, M<strong>or</strong>i M. Endoscopic submucosal dissection f<strong>or</strong><br />

early gastric cancers and large flat adenomas. Endoscopy 2006;<br />

38: 980-986<br />

39 Hirasaki S, Kanzaki H, Matsubara M, Fujita K, Ikeda F,<br />

Taniguchi H, Yumoto E, Suzuki S. Treatment <strong>of</strong> over 20 mm<br />

gastric cancer by endoscopic submucosal dissection using an<br />

insulation-tipped diathermic knife. W<strong>or</strong>ld J Gastroenterol 2007;<br />

13: 3981-3984<br />

40 Saito Y, Uraoka T, Matsuda T, Emura F, Ikehara H, Mashimo<br />

Y, Kikuchi T, Fu KI, Sano Y, Saito D. Endoscopic treatment<br />

<strong>of</strong> large superficial col<strong>or</strong>ectal tum<strong>or</strong>s: a case series <strong>of</strong> 200<br />

endoscopic submucosal dissections (with video). Gastrointest<br />

Endosc 2007; 66: 966-973<br />

41 Tanaka S, Oka S, Kaneko I, Hirata M, Mouri R, Kanao H,<br />

Yoshida S, Chayama K. Endoscopic submucosal dissection f<strong>or</strong><br />

col<strong>or</strong>ectal neoplasia: possibility <strong>of</strong> standardization. Gastrointest<br />

Endosc 2007; 66: 100-107<br />

42 Tamegai Y, Saito Y, Masaki N, Hinohara C, Oshima T,<br />

Kogure E, Liu Y, Uemura N, Saito K. Endoscopic submucosal<br />

dissection: a safe technique f<strong>or</strong> col<strong>or</strong>ectal tum<strong>or</strong>s. Endoscopy<br />

2007; 39: 418-422<br />

43 Onozato Y, Kakizaki S, Ishihara H, Iizuka H, Sohara N,<br />

Okamura S, M<strong>or</strong>i M, Itoh H. Endoscopic submucosal<br />

dissection f<strong>or</strong> rectal tum<strong>or</strong>s. Endoscopy 2007; 39: 423-427<br />

44 Fujishiro M. Endoscopic resection f<strong>or</strong> early gastric cancer.<br />

In: Kaminishi M, Takubo K, Mafune K (Eds). The diversity<br />

<strong>of</strong> gastric carcinoma; Pathogenesis, diagnosis, and therapy.<br />

Springer-Verlag Tokyo 2005: 243-252<br />

45 Yokoi C, Gotoda T, Hamanaka H, Oda I. Endoscopic<br />

submucosal dissection allows curative resection <strong>of</strong> locally<br />

recurrent early gastric cancer after pri<strong>or</strong> endoscopic mucosal<br />

resection. Gastrointest Endosc 2006; 64: 212-218<br />

46 Oka S, Tanaka S, Kaneko I, Mouri R, Hirata M, Kanao H,<br />

Kawamura T, Yoshida S, Yoshihara M, Chayama K. Endoscopic<br />

submucosal dissection f<strong>or</strong> residual/local recurrence <strong>of</strong><br />

early gastric cancer after endoscopic mucosal resection.<br />

Endoscopy 2006; 38: 996-1000<br />

47 Fujishiro M, Goto O, Kakushima N, Kodashima S, Muraki<br />

Y, Omata M. Endoscopic submucosal dissection <strong>of</strong> stomach<br />

neoplasms after unsuccessful endoscopic resection. Dig Liver<br />

Dis 2007; 39: 566-571<br />

48 Kakushima N, Yahagi N, Fujishiro M, Kodashima S,<br />

Nakamura M, Omata M. Efficacy and safety <strong>of</strong> endoscopic<br />

submucosal dissection f<strong>or</strong> tum<strong>or</strong>s <strong>of</strong> the esophagogastric<br />

junction. Endoscopy 2006; 38: 170-174<br />

49 Lee IL, Lin PY, Tung SY, Shen CH, Wei KL, Wu CS.<br />

Endoscopic submucosal dissection f<strong>or</strong> the treatment <strong>of</strong><br />

intraluminal gastric subepithelial tum<strong>or</strong>s <strong>or</strong>iginating from the<br />

muscularis propria layer. Endoscopy 2006; 38: 1024-1028<br />

50 Hurlstone DP, Atkinson R, Sanders DS, Thomson M, Cross<br />

SS, Brown S. Achieving R0 resection in the col<strong>or</strong>ectum<br />

using endoscopic submucosal dissection. Br J Surg 2007; 94:<br />

1536-1542<br />

51 Minami S, Gotoda T, Ono H, Oda I, Hamanaka H. Complete<br />

endoscopic closure <strong>of</strong> gastric perf<strong>or</strong>ation induced by<br />

endoscopic resection <strong>of</strong> early gastric cancer using endoclips<br />

can prevent surgery (with video). Gastrointest Endosc 2006; 63:<br />

596-601<br />

52 Fujishiro M, Yahagi N, Kakushima N, Kodashima S,<br />

Muraki Y, Ono S, Kobayashi K, Hashimoto T, Yamamichi<br />

N, Tateishi A, Shimizu Y, Oka M, Ogura K, Kawabe T,<br />

Ichinose M, Omata M. Successful nonsurgical management <strong>of</strong><br />

perf<strong>or</strong>ation complicating endoscopic submucosal dissection<br />

<strong>of</strong> gastrointestinal epithelial neoplasms. Endoscopy 2006; 38:<br />

1001-1006<br />

53 Toyonaga T. Complications <strong>of</strong> endoscopic submucosal<br />

dissection and their practical management. (in Japanese with<br />

an English abstract) Shokakinaishikyo 2005; 17: 639-649<br />

54 Doyama H, Oom<strong>or</strong>i T, Narumi K, Takemura K, Shimazaki H,<br />

Hiranuma C, Koizumi H. Experience <strong>of</strong> delayed perf<strong>or</strong>ation<br />

after ESD <strong>of</strong> an adenoma in the duodenal 2nd p<strong>or</strong>tion. (in<br />

Japanese, abstract) Endoscopic f<strong>or</strong>um f<strong>or</strong> digestive disease 2006;<br />

22: 175<br />

55 Onozato Y, Iizuka H, Sagawa T, Yoshimura S, Sakamoto I,<br />

Arai H, Ishihara H, Tomizawa N, Ogawa T, Takayama H, Abe<br />

T, Motegi A, Ito H. A case rep<strong>or</strong>t <strong>of</strong> delayed perf<strong>or</strong>ation due<br />

to endoscopic submucosal dissection (ESD) f<strong>or</strong> early gastric<br />

cancer. (in Japanese) Progress <strong>of</strong> Digestive Endosc 2006; 68:<br />

114-115<br />

56 Tanaka M, Oyama T, Miyata Y, Tom<strong>or</strong>i A, Hotta K, M<strong>or</strong>ita<br />

S, Kominato K, Takeuchi M, Hisa T, Furutake M, Takamatsu<br />

M. A case <strong>of</strong> delayed perf<strong>or</strong>ation 6 days after esophageal ESD<br />

successfully recovered by conservative treatment. (in Japanese,<br />

abstract) Endoscopic f<strong>or</strong>um f<strong>or</strong> digestive disease 2005; 21: 98<br />

57 Fujishiro M, Yahagi N, Kakushima N, Kodashima S, Ichinose<br />

M, Omata M. En bloc resection <strong>of</strong> a large semicircular<br />

esophageal cancer by endoscopic submucosal dissection. Surg<br />

Laparosc Endosc Percutan Tech 2006; 16: 237-241<br />

58 Uedo N, Takeuchi Y, Yamada T, Ishihara R, Ogiyama H,<br />

Yamamoto S, Kato M, Tatsumi K, Masuda E, Tamai C,<br />

Higashino K, Iishi H, Tatsuta M. Effect <strong>of</strong> a proton pump<br />

inhibit<strong>or</strong> <strong>or</strong> an H2-recept<strong>or</strong> antagonist on prevention <strong>of</strong><br />

bleeding from ulcer after endoscopic submucosal dissection <strong>of</strong><br />

early gastric cancer: a prospective randomized controlled trial.<br />

Am J Gastroenterol 2007; 102: 1610-1616<br />

59 Kakushima N, Yahagi N, Fujishiro M, Iguchi M, Oka M,<br />

Kobayashi K, Hashimoto T, Omata M. The healing process <strong>of</strong><br />

gastric artificial ulcers after endoscopic submucosal dissection.<br />

Dig Endosc 2004; 16: 327-331<br />

60 Kakushima N, Fujishiro M, Kodashima S, Kobayashi K,<br />

Tateishi A, Iguchi M, Imagawa A, Motoi T, Yahagi N, Omata<br />

M. Histopathologic characteristics <strong>of</strong> gastric ulcers created by<br />

endoscopic submucosal dissection. Endoscopy 2006; 38: 412-415<br />

61 Kakushima N, Fujishiro M, Yahagi N, Kodashima S,<br />

Nakamura M, Omata M. Helicobacter pyl<strong>or</strong>i status and the<br />

extent <strong>of</strong> gastric atrophy do not affect ulcer healing after<br />

endoscopic submucosal dissection. J Gastroenterol Hepatol 2006;<br />

21: 1586-1589<br />

62 Iguchi M, Yahagi N, Fujishiro M, Kakushima N, Oka M,<br />

Enomoto S, Yanaoka K, Arii K, Shimizu Y, Kitauchi S, Omata<br />

M, Ichinose M. The healing process <strong>of</strong> large artificial ulcers in<br />

the col<strong>or</strong>ectum after endoscopic mucosal resection. [abstract].<br />

Gastrointest Endosc 2003; 57: AB226<br />

63 Fujishiro M, Yahagi N, Kakushima N, Kodashima S, Ichinose<br />

M, Omata M. Successful endoscopic en bloc resection <strong>of</strong> a<br />

large laterally spreading tum<strong>or</strong> in the rectosigmoid junction<br />

by endoscopic submucosal dissection. Gastrointest Endosc 2006;<br />

63: 178-183<br />

64 Nakajima T, Oda I, Gotoda T, Hamanaka H, Eguchi T, Yokoi<br />

C, Saito D. Metachronous gastric cancers after endoscopic<br />

resection: how effective is annual endoscopic surveillance?<br />

Gastric Cancer 2006; 9: 93-98<br />

65 Uedo N, Iishi H, Tatsuta M, Ishihara R, Higashino K, Takeuchi<br />

Y, Imanaka K, Yamada T, Yamamoto S, Yamamoto S,<br />

Tsukuma H, Ishiguro S. Longterm outcomes after endoscopic<br />

mucosal resection f<strong>or</strong> early gastric cancer. Gastric Cancer 2006; 9:<br />

88-92<br />

66 Gotoda T, Friedland S, Hamanaka H, Soetikno R. A learning<br />

curve f<strong>or</strong> advanced endoscopic resection. Gastrointest Endosc<br />

2005; 62: 866-867<br />

S- Edit<strong>or</strong> Liu JN L- Edit<strong>or</strong> Alpini GD E- Edit<strong>or</strong> Liu Y<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 2968-2976<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

CLINICAL PRACTICE GUIDELINES<br />

Pharmacological approach to acute pancreatitis<br />

Ulrich Christian Bang, Synne Semb, Camilla Nøjgaard, Flemming Bendtsen<br />

Ulrich Christian Bang, Synne Semb, Camilla Nøjgaard,<br />

Flemming Bendtsen, Department <strong>of</strong> Gastroenterology, Hvidovre<br />

Hospital, Hvidovre DK-2650, Denmark<br />

Flemming Bendtsen, Faculty <strong>of</strong> Health Sciences, University <strong>of</strong><br />

Copenhagen, Blegdamsvej 3B, København N DK-2200, Denmark<br />

Auth<strong>or</strong> contributions: Bang UC and Bendtsen F wrote the<br />

manuscript; Semb S and Nøjgaard C revised the manuscript.<br />

C<strong>or</strong>respondence to: Ulrich Bang, Department <strong>of</strong> Gastroenterology,<br />

Hvidovre Hospital, Kettegaard Allé 30, Hvidovre DK-2650,<br />

Denmark. ulrich_bang@dadlnet.dk<br />

Telephone: +45-26748942 Fax: +45-36473311<br />

Received: February 29, 2008 Revised: April 10, 2008<br />

Abstract<br />

The aim <strong>of</strong> the present review is to summarize<br />

the current knowledge regarding pharmacological<br />

prevention and treatment <strong>of</strong> acute pancreatitis (AP)<br />

<strong>based</strong> on experimental animal models and clinical trials.<br />

Somatostatin (SS) and octreotide inhibit the exocrine<br />

production <strong>of</strong> pancreatic enzymes and may be useful<br />

as prophylaxis against Post Endoscopic retrograde<br />

cholangiopancreatography Pancreatitis (PEP). The<br />

protease inhibit<strong>or</strong> Gabexate mesilate (GM) is used<br />

routinely as treatment to AP in some countries, but<br />

randomized clinical trials and a meta-analysis do not<br />

supp<strong>or</strong>t this <strong>practice</strong>. Nitroglycerin (NGL) is a nitrogen<br />

oxide (NO) don<strong>or</strong>, which relaxes the sphincter <strong>of</strong> Oddi.<br />

Studies show conflicting results when applied pri<strong>or</strong><br />

to ERCP and a large multicenter randomized study<br />

is warranted. Steroids administered as prophylaxis<br />

against PEP has been validated without effect in several<br />

randomized trials. The non-steroidal anti-inflammat<strong>or</strong>y<br />

drugs (NSAID) indomethacin and dicl<strong>of</strong>enac have in<br />

randomized studies showed potential as prophylaxis<br />

against PEP. Interleukin 10 (IL-10) is a cytokine with<br />

anti-inflammat<strong>or</strong>y properties but two trials testing IL-10<br />

as prophylaxis to PEP have returned conflicting results.<br />

Antibodies against tum<strong>or</strong> necrosis fact<strong>or</strong>-alpha (TNF-α)<br />

have a potential as rescue therapy but no clinical trials<br />

are currently being conducted. The antibiotics betalactams<br />

and quinolones reduce m<strong>or</strong>tality when necrosis<br />

is present in pancreas and may also reduce incidence<br />

<strong>of</strong> infected necrosis. Evidence <strong>based</strong> pharmacological<br />

treatment <strong>of</strong> AP is limited and studies on the effect <strong>of</strong><br />

potent anti-inflammat<strong>or</strong>y drugs are warranted.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Acute pancreatitis; Dicl<strong>of</strong>enac; Gabexate;<br />

Indomethacin; Interleukin-10; Necrotizing pancreatitis;<br />

Nitrogen oxides; Octreotide; Protease inhibit<strong>or</strong>s;<br />

Somatostatin<br />

www.wjgnet.com<br />

Peer reviewer: Minoti V Apte, Associate Pr<strong>of</strong>ess<strong>or</strong>, Pancreatic<br />

Research Group, South Western Sydney Clinical School,<br />

The University <strong>of</strong> New South Wales, Liverpool, NSW 2170,<br />

Australia<br />

Bang UC, Semb S, Nøjgaard C, Bendtsen F. Pharmacological<br />

approach to acute pancreatitis. W<strong>or</strong>ld J Gastroenterol 2008;<br />

14(19): 2968-2976 Available from: URL: http://www.wjgnet.<br />

com/1007-9327/14/2968.asp DOI: http://dx.doi.<strong>or</strong>g/10.3748/<br />

wjg.14.2968<br />

INTRODUCTION<br />

Acute pancreatitis (AP) is a localized inflammat<strong>or</strong>y<br />

condition, which may extent to other <strong>or</strong>gans. The<br />

etiology is usually excessive consumption <strong>of</strong> alcohol <strong>or</strong><br />

gallstone disease, but is in some cases iatrogenic following<br />

medication <strong>or</strong> endoscopic retrograde cholangiopancreatography<br />

(ERCP).<br />

Only a few reviews summarizing the available<br />

pharmacological options f<strong>or</strong> treating AP have been<br />

published despite various experimental and clinical testing<br />

<strong>of</strong> potential drugs [1] . The aim <strong>of</strong> the present review is to<br />

validate the current literature covering the pharmacological<br />

treatment <strong>of</strong> AP. The main focus is on human clinical trials<br />

but some animal experimental models have been included<br />

as well (Table 1). AP after ERCP [post-ERCP pancreatitis<br />

(PEP)] can be regarded as a clinical "experimental" model<br />

<strong>of</strong> AP and hence is subject to preventive measures. The<br />

studies <strong>of</strong> potentially prophylactic drugs to PEP are<br />

theref<strong>or</strong>e included (Table 2).<br />

PATHOPHYSIOLOGY<br />

The pathobiological processes have primarily been<br />

investigated in experimental animal models and it is<br />

widely accepted that the acinar cells play a central role in<br />

the development <strong>of</strong> AP. The secret<strong>or</strong>y acinar cells (SAC)<br />

contain zymogen precurs<strong>or</strong>s and the intra-acinar activation<br />

<strong>of</strong> digestive enzymes is a key event in the pathogenesis <strong>of</strong><br />

AP. The molecular mechanism by which zymogen in AP<br />

fails to leave the SAC is unknown. Studies suggest a loss<br />

<strong>of</strong> the terminal actin web <strong>or</strong> a displacement <strong>of</strong> one <strong>of</strong> the<br />

SNARE membrane proteins, which regulate exocytosis [2] .<br />

The inflammat<strong>or</strong>y response is partly caused by the<br />

release <strong>of</strong> chemokines from SAC, which is followed by<br />

recruitment <strong>of</strong> helper T lymphocytes and macrophages<br />

leading to pancreatic edema and accumulation <strong>of</strong><br />

neutrophils. The systemic release <strong>of</strong> cytokines including<br />

maj<strong>or</strong> pro-inflammat<strong>or</strong>y cytokines causes a systemic

---

2970 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

large, double blind, multicenter, placebo-controlled trials<br />

using SS. They used a dosage <strong>of</strong> 750 micrograms SS as an<br />

infusion starting 30 min pri<strong>or</strong> to ERCP, ending 2 h (SS =<br />

183, placebo = 199) <strong>or</strong> 6 h (SS = 351, placebo = 395) after<br />

ERCP. The incidences <strong>of</strong> PEP in the placebo groups were<br />

6.5% and 4.8% respectively and no advantageous effect <strong>of</strong><br />

SS was observed [14,15] .<br />

The rep<strong>or</strong>ts published during the years 2002 to 2006<br />

have been summarized in a meta-analysis, which concluded<br />

that SS <strong>or</strong> octreotide have no effect as prophylaxis pri<strong>or</strong><br />

to ERCP [16] . However, this meta-analysis did not include<br />

the most recent trial from China with 832 patients. In this<br />

study, octreotide was administered as a combination <strong>of</strong><br />

intravenous infusion and subcutaneous injections and the<br />

incidence <strong>of</strong> PEP in the treatment group (n = 414) and the<br />

placebo group (n = 418) was 2.42% and 5.26% respectively<br />

(P = 0.046) [17] .<br />

Octreotide and SS have thus been investigated in<br />

several clinical studies and may have an advantageous<br />

effect as prophylaxis pri<strong>or</strong> to ERCP. Optimal dosage and<br />

cost-effectiveness still need to be elucidated.<br />

Protease inhibit<strong>or</strong>-Gabexate mesilate (GM)<br />

The intracellular activation <strong>of</strong> proteases is a mandat<strong>or</strong>y<br />

step in the development <strong>of</strong> AP and the protease inhibit<strong>or</strong>s<br />

could the<strong>or</strong>etically have an effect in the treatment <strong>of</strong> AP <strong>or</strong><br />

as prophylaxis pri<strong>or</strong> to ERCP. The first protease inhibit<strong>or</strong>,<br />

Aprotinin, was widely used in the 1960’s but randomized<br />

trials could not demonstrate any beneficial effect [18,19] . GM<br />

is a synthetic protease inhibit<strong>or</strong>, which improve histology<br />

sc<strong>or</strong>e in animal models <strong>of</strong> AP [20] .<br />

In the 1980’s several rep<strong>or</strong>ts with a varying number<br />

<strong>of</strong> patients with AP (n = 42 to 223) have been published<br />

but none showed any advantage <strong>of</strong> GM [21-26] . Conversely<br />

Chen et al observed a significant improved survival in a<br />

randomized trial including 52 patients with severe AP<br />

who received GM (m<strong>or</strong>tality 33% vs 8%) [27] . A metaanalysis<br />

later concluded that GM may reduce the m<strong>or</strong>tality<br />

in patients with moderate to severe pancreatitis, but the<br />

auth<strong>or</strong>s also noted that po<strong>or</strong> quality <strong>of</strong> the included<br />

randomized trials limits the power <strong>of</strong> this meta-analysis [28] .<br />

Several papers from Japan rep<strong>or</strong>t a reduced m<strong>or</strong>tality<br />

rate in patients with necrotizing AP receiving GM as<br />

continuous regional arterial infusion (CRAI). However this<br />

conclusion is <strong>based</strong> merely on clinical observations and<br />

not placebo-controlled randomized trials [29,30] .<br />

Looking at the effect on PEP two large studies by<br />

Andriulli et al with in total 1172 patients did not reveal<br />

any beneficial effect <strong>of</strong> GM. These results are in conflict<br />

with an earlier study by Cavallini et al, who in a study<br />

<strong>of</strong> 418 patients observed a PEP incidence <strong>of</strong> 6% in the<br />

GM group and 14% in the placebo group (P = 0.009) [31] .<br />

However, a recent meta-analysis concludes that GM does<br />

not have an advantageous effect as prophylaxis to PEP [32] .<br />

The question continues to be a matter <strong>of</strong> debate<br />

and <strong>based</strong> on their trial with 608 patients, Manes et al<br />

argue that high-risk patients may benefit from GM. They<br />

administered GM either bef<strong>or</strong>e <strong>or</strong> after ERCP compared<br />

to a saline solution. The incidence <strong>of</strong> PEP was 9.4% in<br />

the placebo group, and significantly lower (P < 0.01) in the<br />

GM groups regardless <strong>of</strong> the time GM was administered<br />

www.wjgnet.com<br />

(bef<strong>or</strong>e ERCP 3.9%, after ERCP 3.4%) [33] .<br />

The FDA does not approve GM and the use <strong>of</strong> GM<br />

is not recommended in published guidelines concerning<br />

the treatment <strong>of</strong> AP [4,2,34] . However, Japanese national<br />

guidelines recommend the use <strong>of</strong> protease inhibit<strong>or</strong>s<br />

either applied intravenously <strong>or</strong> as CRAI [35] and GM is<br />

also approved in Italy where it is also used as prophylaxis<br />

against PEP [36] .<br />

Antioxidants<br />

Oxidative stress most likely plays a maj<strong>or</strong> role in the early<br />

development <strong>of</strong> AP [37] and several experimental animal<br />

models show a beneficial effect <strong>of</strong> anti-oxidative drugs [38-44] .<br />

In humans depletion <strong>of</strong> antioxidants is observed in AP [45,46]<br />

c<strong>or</strong>relating to the severity <strong>of</strong> the disease [47] .<br />

Therapy with antioxidants administered intravenously<br />

has been investigated in a prospective double-blind<br />

placebo controlled randomized trial on patients with<br />

predicted severe AP but no effect on m<strong>or</strong>tality could be<br />

demonstrated [48] . The prophylactic effect on the incidence<br />

<strong>of</strong> PEP was tested in two randomized prospective<br />

randomized trials with 256 and 106 patients, respectively.<br />

N-acetylcysteine (NAC) was administered bef<strong>or</strong>e and after<br />

ERCP and both studies concluded that NAC was without<br />

any preventive effect [49,50] . Thus, there is no <strong>evidence</strong> f<strong>or</strong><br />

the use <strong>of</strong> NAC.<br />

NGL<br />

NGL is a don<strong>or</strong> <strong>of</strong> nitrogen oxide (NO), which causes<br />

vasodilatation and reduces cardiac preload. The main<br />

indication f<strong>or</strong> using NGL is angina pect<strong>or</strong>is [51] .<br />

Experimental animal models have shown reduced<br />

pancreatic edema when administering NO as an infusion [52] ,<br />

but until now no clinical randomized trials using NGL in<br />

the treatment <strong>of</strong> AP have been published. As prophylaxis<br />

pri<strong>or</strong> to ERCP three prospective randomized trials have<br />

evaluated NGL. NO induces periampullary sphincter<br />

relaxation and dilation <strong>of</strong> the micro vascular vessels,<br />

which hypothetically improve pancreatic circulation and<br />

nutrition [53] .<br />

Sudhindran et al observed in a study <strong>of</strong> 186 patients<br />

randomized to either NGL 2 mg sublingual 5 min pri<strong>or</strong><br />

to ERCP <strong>or</strong> placebo, an incidence <strong>of</strong> PEP in the NGL<br />

group <strong>of</strong> 8% compared to 18% (P < 0.05) in the placebo<br />

group [54] . This finding was supp<strong>or</strong>ted by M<strong>or</strong>eto et al who<br />

randomized 144 patients to either NGL as dermal patch <strong>or</strong><br />

placebo, and found a significant reduction in the incidence<br />

<strong>of</strong> PEP (4% vs 16%, P < 0.05) [55] . Both studies have<br />

been criticized f<strong>or</strong> having a surprisingly high incidence<br />

<strong>of</strong> PEP in the placebo groups [56] . In a recently published<br />

prospective randomized trial <strong>of</strong> 318 patients the overall<br />

incidence <strong>of</strong> PEP was 7.5% and no significant difference<br />

between the NGL group and the placebo group was<br />

revealed [57] .<br />

NGL has the optimal qualities as a prophylactic agent<br />

as it is cheap and easy to administer. However further trials<br />

are needed to determine its potential use as prophylaxis<br />

against PEP.<br />

C<strong>or</strong>ticosteroids<br />

C<strong>or</strong>ticosteroids are potent unspecific anti-inflammat<strong>or</strong>y

---

Bang UC et al . Pharmacological approach to AP 2971<br />

drugs utilized in a variety <strong>of</strong> inflammat<strong>or</strong>y diseases. Several<br />

case rep<strong>or</strong>ts have suspected steroids <strong>of</strong> being the etiology<br />

to iatrogenic AP but a definitive relationship has not been<br />

established [58-60] .<br />

In rat models <strong>of</strong> AP hydroc<strong>or</strong>tisone has reduced<br />

m<strong>or</strong>tality and blood cytokine levels [61,62] . No human trials<br />

using steroids as treatment <strong>of</strong> AP have been published<br />

and attempts to show a beneficial effect <strong>of</strong> steroids as<br />

prophylaxis against PEP in prospective placebo-controlled<br />

trials have so far been disappointing. In 1999 De Palma<br />

et al randomized 539 patients to either placebo (n =<br />

266) <strong>or</strong> hydroc<strong>or</strong>tisone 100 mg (n = 273) administered<br />

intravenously pri<strong>or</strong> to ERCP. The total incidence <strong>of</strong> PEP<br />

was 5.3% (n = 28) and no significant difference between<br />

the two groups could be demonstrated [63] . In a Polish trial<br />

published in 2001, 300 patients received <strong>or</strong>al prednisone<br />

40 mg, allopurinol 200 mg <strong>or</strong> placebo 15 h and 3 h<br />

pri<strong>or</strong> to ERCP. The total incidence <strong>of</strong> PEP was 10.7%<br />

and no significant difference among the three groups<br />

was displayed [64] . Sherman et al have confirmed these<br />

negative findings in an even larger prospective trial with<br />

1115 patients [65] .<br />

Although steroids have the potential to inhibit the<br />

inflammat<strong>or</strong>y cascade there is no <strong>evidence</strong> f<strong>or</strong> the use<br />

<strong>of</strong> neither hydroc<strong>or</strong>tisone n<strong>or</strong> prednisone as prophylaxis<br />

against PEP.<br />

NSAID<br />

NSAID have an analgesic as well as an anti-inflammat<strong>or</strong>y<br />

effect. Most NSAID act as non-selective inhibit<strong>or</strong>s <strong>of</strong><br />

the enzyme COX which catalyses the f<strong>or</strong>mation <strong>of</strong><br />

prostaglandins and thromboxane from arachidonic acid.<br />

NSAID are used f<strong>or</strong> virtually every known inflammat<strong>or</strong>y<br />

disease.<br />

Salicylic acid and indomethacin have in isolated case<br />

rep<strong>or</strong>ts been related to the development <strong>of</strong> AP [66-68]<br />

as has the selective cyclooxygenase (COX)-2 inhibit<strong>or</strong><br />

celecoxib [69-72] .<br />

Experimental animal models studying the effect <strong>of</strong><br />

NSAID on AP have been contradict<strong>or</strong>y and not revealed<br />

any effect on m<strong>or</strong>tality [73-76] .<br />

The only randomized human study on the therapeutic<br />

effect <strong>of</strong> NSAID on AP has been conducted by Ebbehøj<br />

et al who included 30 patients randomized in two groups<br />

receiving either indomethacin supposit<strong>or</strong>ies 50 mg twice<br />

daily f<strong>or</strong> 7 d <strong>or</strong> placebo. No difference in serum amylase<br />

<strong>or</strong> calcium was observed but patients in the indomethacin<br />

group demanded less opiate as analgesics during<br />

hospitalization. M<strong>or</strong>tality was not registered [77] .<br />

Two studies testing the prophylactic effect <strong>of</strong><br />

indomethacin given pri<strong>or</strong> to ERCP to prevent PEP have<br />

been published. Montano et al included 117 patients, who<br />

received either indomethacin supposit<strong>or</strong>ies 100 mg <strong>or</strong><br />

placebo 2 h pri<strong>or</strong> to ERCP. The incidence <strong>of</strong> PEP was<br />

2.5% and 6.8% respectively but the difference was not<br />

significantly different [78] . In a larger study from Iran 490<br />

participants received 100 mg indomethacin supposit<strong>or</strong>ies<br />

<strong>or</strong> placebo and an incidence <strong>of</strong> PEP <strong>of</strong> 3.2% in the<br />

indomethacin group and 6.8% in the placebo group was<br />

observed. The difference was only b<strong>or</strong>derline significant<br />

different (P = 0.06) and a post hoc analysis showed<br />

significant lower incidence <strong>of</strong> PEP in the subpopulation<br />

<strong>of</strong> patients who underwent pancreatography [79] . However<br />

this conclusion was hampered by the fact that the post hoc<br />

analysis was conducted on 10 subpopulations, which in<br />

general reduces the statistical power considerably [80] .<br />

Another NSAID, dicl<strong>of</strong>enac, has been investigated in<br />

a study including 220 patients receiving either dicl<strong>of</strong>enac<br />

supposit<strong>or</strong>ies 100 mg <strong>or</strong> placebo immediately after ERCP.<br />

PEP occurred with lower frequency in the group receiving<br />

dicl<strong>of</strong>enac compared to the placebo group (6% vs 15%,<br />

P < 0.05) [81] .<br />

The overall impression from placebo-controlled trials<br />

suggests a beneficial effect <strong>of</strong> NSAID used as prophylaxis<br />

against PEP. Both dicl<strong>of</strong>enac and indomethacin can be<br />

administered easily as supposit<strong>or</strong>ies and are inexpensive<br />

drugs. Still, placebo controlled randomized trials with<br />

a larger sample size are needed to verify this promising<br />

effect.<br />

IL-10<br />

IL-10 is produced and released by the helper T cells and its<br />

primary effect is anti-inflammat<strong>or</strong>y. Clinical observations<br />

have shown increased levels <strong>of</strong> IL-10 in the blood during<br />

AP but its role in the treatment <strong>of</strong> AP remains to be<br />

determined [82,83] . The effect <strong>of</strong> IL-10 on AP has been<br />

validated in two experimental studies which showed a<br />

reduced m<strong>or</strong>tality [84,85] .<br />

No human study on the therapeutic effect <strong>of</strong> IL-10<br />

has been conducted but the prophylactic effect <strong>of</strong> IL-10<br />

on PEP has been evaluated in two randomized studies. No<br />

significant difference among the IL-10 and placebo-treated<br />

group was observed in a study with 200 patients receiving<br />

either recombinant IL-10 (8 μg/kg) <strong>or</strong> placebo (9% vs<br />

11%, P = 0.65) [86] . A second study randomized 137 patients<br />

to placebo <strong>or</strong> IL-10 (4 μg/kg <strong>or</strong> 20 μg/kg) administered<br />

30 min pri<strong>or</strong> to ERCP. Overall incidence <strong>of</strong> PEP was 14%<br />

and a significant difference in the incidence among the<br />

three groups was noted (24%, 10%, and 7%). However the<br />

incidence <strong>of</strong> PEP in the placebo was remarkable high [87] .<br />

The results from these two published studies do not<br />

definitively supp<strong>or</strong>t the use <strong>of</strong> IL-10 as prophylaxis against<br />

PEP.<br />

TNF-α<br />

During AP the serum level <strong>of</strong> TNF-α is elevated [88,89] .<br />

The synthesis and release <strong>of</strong> TNF-α takes place in<br />

macrophages located in the pancreas. SAC may as well<br />

release TNF-α and do also express TNF-α recept<strong>or</strong>s<br />

during AP [90-92] . A possible relationship between genetic<br />

polym<strong>or</strong>phism and severity <strong>of</strong> AP has been established [93] .<br />

Blocking the TNF-α mediated inflammation with<br />

anti-TNF-α antibodies <strong>or</strong> pentoxifylline seems to have<br />

a beneficial effect on histology sc<strong>or</strong>e and m<strong>or</strong>tality in<br />

experimental animal models [94-98] .<br />

No data on humans has hitherto been published<br />

apart from a single case-rep<strong>or</strong>t concerning a patient with<br />

interstitial pancreatitis. In this case, a male patient with<br />

severe bloody diarrhea due to segmental Crohn’s disease<br />

also showed signs <strong>of</strong> AP. Serum amylase was high and<br />

ultrasound and abdominal computer tomography (CT)<br />

scans revealed an edematous pancreas. Because <strong>of</strong> these<br />

www.wjgnet.com

---

2972 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

findings treatment with steroids and azathioprine was<br />

abandoned and instead a single infusion with infliximab<br />

5 mg/kg was administered without complications. The<br />

patient's overall condition improved and serum amylase<br />

levels n<strong>or</strong>malized [99] .<br />

Thus experimental data suggest a potential role <strong>of</strong><br />

specific TNF-α inhibition in the treatment <strong>of</strong> AP, but<br />

high risk <strong>of</strong> bacterial infection during AP is a matter<br />

<strong>of</strong> concern. Infliximab has been evaluated in alcoholic<br />

hepatitis, another condition associated with a high risk <strong>of</strong><br />

bacterial infection. The administration <strong>of</strong> prednisolone<br />

40 mg daily and infliximab 10 mg/kg at wk 0, 2 and 4<br />

showed an increased m<strong>or</strong>tality due to infection and the<br />

study was terminated prematurely by the monit<strong>or</strong>ing<br />

committee [100] .<br />

Hence clinical studies on AP must be carefully designed<br />

to evaluate the safety <strong>of</strong> infliximab <strong>or</strong> other specific<br />

TNF-α inhibit<strong>or</strong>.<br />

PAF<br />

PAF was discovered in the 1970’s and soon recognized<br />

to be an imp<strong>or</strong>tant inflammat<strong>or</strong>y mediat<strong>or</strong> [101] . Later<br />

studies with experimental pancreatitis revealed that PAF<br />

is released during AP [102] and induce AP when infused<br />

in arteries supplying the pancreas [103,104] . Experimental<br />

studies have shown a benefit from PAF inhibition<br />

with various antagonists on pancreatic edema and<br />

systemic inflammation as well as a decreased bacterial<br />

translocation [105-107] .<br />

As a consequence <strong>of</strong> the promising results with<br />

experimental AP different clinical studies have evaluated<br />

the effect <strong>of</strong> PAF inhibition. The first trial consisted <strong>of</strong> 83<br />

patients with AP receiving lexipafant (n = 42) <strong>or</strong> placebo<br />

(n = 41). Lexipafant was administered intravenously<br />

(60 mg/d f<strong>or</strong> 3 d) and follow-up was assessed f<strong>or</strong> 5 d by<br />

Organ Failure Sc<strong>or</strong>e (OFS). The investigat<strong>or</strong>s rep<strong>or</strong>ted a<br />

greater reduction in OFS in the lexipafant group (0.905<br />

vs 0.341, P = 0.048), but during the 5 d period m<strong>or</strong>tality<br />

was unaffected [108] . These findings were confirmed in<br />

a second trial including only patients with severe AP.<br />

The participants received lexipafant (n = 27), 100 mg/d<br />

f<strong>or</strong> 5-7 d <strong>or</strong> placebo (n = 23). In the treatment group<br />

a larger reduction in OFS was registered (1.42 vs 0.17,<br />

P = 0.003). Overall m<strong>or</strong>tality was 18% with no difference<br />

between the groups [109] . The last study was published in<br />

2001 and involved 286 patients with severe AP. Lexipafant<br />

(100 mg/d, n = 148) <strong>or</strong> placebo (n = 138) was administered<br />

f<strong>or</strong> 7 d. No positive effect could be shown neither on<br />

OFS n<strong>or</strong> m<strong>or</strong>tality [110] . It has been argued that data on<br />

the effect <strong>of</strong> lexipafant on m<strong>or</strong>tality from experimental<br />

AP were warranted bef<strong>or</strong>e initiation <strong>of</strong> human trials<br />

and the spons<strong>or</strong>’s communication <strong>of</strong> the result has been<br />

questionable [111] . After the termination <strong>of</strong> the clinical trials<br />

the lack <strong>of</strong> effect on m<strong>or</strong>tality in experimental AP was<br />

acknowledged [112] . Randomized trials on sepsis were also<br />

disappointing [113,114] and inhibition <strong>of</strong> PAF in the treatment<br />

<strong>of</strong> AP has thus been abandoned.<br />

Antibiotics<br />

Antibiotics is used to prevent <strong>or</strong> treat infected necrosis in<br />

www.wjgnet.com<br />

the pancreas and does not have potential to change the<br />

pathobiologic course <strong>of</strong> AP. Infected necrosis in pancreas<br />

is a maj<strong>or</strong> clinical problem during AP which severely<br />

deteri<strong>or</strong>ate the prognosis [115,116] . Hence, administration<br />

<strong>of</strong> antibiotics to prevent infection has been evaluated in<br />

several randomized trials.<br />

Sainio et al randomized 60 patients with necrotizing<br />

pancreatitis. The inclusion criteria were C-reactive protein<br />

> 120 mg/L and pancreatic necrosis verified by an<br />

abdominal CT scan. The treated group received infusion<br />

<strong>of</strong> cefuroxim 1.5 g × 3 daily, while patients allocated to the<br />

control group only received antibiotics in case <strong>of</strong> clinical<br />

signs <strong>of</strong> infection. A significant higher m<strong>or</strong>tality was<br />

registered in the control group compared to the cefuroxim<br />

group (23% vs 3%, P = 0.03) [117] .<br />

Pederzoli et al randomized 74 patients with CT verified<br />

pancreatic necrosis to receive either imipenem <strong>or</strong> placebo<br />

but no effect on m<strong>or</strong>tality was registered [118] . In another<br />

prospective randomized study with 90 patients N<strong>or</strong>dback<br />

et al administered imipenem intravenously 1.0 g × 3 daily<br />

and found a reduced incidence <strong>of</strong> multi<strong>or</strong>gan failure<br />

compared to the control group (28% vs 76%, P = 0.0003)<br />

but no difference in m<strong>or</strong>tality [119] .<br />

The studies described above are open-label trials. In<br />

2004 Isenmann et al published a controlled double-blind<br />

study <strong>of</strong> 114 patients with CT verified necrotizing AP. The<br />

inclusion criteria were C-reactive protein > 150 mg/L and/<strong>or</strong><br />

CT-verified pancreas necrosis. Placebo was compared to<br />

a combination <strong>of</strong> cipr<strong>of</strong>loxacin and metronidazole and if<br />

any complications occurred the treatment was converted<br />

to open conventional treatment. No difference in m<strong>or</strong>tality<br />

<strong>or</strong> incidence <strong>of</strong> pancreas necrosis could be shown [120] .<br />

A Cochrane meta-analysis <strong>of</strong> 294 patients with CTverified<br />

pancreas necrosis showed a reduced m<strong>or</strong>tality<br />

in patients with necrotizing AP when beta-lactams<br />

and quinolones were administered intravenously as<br />

prophylaxis [121] .<br />

The subject continues to be a matter <strong>of</strong> debate and<br />

recommendations from maj<strong>or</strong> clinical associations have<br />

different approaches to this issue [4,2,34] .<br />

Studies on the effect <strong>of</strong> prophylactic antibiotics given<br />

pri<strong>or</strong> to ERCP are limited. In a study by Raty et al with 315<br />

patients cephtazidime was administered intravenously pri<strong>or</strong><br />

to ERCP compared with a control group. They found<br />

reduced incidence <strong>of</strong> PEP and cholangitis in the treatment<br />

group (3% vs 9%, P = 0.009) [122] . However the study<br />

was not placebo-controlled and routine administration<br />

<strong>of</strong> antibiotics pri<strong>or</strong> to ERCP cannot be recommended<br />

until randomized placebo controlled studies confirm this<br />

finding.<br />

Probiotics<br />

Intestinal permeability is increased during AP, which may<br />

facilitate translocation <strong>of</strong> bacteria from the intestinal<br />

lumen. Oral probiotics are living micro<strong>or</strong>ganisms that<br />

exert health benefits beyond those <strong>of</strong> inherent basic<br />

nutrition [123] .<br />

Olah et al conducted two prospective placebo<br />

controlled double-blinded studies <strong>of</strong> the therapeutic effect<br />

<strong>of</strong> probiotics to AP. The studies were published in 2002

---

Bang UC et al . Pharmacological approach to AP 2973<br />

and 2007 including 45 and 62 patients with interstitial<br />

<strong>or</strong> severe AP. In the latter study reduced m<strong>or</strong>tality in the<br />

probiotics groups was observed but the difference was not<br />

statistical significant [124,125] .<br />

CONCLUSION<br />

As described in this review we only have limited <strong>evidence</strong><br />

<strong>based</strong> pharmacological approaches when treating AP and<br />

none <strong>of</strong> these are curative. Several treatments including<br />

animal experimental studies have been tried in <strong>or</strong>der to<br />

establish <strong>evidence</strong> f<strong>or</strong> etiology <strong>based</strong> medical treatment<br />

(Tables 1 and 2). In Italy and Japan gabexate is used<br />

routinely with the aim to limit pancreatic auto-digestion,<br />

but as rep<strong>or</strong>ted in this review there is no conclusive<br />

<strong>evidence</strong> f<strong>or</strong> this approach.<br />

Octreotide may be considered as prophylaxis against<br />

PEP but high cost <strong>of</strong> this peptide h<strong>or</strong>mone limits its<br />

potential in clinical <strong>practice</strong>. A much cheaper alternative is<br />

NSAID, which may be considered as prophylaxis against<br />

PEP.<br />

Antibiotics are the drugs <strong>of</strong> choice when infection<br />

is evident. However, recommendations regarding<br />

the prevention <strong>of</strong> infected pancreatic necrosis are<br />

contradict<strong>or</strong>y.<br />

Various problems are encountered when designing<br />

clinical studies <strong>of</strong> AP. The low incidence <strong>of</strong> severe<br />

necrotizing AP constitutes a maj<strong>or</strong> problem, which<br />

demands multicenter studies. Another clinical challenge<br />

is the resemblance <strong>of</strong> AP to infection and bef<strong>or</strong>e<br />

initialization <strong>of</strong> any experimental anti-inflammat<strong>or</strong>y<br />

therapy bacterial infection must be refuted. This delays<br />

the start-up <strong>of</strong> the experimental protocol and causes<br />

bias as the patients in the meantime receive anti-bacterial<br />

treatment. A possible solution could be to administer<br />

antibiotics to all patients in combination with specific antiinflammat<strong>or</strong>y<br />

treatment <strong>or</strong> placebo.<br />

In spite <strong>of</strong> these challeng es the search f<strong>or</strong><br />

pharmacological treatment <strong>of</strong> AP must be sustained. As<br />

we present in this review experimental animal models<br />

supp<strong>or</strong>t a potential effect <strong>of</strong> several anti-inflammat<strong>or</strong>y<br />

drugs, which are candidates f<strong>or</strong> randomized trials. The<br />

most interesting <strong>of</strong> these potential drugs is probably<br />

steroids, which are standard treatment <strong>of</strong> numerous<br />

inflammat<strong>or</strong>y diseases but have never been investigated in<br />

the treatment <strong>of</strong> AP.<br />

Because the outcome <strong>of</strong> the disease depends highly<br />

on the involvement <strong>of</strong> other <strong>or</strong>gans, developing methods<br />

that inhibit the inflammat<strong>or</strong>y signaling pathways presents<br />

a great potential. As new inf<strong>or</strong>mation regarding the<br />

inflammat<strong>or</strong>y pathways continues to emerge from animal<br />

and clinical trials, specific treatment targeting these<br />

inflammat<strong>or</strong>y processes should be considered. It is our<br />

opinion that animal models at this time supp<strong>or</strong>t clinical<br />

trials with anti-TNF-α antibodies although a randomized<br />

trial must be designed not f<strong>or</strong>getting the safety issue.<br />

REFERENCES<br />

1 Lankisch PG, Lerch MM. Pharmacological prevention and<br />

treatment <strong>of</strong> acute pancreatitis: where are we now? Dig Dis<br />

2006; 24: 148-159<br />

2 Pandol SJ, Saluja AK, Imrie CW, Banks PA. Acute pancreatitis:<br />

bench to the bedside. Gastroenterology 2007; 132: 1127-1151<br />

3 Makhija R, Kingsn<strong>or</strong>th AN. Cytokine st<strong>or</strong>m in acute<br />

pancreatitis. J Hepatobiliary Pancreat Surg 2002; 9: 401-410<br />

4 Banks PA, Freeman ML. Practice guidelines in acute<br />

pancreatitis. Am J Gastroenterol 2006; 101: 2379-2400<br />

5 S h e r m a n S , R u f f o l o T A , H a w e s R H , L e h m a n G A .<br />

Complications <strong>of</strong> endoscopic sphincterotomy. A prospective<br />

series with emphasis on the increased risk associated with<br />

sphincter <strong>of</strong> Oddi dysfunction and nondilated bile ducts.<br />

Gastroenterology 1991; 101: 1068-1075<br />

6 Freeman ML, DiSario JA, Nelson DB, Fennerty MB, Lee JG,<br />

Bj<strong>or</strong>kman DJ, Overby CS, Aas J, Ryan ME, Bochna GS, Shaw<br />

MJ, Snady HW, Erickson RV, Mo<strong>or</strong>e JP, Roel JP. Risk fact<strong>or</strong>s<br />

f<strong>or</strong> post-ERCP pancreatitis: a prospective, multicenter study.<br />

Gastrointest Endosc 2001; 54: 425-434<br />

7 Cheng CL, Sherman S, Watkins JL, Barnett J, Freeman M,<br />

Geenen J, Ryan M, Parker H, Frakes JT, Fogel EL, Silverman<br />

WB, Dua KS, Aliperti G, Yakshe P, Uzer M, Jones W, G<strong>of</strong>f J,<br />

Lazzell-Pannell L, Rashdan A, Temkit M, Lehman GA. Risk<br />

fact<strong>or</strong>s f<strong>or</strong> post-ERCP pancreatitis: a prospective multicenter<br />

study. Am J Gastroenterol 2006; 101: 139-147<br />

8 Katz MD, Erstad BL. Octreotide, a new somatostatin analogue.<br />

Clin Pharm 1989; 8: 255-273<br />

9 Cavallini G, Frulloni L. Somatostatin and octreotide in acute<br />

pancreatitis: the never-ending st<strong>or</strong>y. Dig Liver Dis 2001; 33:<br />

192-201<br />

10 Uhl W, Buchler MW, Malfertheiner P, Beger HG, Adler G,<br />

Gaus W. A randomised, double blind, multicentre trial <strong>of</strong><br />

octreotide in moderate to severe acute pancreatitis. Gut 1999;<br />

45: 97-104<br />

11 Poon RT, Yeung C, Liu CL, Lam CM, Yuen WK, Lo CM,<br />

Tang A, Fan ST. Intravenous bolus somatostatin after<br />

diagnostic cholangiopancreatography reduces the incidence <strong>of</strong><br />

pancreatitis associated with therapeutic endoscopic retrograde<br />

cholangiopancreatography procedures: a randomised<br />

controlled trial. Gut 2003; 52: 1768-1773<br />

12 Arvanitidis D, Anagnostopoulos GK, Giannopoulos D,<br />

Pantes A, Agaritsi R, Margantinis G, Tsiakos S, Sak<strong>or</strong>afas<br />

G, Kostopoulos P. Can somatostatin prevent post-ERCP<br />

pancreatitis? Results <strong>of</strong> a randomized controlled trial. J<br />

Gastroenterol Hepatol 2004; 19: 278-282<br />

13 Thomopoulos KC, Pagoni NA, Vagenas KA, Margaritis<br />

VG, Theocharis GI, Nikolopoulou VN. Twenty-four hour<br />

prophylaxis with increased dosage <strong>of</strong> octreotide reduces the<br />

incidence <strong>of</strong> post-ERCP pancreatitis. Gastrointest Endosc 2006;<br />

64: 726-731<br />

14 Andriulli A, Clemente R, Solmi L, Terruzzi V, Suriani R,<br />

Sigillito A, Leandro G, Leo P, De Maio G, Perri F. Gabexate<br />

<strong>or</strong> somatostatin administration bef<strong>or</strong>e ERCP in patients at<br />

high risk f<strong>or</strong> post-ERCP pancreatitis: a multicenter, placebocontrolled,<br />

randomized clinical trial. Gastrointest Endosc 2002;<br />

56: 488-495<br />

15 Andriulli A, Solmi L, Loperfido S, Leo P, Festa V, Belmonte<br />

A, Spirito F, Silla M, F<strong>or</strong>te G, Terruzzi V, Marenco G, Ciliberto<br />

E, Sabatino A, Monica F, Magnolia MR, Perri F. Prophylaxis<br />

<strong>of</strong> ERCP-related pancreatitis: a randomized, controlled trial <strong>of</strong><br />

somatostatin and gabexate mesylate. Clin Gastroenterol Hepatol<br />

2004; 2: 713-718<br />

16 Andriulli A, Leandro G, Federici T, Ippolito A, F<strong>or</strong>lano<br />

R, Iacobellis A, Annese V. Prophylactic administration <strong>of</strong><br />

somatostatin <strong>or</strong> gabexate does not prevent pancreatitis after<br />

ERCP: an updated meta-analysis. Gastrointest Endosc 2007; 65:<br />

624-632<br />

17 Li ZS, Pan X, Zhang WJ, Gong B, Zhi FC, Guo XG, Li PM, Fan<br />

ZN, Sun WS, Shen YZ, Ma SR, Xie WF, Chen MH, Li YQ. Effect<br />

<strong>of</strong> octreotide administration in the prophylaxis <strong>of</strong> post-ERCP<br />

pancreatitis and hyperamylasemia: A multicenter, placebocontrolled,<br />

randomized clinical trial. Am J Gastroenterol 2007;<br />

102: 46-51<br />

18 M<strong>or</strong>bidity <strong>of</strong> acute pancreatitis: the effect <strong>of</strong> aprotinin and<br />

glucagon. Gut 1980; 21: 334-339<br />

www.wjgnet.com

---

2974 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

19 Trapnell JE, Rigby CC, Talbot CH, Duncan EH. A controlled<br />

trial <strong>of</strong> Trasylol in the treatment <strong>of</strong> acute pancreatitis. Br J Surg<br />

1974; 61: 177-182<br />

20 Wisner JR Jr, Renner IG, Grendell JH, Niederau C, Ferrell LD.<br />

Gabexate mesilate (FOY) protects against ceruletide-induced<br />

acute pancreatitis in the rat. Pancreas 1987; 2: 181-186<br />

21 Tympner F, Rosch W. [Effect <strong>of</strong> secretin and gabexate-mesilate<br />

(synthetic protease inhibit<strong>or</strong>) on serum amylase level after<br />

ERCP] Z Gastroenterol 1982; 20: 688-693<br />

22 Freise J, Melzer P, Schmidt FW, H<strong>or</strong>bach L. [Gabexate<br />

mesilate in the treatment <strong>of</strong> acute pancreatitis. Results <strong>of</strong> a<br />

Hannover multicenter double-blind study with 50 patients] Z<br />

Gastroenterol 1986; 24: 200-211<br />

23 Yang CY, Chang-Chien CS, Liaw YF. Controlled trial <strong>of</strong><br />

protease inhibit<strong>or</strong> gabexelate mesilate (FOY) in the treatment<br />

<strong>of</strong> acute pancreatitis. Pancreas 1987; 2: 698-700<br />

24 Harada H, Miyake H, Ochi K, Tanaka J, Kimura I. Clinical<br />

trial with a protease inhibit<strong>or</strong> gabexate mesilate in acute<br />

pancreatitis. Int J Pancreatol 1991; 9: 75-79<br />

25 Valderrama R, Perez-Mateo M, Navarro S, Vazquez N,<br />

Sanjose L, Adrian MJ, Estruch J. Multicenter double-blind trial<br />

<strong>of</strong> gabexate mesylate (FOY) in unselected patients with acute<br />

pancreatitis. Digestion 1992; 51: 65-70<br />

26 Buchler M, Malfertheiner P, Uhl W, Scholmerich J, Stockmann<br />

F, Adler G, Gaus W, Rolle K, Beger HG. Gabexate mesilate in<br />

human acute pancreatitis. German Pancreatitis Study Group.<br />

Gastroenterology 1993; 104: 1165-1170<br />

27 Chen HM, Chen JC, Hwang TL, Jan YY, Chen MF. Prospective<br />

and randomized study <strong>of</strong> gabexate mesilate f<strong>or</strong> the treatment<br />

<strong>of</strong> severe acute pancreatitis with <strong>or</strong>gan dysfunction.<br />

Hepatogastroenterology 2000; 47: 1147-1150<br />

28 Seta T, Noguchi Y, Shimada T, Shikata S, Fukui T. Treatment<br />

<strong>of</strong> acute pancreatitis with protease inhibit<strong>or</strong>s: a meta-analysis.<br />

Eur J Gastroenterol Hepatol 2004; 16: 1287-1293<br />

29 Takeda K, Matsuno S, Sunamura M, Kakugawa Y. Continuous<br />

regional arterial infusion <strong>of</strong> protease inhibit<strong>or</strong> and antibiotics<br />

in acute necrotizing pancreatitis. Am J Surg 1996; 171: 394-398<br />

30 Takeda K, Yamauchi J, Shibuya K, Sunamura M, Mikami Y,<br />

Matsuno S. Benefit <strong>of</strong> continuous regional arterial infusion <strong>of</strong><br />

protease inhibit<strong>or</strong> and antibiotic in the management <strong>of</strong> acute<br />

necrotizing pancreatitis. Pancreatology 2001; 1: 668-673<br />

31 Cavallini G, Tittobello A, Frulloni L, Masci E, Mariana A,<br />

Di Francesco V. Gabexate f<strong>or</strong> the prevention <strong>of</strong> pancreatic<br />

damage related to endoscopic retrograde cholangiopancreat<br />

ography. Gabexate in digestive endoscopy--Italian Group. N<br />

Engl J Med 1996; 335: 919-923<br />

32 Zheng M, Chen Y, Yang X, Li J, Zhang Y, Zeng Q. Gabexate in<br />

the prophylaxis <strong>of</strong> post-ERCP pancreatitis: a meta-analysis <strong>of</strong><br />

randomized controlled trials. BMC Gastroenterol 2007; 7: 6<br />

33 Manes G, Ardizzone S, Lombardi G, Uomo G, Pieramico<br />

O, P<strong>or</strong>ro GB. Efficacy <strong>of</strong> postprocedure administration <strong>of</strong><br />

gabexate mesylate in the prevention <strong>of</strong> post-ERCP pancreatitis:<br />

a randomized, controlled, multicenter study. Gastrointest<br />

Endosc 2007; 65: 982-987<br />

34 Whitcomb DC. Clinical <strong>practice</strong>. Acute pancreatitis. N Engl J<br />

Med 2006; 354: 2142-2150<br />

35 Otsuki M, Hirota M, Arata S, Koizumi M, Kawa S, Kamisawa T,<br />

Takeda K, Mayumi T, Kitagawa M, Ito T, Inui K, Shimosegawa<br />

T, Tanaka S, Kataoka K, Saisho H, Okazaki K, Kuroda Y,<br />

Sawabu N, Takeyama Y. Consensus <strong>of</strong> primary care in acute<br />

pancreatitis in Japan. W<strong>or</strong>ld J Gastroenterol 2006; 12: 3314-3323<br />

36 Pelagotti F, Cecchi M, Mess<strong>or</strong>i A. Use <strong>of</strong> gabexate mesylate<br />

in Italian hospitals: a multicentre observational study. J Clin<br />

Pharm Ther 2003; 28: 191-196<br />

37 Sweiry JH, Mann GE. Role <strong>of</strong> oxidative stress in the<br />

pathogenesis <strong>of</strong> acute pancreatitis. Scand J Gastroenterol Suppl<br />

1996; 219: 10-15<br />

38 Neuschwander-Tetri BA, Ferrell LD, Sukhabote RJ, Grendell<br />

JH. Glutathione monoethyl ester ameli<strong>or</strong>ates caeruleininduced<br />

pancreatitis in the mouse. J Clin Invest 1992; 89:<br />

109-116<br />

39 Demols A, Van Laethem JL, Quertinmont E, Legros F, Louis H,<br />

Le Moine O, Deviere J. N-acetylcysteine decreases severity <strong>of</strong><br />

www.wjgnet.com<br />

acute pancreatitis in mice. Pancreas 2000; 20: 161-169<br />

40 Sevillano S, De la Mano AM, De Dios I, Ramudo L, Manso<br />

MA. Maj<strong>or</strong> pathological mechanisms <strong>of</strong> acute pancreatitis are<br />

prevented by N-acetylcysteine. Digestion 2003; 68: 34-40<br />

41 Mumcu S, Alhan E, Turkyilmaz S, Kural BV, Ercin C,<br />

Kalyoncu NI. Effects <strong>of</strong> N-acetylcysteine on acute necrotizing<br />

pancreatitis in rats. Eur Surg Res 2005; 37: 173-178<br />

42 Ramudo L, Manso MA, Vicente S, De Dios I. Pro- and<br />

anti-inflammat<strong>or</strong>y response <strong>of</strong> acinar cells during acute<br />

pancreatitis. Effect <strong>of</strong> N-acetyl cysteine. Cytokine 2005; 32:<br />

125-131<br />

43 Esrefoglu M, Gul M, Ates B, Yilmaz I. Ultrastructural clues<br />

f<strong>or</strong> the protective effect <strong>of</strong> asc<strong>or</strong>bic acid and N-acetylcysteine<br />

against oxidative damage on caerulein-induced pancreatitis.<br />

Pancreatology 2006; 6: 477-485<br />

44 Manso MA, Ramudo L, De Dios I. Extrapancreatic <strong>or</strong>gan<br />

impairment during acute pancreatitis induced by bilepancreatic<br />

duct obstruction. Effect <strong>of</strong> N-acetylcysteine. Int J<br />

Exp Pathol 2007; 88: 343-349<br />

45 Scott P, Bruce C, Sch<strong>of</strong>ield D, Shiel N, Braganza JM, McCloy<br />

RF. Vitamin C status in patients with acute pancreatitis. Br J<br />

Surg 1993; 80: 750-754<br />

46 Braganza JM, Scott P, Bilton D, Sch<strong>of</strong>ield D, Chaloner C, Shiel<br />

N, Hunt LP, Bottiglieri T. Evidence f<strong>or</strong> early oxidative stress<br />

in acute pancreatitis. Clues f<strong>or</strong> c<strong>or</strong>rection. Int J Pancreatol 1995;<br />

17: 69-81<br />

47 Bonham MJ, Abu-Zidan FM, Simovic MO, Sluis KB,<br />

Wilkinson A, Winterbourn CC, Winds<strong>or</strong> JA. Early asc<strong>or</strong>bic<br />

acid depletion is related to the severity <strong>of</strong> acute pancreatitis.<br />

Br J Surg 1999; 86: 1296-1301<br />

48 Siriwardena AK, Mason JM, Balachandra S, Bagul A,<br />

Galloway S, F<strong>or</strong>mela L, Hardman JG, Jamdar S. Randomised,<br />

double blind, placebo controlled trial <strong>of</strong> intravenous<br />

antioxidant (n-acetylcysteine, selenium, vitamin C) therapy in<br />

severe acute pancreatitis. Gut 2007; 56: 1439-1444<br />

49 Katsinelos P, Kountouras J, Paroutoglou G, Beltsis A, Mimidis<br />

K, Zavos C. Intravenous N-acetylcysteine does not prevent<br />

post-ERCP pancreatitis. Gastrointest Endosc 2005; 62: 105-111<br />

50 Milewski J, Rydzewska G, Degowska M, Kierzkiewicz<br />

M, Rydzewski A. N-acetylcysteine does not prevent<br />

post-endoscopic retrograde cholangiopancreatography<br />

hyperamylasemia and acute pancreatitis. W<strong>or</strong>ld J Gastroenterol<br />

2006; 12: 3751-3755<br />

51 S<strong>or</strong>kin EM, Brogden RN, Romankiewicz JA. Intravenous<br />

glyceryl trinitrate (nitroglycerin). A review <strong>of</strong> its pharmacological<br />

properties and therapeutic efficacy. Drugs 1984; 27: 45-80<br />

52 Werner J, Rivera J, Fernandez-del Castillo C, Lewandrowski<br />

K, Adrie C, Rattner DW, Warshaw AL. Differing roles <strong>of</strong><br />

nitric oxide in the pathogenesis <strong>of</strong> acute edematous versus<br />

necrotizing pancreatitis. Surgery 1997; 121: 23-30<br />

53 Wehrmann T, Schmitt T, Stergiou N, Caspary WF, Seifert<br />

H. Topical application <strong>of</strong> nitrates onto the papilla <strong>of</strong> Vater:<br />

manometric and clinical results. Endoscopy 2001; 33: 323-328<br />

54 Sudhindran S, Bromwich E, Edwards PR. Prospective<br />

randomized double-blind placebo-controlled trial <strong>of</strong> glyceryl<br />

trinitrate in endoscopic retrograde cholangiopancreatographyinduced<br />

pancreatitis. Br J Surg 2001; 88: 1178-1182<br />

55 M<strong>or</strong>eto M, Zaballa M. Prospective randomized double-blind<br />

placebo-controlled trial <strong>of</strong> glyceryl trinitrate in endoscopic<br />

retrograde cholangiopancreatography-induced pancreatitis. Br<br />

J Surg 2002; 89: 628; auth<strong>or</strong> reply 629<br />

56 Muralidharan V, Jamidar P. Pharmacologic prevention <strong>of</strong><br />

post-ERCP pancreatitis: is nitroglycerin a sangreal? Gastrointest<br />

Endosc 2006; 64: 358-360<br />

57 Kaffes AJ, Bourke MJ, Ding S, Alrubaie A, Kwan V, Williams<br />

SJ. A prospective, randomized, placebo-controlled trial <strong>of</strong><br />

transdermal glyceryl trinitrate in ERCP: effects on technical<br />

success and post-ERCP pancreatitis. Gastrointest Endosc 2006;<br />

64: 351-357<br />

58 Bourne MS, Dawson H. Acute pancreatitis complicating<br />

prednisolone therapy. Lancet 1958; 2: 1209-1210<br />

59 B<strong>or</strong>uchowicz A, Gallon P, Foissey D, Gower P, Gamblin C,<br />

Cuingnet P, Maunoury V, C<strong>or</strong>tot A, Colombel JF. [Acute

---

Bang UC et al . Pharmacological approach to AP 2975<br />

pancreatitis associated with c<strong>or</strong>ticosteroid treatment in<br />

Crohn's disease] Gastroenterol Clin Biol 2003; 27: 560-561<br />

60 Khanna S, Kumar A. Acute pancreatitis due to hydroc<strong>or</strong>tisone<br />

in a patient with ulcerative colitis. J Gastroenterol Hepatol 2003;<br />

18: 1110-1111<br />

61 Glo<strong>or</strong> B, Uhl W, Tcholakov O, Roggo A, Muller CA, W<strong>or</strong>ni M,<br />

Buchler MW. Hydroc<strong>or</strong>tisone treatment <strong>of</strong> early SIRS in acute<br />

experimental pancreatitis. Dig Dis Sci 2001; 46: 2154-2161<br />

62 Lazar G Jr, Varga J, Lazar G, Duda E, Takacs T, Balogh A,<br />

Lonovics J. The effects <strong>of</strong> glucoc<strong>or</strong>ticoids and a glucoc<strong>or</strong>ticoid<br />

antagonist (RU 38486) on experimental acute pancreatitis in<br />

rat. Acta Chir Hung 1997; 36: 190-191<br />

63 De Palma GD, Catanzano C. Use <strong>of</strong> c<strong>or</strong>ticosteriods in the<br />

prevention <strong>of</strong> post-ERCP pancreatitis: results <strong>of</strong> a controlled<br />

prospective study. Am J Gastroenterol 1999; 94: 982-985<br />

64 Budzynska A, Marek T, Nowak A, Kacz<strong>or</strong> R, Nowakowska-<br />

Dulawa E. A prospective, randomized, placebo-controlled<br />

trial <strong>of</strong> prednisone and allopurinol in the prevention <strong>of</strong> ERCPinduced<br />

pancreatitis. Endoscopy 2001; 33: 766-772<br />

65 Sherman S, Blaut U, Watkins JL, Barnett J, Freeman M, Geenen<br />

J, Ryan M, Parker H, Frakes JT, Fogel EL, Silverman WB, Dua<br />

KS, Aliperti G, Yakshe P, Uzer M, Jones W, G<strong>of</strong>f J, Earle D,<br />

Temkit M, Lehman GA. Does prophylactic administration<br />

<strong>of</strong> c<strong>or</strong>ticosteroid reduce the risk and severity <strong>of</strong> post-ERCP<br />

pancreatitis: a randomized, prospective, multicenter study.<br />

Gastrointest Endosc 2003; 58: 23-29<br />

66 Sussman S. Severe salicylism and acute pancreatitis. Calif Med<br />

1963; 99: 29-32<br />

67 Guerra M. Toxicity <strong>of</strong> indomethacin. Rep<strong>or</strong>t <strong>of</strong> a case <strong>of</strong> acute<br />

pancreatitis. JAMA 1967; 200: 552-553<br />

68 Memis D, Akalin E, Yucel T. Indomethacin-induced<br />

pancreatitis: a case rep<strong>or</strong>t. JOP 2005; 6: 344-347<br />

69 Amaravadi RK, Jacobson BC, Solomon DH, Fischer MA. Acute<br />

pancreatitis associated with r<strong>of</strong>ecoxib. Am J Gastroenterol 2002;<br />

97: 1077-1078<br />

70 Nind G, Selby W. Acute pancreatitis: a rare complication <strong>of</strong><br />

celecoxib. Intern Med J 2002; 32: 624-625<br />

71 Baciewicz AM, Sokos DR, King TJ. Acute pancreatitis<br />

associated with celecoxib. Ann Intern Med 2000; 132: 680<br />

72 Carrillo-Jimenez R, Nurnberger M. Celecoxib-induced acute<br />

pancreatitis and hepatitis: a case rep<strong>or</strong>t. Arch Intern Med 2000;<br />

160: 553-554<br />

73 Alhan E, Kalyoncu NI, Ercin C, Kural BV. Effects <strong>of</strong> the<br />

celecoxib on the acute necrotizing pancreatitis in rats.<br />

Inflammation 2004; 28: 303-309<br />

74 Coelle EF, Adham N, Elash<strong>of</strong>f J, Lewin K, Tayl<strong>or</strong> IL. Effects<br />

<strong>of</strong> prostaglandin and indomethacin on diet-induced acute<br />

pancreatitis in mice. Gastroenterology 1983; 85: 1307-1312<br />

75 de Almeida JL, Jukemura J, Coelho AM, Patzina RA,<br />

Machado MC, da Cunha JE. Inhibition <strong>of</strong> cyclooxygenase-2<br />

in experimental severe acute pancreatitis. Clinics 2006; 61:<br />

301-306<br />

76 Foitzik T, Hotz HG, Hotz B, Wittig F, Buhr HJ. Selective<br />

inhibition <strong>of</strong> cyclooxygenase-2 (COX-2) reduces prostaglandin<br />

E2 production and attenuates systemic disease sequelae in<br />

experimental pancreatitis. Hepatogastroenterology 2003; 50:<br />

1159-1162<br />

77 Ebbehoj N, Friis J, Svendsen LB, Bulow S, Madsen P.<br />

Indomethacin treatment <strong>of</strong> acute pancreatitis. A controlled<br />

double-blind trial. Scand J Gastroenterol 1985; 20: 798-800<br />

78 Montano LA, Garcia CJ, Gonzalez OA, Fuentes OC, Davalos CC,<br />

Rodriguez L, X. [Prevention <strong>of</strong> hyperamilasemia and pancreatitis<br />

after endoscopic retrograde cholangiopancreatography with<br />

rectal administration <strong>of</strong> indomethacin] Rev Gastroenterol Mex<br />

2006; 71: 262-268<br />

79 Sotoudehmanesh R, Khatibian M, Kolahdoozan S, Ainechi<br />

S, Malboosbaf R, Nouraie M. Indomethacin may reduce the<br />

incidence and severity <strong>of</strong> acute pancreatitis after ERCP. Am J<br />

Gastroenterol 2007; 102: 978-983<br />

80 Wagh MS, Sherman S. Indomethacin f<strong>or</strong> post-ERCP<br />

pancreatitis prophylaxis: another attempt at the Holy Grail.<br />

Am J Gastroenterol 2007; 102: 984-986<br />

81 Murray B, Carter R, Imrie C, Evans S, O'Suilleabhain C.<br />

Dicl<strong>of</strong>enac reduces the incidence <strong>of</strong> acute pancreatitis<br />

after endoscopic retrograde cholangiopancreatography.<br />

Gastroenterology 2003; 124: 1786-1791<br />

82 Berney T, Gasche Y, Robert J, Jenny A, Mensi N, Grau G,<br />

Vermeulen B, M<strong>or</strong>el P. Serum pr<strong>of</strong>iles <strong>of</strong> interleukin-6,<br />

interleukin-8, and interleukin-10 in patients with severe and<br />

mild acute pancreatitis. Pancreas 1999; 18: 371-377<br />

83 Pezzilli R, Billi P, Miniero R, Barakat B. Serum interleukin-10<br />

in human acute pancreatitis. Dig Dis Sci 1997; 42: 1469-1472<br />

84 Kusske AM, Rongione AJ, Ashley SW, McFadden DW,<br />

Reber HA. Interleukin-10 prevents death in lethal necrotizing<br />

pancreatitis in mice. Surgery 1996; 120: 284-288; discussion 289<br />

85 Rongione AJ, Kusske AM, Reber HA, Ashley SW, McFadden<br />

DW. Interleukin-10 reduces circulating levels <strong>of</strong> serum<br />

cytokines in experimental pancreatitis. J Gastrointest Surg 1997;<br />

1: 159-165; discussion 165-166<br />

86 Dumot JA, Conwell DL, Zuccaro G Jr, Vargo JJ, Shay SS,<br />

Easley KA, Ponsky JL. A randomized, double blind study<br />

<strong>of</strong> interleukin 10 f<strong>or</strong> the prevention <strong>of</strong> ERCP-induced<br />

pancreatitis. Am J Gastroenterol 2001; 96: 2098-2102<br />

87 Deviere J, Le Moine O, Van Laethem JL, Eisendrath P, Ghilain<br />

A, Severs N, Cohard M. Interleukin 10 reduces the incidence<br />

<strong>of</strong> pancreatitis after therapeutic endoscopic retrograde cholan<br />

giopancreatography. Gastroenterology 2001; 120: 498-505<br />

88 Kaufmann P, Tilz GP, Lueger A, Demel U. Elevated plasma<br />

levels <strong>of</strong> soluble tum<strong>or</strong> necrosis fact<strong>or</strong> recept<strong>or</strong> (sTNFRp60)<br />

reflect severity <strong>of</strong> acute pancreatitis. Intensive Care Med 1997;<br />

23: 841-848<br />

89 Brivet FG, Emilie D, Galanaud P. Pro- and anti-inflammat<strong>or</strong>y<br />

cytokines during acute severe pancreatitis: an early and<br />

sustained response, although unpredictable <strong>of</strong> death. Parisian<br />

Study Group on Acute Pancreatitis. Crit Care Med 1999; 27:<br />

749-755<br />

90 Vaccaro MI, Ropolo A, Grasso D, Calvo EL, Ferreria M,<br />

Iovanna JL, Lanosa G. Pancreatic acinar cells submitted to<br />

stress activate TNF-alpha gene expression. Biochem Biophys Res<br />

Commun 2000; 268: 485-490<br />

91 Gukovskaya AS, Gukovsky I, Zaninovic V, Song M, Sandoval<br />

D, Gukovsky S, Pandol SJ. Pancreatic acinar cells produce,<br />

release, and respond to tum<strong>or</strong> necrosis fact<strong>or</strong>-alpha. Role in<br />

regulating cell death and pancreatitis. J Clin Invest 1997; 100:<br />

1853-1862<br />

92 Ramudo L, Manso MA, Sevillano S, de Dios I. Kinetic study<br />

<strong>of</strong> TNF-alpha production and its regulat<strong>or</strong>y mechanisms<br />

in acinar cells during acute pancreatitis induced by bilepancreatic<br />

duct obstruction. J Pathol 2005; 206: 9-16<br />

93 Balog A, Gyulai Z, B<strong>or</strong>os LG, Farkas G, Takacs T, Lonovics<br />

J, Mandi Y. Polym<strong>or</strong>phism <strong>of</strong> the TNF-alpha, HSP70-2,<br />

and CD14 genes increases susceptibility to severe acute<br />

pancreatitis. Pancreas 2005; 30: e46-e50<br />

94 Hughes CB, Gaber LW, Mohey el-Din AB, Grewal HP, Kotb M,<br />

Mann L, Gaber AO. Inhibition <strong>of</strong> TNF alpha improves survival<br />

in an experimental model <strong>of</strong> acute pancreatitis. Am Surg 1996;<br />

62: 8-13<br />

95 Chen D, Wang W, Wang J. Influence <strong>of</strong> anti-TNF alpha<br />

monocolonal antibody on intestinal barrier in rats with acute<br />

pancreatitis. Chin Med Sci J 2000; 15: 257<br />

96 Malleo G, Mazzon E, Genovese T, Di Paola R, Muia C,<br />

Cent<strong>or</strong>rino T, Siriwardena AK, Cuzzocrea S. Etanercept<br />

attenuates the development <strong>of</strong> cerulein-induced acute<br />

pancreatitis in mice: a comparison with TNF-alpha genetic<br />

deletion. Shock 2007; 27: 542-551<br />

97 Ramudo L, Manso MA, Sevillano S, de Dios I. Kinetic study<br />

<strong>of</strong> TNF-alpha production and its regulat<strong>or</strong>y mechanisms<br />

in acinar cells during acute pancreatitis induced by bilepancreatic<br />

duct obstruction. J Pathol 2005; 206: 9-16<br />

98 Pereda J, Sabater L, Cassinello N, Gomez-Cambronero L,<br />

Closa D, Folch-Puy E, Aparisi L, Calvete J, Cerda M, Lledo<br />

S, Vina J, Sastre J. Effect <strong>of</strong> simultaneous inhibition <strong>of</strong> TNFalpha<br />

production and xanthine oxidase in experimental acute<br />

pancreatitis: the role <strong>of</strong> mitogen activated protein kinases. Ann<br />

Surg 2004; 240: 108-116<br />

99 Triantafillidis JK, Cheracakis P, Hereti IA, Argyros N, Karra<br />

www.wjgnet.com

---

2976 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

E. Acute idiopathic pancreatitis complicating active Crohn's<br />

disease: fav<strong>or</strong>able response to infliximab treatment. Am J<br />

Gastroenterol 2000; 95: 3334-3336<br />

100 Naveau S, Chollet-Martin S, Dharancy S, Mathurin P, Jouet P,<br />

Piquet MA, Davion T, Oberti F, Broet P, Emilie D. A doubleblind<br />

randomized controlled trial <strong>of</strong> infliximab associated with<br />

prednisolone in acute alcoholic hepatitis. Hepatology 2004; 39:<br />

1390-1397<br />

101 Benveniste J, Henson PM, Cochrane CG. Leukocytedependent<br />

histamine release from rabbit platelets. The role <strong>of</strong><br />

IgE, basophils, and a platelet-activating fact<strong>or</strong>. J Exp Med 1972;<br />

136: 1356-1377<br />

102 Kald B, Kald A, Ihse I, Tagesson C. Release <strong>of</strong> plateletactivating<br />

fact<strong>or</strong> in acute experimental pancreatitis. Pancreas<br />

1993; 8: 440-442<br />

103 Emanuelli G, Montrucchio G, Gaia E, Dughera L, C<strong>or</strong>vetti G,<br />

Gubetta L. Experimental acute pancreatitis induced by platelet<br />

activating fact<strong>or</strong> in rabbits. Am J Pathol 1989; 134: 315-326<br />

104 Yotsumoto F, Manabe T, Kyogoku T, Hirano T, Ohshio G,<br />

Yamamoto M, Imamura T, Yoshitomi S. Platelet-activating<br />

fact<strong>or</strong> involvement in the aggravation <strong>of</strong> acute pancreatitis in<br />

rabbits. Digestion 1994; 55: 260-267<br />

105 Jancar S, De Giaccobi G, Mariano M, Mencia-Huerta JM, Sirois<br />

P, Braquet P. Immune complex induced pancreatitis: effect <strong>of</strong><br />

BN 52021, a selective antagonist <strong>of</strong> platelet-activating fact<strong>or</strong>.<br />

Prostaglandins 1988; 35: 757-770<br />

106 Dabrowski A, Gabryelewicz A, Chyczewski L. The effect <strong>of</strong><br />

platelet activating fact<strong>or</strong> antagonist (BN 52021) on ceruleininduced<br />

acute pancreatitis with reference to oxygen radicals.<br />

Int J Pancreatol 1991; 8: 1-11<br />

107 Tomaszewska R, Dembinski A, Warzecha Z, Banas M,<br />

Konturek SJ, Stachura J. Platelet activating fact<strong>or</strong> (PAF)<br />

inhibit<strong>or</strong> (TCV-309) reduces caerulein- and PAF-induced<br />

pancreatitis. A m<strong>or</strong>phologic and functional study in the rat. J<br />

Physiol Pharmacol 1992; 43: 345-352<br />

108 Kingsn<strong>or</strong>th AN, Galloway SW, F<strong>or</strong>mela LJ. Randomized,<br />

double-blind phase II trial <strong>of</strong> Lexipafant, a platelet-activating<br />

fact<strong>or</strong> antagonist, in human acute pancreatitis. Br J Surg 1995;<br />

82: 1414-1420<br />

109 McKay CJ, Curran F, Sharples C, Baxter JN, Imrie CW.<br />

Prospective placebo-controlled randomized trial <strong>of</strong> lexipafant<br />

in predicted severe acute pancreatitis. Br J Surg 1997; 84:<br />

1239-1243<br />

110 Johnson CD, Kingsn<strong>or</strong>th AN, Imrie CW, McMahon MJ,<br />

Neoptolemos JP, McKay C, Toh SK, Skaife P, Leeder PC,<br />

Wilson P, Larvin M, Curtis LD. Double blind, randomised,<br />

placebo controlled study <strong>of</strong> a platelet activating fact<strong>or</strong><br />

antagonist, lexipafant, in the treatment and prevention <strong>of</strong><br />

<strong>or</strong>gan failure in predicted severe acute pancreatitis. Gut 2001;<br />

48: 62-69<br />

111 Abu-Zidan FM, Winds<strong>or</strong> JA. Lexipafant and acute<br />

pancreatitis: a critical appraisal <strong>of</strong> the clinical trials. Eur J Surg<br />

2002; 168: 215-219<br />

www.wjgnet.com<br />

112 Rivera JA, Werner J, Warshaw AL, Lewandrowski KB,<br />

Rattner DW, Fernandez del Castillo C. Lexipafant fails to<br />

improve survival in severe necrotizing pancreatitis in rats. Int<br />

J Pancreatol 1998; 23: 101-106<br />

113 Suputtamongkol Y, Intaranongpai S, Smith MD, Angus B,<br />

Chaowagul W, Permpikul C, Simpson JA, Leelarasamee A,<br />

Curtis L, White NJ. A double-blind placebo-controlled study<br />

<strong>of</strong> an infusion <strong>of</strong> lexipafant (Platelet-activating fact<strong>or</strong> recept<strong>or</strong><br />

antagonist) in patients with severe sepsis. Antimicrob Agents<br />

Chemother 2000; 44: 693-696<br />

114 Vincent JL, Spapen H, Bakker J, Webster NR, Curtis L. Phase<br />

II multicenter clinical study <strong>of</strong> the platelet-activating fact<strong>or</strong><br />

recept<strong>or</strong> antagonist BB-882 in the treatment <strong>of</strong> sepsis. Crit Care<br />

Med 2000; 28: 638-642<br />

115 Beger HG, Bittner R, Block S, Buchler M. Bacterial<br />

contamination <strong>of</strong> pancreatic necrosis. A prospective clinical<br />

study. Gastroenterology 1986; 91: 433-438<br />

116 Isenmann R, Rau B, Beger HG. Bacterial infection and extent<br />

<strong>of</strong> necrosis are determinants <strong>of</strong> <strong>or</strong>gan failure in patients with<br />

acute necrotizing pancreatitis. Br J Surg 1999; 86: 1020-1024<br />

117 Sainio V, Kemppainen E, Puolakkainen P, Taavitsainen M,<br />

Kivisaari L, Valtonen V, Haapiainen R, Schroder T, Kivilaakso<br />

E. Early antibiotic treatment in acute necrotising pancreatitis.<br />

Lancet 1995; 346: 663-667<br />

118 Pederzoli P, Bassi C, Vesentini S, Campedelli A. A<br />

randomized multicenter clinical trial <strong>of</strong> antibiotic prophylaxis<br />

<strong>of</strong> septic complications in acute necrotizing pancreatitis with<br />

imipenem. Surg Gynecol Obstet 1993; 176: 480-483<br />

119 N<strong>or</strong>dback I, Sand J, Saaristo R, Paajanen H. Early treatment<br />

with antibiotics reduces the need f<strong>or</strong> surgery in acute<br />

necrotizing pancreatitis--a single-center randomized study. J<br />

Gastrointest Surg 2001; 5: 113-118; discussion 118-120<br />

120 Isenmann R, Runzi M, Kron M, Kahl S, Kraus D, Jung N,<br />

Maier L, Malfertheiner P, Goebell H, Beger HG. Prophylactic<br />

antibiotic treatment in patients with predicted severe<br />

acute pancreatitis: a placebo-controlled, double-blind trial.<br />

Gastroenterology 2004; 126: 997-1004<br />

121 Villat<strong>or</strong>o E, Bassi C, Larvin M. Antibiotic therapy f<strong>or</strong><br />

prophylaxis against infection <strong>of</strong> pancreatic necrosis in acute<br />

pancreatitis. Cochrane Database Syst Rev 2006: CD002941<br />

122 Raty S, Sand J, Pulkkinen M, Matikainen M, N<strong>or</strong>dback I.<br />

Post-ERCP pancreatitis: reduction by routine antibiotics. J<br />

Gastrointest Surg 2001; 5: 339-345; discussion 345<br />

123 Guarner F, Malagelada JR. Gut fl<strong>or</strong>a in health and disease.<br />

Lancet 2003; 361: 512-519<br />

124 Olah A, Belagyi T, Issekutz A, Gamal ME, Bengmark S.<br />

Randomized clinical trial <strong>of</strong> specific lactobacillus and fibre<br />

supplement to early enteral nutrition in patients with acute<br />

pancreatitis. Br J Surg 2002; 89: 1103-1107<br />

125 Olah A, Belagyi T, Poto L, Romics L Jr, Bengmark S. Synbiotic<br />

control <strong>of</strong> inflammation and infection in severe acute<br />

pancreatitis: a prospective, randomized, double blind study.<br />

Hepatogastroenterology 2007; 54: 590-594<br />

S- Edit<strong>or</strong> Li DL L- Edit<strong>or</strong> Alpini GD E- Edit<strong>or</strong> Lu W

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 2977-2979<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

Hugh James Freeman, MD, FRCPC, FACP, Series Edit<strong>or</strong><br />

Intraductal papillary mucinous neoplasms and other<br />

pancreatic cystic lesions<br />

Hugh James Freeman<br />

Hugh James Freeman, Department <strong>of</strong> Medicine (Gastroenterology),<br />

University <strong>of</strong> British Columbia, Vancouver V6T 1W5,<br />

Canada<br />

Auth<strong>or</strong> contribution: Freeman HJ contributed all to this paper.<br />

C<strong>or</strong>respondence to: Dr. Hugh James Freeman, MD, FRCPC,<br />

FACP, Department <strong>of</strong> Medicine (Gastroenterology), University <strong>of</strong><br />

British Columbia Hospital, 2211 Wesbrook Mall, Vancouver V6T<br />

1W5, Canada. hugfree@shaw.ca<br />

Telephone: +1-604-8227216 Fax: +1-604-8227236<br />

Received: February 18, 2008 Revised: March 20, 2008<br />

Abstract<br />

Pancreatic cystic neoplasms are being increasingly<br />

recognized, even in the absence <strong>of</strong> symptoms, in large<br />

part, due to markedly improved imaging modalities<br />

such as magnetic resonance imaging (MRI)/magnetic<br />

resonance cholangio pancreatography (MRCP) and<br />

computer tomography (CT) scanning. During the<br />

past 2 decades, better imaging <strong>of</strong> these cystic lesions<br />

has resulted in definition <strong>of</strong> different types, including<br />

pancreatic intraductal papillary mucinous neoplasms<br />

( I P M N ) . W h i l e I P M N represent o n l y a d i s t i n c t<br />

min<strong>or</strong>ity <strong>of</strong> all pancreatic cancers, they appear to be<br />

a relatively frequent neoplastic f<strong>or</strong>m <strong>of</strong> pancreatic<br />

cystic neoplasm. M<strong>or</strong>eover, IPMN have a much better<br />

outcome and prognosis compared to pancreatic ductal<br />

adenocarcinomas. Theref<strong>or</strong>e, recognition <strong>of</strong> this entity<br />

is exceedingly imp<strong>or</strong>tant f<strong>or</strong> the clinician involved in<br />

diagnosis and further evaluation <strong>of</strong> a potentially curable<br />

f<strong>or</strong>m <strong>of</strong> pancreatic cancer.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Pancreatic cancer; Pancreatic intraductal<br />

papillary mucinous neoplasms; Mucinous cystic neoplasm<br />

<strong>of</strong> pancreas; Serous cystadenoma; Pancreatic cystic<br />

lesions<br />

Peer reviewer: Michael Steer, Pr<strong>of</strong>ess<strong>or</strong>, Department <strong>of</strong> Surgery,<br />

Tufts-Nemc, 860 Washington St, Boston, Ma 02111, United States<br />

Freeman HJ. Intraductal papillary mucinous neoplasms and<br />

other pancreatic cystic lesions. W<strong>or</strong>ld J Gastroenterol 2008;<br />

14(19): 2977-2979 Available from URL: http://www.wjgnet.<br />

com/1007-9327/14/2977.asp DOI: http://dx.doi.<strong>or</strong>g/10.3748/<br />

wjg.14.2977<br />

INTRODUCTION<br />

OBSERVER<br />

Due to increasing precision <strong>of</strong> modern imaging modalities,<br />

particularly computer tomography (CT) scanning (with<br />

contrast enhancement) and magnetic resonance imaging<br />

(MRI)/magnetic resonance cholangio pancreatography<br />

(MRCP), pancreatic cystic lesions are commonly being<br />

detected. This has been rep<strong>or</strong>ted in up to 25% <strong>of</strong> patients,<br />

particularly with increasing age [1,2] . From a pathological<br />

rather than imaging perspective, however, a cyst is f<strong>or</strong>mally<br />

defined as a fluid-filled and closed cavity with an epithelial<br />

lining. In the pancreas (as opposed to liver and spleen),<br />

cyst-like lesions have special significance as different<br />

neoplasms in the pancreas are true cysts, <strong>or</strong> alternatively,<br />

may appear cystic either from dilation <strong>of</strong> a tum<strong>or</strong><br />

obstructed <strong>or</strong> stenosed pancreatic duct <strong>or</strong> from necrotic<br />

changes and degeneration within a solid neoplastic lesion,<br />

possibly from rapid tum<strong>or</strong> growth that outstrips its blood<br />

supply.<br />

Most commonly, a pancreatic cystic lesion defined by<br />

imaging represents a pseudocyst, usually due to alcoholic<br />

pancreatitis. Pseudocysts are distributed evenly throughout<br />

the pancreas and have no evident risk <strong>of</strong> malignancy.<br />

In a pseudocyst, no epithelial lining is present. As such,<br />

the pathological criteria f<strong>or</strong> a true cyst (despite its cystic<br />

imaging appearance) are not satisfied. Most other true<br />

cysts (with the exception <strong>of</strong> congenital pancreatic cysts)<br />

are neoplastic and, theref<strong>or</strong>e, these represent a potentially<br />

significant clinical finding [3,4] . A number <strong>of</strong> different<br />

neoplastic cystic lesions in the pancreas have been identified<br />

and labeled as capitalized abbreviations (Table 1) [4] .<br />

As prognosis f<strong>or</strong> each type <strong>of</strong> cystic neoplasm may differ,<br />

precise definition <strong>of</strong> any imaged cystic lesion, even if<br />

asymptomatic <strong>or</strong> incidentally detected, is crucial [5] .<br />

NEOPLASTIC PANCREATIC CYSTIC<br />

LESIONS<br />

Most neoplastic cystic lesions <strong>of</strong> the pancreas occur in<br />

young <strong>or</strong> middle-aged females [serous cystadenoma (SCA),<br />

mucinous cystic neoplasia (MCN), and solid pseudopapillary<br />

neoplasia (SPN)], however, intraductal papillary<br />

mucinous neoplasms (IPMN) are most <strong>of</strong>ten detected<br />

in elderly males (m<strong>or</strong>eso than females) [4] . Most cystic<br />

neoplasms are evenly distributed throughout the pancreas,<br />

however, the pancreatic head and uncinate process are<br />

www.wjgnet.com

---

2978 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

Table 1 Types <strong>of</strong> pancreatic cystic neoplasms<br />

Types <strong>of</strong> pancreatic cystic neoplasms<br />

Serous cystadenoma, <strong>or</strong> SCA<br />

Mucinous cystic neoplasm, <strong>or</strong> MCN<br />

Intraductal papillary mucinous neoplasm, <strong>or</strong> IPMN<br />

Solid pseudopapillary neoplasm (with degeneration), <strong>or</strong> SPN<br />

Cystic necrosis (endocrine tum<strong>or</strong>, ductal adenocarcinoma)<br />

most common sites f<strong>or</strong> IPMN while the body and tail are<br />

most common sites f<strong>or</strong> MCN [4] . F<strong>or</strong> most cystic types,<br />

malignant potential appears to be low, except f<strong>or</strong> MCN<br />

and rapidly growing pancreatic ductal adenocarcinomas<br />

<strong>or</strong> even m<strong>or</strong>e rare endocrine neoplasms [4] . In contrast,<br />

most IPMN are slow growing and have low malignant<br />

potential, with a much better prognosis, especially if<br />

compared to pancreatic ductal adenocarcinoma [4] . Thus,<br />

their recognition is significant because an opp<strong>or</strong>tunity may<br />

be present at the time <strong>of</strong> recognition to resect surgically<br />

this type <strong>of</strong> pancreatic cystic neoplasm.<br />

INTRADUCTAL PAPILLARY MUCINOUS<br />

NEOPLASMS<br />

IPMN appears to be quite a unique type <strong>of</strong> neoplasm,<br />

representing a broad spectrum <strong>of</strong> mucin-producing lesions<br />

<strong>of</strong> the exocrine pancreas classified as benign adenomas<br />

to invasive carcinoma. IPMN appear to arise from the<br />

epithelium <strong>of</strong> the main duct <strong>or</strong> its branches, <strong>of</strong>ten with<br />

variable duct dilation and IPMN are also believed by some<br />

to follow the so-called “adenoma-carcinoma” sequence.<br />

Neoplastic cells are most <strong>of</strong>ten papillary, although flat<br />

epithelium may also be defined.<br />

IPMN <strong>of</strong> pancreas represents up to one-third <strong>of</strong> all<br />

pancreatic cystic neoplasms, but only about 1% <strong>of</strong> all<br />

pancreatic cancers [3,6] . Of particular note, IPMN also<br />

represents about 25% <strong>of</strong> all surgically resected pancreatic<br />

neoplasms, again likely emphasizing the critical significance<br />

<strong>of</strong> early recognition [6] . IPMN was first described by<br />

Ohhashi and colleagues in 1982 followed by a notation<br />

by the same group <strong>of</strong> a very prolonged survival (over a<br />

quarter century) <strong>of</strong> a case <strong>of</strong> IPMN [7] . The first series<br />

<strong>of</strong> N<strong>or</strong>th American patients were described only in<br />

1990 [8] . Since then, interest in this neoplasm appears to<br />

have increased exponentially as reflected in the annual<br />

number <strong>of</strong> publications in Medline from 1994 to 2006<br />

related to IPMN noted elsewhere [6] . Interestingly, IPMN<br />

has also been documented to be multifocal and there is<br />

a higher occurrence rate <strong>of</strong> synchronous extrapancreatic<br />

malignancies (compared to pancreatic ductal adenocarcinoma)<br />

[9] . Finally, independent synchronous <strong>or</strong><br />

metachronous pancreatic ductal adenocarcinomas [10] as<br />

well as endocrine tum<strong>or</strong>s [11] with IPMN have also been<br />

described.<br />

Based on anatomic involvement <strong>of</strong> the pancreatic<br />

duct, IPMN <strong>of</strong> the pancreas may predominantly involve<br />

the main pancreatic duct (“main duct type”), secondary<br />

ducts (“branch duct type”) <strong>or</strong> both (“mixed type”). Branch<br />

duct type IPMN are usually smaller, less papillary and<br />

www.wjgnet.com<br />

tend to occur in the periphery <strong>of</strong> the pancreatic head <strong>or</strong><br />

in the distal pancreas. Malignant transf<strong>or</strong>mations occur<br />

less <strong>of</strong>ten in the branch duct type. Evidence suggests that<br />

asymptomatic branch duct IPMN less than 3 cm in size<br />

without mural nodules, thickened septa <strong>or</strong> high grade<br />

dysplasia have a relatively benign biological behavi<strong>or</strong> and<br />

should be considered optimal candidates f<strong>or</strong> surgical<br />

treatment [6] .<br />

Diagnosis may be enhanced by MRCP combined with<br />

dynamic imaging since this improves localization, staging<br />

and, most imp<strong>or</strong>tant, the potential f<strong>or</strong> surgical resectability.<br />

A contrast-enhanced CT scan may also yield added<br />

inf<strong>or</strong>mation regarding invasion, but also the relationship<br />

<strong>of</strong> the lesion to contiguous <strong>or</strong>gans and vessels. Finally,<br />

endoscopic visualization <strong>of</strong> a patulous <strong>or</strong> so-called “fisheye”<br />

papilla <strong>of</strong> Vater , especially at the time <strong>of</strong> ERCP may<br />

be helpful, if not pathognomonic. ERCP also permits<br />

an opp<strong>or</strong>tunity f<strong>or</strong> added sampling <strong>of</strong> ductal content f<strong>or</strong><br />

cytology. Endoscopic ultrasonograph (EUS) may also<br />

provide added imaging inf<strong>or</strong>mation and permit fine needle<br />

aspiration biopsy although some concerns have been<br />

raised regarding the risk <strong>of</strong> seeding and dissemination <strong>of</strong><br />

malignant cells [4] . Positron emission tomographic scanning<br />

may be helpful but its role needs to be better defined.<br />

Finally, serological studies including CA 19-9 and CEA<br />

may serve some value but it is limited since these are<br />

rep<strong>or</strong>ted to be elevated in less than 20% <strong>of</strong> IPMN [4] . F<strong>or</strong><br />

pre-operative evaluation, all <strong>of</strong> these investigations may<br />

provide useful inf<strong>or</strong>mation, but are most imp<strong>or</strong>tant if<br />

surgical resection is being contemplated. Unf<strong>or</strong>tunately,<br />

some patients are older with other concomitant health<br />

issues. In these, surgical treatment and resection may not<br />

lead to a significant positive long-term result and, as in<br />

these patients, even a m<strong>or</strong>e judicious approach to invasive<br />

evaluative investigations may be reasonable. If surgical<br />

excision is complete, recurrence may still occur, usually at<br />

a distant site, but this rate <strong>of</strong> recurrence is limited, and the<br />

overall 5-year survival rate has been rep<strong>or</strong>ted to exceed<br />

80% f<strong>or</strong> noninvasive IPMN and approximately 50% f<strong>or</strong><br />

malignant invasive IPMN. Thus, accurate evaluation <strong>of</strong><br />

IPMN is exceedingly imp<strong>or</strong>tant as a recent analysis [4] has<br />

suggested that this is one <strong>of</strong> the few surgically curable<br />

pancreatic neoplasms.<br />

REFERENCES<br />

1 Zhang XM, Mitchell DG, Dohke M, Holland GA, Parker L.<br />

Pancreatic cysts: depiction on single-shot fast spin-echo MR<br />

images. Radiology 2002; 223: 547-553<br />

2 Kimura W, Nagai H, Kuroda A, Muto T, Esaki Y. Analysis <strong>of</strong><br />

small cystic lesions <strong>of</strong> the pancreas. Int J Pancreatol 1995; 18:<br />

197-206<br />

3 Brugge WR, Lauwers GY, Sahani D, Fernandez-del Castillo C,<br />

Warshaw AL. Cystic neoplasms <strong>of</strong> the pancreas. N Engl J Med<br />

2004; 351: 1218-1226<br />

4 Oh HC, Kim MH, Hwang CY, Lee TY, Lee SS, Seo DW, Lee<br />

SK. Cystic lesions <strong>of</strong> the pancreas: challenging issues in clinical<br />

<strong>practice</strong>. Am J Gastroenterol 2008; 103: 229-239; quiz 228, 240<br />

5 Fernandez-del Castillo C, Targarona J, Thayer SP, Rattner<br />

DW, Brugge WR, Warshaw AL. Incidental pancreatic cysts:<br />

clinicopathologic characteristics and comparison with<br />

symptomatic patients. Arch Surg 2003; 138: 427-423; discussion<br />

433-434<br />

6 Belyaev O, Seelig MH, Muller CA, Tannapfel A, Schmidt

---

Freeman HJ. Pancreatic cystic neoplasms 2979<br />

WE, Uhl W. Intraductal papillary mucinous neoplasms <strong>of</strong> the<br />

pancreas. J Clin Gastroenterol 2008; 42: 284-294<br />

7 Shimizu Y, Yasui K, M<strong>or</strong>imoto T, T<strong>or</strong>ii A, Yamao K, Ohhashi<br />

K. Case <strong>of</strong> intraductal papillary mucinous tum<strong>or</strong> (noninvasive<br />

adenocarcinoma) <strong>of</strong> the pancreas resected 27 years after onset.<br />

Int J Pancreatol 1999; 26: 93-98<br />

8 Warshaw AL, Compton CC, Lewandrowski K, Cardenosa<br />

G, Mueller PR. Cystic tum<strong>or</strong>s <strong>of</strong> the pancreas. New clinical,<br />

radiologic, and pathologic observations in 67 patients. Ann Surg<br />

1990; 212: 432-443; discussion 444-445<br />

9 Sugiyama M, Atomi Y. Extrapancreatic neoplasms occur<br />

with unusual frequency in patients with intraductal papillary<br />

mucinous tum<strong>or</strong>s <strong>of</strong> the pancreas. Am J Gastroenterol 1999; 94:<br />

470-473<br />

10 Proshin S, Yamaguchi K, Wada T, Miyagi T. Modulation <strong>of</strong><br />

neuritogenesis by ganglioside-specific sialidase (Neu 3) in human<br />

neuroblastoma NB-1 cells. Neurochem Res 2002; 27: 841-846<br />

11 Marrache F, Cazals-Hatem D, Kianmanesh R, Palazzo L,<br />

Couvelard A, O'Toole D, Maire F, Hammel P, Levy P, Sauvanet<br />

A, Ruszniewski P. Endocrine tum<strong>or</strong> and intraductal papillary<br />

mucinous neoplasm <strong>of</strong> the pancreas: a f<strong>or</strong>tuitous association?<br />

Pancreas 2005; 31: 79-83<br />

S- Edit<strong>or</strong> Li DL L- Edit<strong>or</strong> Alpini GD E- Edit<strong>or</strong> Liu Y<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 2980-2985<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

REVIEW<br />

Proton pump inhibit<strong>or</strong>s in cirrhosis: <strong>Tradition</strong> <strong>or</strong> <strong>evidence</strong><br />

<strong>based</strong> <strong>practice</strong>?<br />

Francesca Lodato, Francesco Azzaroli, Maria Di Girolamo, Valentina Feletti, Paolo Cecinato, Andrea Lisotti,<br />

Davide Festi, Enrico Roda, Giuseppe Mazzella<br />

Francesca Lodato, Francesco Azzaroli, Maria Di Girolamo,<br />

Valentina Feletti, Paolo Cecinato, Andrea Lisotti, Davide<br />

Festi, Enrico Roda, Giuseppe Mazzella, Department <strong>of</strong> Internal<br />

Medicine and Gastroenterology, Gastroenterology Unit, University<br />

<strong>of</strong> Bologna, Bologna 40138, Italy<br />

Auth<strong>or</strong> contributions: Lodato F, Azzaroli F and Mazzella G<br />

wrote the paper; Di Girolamo M, Feletti V, Cecinato P, Lisotti A<br />

did the bibliographic research; Festi D and Roda E contributed in<br />

writing and reviewing the paper.<br />

C<strong>or</strong>respondence to: Francesca Lodato, Dr, Dipartimento di<br />

Medicina Interna e Gastroenterologia, U.O. di Gastroenterologia,<br />

Via Massarenti 9, Bologna 40138,<br />

Italy. francesca.lodato@unibo.it<br />

Telephone: +39-51-6364120 Fax: +39-51-6364120<br />

Received: November 12, 2007 Revised: April 6, 2008<br />

Abstract<br />

Proton Pump Inhibit<strong>or</strong>s (PPI) are very effective in<br />

inhibiting acid secretion and are extensively used in many<br />

acid related diseases. They are also <strong>of</strong>ten used in patients<br />

with cirrhosis sometimes in the absence <strong>of</strong> a specific<br />

acid related disease, with the aim <strong>of</strong> preventing peptic<br />

complications in patients with variceal <strong>or</strong> hypertensive<br />

gastropathic bleeding receiving multidrug treatment.<br />

Contradicting rep<strong>or</strong>ts supp<strong>or</strong>t their use in cirrhosis<br />

and <strong>evidence</strong> <strong>of</strong> their efficacy in this condition is po<strong>or</strong>.<br />

M<strong>or</strong>eover there are convincing papers suggesting that<br />

acid secretion is reduced in patients with liver cirrhosis.<br />

With regard to Helicobacter pyl<strong>or</strong>i (H pyl<strong>or</strong>i) infection, its<br />

prevalence in patients with cirrhosis is largely variable<br />

among different studies, and it seems that H pyl<strong>or</strong>i<br />

eradication does not prevent gastro-duodenal ulcer<br />

f<strong>or</strong>mation and bleeding. With regard to the prevention<br />

and treatment <strong>of</strong> oesophageal complications after banding<br />

<strong>or</strong> sclerotherapy <strong>of</strong> oesophageal varices, there is little<br />

<strong>evidence</strong> f<strong>or</strong> a protective role <strong>of</strong> PPI. M<strong>or</strong>eover, due to<br />

liver metabolism <strong>of</strong> PPI, the dose <strong>of</strong> most available PPIs<br />

should be reduced in cirrhotics. In conclusion, the use <strong>of</strong><br />

this class <strong>of</strong> drugs seems m<strong>or</strong>e habit related than <strong>evidence</strong>-<br />

<strong>based</strong> eventually leading to an increase in health costs.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Proton pump inhibit<strong>or</strong>s; Cirrhosis; Helicobacter<br />

pyl<strong>or</strong>i ; Peptic ulcer; CYP P450<br />

Peer reviewer: Katja Breitkopf, Dr, Department <strong>of</strong> Medicine<br />

II, University Hospital Mannheim, University <strong>of</strong> Heidelberg,<br />

www.wjgnet.com<br />

Theod<strong>or</strong>-Kutzer-Ufer 1-3, Mannheim 68167, Germany<br />

Lodato F, Azzaroli F, Di Girolamo M, Feletti V, Cecinato P,<br />

Lisotti A, Festi D, Roda E, Mazzella G. Proton pump inhibit<strong>or</strong>s<br />

in cirrhosis: <strong>Tradition</strong> <strong>or</strong> <strong>evidence</strong> <strong>based</strong> <strong>practice</strong>? W<strong>or</strong>ld J<br />

Gastroenterol 2008; 14(19): 2980-2985 Available from: URL:<br />

http://www.wjgnet.com/1007-9327/14/2980.asp DOI: http://<br />

dx.doi.<strong>or</strong>g/10.3748/wjg.14.2980<br />

INTRODUCTION<br />

Proton Pump Inhibit<strong>or</strong>s (PPI) are extensively used in<br />

different acid related diseases. Their efficacy in inhibiting<br />

acid secretion is well known [1-4] , and the use <strong>of</strong> this class<br />

<strong>of</strong> drugs has increased w<strong>or</strong>ldwide. They act through<br />

inhibition <strong>of</strong> the H + /K + ATPase <strong>of</strong> parietal cells<br />

producing the so called “inhibit<strong>or</strong>y complex” and blocking<br />

HCl secretion [5] . They are metabolized in the liver by the<br />

CYP450 cytochrome [6] .<br />

PPI are also <strong>of</strong>ten used in patients with liver cirrhosis<br />

sometimes in the absence <strong>of</strong> a specific acid related disease,<br />

with the aim <strong>of</strong> preventing peptic complications in<br />

patients with variceal <strong>or</strong> hypertensive gastropathic bleeding<br />

receiving multidrug treatment.<br />

The aim <strong>of</strong> this edit<strong>or</strong>ial is to revise the efficacy and<br />

safety pr<strong>of</strong>ile <strong>of</strong> PPI in patients with liver cirrhosis.<br />

GASTRIC ACID SECRETION AND LIVER<br />

CIRRHOSIS<br />

The role <strong>of</strong> gastric secretion in cirrhosis is controversial.<br />

Some studies rep<strong>or</strong>t reduced acid production [7-10] while<br />

others rep<strong>or</strong>ted n<strong>or</strong>mal production [11-15] . The evaluation<br />

<strong>of</strong> 24-h acidity by gastric ph-metry in 49 patients with<br />

cirrhosis showed a marked hypoacidity in patients with<br />

cirrhosis compared to controls, mainly during the night<br />

hours [16] . This may depend on hemodynamic alterations<br />

consequent to p<strong>or</strong>tal hypertension and is supp<strong>or</strong>ted<br />

by experimental studies showing reduced gastric acid<br />

secretion in animals with p<strong>or</strong>tal hypertension [17,18] . These<br />

observations rule out the relevance <strong>of</strong> gastric acid in the<br />

pathogenesis <strong>of</strong> ulcers in cirrhotics.<br />

Gastrin, the gastric h<strong>or</strong>mone whose secretion is<br />

regulated by intragastric pH, and that regulates the<br />

production <strong>of</strong> HCl and pepsin, is partially metabolized

---

Lodato F et al . PPI in liver cirrhosis 2981<br />

Table 1 Prevalence <strong>of</strong> peptic ulcer in patients with liver<br />

cirrhosis<br />

Investigat<strong>or</strong> Number <strong>of</strong> patients Gastric ulcer prevalence (%)<br />

Siringo, 1995 324 4.6<br />

Chen, 1996 245 20.8<br />

Tsai, 1998 130 16.1<br />

Kirk, 1980 163 14.7<br />

Rabinovitz, 1990 216 7.8<br />

by the liver and mainly by the kidneys. Gastrin is elevated<br />

in serum <strong>of</strong> patients with Helicobacter pyl<strong>or</strong>i (H pyl<strong>or</strong>i)<br />

infection <strong>or</strong> atrophic gastritis. Few studies have evaluated<br />

gastrin levels in cirrhosis, and their contribution towards<br />

understanding the pathophysiology <strong>of</strong> gastric acid<br />

secretion is very limited. Avgerinos et al [19] evaluated the<br />

urinary gastrin output in patients with cirrhosis with and<br />

without hepato-renal syndrome. Serum gastrin levels were<br />

higher in cirrhotics compared to controls; and in cirrhotics<br />

with hepato-renal syndrome the difference was greater<br />

suggesting that impaired urinary gastrin secretion may<br />

contribute to their hypergastrinemia. The same results were<br />

found by Lo et al [11] who also showed a significantly lower<br />

maximal pepsin output in cirrhotics compared to controls.<br />

Progastrin and gastrin serum levels have been rep<strong>or</strong>ted<br />

to be significantly higher in patients with cirrhosis <strong>of</strong> any<br />

Child-Pugh class compared to controls while there are no<br />

differences between controls and patients with chronic<br />

hepatitis B <strong>or</strong> C [20] . Indeed, it is imp<strong>or</strong>tant to note that in<br />

this study, the prevalence <strong>of</strong> H pyl<strong>or</strong>i infection in cirrhotic<br />

patients was 83% versus 50% in controls. Theref<strong>or</strong>e, it is<br />

not clear whether the difference in progastrin and gastrin<br />

level was due to reduced liver metabolism, to H pyl<strong>or</strong>i<br />

infection, <strong>or</strong> both. In summary, gastrin increase in patients<br />

with liver cirrhosis could be related to: (1) impaired hepatic<br />

gastrin catabolism; (2) impaired renal function, at least<br />

in those with HRS; (3) gastric mucosal alteration due to<br />

gastropathy-related cirrhosis.<br />

PEPTIC ULCERS AND LIVER CIRRHOSIS<br />

Many auth<strong>or</strong>s rep<strong>or</strong>ted an increased prevalence <strong>of</strong> peptic<br />

ulcers in patients with cirrhosis [21,22] and it was shown<br />

that cirrhotics have an increased risk <strong>of</strong> developing<br />

gastric <strong>or</strong> duodenal ulcers during an interval <strong>of</strong> one year<br />

compared to non cirrhotics [23] . The prevalence <strong>of</strong> peptic<br />

ulcers ranges between 4.6% and 21% in patients with<br />

cirrhosis [21,22,24-26,39] (Table 1). However, the pathogenesis<br />

<strong>of</strong> this finding is far from being elucidated and different<br />

fact<strong>or</strong>s have been proposed in relation to increased ulcer<br />

prevalence in patients with cirrhosis. Furtherm<strong>or</strong>e the<br />

prevalence <strong>of</strong> duodenal and gastric ulcers in patients<br />

with liver cirrhosis increases with disease progression [27]<br />

(Table 2). Several the<strong>or</strong>ies have been postulated. It has<br />

been demonstrated that the gastric mucosa in rats with<br />

p<strong>or</strong>tal hypertension is m<strong>or</strong>e susceptible to aggressive<br />

agents such as bile acids, aspirin and alcohol [28] . Some<br />

investigat<strong>or</strong>s have attributed to p<strong>or</strong>tal hypertension itself<br />

the increased risk <strong>of</strong> peptic ulcer [29] , nevertheless no<br />

Table 2 Gastric and duodenal ulcer in patients with liver<br />

cirrhosis acc<strong>or</strong>ding to the severity <strong>of</strong> p<strong>or</strong>tal hypertension (from<br />

Wu et al 1995)<br />

study has clarified the pathogenesis <strong>of</strong> peptic ulceration<br />

in cirrhosis.<br />

H PyLORI IN PATIENTS wITH LIVER<br />

CIRRHOSIS<br />

The prevalence <strong>of</strong> H pyl<strong>or</strong>i in patients with cirrhosis has<br />

been investigated in many epidemiological studies with<br />

values ranging from 27% to 89% [24,27,30-33] . This large<br />

variability may be due to the test used to evaluate H pyl<strong>or</strong>i<br />

infection. In the study with the largest prevalence <strong>of</strong><br />

H pyl<strong>or</strong>i infection, values were been obtained by titration<br />

<strong>of</strong> serum IgG, against H pyl<strong>or</strong>i. The tests usually used f<strong>or</strong><br />

evaluating the presence <strong>of</strong> H pyl<strong>or</strong>i should be revised since<br />

haemodynamic alterations in cirrhosis could impair the<br />

results <strong>of</strong> urea 13C BT, and hypergammaglobulinemia<br />

typical <strong>of</strong> cirrhosis, might produce a false positive test [34-38] .<br />

Italian studies generally and sometimes significantly<br />

showed a higher prevalence than in non cirrhotic patients,<br />

while studies from Taiwan failed to show a similar trend.<br />

When evaluating the prevalence <strong>of</strong> H pyl<strong>or</strong>i infection<br />

in cirrhotics there seems to be no relationship between<br />

the aetiology <strong>of</strong> cirrhosis and the prevalence <strong>of</strong> H pyl<strong>or</strong>i<br />

evaluated by determination <strong>of</strong> serum IgG [24] . The role <strong>of</strong><br />

H pyl<strong>or</strong>i in determining peptic ulceration in cirrhosis is<br />

controversial: some auth<strong>or</strong>s conclude that the increased risk<br />

<strong>of</strong> gastroduodenal ulcer is not related to H pyl<strong>or</strong>i infection,<br />

whilst others conclude that peptic disease and non-ulcer<br />

dyspepsia are firmly linked to H pyl<strong>or</strong>i infection [32,39-41] . A<br />

meta-analysis showed an increased risk <strong>of</strong> ulcers developing<br />

in patients with H pyl<strong>or</strong>i infection and cirrhosis [42] .<br />

If H pyl<strong>or</strong>i infection were an etiopathological fact<strong>or</strong><br />

implicated in digestive bleeding in cirrhosis, eradication<br />

<strong>of</strong> infection would decrease the risk <strong>of</strong> ulcer recurrence.<br />

However a study aiming to investigate the role <strong>of</strong> H pyl<strong>or</strong>i<br />

eradication in cirrhotics demonstrated a similar recurrence<br />

rate between cirrhotics with successful H pyl<strong>or</strong>i eradication<br />

and those with active H pyl<strong>or</strong>i infection [43] . In conclusion,<br />

the role <strong>of</strong> H pyl<strong>or</strong>i infection in the occurrence <strong>of</strong> gastric<br />

<strong>or</strong> duodenal ulcers <strong>or</strong> in determining digestive bleeding in<br />

the setting <strong>of</strong> liver cirrhosis is still unclear.<br />

ESOPHAGEAL DISORDERS AND LIVER<br />

CIRRHOSIS<br />

Controls<br />

(n = 60)<br />

Compensated<br />

cirrhosis (n = 60)<br />

Decompensated<br />

cirrhosis (n = 60)<br />

n % n % n %<br />

Duodenal ulcer 2 3.3 10 16.7 8 13.3 0.046<br />

Gastric ulcer 1 1.7 2 3.3 9 15.0 0.006<br />

All ulcers 3 5.0 12 20.0 17 28.3 0.003<br />

It has been postulated in the past, that gastro-esophageal<br />

reflux may contribute to oesophagitis and variceal<br />

P<br />

www.wjgnet.com

---

2982 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

bleeding in cirrhotic patients [44] , and acid reflux could<br />

be exacerbated by the presence <strong>of</strong> ascites and water<br />

retention [45] . M<strong>or</strong>e recent papers do not confirm these<br />

hypotheses [46,47] and rep<strong>or</strong>t a high incidence <strong>of</strong> gastroesophageal<br />

reflux only in patients with alcoholic cirrhosis,<br />

though the presence <strong>of</strong> reflux did not c<strong>or</strong>relate with<br />

disease severity <strong>or</strong> bleeding episodes [48] . Functional<br />

studies showed decreased lower esophageal sphincter<br />

function with low amplitude <strong>of</strong> primary peristalsis and<br />

acid clearance in patients with large varices [49-51] . These<br />

phenomenon could also be due to a mechanical effect<br />

<strong>of</strong> the presence <strong>of</strong> varices. In conclusion, it is unclear<br />

whether the presence <strong>of</strong> cirrhosis itself could predispose<br />

to the onset <strong>of</strong> gastro-esophageal reflux. It seems that<br />

the presence <strong>of</strong> varices is related to reflux episodes,<br />

although it is not clear whether these might contribute to<br />

bleeding from varices.<br />

Another m<strong>or</strong>e studied point is the fact that<br />

endoscopic treatment f<strong>or</strong> variceal bleeding <strong>or</strong> prevention<br />

<strong>of</strong> bleeding varices, may produce oesophageal motility<br />

dysfunction. Several studies evaluated the effect <strong>of</strong><br />

endoscopic variceal sclerotherapy (EVS) on gastrooesophageal<br />

reflux. Some auth<strong>or</strong>s sug gest that<br />

endoscopic treatment produces an acute impairment <strong>of</strong><br />

oesophageal motility which is partially rest<strong>or</strong>ed after days<br />

<strong>or</strong> weeks [52-54] , others suggest that sclerotherapy produce<br />

a chemical esophagitis that impairs oesophageal motility<br />

and in turn may favour acid related reflux esophagitis [55] .<br />

It seems that endoscopic variceal ligation (EVL) is safer<br />

in terms <strong>of</strong> oesophageal dysmotility induction when<br />

compared to EVS [56-59] . The reason f<strong>or</strong> this finding is<br />

unclear. Autoptical studies after EVS show the presence<br />

<strong>of</strong> obliteration <strong>of</strong> the submucosal vascular channels,<br />

fibrosis and oesophagitis [60] reflecting the necrosis<br />

induced by the sclerosing agent. The inflammation caused<br />

by EVS may justify mot<strong>or</strong> dysfunctions and acid reflux.<br />

Avgerinos et al [61] showed that EVL produces a higher<br />

early increase in lower oesophageal sphincter pressure,<br />

and this might prevent gastro-oesophageal reflux.<br />

Apart from the pathogenesis <strong>of</strong> mot<strong>or</strong> dysfunction<br />

following EVS and EVL, these procedures are related<br />

to local complications such as oesophageal ulcerations,<br />

strictures and perf<strong>or</strong>ations [62,63] ; although from this point <strong>of</strong><br />

view, EVL seem to be safer than EVS [64,65] . Uncontrolled<br />

non randomized studies, showed that PPI may have a role<br />

in the prevention and healing <strong>of</strong> post-EVS ulcerations [66-69]<br />

although this was not confirmed by other auth<strong>or</strong>s [70] . With<br />

regard to post EVL ulcers, the incidence is between 2% to<br />

5% [71,72] . Pantoprazole has been shown to reduce the size<br />

<strong>of</strong> ulcers in patients undergoing elective band ligation, but<br />

not the rate <strong>of</strong> occurrence <strong>or</strong> the symptoms [73] . Given the<br />

relatively benign nature <strong>of</strong> the intervention, the auth<strong>or</strong>s<br />

conclude that PPI treatment is advisable in patients<br />

undergoing elective EVL.<br />

In summary, expert opinion <strong>based</strong> on <strong>evidence</strong><br />

<strong>of</strong> scarce value, advise PPI use in cirrhotic patients<br />

undergoing endoscopic treatment f<strong>or</strong> varices, especially<br />

when treatment is perf<strong>or</strong>med by EVS, to prevent gastroesophageal<br />

reflux which may w<strong>or</strong>sen the procedure related<br />

inflammation <strong>or</strong> ulceration.<br />

www.wjgnet.com<br />

PPI SAfETy IN CIRRHOTIC PATIENTS<br />

Acute hepatitis due to PPI use is described in the literature<br />

f<strong>or</strong> most PPIs available on the market [74-79] . All PPIs are<br />

metabolized in the liver by cytochrome CYP450; two<br />

isoenzymes are involved in PPI metabolism (CYP2C19<br />

and CYP3A4) [6] . CYP2C19 is the main metabolic<br />

pathway while CYP3A4 is activated only when the other<br />

enzyme is saturated [80] . Nevertheless, the affinity <strong>of</strong> each<br />

isoenzyme f<strong>or</strong> different PPIs is different and rabeprazole<br />

is metabolized mainly by a non enzymatic pathway.<br />

There are two CYP2C19 phenotypes: extensive and<br />

po<strong>or</strong> metabolisers [81-83] . The po<strong>or</strong> phenotype is present in<br />

2%-6% <strong>of</strong> Caucasians and 20% <strong>of</strong> the Asian population.<br />

Po<strong>or</strong> metabolisers have higher plasma levels <strong>of</strong> PPI, which<br />

could lead to higher efficacy but also to potential adverse<br />

events. The effects <strong>of</strong> these genotypes varies acc<strong>or</strong>ding<br />

to the specific PPI used and in general is greater when<br />

using omeprazole decreasing progressively to lansoprazole,<br />

esomeprazole, pantoprazole and finally rabeprazole [6,83] .<br />

PPI are metabolized in the liver and secreted by the<br />

kidney. Renal impairment has minimal effect on PPI<br />

clearance, and theref<strong>or</strong>e there is no need to reduce PPI<br />

dosage in patients with renal diseases [80,84] . This is not the<br />

case f<strong>or</strong> liver impairment in which the Area under the<br />

Curve (AUC) <strong>of</strong> PPIs increases and their half-life becomes<br />

4 h to 8 h greater [80] with increasing risk <strong>of</strong> accumulation.<br />

This effect was also seen with rabeprazole [85] although a<br />

dose reduction seems to be unnecessary with a 20 mg,<br />

once daily dose in patients with mild to moderate liver<br />

cirrhosis. When using other PPIs <strong>or</strong> rabeprazole at<br />

40 mg/d dose, dose reduction in patients with cirrhosis is<br />

advisable.<br />

CONCLUSION<br />

PPI drugs are extensively used in clinical <strong>practice</strong> in<br />

cirrhotic patients. Besides habit, the <strong>evidence</strong> that PPI are<br />

necessary in most indications is very weak. First <strong>of</strong> all,<br />

there is convincing <strong>evidence</strong> that acid secretion is reduced<br />

in patients with liver cirrhosis. This is mainly due to the<br />

presence <strong>of</strong> hypertensive gastropathy f<strong>or</strong> which there is no<br />

<strong>evidence</strong> <strong>of</strong> any efficacy <strong>of</strong> PPI. With regard to H pyl<strong>or</strong>i<br />

infection, its prevalence in patients with cirrhosis is largely<br />

variable among different studies, probably as a result<br />

<strong>of</strong> different diagnostic tests used. We believe that the<br />

condition <strong>of</strong> hypochl<strong>or</strong>idemia <strong>of</strong> cirrhotics makes it m<strong>or</strong>e<br />

probable that its prevalence is lower than in the general<br />

population. Nevertheless, it seems that H pyl<strong>or</strong>i eradication<br />

does not prevent from gastro-duodenal ulcer f<strong>or</strong>mation<br />

and bleeding.<br />

It is probable that the main reason f<strong>or</strong> PPI use in<br />

cirrhosis might be the prevention and treatment <strong>of</strong><br />

oesophageal complications after banding <strong>or</strong> sclerotherapy<br />

<strong>of</strong> oesophageal varices. However even in this case<br />

<strong>evidence</strong> f<strong>or</strong> a protective role <strong>of</strong> PPI are scarce. When<br />

using PPI in cirrhotic patients, the dose should be reduced<br />

in consideration <strong>of</strong> the increased half-life <strong>of</strong> these drugs<br />

in this group <strong>of</strong> patients. Dose adjustment does not seem<br />

necessary when using rabeprazole at a 20 mg, once daily

---

Lodato F et al . PPI in liver cirrhosis 2983<br />

dose. The use <strong>of</strong> this class <strong>of</strong> drugs seems m<strong>or</strong>e habitrelated<br />

than <strong>evidence</strong>- <strong>based</strong>, eventually leading to an<br />

increase in health costs.<br />

REfERENCES<br />

1 Bamberg P, Caswell CM, Frame MH, Lam SK, Wong EC. A<br />

meta-analysis comparing the efficacy <strong>of</strong> omeprazole with H2recept<strong>or</strong><br />

antagonists f<strong>or</strong> acute treatment <strong>of</strong> duodenal ulcer in<br />

Asian patients. J Gastroenterol Hepatol 1992; 7: 577-585<br />

2 Eriksson S, Langstrom G, Rikner L, Carlsson R, Naesdal<br />

J. Omeprazole and H2-recept<strong>or</strong> antagonists in the acute<br />

treatment <strong>of</strong> duodenal ulcer, gastric ulcer and reflux<br />

oesophagitis: a meta-analysis. Eur J Gastroenterol Hepatol 1995; 7:<br />

467-475<br />

3 Gisbert JP, Gonzalez L, Calvet X, Roque M, Gabriel R, Pajares<br />

JM. Proton pump inhibit<strong>or</strong>s versus H2-antagonists: a metaanalysis<br />

<strong>of</strong> their efficacy in treating bleeding peptic ulcer.<br />

Aliment Pharmacol Ther 2001; 15: 917-926<br />

4 Gisbert JP, Kh<strong>or</strong>rami S, Calvet X, Gabriel R, Carballo F,<br />

Pajares JM. Meta-analysis: proton pump inhibit<strong>or</strong>s vs. H2recept<strong>or</strong><br />

antagonists--their efficacy with antibiotics in<br />

Helicobacter pyl<strong>or</strong>i eradication. Aliment Pharmacol Ther 2003;<br />

18: 757-766<br />

5 Sachs G, Shin JM, Briving C, Wallmark B, Hersey S. The<br />

pharmacology <strong>of</strong> the gastric acid pump: the H+, K+ ATPase.<br />

Annu Rev Pharmacol Toxicol 1995; 35: 277-305<br />

6 Andersson T, Cederberg C, Edvardsson G, Heggelund A,<br />

Lundb<strong>or</strong>g P. Effect <strong>of</strong> omeprazole treatment on diazepam<br />

plasma levels in slow versus n<strong>or</strong>mal rapid metabolizers <strong>of</strong><br />

omeprazole. Clin Pharmacol Ther 1990; 47: 79-85<br />

7 Fraser AG, Pounder RE, Burroughs AK. Gastric secretion and<br />

peptic ulceration in cirrhosis. J Hepatol 1993; 19: 171-182<br />

8 Scobie BA, Summerskill WH. Reduced Gastric Acid Output<br />

in Cirrhosis: Quantitation and Relationships. Gut 1964; 5:<br />

422-428<br />

9 Lam SK. Hypergastrinaemia in cirrhosis <strong>of</strong> liver. Gut 1976; 17:<br />

700-708<br />

10 Gaur SK, Vij JC, Sarin SK, Anand BS. Gastric secretion in<br />

cirrhosis and non-cirrhotic p<strong>or</strong>tal fibrosis. Digestion 1988; 39:<br />

151-155<br />

11 Lo WC, Lin HJ, Wang K, Lee FY, Perng CL, Lin HC, Lee SD.<br />

Gastric secretion in Chinese patients with cirrhosis. J Clin<br />

Gastroenterol 1996; 23: 256-260<br />

12 Mazzacca G, Budillon G, De Marco F, De Ritis F. Serum<br />

gastrin in patients with cirrhosis <strong>of</strong> the liver. Digestion 1974;<br />

11: 232-239<br />

13 Tabaqchali S, Dawson AM. Peptic Ulcer and Gastric Secretion<br />

in Patients with Liver Disease. Gut 1964; 5: 417-421<br />

14 Orl<strong>of</strong>f MJ, Chandler JG, Alderman SJ, Keiter JE, Rosen H.<br />

Gastric secretion and peptic ulcer following p<strong>or</strong>tacaval shunt<br />

in man. Ann Surg 1969; 170: 515-527<br />

15 Lenz HJ, Struck T, Greten H, Koss MA, Eysselein VE, Walsh<br />

JH, Isenberg JI. Increased sensitivity <strong>of</strong> gastric acid secretion to<br />

gastrin in cirrhotic patients with p<strong>or</strong>tacaval shunt. J Clin Invest<br />

1987; 79: 1120-1124<br />

16 Savarino V, Mela GS, Zentilin P, Mansi C, Mele MR, Vigneri<br />

S, Cutela P, Vassallo A, Dall<strong>or</strong>to E, Celle G. Evaluation <strong>of</strong><br />

24-hour gastric acidity in patients with hepatic cirrhosis. J<br />

Hepatol 1996; 25: 152-157<br />

17 Kaur S, Kaur U, Agnihotri N, Tandon CD, Majumdar S.<br />

Modulation <strong>of</strong> acid secretion in common bile duct ligationrelated<br />

gastropathy in Wistar rats. J Gastroenterol Hepatol 2001;<br />

16: 755-762<br />

18 Agnihotri N, Kaur U, Dhawan V, Dilawari JB. Extrahepatic<br />

p<strong>or</strong>tal hypertensive gastropathy in Wistar rats: modulation<br />

<strong>of</strong> acid secretion in isolated parietal cells. Dig Dis Sci 1998; 43:<br />

56-66<br />

19 Avgerinos A, Dimitriou-Voudri Y, Adamopoulos A,<br />

Papadimitriou N, Voudris B, Rekoumis G, Raptis S. Urinary<br />

gastrin output and serum gastrin in patients with liver cirrhosis.<br />

Urinary gastrin output in cirrhosis. Hepatogastroenterology 1994;<br />

41: 445-448<br />

20 Konturek SJ, Gonciarz M, Gonciarz Z, Bielanski W, Mazur W,<br />

Mularczyk A, Konturek PC, Goetze JP, Rehfeld JF. Progastrin<br />

and its products from patients with chronic viral hepatitis and<br />

liver cirrhosis. Scand J Gastroenterol 2003; 38: 643-647<br />

21 Kirk AP, Dooley JS, Hunt RH. Peptic ulceration in patients<br />

with chronic liver disease. Dig Dis Sci 1980; 25: 756-760<br />

22 Rabinovitz M, Schade RR, Dindzans V, Van Thiel DH,<br />

Gavaler JS. Prevalence <strong>of</strong> duodenal ulcer in cirrhotic males<br />

referred f<strong>or</strong> liver transplantation. Does the etiology <strong>of</strong> cirrhosis<br />

make a difference? Dig Dis Sci 1990; 35: 321-326<br />

23 Siringo S, Burroughs AK, Bolondi L, Muia A, Di Febo G,<br />

Miglioli M, Cavalli G, Barbara L. Peptic ulcer and its course<br />

in cirrhosis: an endoscopic and clinical prospective study. J<br />

Hepatol 1995; 22: 633-641<br />

24 Siringo S, Vaira D, Menegatti M, Piscaglia F, S<strong>of</strong>ia S, Gaetani<br />

M, Miglioli M, C<strong>or</strong>inaldesi R, Bolondi L. High prevalence <strong>of</strong><br />

Helicobacter pyl<strong>or</strong>i in liver cirrhosis: relationship with clinical<br />

and endoscopic features and the risk <strong>of</strong> peptic ulcer. Dig Dis<br />

Sci 1997; 42: 2024-2030<br />

25 Chen LS, Lin HC, Lee FY, Hou MC, Lee SD. Prevalence<br />

<strong>of</strong> duodenal ulcer in cirrhotic patients and its relation to<br />

Helicobacter pyl<strong>or</strong>i and p<strong>or</strong>tal hypertension. Zhonghua Yixue<br />

Zazhi (Taipei) 1995; 56: 226-231<br />

26 Sacchetti C, Capello M, Rebecchi P, Roncucci L, Zanghieri<br />

G, Tripodi A, Ponz de Leon M. Frequency <strong>of</strong> upper<br />

gastrointestinal lesions in patients with liver cirrhosis. Dig Dis<br />

Sci 1988; 33: 1218-1222<br />

27 Wu CS, Lin CY, Liaw YF. Helicobacter pyl<strong>or</strong>i in cirrhotic<br />

patients with peptic ulcer disease: a prospective, case<br />

controlled study. Gastrointest Endosc 1995; 42: 424-427<br />

28 Sarfeh IJ, Tarnawski A, Malki A, Mason GR, Mach T, Ivey KJ.<br />

P<strong>or</strong>tal hypertension and gastric mucosal injury in rats. Effects<br />

<strong>of</strong> alcohol. Gastroenterology 1983; 84: 987-993<br />

29 Chen LS, Lin HC, Hwang SJ, Lee FY, Hou MC, Lee SD.<br />

Prevalence <strong>of</strong> gastric ulcer in cirrhotic patients and its relation<br />

to p<strong>or</strong>tal hypertension. J Gastroenterol Hepatol 1996; 11: 59-64<br />

30 Nam YJ, Kim SJ, Shin WC, Lee JH, Choi WC, Kim KY, Han<br />

TH. [Gastric pH and Helicobacter pyl<strong>or</strong>i infection in patients<br />

with liver cirrhosis] K<strong>or</strong>ean J Hepatol 2004; 10: 216-222<br />

31 Pellicano R, Leone N, Berrutti M, Cutufia MA, Fi<strong>or</strong>entino M,<br />

Rizzetto M, Ponzetto A. Helicobacter pyl<strong>or</strong>i seroprevalence<br />

in hepatitis C virus positive patients with cirrhosis. J Hepatol<br />

2000; 33: 648-650<br />

32 Zullo A, Rinaldi V, Meddi P, Folino S, Lauria V, Diana F,<br />

Winn S, Attili AF. Helicobacter pyl<strong>or</strong>i infection in dyspeptic<br />

cirrhotic patients. Hepatogastroenterology 1999; 46: 395-400<br />

33 Chen JJ, Changchien CS, Tai DI, Chiou SS, Lee CM, Kuo CH.<br />

Role <strong>of</strong> Helicobacter pyl<strong>or</strong>i in cirrhotic patients with peptic<br />

ulcer. A serological study. Dig Dis Sci 1994; 39: 1565-1568<br />

34 Nishiguchi S, Kuroki T, Ueda T, Fukuda K, Takeda T,<br />

Nakajima S, Shiomi S, Kobayashi K, Otani S, Hayashi N.<br />

Detection <strong>of</strong> hepatitis C virus antibody in the absence <strong>of</strong> viral<br />

RNA in patients with autoimmune hepatitis. Ann Intern Med<br />

1992; 116: 21-25<br />

35 Theilmann L, Blazek M, Goeser T, Gmelin K, Kommerell B,<br />

Fiehn W. False-positive anti-HCV tests in rheumatoid arthritis.<br />

Lancet 1990; 335: 1346<br />

36 Rivera J, Garcia-Monf<strong>or</strong>te A, Pineda A Millan Nunez-C<strong>or</strong>tes J.<br />

Arthritis in patients with chronic hepatitis C virus infection. J<br />

Rheumatol 1999; 26: 420-424<br />

37 Maillefert JF, Muller G, Falgarone G, Bour JB, Ratovohery D,<br />

Dougados M, Tavernier C, Breban M. Prevalence <strong>of</strong> hepatitis<br />

C virus infection in patients with rheumatoid arthritis. Ann<br />

Rheum Dis 2002; 61: 635-637<br />

38 B<strong>or</strong>que L, Elena A, Maside C, Rus A, Del Cura J. Rheumatoid<br />

arthritis and hepatitis C virus antibodies. Clin Exp Rheumatol<br />

1991; 9: 617-619<br />

39 Tsai CJ. Helicobacter pyl<strong>or</strong>i infection and peptic ulcer disease<br />

in cirrhosis. Dig Dis Sci 1998; 43: 1219-1225<br />

40 Calvet X, Navarro M, Gil M, Lafont A, Sanfeliu I, Brullet E,<br />

www.wjgnet.com

---

2984 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

Campo R, Dalmau B, Rivero E, Mas P. Epidemiology <strong>of</strong> peptic<br />

ulcer disease in cirrhotic patients: role <strong>of</strong> Helicobacter pyl<strong>or</strong>i<br />

infection. Am J Gastroenterol 1998; 93: 2501-2507<br />

41 D<strong>or</strong>e MP, Mura D, Deledda S, Maragkoudakis E, Pironti<br />

A, Realdi G. Active peptic ulcer disease in patients with<br />

hepatitis C virus-related cirrhosis: the role <strong>of</strong> Helicobacter<br />

pyl<strong>or</strong>i infection and p<strong>or</strong>tal hypertensive gastropathy. Can J<br />

Gastroenterol 2004; 18: 521-524<br />

42 Vergara M, Calvet X, Roque M. Helicobacter pyl<strong>or</strong>i is a risk<br />

fact<strong>or</strong> f<strong>or</strong> peptic ulcer disease in cirrhotic patients. A metaanalysis.<br />

Eur J Gastroenterol Hepatol 2002; 14: 717-722<br />

43 Lo GH, Yu HC, Chan YC, Chen WC, Hsu PI, Lin CK, Lai<br />

KH. The effects <strong>of</strong> eradication <strong>of</strong> Helicobacter pyl<strong>or</strong>i on the<br />

recurrence <strong>of</strong> duodenal ulcers in patients with cirrhosis.<br />

Gastrointest Endosc 2005; 62: 350-356<br />

44 Ahmed AM, al Karawi MA, Shariq S, Mohamed AE.<br />

Frequency <strong>of</strong> gastroesophageal reflux in patients with liver<br />

cirrhosis. Hepatogastroenterology 1993; 40: 478-480<br />

45 Simpson JA, Conn HO. Role <strong>of</strong> ascites in gastroesophageal<br />

reflux with comments on the pathogenesis <strong>of</strong> bleeding<br />

esophageal varices. Gastroenterology 1968; 55: 17-25<br />

46 Van Thiel DH, Stremple JF. Lower esophageal sphincter<br />

pressure in cirrhotic men with ascites: bef<strong>or</strong>e and after<br />

diuresis. Gastroenterology 1977; 72: 842-844<br />

47 Eckardt VF, Grace ND, Kantrowitz PA. Does lower esophageal<br />

sphincter incompetency contribute to esophageal bleeding?<br />

Gastroenterology 1976; 71: 185-189<br />

48 Arsene D, Bruley des Varannes S, Galmiche JP, Denis P,<br />

Chayvialle JA, Hellot MF, Ducrotte P, Colin R. Gastrooesophageal<br />

reflux and alcoholic cirrhosis. A reappraisal. J<br />

Hepatol 1987; 4: 250-258<br />

49 I w a k i r i K , K o b a y a s h i M , S e s o k o M , N o m u r a T .<br />

Gastroesophageal reflux and esophageal motility in patients<br />

with esophageal varies. Gastroenterol Jpn 1993; 28: 477-482<br />

50 Fl<strong>or</strong>es PP, Lemme EM, Coelho HS. [Esophageal mot<strong>or</strong><br />

dis<strong>or</strong>ders in cirrhotic patients with esophageal varices nonsubmitted<br />

to endoscopic treatment] Arq Gastroenterol 2005; 42:<br />

213-220<br />

51 Passaretti S, Mazzotti G, de Franchis R, Cipolla M, Testoni<br />

PA, Tittobello A. Esophageal motility in cirrhotics with and<br />

without esophageal varices. Scand J Gastroenterol 1989; 24:<br />

334-338<br />

52 Grande L, Planas R, Lacima G, Boix J, Ros E, Esteve M,<br />

M<strong>or</strong>illas R, Gasull MA. Sequential esophageal motility<br />

studies after endoscopic injection sclerotherapy: a prospective<br />

investigation. Am J Gastroenterol 1991; 86: 36-40<br />

53 Snady H, K<strong>or</strong>sten MA. Esophageal acid-clearance and motility<br />

after endoscopic sclerotherapy <strong>of</strong> esophageal varices. Am J<br />

Gastroenterol 1986; 81: 419-422<br />

54 Sauerbruch T, Wirsching R, Leisner B, Weinzierl M, Pfahler<br />

M, Paumgartner G. Esophageal function after sclerotherapy <strong>of</strong><br />

bleeding varices. Scand J Gastroenterol 1982; 17: 745-751<br />

55 Reilly JJ Jr, Schade RR, Van Thiel DS. Esophageal function<br />

after injection sclerotherapy: pathogenesis <strong>of</strong> esophageal<br />

stricture. Am J Surg 1984; 147: 85-88<br />

56 Viazis N, Armonis A, Vlachogiannakos J, Rekoumis G,<br />

Stefanidis G, Papadimitriou N, Manolakopoulos S, Avgerinos<br />

A. Effects <strong>of</strong> endoscopic variceal treatment on oesophageal<br />

function: a prospective, randomized study. Eur J Gastroenterol<br />

Hepatol 2002; 14: 263-269<br />

57 G<strong>of</strong>f JS, Reveille RM, Van Stiegmann G. Endoscopic<br />

sclerotherapy versus endoscopic variceal ligation: esophageal<br />

symptoms, complications, and motility. Am J Gastroenterol<br />

1988; 83: 1240-1244<br />

58 Berner JS, Gaing AA, Sharma R, Almen<strong>of</strong>f PL, Muhlfelder<br />

T, K<strong>or</strong>sten MA. Sequelae after esophageal variceal ligation<br />

and sclerotherapy: a prospective randomized study. Am J<br />

Gastroenterol 1994; 89: 852-858<br />

59 Hou MC, Yen TC, Lin HC, Kuo BI, Chen CH, Lee FY, Liu RS,<br />

Chang FY, Lee SD. Sequential changes <strong>of</strong> esophageal motility<br />

after endoscopic injection sclerotherapy <strong>or</strong> variceal ligation<br />

f<strong>or</strong> esophageal variceal bleeding: a scintigraphic study. Am J<br />

www.wjgnet.com<br />

Gastroenterol 1997; 92: 1875-1878<br />

60 Papadimos D, Kerlin P, Harris OD. Endoscopic sclerotherapy:<br />

lessons from a necropsy study. Gastrointest Endosc 1986; 32:<br />

269-273<br />

61 Avgerinos A, Viazis N, Armonis A, Vlachogiannakos J,<br />

Rekoumis G, Stefanidis G, Papadimitriou N, Manolakopoulos<br />

S, Raptis SA. Early increase <strong>of</strong> lower oesophageal sphincter<br />

pressure after band ligation <strong>of</strong> oesophageal varices in<br />

cirrhotics: an intriguing phenomenon. Eur J Gastroenterol<br />

Hepatol 2002; 14: 1319-1323<br />

62 Stiegmann GV. Evolution <strong>of</strong> endoscopic therapy f<strong>or</strong><br />

esophageal varices. Surg Endosc 2006; 20 Suppl 2: S467-S470<br />

63 Krige JE, B<strong>or</strong>nman PC, Shaw JM, Apostolou C. Complications<br />

<strong>of</strong> endoscopic variceal therapy. S Afr J Surg 2005; 43: 177-188,<br />

190-194<br />

64 Schmitz RJ, Sharma P, Badr AS, Qamar MT, Weston AP.<br />

Incidence and management <strong>of</strong> esophageal stricture f<strong>or</strong>mation,<br />

ulcer bleeding, perf<strong>or</strong>ation, and massive hematoma f<strong>or</strong>mation<br />

from sclerotherapy versus band ligation. Am J Gastroenterol<br />

2001; 96: 437-441<br />

65 Stiegmann GV, G<strong>of</strong>f JS, Michaletz-Onody PA, K<strong>or</strong>ula J,<br />

Lieberman D, Saeed ZA, Reveille RM, Sun JH, Lowenstein<br />

SR. Endoscopic sclerotherapy as compared with endoscopic<br />

ligation f<strong>or</strong> bleeding esophageal varices. N Engl J Med 1992;<br />

326: 1527-1532<br />

66 Jaspersen D, K<strong>or</strong>ner T, Sch<strong>or</strong>r W, Hammar CH. Omeprazole<br />

in the management <strong>of</strong> sclerotherapy-induced esophageal<br />

ulcers resistant to H2 blocker treatment. J Gastroenterol 1995;<br />

30: 128-130<br />

67 Gimson A, Polson R, Westaby D, Williams R. Omeprazole<br />

in the management <strong>of</strong> intractable esophageal ulceration<br />

following injection sclerotherapy. Gastroenterology 1990; 99:<br />

1829-1831<br />

68 Shephard H, Barkin JS. Omeprazole heals mucosal ulcers<br />

associated with endoscopic injection sclerotherapy. Gastrointest<br />

Endosc 1993; 39: 474-475<br />

69 Johlin FC, Labrecque DR, Neil GA. Omeprazole heals mucosal<br />

ulcers associated with endoscopic injection sclerotherapy. Dig<br />

Dis Sci 1992; 37: 1373-1376<br />

70 Garg PK, Sidhu SS, Bhargava DK. Role <strong>of</strong> omeprazole<br />

in prevention and treatment <strong>of</strong> postendoscopic variceal<br />

sclerotherapy esophageal complications. Double-blind<br />

randomized study. Dig Dis Sci 1995; 40: 1569-1574<br />

71 Laine L, el-Newihi HM, Migikovsky B, Sloane R, Garcia F.<br />

Endoscopic ligation compared with sclerotherapy f<strong>or</strong> the<br />

treatment <strong>of</strong> bleeding esophageal varices. Ann Intern Med 1993;<br />

119: 1-7<br />

72 Gimson AE, Ramage JK, Panos MZ, Hayllar K, Harrison<br />

PM, Williams R, Westaby D. Randomised trial <strong>of</strong> variceal<br />

banding ligation versus injection sclerotherapy f<strong>or</strong> bleeding<br />

oesophageal varices. Lancet 1993; 342: 391-394<br />

73 Shaheen NJ, Stuart E, Schmitz SM, Mitchell KL, Fried MW,<br />

Zacks S, Russo MW, Galanko J, Shrestha R. Pantoprazole<br />

reduces the size <strong>of</strong> postbanding ulcers after variceal band<br />

ligation: a randomized, controlled trial. Hepatology 2005; 41:<br />

588-594<br />

74 Koury SI, Stone CK, La Charite DD. Omeprazole and the<br />

development <strong>of</strong> acute hepatitis. Eur J Emerg Med 1998; 5:<br />

467-469<br />

75 Romero-Gomez M, Otero MA, Suarez-Garcia E, Garcia Diaz<br />

E, Fobelo MJ, Castro-Fernandez M. Acute hepatitis related to<br />

omeprazole. Am J Gastroenterol 1999; 94: 1119-1120<br />

76 Viana de Miguel C, Alvarez Garcia M, Sanchez Sanchez A<br />

Carvajal Garcia-Pando A. [Lansoprazole-induced hepatitis]<br />

Med Clin (Barc) 1997; 108: 599<br />

77 C<strong>or</strong>des A, Vogt W, Maier KP. [Pantoprazole-induced<br />

hepatitis] Dtsch Med Wochenschr 2003; 128: 611-614<br />

78 Garcia-C<strong>or</strong>tes M, Lucena MI, Andrade RJ, Romero-Gomez M<br />

Fernandez MC. Lansoprazole-induced hepatic dysfunction.<br />

Ann Pharmacother 2003; 37: 1731<br />

79 Darabi K. Proton-pump-inhibit<strong>or</strong>-induced hepatitis. South<br />

Med J 2005; 98: 844-845

---

Lodato F et al . PPI in liver cirrhosis 2985<br />

80 Thjodleifsson B. Treatment <strong>of</strong> acid-related diseases in the<br />

elderly with emphasis on the use <strong>of</strong> proton pump inhibit<strong>or</strong>s.<br />

Drugs Aging 2002; 19: 911-927<br />

81 H<strong>or</strong>ai Y, Ishizaki T. Pharmacogenetics and its clinical<br />

implications. Part II. Oxidation polym<strong>or</strong>phism. Ration Drug<br />

Ther 1988; 22: 1-8<br />

82 Kupfer A, Preisig R. Pharmacogenetics <strong>of</strong> mephenytoin: a<br />

new drug hydroxylation polym<strong>or</strong>phism in man. Eur J Clin<br />

Pharmacol 1984; 26: 753-759<br />

83 Ishizaki T, H<strong>or</strong>ai Y. Review article: cytochrome P450 and<br />

the metabolism <strong>of</strong> proton pump inhibit<strong>or</strong>s--emphasis on<br />

rabeprazole. Aliment Pharmacol Ther 1999; 13 Suppl 3: 27-36<br />

84 Keane WF, Swan SK, Grimes I, Humphries TJ. Rabeprazole:<br />

pharmacokinetics and tolerability in patients with stable, endstage<br />

renal failure. J Clin Pharmacol 1999; 39: 927-933<br />

85 Hoyumpa AM, Trevino-Alanis H, Grimes I, Humphries<br />

TJ. Rabeprazole: pharmacokinetics in patients with stable,<br />

compensated cirrhosis. Clin Ther 1999; 21: 691-701<br />

S- Edit<strong>or</strong> Zhong XY L- Edit<strong>or</strong> Lal<strong>or</strong> PF E- Edit<strong>or</strong> Lu W<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 2986-2989<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

TOPIC HIGHLIGHT<br />

Gianfranco D Alpini, PhD, Pr<strong>of</strong>ess<strong>or</strong>; Sharon DeM<strong>or</strong>row, Assistant Pr<strong>of</strong>ess<strong>or</strong>, Series Edit<strong>or</strong><br />

Mechanisms <strong>of</strong> biliary carcinogenesis and growth<br />

Candace Wise, Metaneeya Pilanthananond, Benjamin F Perry, Gianfranco Alpini, Michael McNeal, Shannon S Glaser<br />

Candace Wise, Gianfranco Alpini, Shannon S Glaser, Systems<br />

Biology and Translational Medicine, Scott and White Hospital<br />

and The Texas A&M University System Health Science Center,<br />

Temple, TX 76504, United States<br />

Metaneeya Pilanthananond, Gianfranco Alpini, Shannon<br />

S Glaser, Department <strong>of</strong> Medicine, Scott and White Hospital<br />

and The Texas A&M University System Health Science Center,<br />

Temple, TX 76504, United States<br />

Benjamin F Perry, Michael McNeal, The Texas A&M University<br />

System Health Science Center, College <strong>of</strong> Medicine, Temple, TX<br />

76504, United States<br />

Gianfranco Alpini, Central Texas Veterans Health Care System,<br />

Temple, TX 76504, United States<br />

Supp<strong>or</strong>ted by a grant award (#060483) to Dr. Glaser from Scott<br />

and White Hospital<br />

C<strong>or</strong>respondence to: Shannon S Glaser, Assistant Pr<strong>of</strong>ess<strong>or</strong>,<br />

Department <strong>of</strong> Medicine, Scott and White Hospita, Medical<br />

Research Building Room 316B, 702 SW HK Dodgen Loop,<br />

Temple, Texas 76504, United States. sglaser@medicine.tamhsc.edu<br />

Telephone: +1-254-7427058 Fax: +1-254-7245944<br />

Received: September 29, 2007 Revised: November 13, 2007<br />

Abstract<br />

Cholangiocarcinoma is a rare cancer <strong>or</strong>iginating from<br />

the neoplastic transf<strong>or</strong>mation <strong>of</strong> the epithelial cells<br />

(i.e. cholangiocytes) that line the biliary tract. The<br />

prognosis f<strong>or</strong> patients with cholangiocarcinoma is<br />

grim due to lack <strong>of</strong> viable treatment options. The<br />

increase in w<strong>or</strong>ld-wide incidence and m<strong>or</strong>tality from<br />

cholangiocarcinoma highlights the imp<strong>or</strong>tance <strong>of</strong><br />

understanding the intracellular mechanisms that trigger<br />

the neoplastic transf<strong>or</strong>mation <strong>of</strong> cholangiocytes and<br />

the growth <strong>of</strong> biliary cancers. The purpose <strong>of</strong> the<br />

following review is to address what has been learned<br />

over the past decade concerning the molecular basis<br />

<strong>of</strong> cholangiocarcinogenesis. The material presented is<br />

divided into two sections: (1) mechanisms regulating<br />

neoplastic transf<strong>or</strong>mation <strong>of</strong> cholangiocytes; and (2)<br />

fact<strong>or</strong>s regulating cholangiocarcinoma growth. An<br />

understanding <strong>of</strong> the growth regulat<strong>or</strong>y mechanisms<br />

<strong>of</strong> cholangiocarcinoma will lead to the identification <strong>of</strong><br />

therapeutic targets f<strong>or</strong> this devastating cancer.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Biliary carcinogenesis; Cholangiocarcinomas;<br />

Primary biliary cirrhosis; Primary sclerosing cholangitis<br />

Peer reviewer: Giammarco Fava, MD, Department <strong>of</strong> Gastroenterology,<br />

Università Politecnica delle Marche, Ancona, via<br />

www.wjgnet.com<br />

Gervasoni 12, 60129 Ancona, Italy<br />

Wise C, Pilanthananond M, Perry BF, Alpini G, McNeal M, Glaser<br />

SS. Mechanisms <strong>of</strong> biliary carcinogenesis and growth. W<strong>or</strong>ld J<br />

Gastroenterol 2008; 14(19): 2986-2989 Available from: URL:<br />

http://www.wjgnet.com/1007-9327/14/2986.asp DOI: http://<br />

dx.doi.<strong>or</strong>g/10.3748/wjg.14.2986<br />

INTRODUCTION<br />

Cholangiocytes are simple epithelial cells that line the<br />

intrahepatic biliary tract, which is a three-dimensional<br />

netw<strong>or</strong>k <strong>of</strong> interconnecting ducts. The primar y<br />

physiological function <strong>of</strong> cholangiocytes is the modification<br />

bile <strong>of</strong> canalicular <strong>or</strong>igin and drainage <strong>of</strong> bile from<br />

the liver [1] . In addition to their role in the modification<br />

<strong>of</strong> ductal bile, cholangiocytes also participate in the<br />

detoxification <strong>of</strong> xenobiotics [1] . In recent years, interest in<br />

the study <strong>of</strong> cholangiocytes has increased dramatically due<br />

to a rise in the incidence <strong>of</strong> cholestatic liver diseases and<br />

biliary tract cancers (i.e. cholangiocarcinoma) in patients<br />

w<strong>or</strong>ldwide [2-5] .<br />

In diseases <strong>of</strong> the biliary tree (e.g. primary biliary<br />

cirrhosis (PBC), primary sclerosing cholangitis (PSC),<br />

liver allograft rejection and graft-versus-host disease),<br />

cholangiocytes are the primary target cells [1] . These<br />

cholangiopathies cause m<strong>or</strong>bidity and m<strong>or</strong>tality and are a<br />

maj<strong>or</strong> indication f<strong>or</strong> liver transplantation [1] . In fact, these<br />

diseases contribute to 20% <strong>of</strong> the liver transplants in adults<br />

and 50% <strong>of</strong> those in pediatric patients [6] . Proliferation <strong>of</strong><br />

cholangiocytes is critical f<strong>or</strong> the maintenance <strong>of</strong> biliary<br />

mass and secret<strong>or</strong>y function during the pathogenesis <strong>of</strong><br />

chronic cholestatic liver diseases, such as primary biliary<br />

cirrhosis (PBC), and primary sclerosing cholangitis (PSC).<br />

Previous studies have demonstrated that proliferating<br />

cholangiocytes serve as a neuroendocrine compartment<br />

during liver disease pathogenesis and as such secrete and<br />

respond to a number <strong>of</strong> h<strong>or</strong>mones and neuropeptides<br />

contributing to the autocrine and paracrine pathways<br />

that modulate liver inflammation and fibrosis, which are<br />

predicted to play key roles in cholangiocarcinogenesis [7] .<br />

Cholangiocarcinomas are adenocarcinomas that arise<br />

from the neoplastic transf<strong>or</strong>mation <strong>of</strong> cholangiocytes.<br />

Cholangiocarcinoma occurs in approximately 2 per 100 000<br />

people and account f<strong>or</strong> approximately 13% <strong>of</strong> primary liver<br />

cancers [4] . Cholangiocarcinomas can be divided into three<br />

categ<strong>or</strong>ies <strong>based</strong> upon anatomic location: (1) intrahepatic

---

Wise C et al . Biliary carcinogenesis 2987<br />

cholangiocarcinoma, occurring in the bile ducts residing<br />

within the liver; (2) hilar cholangiocarcinoma, occurring<br />

at the confluence <strong>of</strong> the right and left hepatic ducts; and<br />

(3) distal extrahepatic bile duct cancers [8] . The prognosis<br />

f<strong>or</strong> cholangiocarcinoma is grim due to lack <strong>of</strong> early<br />

diagnostic modalities and effective treatment paradigms.<br />

Cholangiocarcinomas are slow growing, metastasize<br />

late during the cancer’s progression, and present with<br />

symptoms <strong>of</strong> cholestasis due to the blockage <strong>of</strong> the bile<br />

duct by tum<strong>or</strong> growth [8] . In most cases, the tum<strong>or</strong>s are<br />

well advanced at the time <strong>of</strong> diagnosis, which results in<br />

limited treatment options [9] . Many <strong>of</strong> these tum<strong>or</strong>s are too<br />

advanced to be removed surgically and chemotherapy and<br />

radiation therapy usually are not effective, which indicates<br />

the dire need to understand the mechanisms that activate<br />

the neoplastic transf<strong>or</strong>mation <strong>of</strong> cholangiocytes and<br />

control the growth <strong>of</strong> cholangiocarcinomas.<br />

RISK FACTORS FOR<br />

CHOLANGIOCARCINOMA<br />

Several recent studies have shown that there is an<br />

increasing incidence <strong>of</strong> cholangiocarcinoma w<strong>or</strong>ld-wide<br />

and in particular in Western countries, such as the United<br />

States, the United Kingdom, and Australia [4,10-12] . Although<br />

most patients do not have identifiable risk fact<strong>or</strong>s f<strong>or</strong><br />

the disease, several risk fact<strong>or</strong> have been established f<strong>or</strong><br />

cholangiocarcinoma [13] . The list <strong>of</strong> risk fact<strong>or</strong>s includes:<br />

gallstones <strong>or</strong> gallbladder inflammation, chronic ulcerative<br />

colitis, chronic infection <strong>of</strong> liver flukes, Clon<strong>or</strong>chis sinensis<br />

and Opisth<strong>or</strong>chis viverrini, and primary sclerosing cholangitis<br />

(PSC) [14] . In addition, a recent study revealed several<br />

novel risk fact<strong>or</strong>s f<strong>or</strong> intrahepatic cholangiocarcinoma [15] .<br />

Hepatitis C virus infection, non-alcoholic fatty liver<br />

disease, obesity and smoking are all associated with<br />

intrahepatic cholangiocarcinoma [15] . The maj<strong>or</strong>ity <strong>of</strong> these<br />

risk fact<strong>or</strong>s have the common features <strong>of</strong> chronic liver<br />

inflammation, cholestasis, and increased cholangiocyte<br />

turnover [16,17] .<br />

MOLECULAR MECHANISMS<br />

CONTRIBUTING TO<br />

CHOLANGIOCARCINOGENESIS<br />

A common and imp<strong>or</strong>tant contribut<strong>or</strong> to the malignant<br />

transf<strong>or</strong>mation <strong>of</strong> cholangiocytes is chronic inflammation<br />

<strong>of</strong> the liver. This inflammation is <strong>of</strong>ten coupled with<br />

the injury <strong>of</strong> bile duct epithelium and obstruction <strong>of</strong><br />

bile flow, which increases cholangiocyte turnover (i.e.<br />

dysregulation in the balance <strong>of</strong> cholangiocyte proliferation<br />

and apoptosis) [9,18] . Persistent inflammation is thought<br />

to promote carcinogenesis by causing DNA damage,<br />

activating tissue reparative proliferation, and by creating<br />

a local environment that is enriched with cytokines and<br />

other growth fact<strong>or</strong>s [19] . Thereby, chronic inflammation<br />

creates local environmental conditions that are primed<br />

f<strong>or</strong> cells to develop autonomous proliferative signaling<br />

by constitutive activation <strong>of</strong> pro-proliferative intracellular<br />

signaling pathways and enhanced production <strong>of</strong> mitogenic<br />

fact<strong>or</strong>s. Indeed recent studies have demonstrated that<br />

cholangiocytes release cytokines, such as interleukin 6<br />

(IL-6), transf<strong>or</strong>ming growth fact<strong>or</strong>-β (TGF-β), IL-8,<br />

tum<strong>or</strong> necrosis fact<strong>or</strong>-α (TNF-α) and platelet–derived<br />

growth fact<strong>or</strong> (PDGF). These fact<strong>or</strong>s can interact with<br />

cholangiocytes in an autocrine/paracrine fashion to<br />

regulate cholangiocyte intracellular signaling responses,<br />

which are thought to be altered during cholangiocarcinoge<br />

nesis [20] .<br />

Cytokines activate inducible nitric oxide synthase<br />

(iNOS) in cholangiocytes. This results in the generation <strong>of</strong><br />

nitric oxide, which along with other reactive oxygen species,<br />

may alter DNA bases, result in direct DNA damage and<br />

trigger the downregulation <strong>of</strong> DNA repair mechanisms [18] .<br />

Nitric oxide can directly <strong>or</strong> through the f<strong>or</strong>mation <strong>of</strong><br />

peroxynitrite species can lead to the deamination <strong>of</strong><br />

guanine and DNA adduct f<strong>or</strong>mation thereby promoting<br />

DNA mutations [18,21] . The resultant DNA damage leads to<br />

an increased mutation rate and alteration <strong>of</strong> genes critical<br />

to cell proliferation control. Consistent with this line <strong>of</strong><br />

thought, activating mutations and the overexpression <strong>of</strong><br />

EGFR, erb-2, K-ras, BRAF and hepatocyte growth fact<strong>or</strong>/<br />

c-met (HGF) have been rep<strong>or</strong>ted f<strong>or</strong> cholangiocarcinoma.<br />

In addition, the proto-oncogene c-erbB-2 is activated in<br />

patients with cholangiocarcinoma [22,23] . Mutations affecting<br />

the promoter <strong>of</strong> the tum<strong>or</strong> suppress<strong>or</strong> p16 INK4a that result<br />

in loss <strong>of</strong> transcription occur in both PSC and PSCassociated<br />

cholangiocarcinoma [24] . Alterations <strong>of</strong> p53,<br />

APC, and DPC4 tum<strong>or</strong> suppress<strong>or</strong> genes by a combination<br />

<strong>of</strong> chromosomal deletion, mutation, <strong>or</strong> methylation; and<br />

infrequently microsatellite instability have also been linked<br />

to cholangiocarcinoma [25] . In addition to increased ability<br />

<strong>of</strong> cholangiocytes to escape from senescence, activation<br />

<strong>of</strong> iNOS promotes the upregulation <strong>of</strong> COX-2 in<br />

imm<strong>or</strong>talized mouse cholangiocytes suggesting that COX-2<br />

and COX-2 derived prostanoids might play a key role in<br />

cholangiocarcinogenesis [26,27] . COX-2 also upregulated the<br />

expression <strong>of</strong> Notch, which has been implicated in other<br />

cancer types [27] .<br />

Cytokines, such as IL-6, appear to play an imp<strong>or</strong>tant<br />

role in cholangiocyte evasion <strong>of</strong> apoptosis. During<br />

the pathogenesis <strong>of</strong> cancer, the activation <strong>of</strong> evasion<br />

<strong>of</strong> apoptosis pathways helps to prevent cells with<br />

accumulating DNA damage from undergoing cell death<br />

pathways that n<strong>or</strong>mally eliminate such dysfunctional cells.<br />

Cholangiocarcinoma cells have been shown to secrete<br />

IL-6 and in an autocrine fashion IL-6 activates the prosurvival<br />

p38 mitogen activated protein kinase [28] . In fact,<br />

IL-6 upregulated the expression <strong>of</strong> myeloid cell leukemia-1<br />

(Mcl-1) expression through STAT3 and AKT signaling<br />

pathways [29,30] . Mcl-1 is an anti-apoptotic protein in the<br />

Bcl-2 family <strong>of</strong> apoptotic proteins. Recently, the cellular<br />

expression <strong>of</strong> Mcl-1 has been shown to be controlled by<br />

the small endogenous RNA molecule, mir-29, which is<br />

down regulated in malignant cells consistent with Mcl-1<br />

overexpression [31] . Enf<strong>or</strong>ced expression <strong>of</strong> mir-29 reduced<br />

Mcl-1 expression the malignant human cholangiocytes,<br />

KMCH [31] . Modulation <strong>of</strong> expression small endogenous<br />

RNAs such as mir-29 might represent a therapeutic<br />

paradigm f<strong>or</strong> cholangiocarcinomas.<br />

www.wjgnet.com

---

2988 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

Cholestasis<br />

and<br />

chronic inflammation<br />

Release <strong>of</strong> growth<br />

promoting fact<strong>or</strong>s<br />

and cytokines<br />

NO, COX-2 upregulation,<br />

HGF/c-met K-ras mutation,<br />

Mcl-1 upregulation, p16 INK4<br />

mutation<br />

FACTORS REGULATING<br />

Biliary epithelium<br />

IL-6, TGF-β, IL-8, TNF-α, PDGF<br />

Cholangiocyte proliferation<br />

Enhanced proliferative signaling, increased<br />

mutation <strong>of</strong> tum<strong>or</strong> suppress<strong>or</strong> genes,<br />

evasion <strong>of</strong> apoptosis<br />

Cholangiocarcinoma<br />

Figure 1 Summary <strong>of</strong> key mechanisms regulating cholangiocarcinogenesis.<br />

CHOLANGIOCARCINOMA GROWTH<br />

A number <strong>of</strong> recent studies have shown that the nervous<br />

system, neuropeptides and neuroendocrine h<strong>or</strong>mones<br />

play a key role in the modulation <strong>of</strong> cholangiocarcinoma<br />

growth [32] . We have demonstrated that proliferating<br />

cholangiocytes serve as a neuroendocrine compartment<br />

during liver disease pathogenesis and as such secrete and<br />

respond to a number <strong>of</strong> h<strong>or</strong>mones and neuropeptides<br />

contributing to the autocrine and paracrine pathways<br />

that modulate liver inflammation and fibrosis [7] . The<br />

sympathetic nervous system has been shown to have a<br />

role in the negative regulation <strong>of</strong> cholangiocarcinoma<br />

growth [33] . The cholangiocarcinoma cell lines, Mz-<br />

ChA-1 and TFK-1, express the α2A-, α2B-, and α2Cadrenergic<br />

recept<strong>or</strong> subtypes [33] . Stimulation <strong>of</strong> the α2<br />

recept<strong>or</strong>s induced an upregulation <strong>of</strong> intracellular cAMP,<br />

which inhibited EGF-induced MAPK activity through<br />

an increase in Raf-1 and the sustained activation <strong>of</strong><br />

B-raf, which resulted in the subsequent reduction <strong>of</strong><br />

cholangiocarcinoma proliferation [33] . Although muscarinic<br />

acetylcholine recept<strong>or</strong> are expressed by cholangiocytes<br />

and play a role in regulating secretin-induced bile flow in<br />

rodents, the role <strong>of</strong> the parasympathetic nervous system<br />

has not been evaluated in cholangiocarcinoma and warrants<br />

consideration as a fact<strong>or</strong> regulating cholangiocarcinoma<br />

growth [34,35] .<br />

Other neuroendocrine h<strong>or</strong>mones and neurotransmitters<br />

have also been shown to play a role in the regulation <strong>of</strong><br />

cholangiocarcinoma growth. The cholangiocarcinoma<br />

cell lines, Mz-ChA-1, HuH-28 and TFK-1, express<br />

the gastrin/CCK-B recept<strong>or</strong> and gastrin inhibits the<br />

proliferation and induces the activation <strong>of</strong> apoptosis in<br />

these cholangiocarcinomas through the activation <strong>of</strong> Ca 2+ -<br />

dependent PKC-α signaling. Most recently, Fava et al<br />

have shown that γ-aminobutyric acid (GABA) inhibits<br />

cholangiocarcinoma cell proliferation and migration [36] .<br />

This effect was also evident in vivo with GABA significantly<br />

decreasing the growth <strong>of</strong> cholangiocarcinoma tum<strong>or</strong><br />

xenografts in nude mice [36] .<br />

Female steroid h<strong>or</strong>mones, such as estrogens, have<br />

also been shown to play a role in the promoting <strong>of</strong><br />

www.wjgnet.com<br />

cholangiocarcinoma cell growth. 17-β estradiol stimulated<br />

the proliferation <strong>of</strong> human cholangiocarcinoma cells<br />

in vitro, which was blocked by tamoxifen [37] . Alvaro<br />

et al have demonstrated that human intrahepatic<br />

cholangiocarcinomas express the recept<strong>or</strong>s f<strong>or</strong> both<br />

estrogens and insulin-like growth fact<strong>or</strong> (IGF-1) [38] . Their<br />

study indicates that estrogens and IGF-1 co<strong>or</strong>dinately<br />

regulate cholangiocarcinoma growth and apoptosis [38] .<br />

Modulation <strong>of</strong> the endocannabinoid system is currently<br />

being targeted to develop possible therapeutic strategies<br />

f<strong>or</strong> other cancer types. We recently demonstrated the novel<br />

finding that the two maj<strong>or</strong> endocannabinoids, anandamide<br />

and 2-arachidonylglycerol, have opposing actions on<br />

cholangiocarcinoma growth [39] . Interestingly, anandamide<br />

was found to be antiproliferative and to promote<br />

apoptosis, while, in contrast, 2-arachidonylglycerol<br />

stimulated cholangiocarcinoma cell growth [39] . Anandamide<br />

was shown to recruited Fas and Fas ligand into lipid rafts<br />

resulting in the activation <strong>of</strong> death recept<strong>or</strong> pathways and<br />

apoptosis in the cholangiocarcinoma cells [39] .<br />

CONCLUSION<br />

Cholangiocarcinoma is a devastating neoplasm <strong>of</strong><br />

the biliary tract that is increasing in incidence. While<br />

treatment options are limited, our knowledge base <strong>of</strong><br />

the fact<strong>or</strong>s controlling cholangiocarcinogenesis and<br />

cholangiocarcinoma growth has greatly expanded in the<br />

past decade. These studies have clearly demonstrated<br />

that, during the course <strong>of</strong> chronic cholestasis and<br />

associated liver inflammation, a number <strong>of</strong> fact<strong>or</strong>s are<br />

released into the local environment that set into motion<br />

a series <strong>of</strong> events compound genomic damage leading<br />

to autonomous proliferation and escape from apoptosis<br />

(Figure 1). Several potential areas seem promising f<strong>or</strong><br />

the development <strong>of</strong> prevention and treatment strategies<br />

f<strong>or</strong> cholangiocarcinoma. In particular, inhibition <strong>of</strong> the<br />

COX-2 pathway during PSC warrants further investigation.<br />

Also, modulation <strong>of</strong> cholangiocarcinoma growth by the<br />

regulating neural imput <strong>or</strong> the endocannabinoid system<br />

might prove fruitful. Understanding the molecular<br />

mechanisms triggering biliary tract cancers will be key f<strong>or</strong><br />

the development <strong>of</strong> new treatments and diagnostic tools<br />

f<strong>or</strong> cholangiocarcinoma.<br />

REFERENCES<br />

1 Alpini G, Prall RT, LaRusso NF. The pathobiology <strong>of</strong> biliary<br />

epithelia. The Liver; Biology & Pathobiology, 4E I M Arias,<br />

Boyer JL, Chisari FV, Fausto N, Jakoby W, Schachter D, and<br />

Shafritz D. Philadelphia: Lippincott Williams & Wilkins, 2001:<br />

421-435<br />

2 Roberts SK, Ludwig J, Larusso NF. The pathobiology <strong>of</strong><br />

biliary epithelia. Gastroenterology 1997; 112: 269-279<br />

3 Ahrendt SA, Nakeeb A, Pitt HA. Cholangiocarcinoma. Clin<br />

Liver Dis 2001; 5: 191-218<br />

4 Patel T. W<strong>or</strong>ldwide trends in m<strong>or</strong>tality from biliary tract<br />

malignancies. BMC Cancer 2002; 2: 10<br />

5 Patel T. Cholangiocarcinoma. Nat Clin Pract Gastroenterol<br />

Hepatol 2006; 3: 33-42<br />

6 Annual Rep<strong>or</strong>t <strong>of</strong> the US Organ Procurement. Transplantation<br />

Netw<strong>or</strong>k and the Scientific Registry f<strong>or</strong> Transplant<br />

Recipients: Transplant Data 1991-2000<br />

7 Alvaro D, Mancino MG, Glaser S, Gaudio E, Marzioni

---

Wise C et al . Biliary carcinogenesis 2989<br />

M, Francis H, Alpini G. Proliferating cholangiocytes:<br />

a neuroendocrine compartment in the diseased liver.<br />

Gastroenterology 2007; 132: 415-431<br />

8 Malhi H, G<strong>or</strong>es GJ. Cholangiocarcinoma: modern advances in<br />

understanding a deadly old disease. J Hepatol 2006; 45: 856-867<br />

9 Lazaridis KN, G<strong>or</strong>es GJ. Cholangiocarcinoma. Gastroenterology<br />

2005; 128: 1655-1667<br />

10 Tayl<strong>or</strong>-Robinson SD, Toledano MB, Ar<strong>or</strong>a S, Keegan TJ,<br />

Hargreaves S, Beck A, Khan SA, Elliott P, Thomas HC. Increase<br />

in m<strong>or</strong>tality rates from intrahepatic cholangiocarcinoma in<br />

England and Wales 1968-1998. Gut 2001; 48: 816-820<br />

11 Khan SA, Tayl<strong>or</strong>-Robinson SD, Toledano MB, Beck A, Elliott P,<br />

Thomas HC. Changing international trends in m<strong>or</strong>tality rates<br />

f<strong>or</strong> liver, biliary and pancreatic tumours. J Hepatol 2002; 37:<br />

806-813<br />

12 Davila JA, El-Serag HB. Cholangiocarcinoma: the "other" liver<br />

cancer on the rise. Am J Gastroenterol 2002; 97: 3199-200<br />

13 G<strong>or</strong>es GJ. Cholangiocarcinoma: current concepts and insights.<br />

Hepatology 2003; 37: 961-969<br />

14 Khan SA, Davidson BR, Goldin R, Pereira SP, Rosenberg WM,<br />

Tayl<strong>or</strong>-Robinson SD, Thillainayagam AV, Thomas HC, Thursz<br />

MR, Wasan H. Guidelines f<strong>or</strong> the diagnosis and treatment <strong>of</strong><br />

cholangiocarcinoma: consensus document. Gut 2002; 51 Suppl<br />

6: VI1-VI9<br />

15 Welzel TM, Graubard BI, El-Serag HB, Shaib YH, Hsing<br />

AW, Davila JA, McGlynn KA. Risk fact<strong>or</strong>s f<strong>or</strong> intrahepatic<br />

and extrahepatic cholangiocarcinoma in the United States: a<br />

population-<strong>based</strong> case-control study. Clin Gastroenterol Hepatol<br />

2007; 5: 1221-1228<br />

16 Okuda K, Nakanuma Y, Miyazaki M. Cholangiocarcinoma:<br />

recent progress. Part 2: molecular pathology and treatment. J<br />

Gastroenterol Hepatol 2002; 17: 1056-1063<br />

17 Okuda K, Nakanuma Y, Miyazaki M. Cholangiocarcinoma:<br />

recent progress. Part 1: epidemiology and etiology. J<br />

Gastroenterol Hepatol 2002; 17: 1049-1055<br />

18 Jaiswal M, LaRusso NF, Burgart LJ, G<strong>or</strong>es GJ. Inflammat<strong>or</strong>y<br />

cytokines induce DNA damage and inhibit DNA repair<br />

in cholangiocarcinoma cells by a nitric oxide-dependent<br />

mechanism. Cancer Res 2000; 60: 184-190<br />

19 Schottenfeld D, Beebe-Dimmer J. Chronic inflammation:<br />

a common and imp<strong>or</strong>tant fact<strong>or</strong> in the pathogenesis <strong>of</strong><br />

neoplasia. CA Cancer J Clin 2006; 56: 69-83<br />

20 Berthiaume EP, Wands J. The molecular pathogenesis <strong>of</strong><br />

cholangiocarcinoma. Semin Liver Dis 2004; 24: 127-137<br />

21 Jaiswal M, LaRusso NF, Shapiro RA, Billiar TR, G<strong>or</strong>es GJ.<br />

Nitric oxide-mediated inhibition <strong>of</strong> DNA repair potentiates<br />

oxidative DNA damage in cholangiocytes. Gastroenterology<br />

2001; 120: 190-199<br />

22 Endo K, Yoon BI, Pairojkul C, Demetris AJ, Sirica AE. ERBB-2<br />

overexpression and cyclooxygenase-2 up-regulation in human<br />

cholangiocarcinoma and risk conditions. Hepatology 2002; 36:<br />

439-450<br />

23 Lai GH, Zhang Z, Shen XN, Ward DJ, Dewitt JL, Holt SE,<br />

Rozich RA, Hixson DC, Sirica AE. erbB-2/neu transf<strong>or</strong>med<br />

rat cholangiocytes recapitulate key cellular and molecular<br />

features <strong>of</strong> human bile duct cancer. Gastroenterology 2005; 129:<br />

2047-2057<br />

24 Taniai M, Higuchi H, Burgart LJ, G<strong>or</strong>es GJ. p16INK4a<br />

promoter mutations are frequent in primary sclerosing<br />

cholangitis (PSC) and PSC-associated cholangiocarcinoma.<br />

Gastroenterology 2002; 123: 1090-1098<br />

25 Rashid A. Cellular and molecular biology <strong>of</strong> biliary tract<br />

cancers. Surg Oncol Clin N Am 2002; 11: 995-1009<br />

26 Ishimura N, Bronk SF, G<strong>or</strong>es GJ. Inducible nitric oxide<br />

synthase upregulates cyclooxygenase-2 in mouse cholangiocytes<br />

promoting cell growth. Am J Physiol Gastrointest Liver Physiol<br />

2004; 287: G88-G95<br />

27 Ishimura N, Bronk SF, G<strong>or</strong>es GJ. Inducible nitric oxide synthase<br />

up-regulates Notch-1 in mouse cholangiocytes: implications f<strong>or</strong><br />

carcinogenesis. Gastroenterology 2005; 128: 1354-1368<br />

28 Park J, Tadlock L, G<strong>or</strong>es GJ, Patel T. Inhibition <strong>of</strong> interleukin<br />

6-mediated mitogen-activated protein kinase activation<br />

attenuates growth <strong>of</strong> a cholangiocarcinoma cell line. Hepatology<br />

1999; 30: 1128-1133<br />

29 Isomoto H, Kobayashi S, Werneburg NW, Bronk SF,<br />

Guicciardi ME, Frank DA, G<strong>or</strong>es GJ. Interleukin 6 upregulates<br />

myeloid cell leukemia-1 expression through a STAT3 pathway<br />

in cholangiocarcinoma cells. Hepatology 2005; 42: 1329-1338<br />

30 Kobayashi S, Werneburg NW, Bronk SF, Kaufmann SH,<br />

G<strong>or</strong>es GJ. Interleukin-6 contributes to Mcl-1 up-regulation<br />

and TRAIL resistance via an Akt-signaling pathway in<br />

cholangiocarcinoma cells. Gastroenterology 2005; 128: 2054-2065<br />

31 Mott JL, Kobayashi S, Bronk SF, G<strong>or</strong>es GJ. mir-29 regulates<br />

Mcl-1 protein expression and apoptosis. Oncogene 2007; 26:<br />

6133-6140<br />

32 Marzioni M, Fava G, Benedetti A. Nervous and Neuroendocrine<br />

regulation <strong>of</strong> the pathophysiology <strong>of</strong> cholestasis and <strong>of</strong> biliary<br />

carcinogenesis. W<strong>or</strong>ld J Gastroenterol 2006; 12: 3471-3480<br />

33 Kanno N, Lesage G, Phinizy JL, Glaser S, Francis H, Alpini<br />

G. Stimulation <strong>of</strong> alpha2-adrenergic recept<strong>or</strong> inhibits<br />

cholangiocarcinoma growth through modulation <strong>of</strong> Raf-1 and<br />

B-Raf activities. Hepatology 2002; 35: 1329-1340<br />

34 Alvaro D, Alpini G, Jezequel AM, Bassotti C, Francia C, Fraioli<br />

F, Romeo R, Marucci L, Le Sage G, Glaser SS, Benedetti A. Role<br />

and mechanisms <strong>of</strong> action <strong>of</strong> acetylcholine in the regulation <strong>of</strong><br />

rat cholangiocyte secret<strong>or</strong>y functions. J Clin Invest 1997; 100:<br />

1349-1362<br />

35 LeSagE G, Alvaro D, Benedetti A, Glaser S, Marucci L,<br />

Baiocchi L, Eisel W, Caligiuri A, Phinizy JL, Rodgers R, Francis<br />

H, Alpini G. Cholinergic system modulates growth, apoptosis,<br />

and secretion <strong>of</strong> cholangiocytes from bile duct-ligated rats.<br />

Gastroenterology 1999; 117: 191-199<br />

36 Fava G, Marucci L, Glaser S, Francis H, De M<strong>or</strong>row S, Benedetti<br />

A, Alvaro D, Venter J, Meininger C, Patel T, Taffetani S,<br />

Marzioni M, Summers R, Reichenbach R, Alpini G. gamma-<br />

Aminobutyric acid inhibits cholangiocarcinoma growth by<br />

cyclic AMP-dependent regulation <strong>of</strong> the protein kinase A/<br />

extracellular signal-regulated kinase 1/2 pathway. Cancer Res<br />

2005; 65: 11437-11446<br />

37 Sampson LK, Vickers SM, Ying W, Phillips JO. Tamoxifenmediated<br />

growth inhibition <strong>of</strong> human cholangiocarcinoma.<br />

Cancer Res 1997; 57: 1743-1749<br />

38 Alvaro D, Barbaro B, Franchitto A, On<strong>or</strong>i P, Glaser SS, Alpini<br />

G, Francis H, Marucci L, Sterpetti P, Ginanni-C<strong>or</strong>radini S,<br />

Onetti Muda A, Dostal DE, De Santis A, Attili AF, Benedetti A,<br />

Gaudio E. Estrogens and insulin-like growth fact<strong>or</strong> 1 modulate<br />

neoplastic cell growth in human cholangiocarcinoma. Am J<br />

Pathol 2006; 169: 877-888<br />

39 DeM<strong>or</strong>row S, Glaser S, Francis H, Venter J, Vaculin B, Vaculin<br />

S, Alpini G. Opposing actions <strong>of</strong> endocannabinoids on<br />

cholangiocarcinoma growth: recruitment <strong>of</strong> Fas and Fas ligand<br />

to lipid rafts. J Biol Chem 2007; 282: 13098-13113<br />

S- Edit<strong>or</strong> Liu Y L- Edit<strong>or</strong> Negro F E- Edit<strong>or</strong> Lu W<br />

www.wjgnet.com

---

Socoteanu MP et al . c-Met targeted therapy <strong>of</strong> cholangiocarcinoma 2993<br />

f<strong>or</strong> cholangiocellular carcinoma: analysis <strong>of</strong> a single-center<br />

experience and review <strong>of</strong> the literature. Liver Transpl 2001; 7:<br />

1023-1033<br />

2 Iwatsuki S, Todo S, Marsh JW, Madariaga JR, Lee RG, Dv<strong>or</strong>chik<br />

I, Fung JJ, Starzl TE. Treatment <strong>of</strong> hilar cholangiocarcinoma<br />

(Klatskin tum<strong>or</strong>s) with hepatic resection <strong>or</strong> transplantation. J<br />

Am Coll Surg 1998; 187: 358-364<br />

3 Goldstein RM, Stone M, Tillery GW, Senzer N, Levy M,<br />

Husberg BS, Gonwa T, Klintmalm G. Is liver transplantation<br />

indicated f<strong>or</strong> cholangiocarcinoma? Am J Surg 1993; 166:<br />

768-771; discussion 771-772<br />

4 Becker NS, Rodriguez JA, Barshes NR, O'Mahony CA,<br />

Goss JA, Aloia TA. Outcomes Analysis f<strong>or</strong> 280 Patients with<br />

Cholangiocarcinoma Treated with Liver Transplantation Over<br />

an 18-year Period. J Gastrointest Surg 2008; 12: 117-122<br />

5 Thongprasert S. The role <strong>of</strong> chemotherapy in cholangiocarcinoma.<br />

Ann Oncol 2005; 16 Suppl 2: ii93-ii96<br />

6 Alberts SR, Al-Khatib H, Mahoney MR, Burgart L, Cera<br />

PJ, Flynn PJ, Finch TR, Levitt R, Windschitl HE, Knost JA,<br />

Tschetter LK. Gemcitabine, 5-flu<strong>or</strong>ouracil, and leucov<strong>or</strong>in in<br />

advanced biliary tract and gallbladder carcinoma: a N<strong>or</strong>th<br />

Central Cancer Treatment Group phase II trial. Cancer 2005;<br />

103: 111-118<br />

7 Therasse P, Arbuck SG, Eisenhauer EA, Wanders J, Kaplan<br />

RS, Rubinstein L, Verweij J, Van Glabbeke M, van Oosterom<br />

AT, Christian MC, Gwyther SG. New guidelines to evaluate<br />

the response to treatment in solid tum<strong>or</strong>s. European<br />

Organization f<strong>or</strong> Research and Treatment <strong>of</strong> Cancer, National<br />

Cancer Institute <strong>of</strong> the United States, National Cancer Institute<br />

<strong>of</strong> Canada. J Natl Cancer Inst 2000; 92: 205-216<br />

8 Lee CS, Pirdas A. Epidermal growth fact<strong>or</strong> recept<strong>or</strong><br />

immun<strong>or</strong>eactivity in gallbladder and extrahepatic biliary tract<br />

tumours. Pathol Res Pract 1995; 191: 1087-1091<br />

9 Yoon JH, Gwak GY, Lee HS, Bronk SF, Werneburg NW, G<strong>or</strong>es<br />

GJ. Enhanced epidermal growth fact<strong>or</strong> recept<strong>or</strong> activation in<br />

human cholangiocarcinoma cells. J Hepatol 2004; 41: 808-814<br />

10 Werneburg NW, Yoon JH, Higuchi H, G<strong>or</strong>es GJ. Bile acids<br />

activate EGF recept<strong>or</strong> via a TGF-alpha-dependent mechanism<br />

in human cholangiocyte cell lines. Am J Physiol Gastrointest<br />

Liver Physiol 2003; 285: G31-G36<br />

11 Shepherd FA, Rodrigues Pereira J, Ciuleanu T, Tan EH, Hirsh<br />

V, Thongprasert S, Campos D, Maoleekoonpiroj S, Smylie M,<br />

Martins R, van Kooten M, Dediu M, Findlay B, Tu D, Johnston<br />

D, Bezjak A, Clark G, Santabarbara P, Seymour L. Erlotinib in<br />

previously treated non-small-cell lung cancer. N Engl J Med<br />

2005; 353: 123-132<br />

12 Mo<strong>or</strong>e MJ, Goldstein D, Hamm J, Figer A, Hecht JR, Gallinger<br />

S, Au HJ, Murawa P, Walde D, Wolff RA, Campos D, Lim<br />

R, Ding K, Clark G, Voskoglou-Nomikos T, Ptasynski M,<br />

Parulekar W. Erlotinib plus gemcitabine compared with<br />

gemcitabine alone in patients with advanced pancreatic<br />

cancer: a phase III trial <strong>of</strong> the National Cancer Institute <strong>of</strong><br />

Canada Clinical Trials Group. J Clin Oncol 2007; 25: 1960-1966<br />

13 Philip PA, Mahoney MR, Allmer C, Thomas J, Pitot HC, Kim G,<br />

Donehower RC, Fitch T, Picus J, Erlichman C. Phase II study<br />

<strong>of</strong> erlotinib in patients with advanced biliary cancer. J Clin<br />

Oncol 2006; 24: 3069-3074<br />

14 Tsao MS, Sakurada A, Cutz JC, Zhu CQ, Kamel-Reid S, Squire<br />

J, L<strong>or</strong>imer I, Zhang T, Liu N, Daneshmand M, Marrano P,<br />

da Cunha Santos G, Lagarde A, Richardson F, Seymour L,<br />

Whitehead M, Ding K, Pater J, Shepherd FA. Erlotinib in lung<br />

cancer - molecular and clinical predict<strong>or</strong>s <strong>of</strong> outcome. N Engl J<br />

Med 2005; 353: 133-144<br />

15 Tsao MS, Liu G, Shepherd FA. Serum proteomic classifier<br />

f<strong>or</strong> predicting response to epidermal growth fact<strong>or</strong> recept<strong>or</strong><br />

inhibit<strong>or</strong> therapy: have we built a better mousetrap? J Natl<br />

Cancer Inst 2007; 99: 826-827<br />

16 Olnes MJ, Erlich R. A review and update on cholangiocarcinoma.<br />

Oncology 2004; 66: 167-179<br />

17 Rashid A. Cellular and molecular biology <strong>of</strong> biliary tract<br />

cancers. Surg Oncol Clin N Am 2002; 11: 995-1009<br />

18 Terada T, Nakanuma Y, Sirica AE. Immunohistochemical<br />

demonstration <strong>of</strong> MET overexpression in human intrahepatic<br />

cholangiocarcinoma and in hepatolithiasis. Hum Pathol 1998;<br />

29: 175-180<br />

19 Farazi PA, Zeisberg M, Glickman J, Zhang Y, Kalluri R,<br />

DePinho RA. Chronic bile duct injury associated with fibrotic<br />

matrix microenvironment provokes cholangiocarcinoma in<br />

p53-deficient mice. Cancer Res 2006; 66: 6622-6627<br />

20 Radaeva S, Ferreira-Gonzalez A, Sirica AE. Overexpression <strong>of</strong><br />

C-NEU and C-MET during rat liver cholangiocarcinogenesis:<br />

A link between biliary intestinal metaplasia and mucinproducing<br />

cholangiocarcinoma. Hepatology 1999; 29: 1453-1462<br />

21 Furge KA, Zhang YW, Vande Woude GF. Met recept<strong>or</strong><br />

tyrosine kinase: enhanced signaling through adapter proteins.<br />

Oncogene 2000; 19: 5582-5589<br />

22 Gao CF, Vande Woude GF. HGF/SF-Met signaling in tum<strong>or</strong><br />

progression. Cell Res 2005; 15: 49-51<br />

23 Birchmeier C, Birchmeier W, Gherardi E, Vande Woude GF.<br />

Met, metastasis, motility and m<strong>or</strong>e. Nat Rev Mol Cell Biol 2003; 4:<br />

915-925<br />

24 Zhang YW, Vande Woude GF. HGF/SF-met signaling in<br />

the control <strong>of</strong> branching m<strong>or</strong>phogenesis and invasion. J Cell<br />

Biochem 2003; 88: 408-417<br />

25 Hida Y, M<strong>or</strong>ita T, Fujita M, Miyasaka Y, H<strong>or</strong>ita S, Fujioka Y,<br />

Nagashima K, Katoh H. Clinical significance <strong>of</strong> hepatocyte<br />

growth fact<strong>or</strong> and c-Met expression in extrahepatic biliary<br />

tract cancers. Oncol Rep 1999; 6: 1051-1056<br />

26 Aishima SI, Taguchi KI, Sugimachi K, Shimada M, Sugimachi<br />

K, Tsuneyoshi M. c-erbB-2 and c-Met expression relates to<br />

cholangiocarcinogenesis and progression <strong>of</strong> intrahepatic<br />

cholangiocarcinoma. Histopathology 2002; 40: 269-278<br />

27 Leelawat K, Leelawat S, Tepaks<strong>or</strong>n P, Rattanasinganchan<br />

P, Leungchaweng A, Tohtong R, Sobhon P. Involvement <strong>of</strong><br />

c-Met/hepatocyte growth fact<strong>or</strong> pathway in cholangiocarcinoma<br />

cell invasion and its therapeutic inhibition with small<br />

interfering RNA specific f<strong>or</strong> c-Met. J Surg Res 2006; 136: 78-84<br />

28 Sirica AE. Cholangiocarcinoma: molecular targeting strategies<br />

f<strong>or</strong> chemoprevention and therapy. Hepatology 2005; 41: 5-15<br />

29 Peruzzi B, Bottaro DP. Targeting the c-Met signaling pathway<br />

in cancer. Clin Cancer Res 2006; 12: 3657-3660<br />

30 Cao B, Su Y, Oskarsson M, Zhao P, K<strong>or</strong>t EJ, Fisher RJ, Wang<br />

LM, Vande Woude GF. Neutralizing monoclonal antibodies<br />

to hepatocyte growth fact<strong>or</strong>/scatter fact<strong>or</strong> (HGF/SF) display<br />

antitum<strong>or</strong> activity in animal models. Proc Natl Acad Sci USA<br />

2001; 98: 7443-7448<br />

31 Kim KJ, Wang L, Su YC, Gillespie GY, Salhotra A, Lal B,<br />

Laterra J. Systemic anti-hepatocyte growth fact<strong>or</strong> monoclonal<br />

antibody therapy induces the regression <strong>of</strong> intracranial glioma<br />

xenografts. Clin Cancer Res 2006; 12: 1292-1298<br />

32 Burgess T, Coxon A, Meyer S, Sun J, Rex K, Tsuruda T, Chen<br />

Q, Ho SY, Li L, Kaufman S, McD<strong>or</strong>man K, Cattley RC, Sun<br />

J, Elliott G, Zhang K, Feng X, Jia XC, Green L, Radinsky R,<br />

Kendall R. Fully human monoclonal antibodies to hepatocyte<br />

growth fact<strong>or</strong> with therapeutic potential against hepatocyte<br />

growth fact<strong>or</strong>/c-Met-dependent human tum<strong>or</strong>s. Cancer Res<br />

2006; 66: 1721-1729<br />

33 Kakkar T, Ma M, Zhuang Y, Patton A, Hu Z, Mounho B.<br />

Pharmacokinetics and safety <strong>of</strong> a fully human hepatocyte<br />

growth fact<strong>or</strong> antibody, AMG 102, in cynomolgus monkeys.<br />

Pharm Res 2007; 24: 1910-1918<br />

34 Martens T, Schmidt NO, Eckerich C, Fillbrandt R, Merchant<br />

M, Schwall R, Westphal M, Lamszus K. A novel one-armed<br />

anti-c-Met antibody inhibits glioblastoma growth in vivo. Clin<br />

Cancer Res 2006; 12: 6144-6152<br />

35 Michieli P, Mazzone M, Basilico C, Cavassa S, Sottile A,<br />

Naldini L, Comoglio PM. Targeting the tum<strong>or</strong> and its<br />

microenvironment by a dual-function decoy Met recept<strong>or</strong>.<br />

Cancer Cell 2004; 6: 61-73<br />

36 Eder JP, Heath E, Appleman L, Shapiro G, Wang D, Malburg L,<br />

Zhu AX, Leader T, Wolanski A, LoRusso P. Phase I experience<br />

with c-MET inhibit<strong>or</strong> XL880 administered <strong>or</strong>ally to patients<br />

(pts) with solid tum<strong>or</strong>s. ASCO (Meeting Abstracts) 2007; 25:<br />

3526<br />

37 Ross RW, Stein M, Sarantopoulos J, Eisenberg P, Logan T,<br />

Srinivas S, Rosenberg J, Vaishampayan U. A phase II study <strong>of</strong><br />

www.wjgnet.com

---

2994 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

the c-Met RTK inhibit<strong>or</strong> XL880 in patients (pts) with papillary<br />

renal-cell carcinoma (PRC). ASCO (Meeting Abstracts) 2007;<br />

25: 15601<br />

38 Puri N, Khramtsov A, Ahmed S, Nallasura V, Hetzel<br />

JT, Jagadeeswaran R, Karczmar G, Salgia R. A selective<br />

small molecule inhibit<strong>or</strong> <strong>of</strong> c-Met, PHA665752, inhibits<br />

tum<strong>or</strong>igenicity and angiogenesis in mouse lung cancer<br />

xenografts. Cancer Res 2007; 67: 3529-3534<br />

39 Christensen JG, Schreck R, Burrows J, Kuruganti P, Chan E,<br />

Le P, Chen J, Wang X, Ruslim L, Blake R, Lipson KE, Ramphal<br />

J, Do S, Cui JJ, Cherrington JM, Mendel DB. A selective small<br />

molecule inhibit<strong>or</strong> <strong>of</strong> c-Met kinase inhibits c-Met-dependent<br />

phenotypes in vitro and exhibits cyt<strong>or</strong>eductive antitum<strong>or</strong><br />

activity in vivo. Cancer Res 2003; 63: 7345-7355<br />

40 Wang X, Le P, Liang C, Chan J, Kiewlich D, Miller T, Harris<br />

D, Sun L, Rice A, Vasile S, Blake RA, Howlett AR, Patel N,<br />

McMahon G, Lipson KE. Potent and selective inhibit<strong>or</strong>s <strong>of</strong><br />

the Met [hepatocyte growth fact<strong>or</strong>/scatter fact<strong>or</strong> (HGF/SF)<br />

recept<strong>or</strong>] tyrosine kinase block HGF/SF-induced tum<strong>or</strong> cell<br />

growth and invasion. Mol Cancer Ther 2003; 2: 1085-1092<br />

41 Sattler M, Pride YB, Ma P, Gramlich JL, Chu SC, Quinnan<br />

www.wjgnet.com<br />

LA, Shirazian S, Liang C, Podar K, Christensen JG, Salgia R.<br />

A novel small molecule met inhibit<strong>or</strong> induces apoptosis in<br />

cells transf<strong>or</strong>med by the oncogenic TPR-MET tyrosine kinase.<br />

Cancer Res 2003; 63: 5462-5469<br />

42 Garcia A, Rosen L, C. C. Cunningham, J. Nemunaitis, C. Li, N.<br />

Rulewski, A. Dovholuk, R. Savage, T. Chan, R. Bukowksi and<br />

T. Mekhail. Phase 1 study <strong>of</strong> ARQ 197, a selective inhibit<strong>or</strong><br />

<strong>of</strong> the c-Met RTK in patients with metastatic solid tum<strong>or</strong>s<br />

reaches recommended phase 2 dose. ASCO Annual Meeting<br />

Proceedings (Post-Meeting Edition) 2007; 25: 3525<br />

43 Smolen GA, S<strong>or</strong>della R, Muir B, Mohapatra G, Barmettler<br />

A, Archibald H, Kim WJ, Okimoto RA, Bell DW, Sgroi DC,<br />

Christensen JG, Settleman J, Haber DA. Amplification <strong>of</strong> MET<br />

may identify a subset <strong>of</strong> cancers with extreme sensitivity to the<br />

selective tyrosine kinase inhibit<strong>or</strong> PHA-665752. Proc Natl Acad<br />

Sci USA 2006; 103: 2316-2321<br />

44 Ma PC, Schaefer E, Christensen JG, Salgia R. A selective<br />

small molecule c-MET Inhibit<strong>or</strong>, PHA665752, cooperates with<br />

rapamycin. Clin Cancer Res 2005; 11: 2312-2319<br />

45 Wong L, Suh DY, Frankel AE. Toxin conjugate therapy <strong>of</strong><br />

cancer. Semin Oncol 2005; 32: 591-595<br />

S- Edit<strong>or</strong> Li DL L- Edit<strong>or</strong> Alpini GD E- Edit<strong>or</strong> Lu W

---

A<br />

Nguyen K et al . Endoscopy in diagnosis and management <strong>of</strong> cholangiocarcinoma 2997<br />

Figure 3 A: Distal common bile duct lesion with proximal biliary dilation; B: Fine needle aspiration <strong>of</strong> common bile duct lesion; C: ERCP shows distal common bile duct<br />

stricture consistent with findings on EUS.<br />

lignancy, EUS with fine needle aspiration is a useful tool<br />

(Figure 3).<br />

EUS images, alone without FNA, are not reliable in<br />

evaluating hilar lesions. Criteria such as echotexture, size<br />

<strong>of</strong> mass, contour abn<strong>or</strong>malities, and the shape and b<strong>or</strong>ders<br />

<strong>of</strong> the stenosis do not reliably differentiate malignant<br />

from benign lesions. EUS also provides visualization <strong>of</strong><br />

hilar, celiax axis and para-a<strong>or</strong>tic lymph nodes to determine<br />

local and distant metastasis. Fine needle aspiration <strong>of</strong><br />

these lymph nodes is the most accurate way to diagnose<br />

cholangiocarcinoma and also allows f<strong>or</strong> staging. In addition,<br />

EUS can evaluate the pancreas f<strong>or</strong> causes <strong>of</strong> biliary<br />

strictures such as pancreatic masses <strong>or</strong> changes <strong>of</strong> chronic<br />

pancreatitis.<br />

In a study by Fritscher-Ravens et al [11] , patients with<br />

hilar strictures and inconclusive tissue diagnosis by ERCP,<br />

underwent EUS with fine needle aspiration. Of 44 patients,<br />

lesions at the hilum were noted in all the patients, and<br />

adequate material was obtained in 43 patients. Cytology<br />

revealed hilar cholangiocarcinoma in 59% <strong>of</strong> patients, with<br />

an accuracy <strong>of</strong> 91%, sensitivity <strong>of</strong> 89% and specificity <strong>of</strong><br />

100%. Accurate diagnosis changed the management in<br />

m<strong>or</strong>e than half <strong>of</strong> these patients that previously had nondiagnostic<br />

ERCPs.<br />

In 2004, Eloubeidi et al [12] evaluated 28 patients in a<br />

prospective study to assess how EUS-FNA impacted patient<br />

management. Of the 28 patients, 3 were excluded<br />

because the lesion could not be identified by EUS. The<br />

sensitivity, specificity, and accuracy were 86%, 100%,<br />

and 88%, respectively, with numbers similar to the study<br />

by Fritscher-Ravens et al. A positive impact was made in<br />

84% <strong>of</strong> patients. In 10 patients, surgery was prevented in<br />

patients with inoperable disease, 8 patients had surgery<br />

facilitated as they had unidentifiable cancer by other modalities,<br />

and 4 patients with benign disease avoided surgery.<br />

Pri<strong>or</strong> studies have shown that 13%-24% <strong>of</strong> patients with<br />

suspected cholangiocarcinomas had benign disease at the<br />

time <strong>of</strong> surgery. By perf<strong>or</strong>ming EUS with FNA in these<br />

patients with indeterminate strictures, surgical treatment<br />

could be tail<strong>or</strong>ed and appropriate management decisions<br />

be made.<br />

A further modification <strong>of</strong> ultrasound technology<br />

allows the placement <strong>of</strong> a high frequency intraductal<br />

ultrasound probe (IDUS). Although several features such<br />

B<br />

C<br />

as irregular wall thickening can be highly suggestive <strong>of</strong><br />

malignancy, IDUS as yet has no associated capability f<strong>or</strong><br />

tissue acquisition.<br />

Per<strong>or</strong>al cholangioscopy and spyglass<br />

During ERCP, miniature cholangioscopes can be used to<br />

directly visualize the bile ducts and any strictures <strong>or</strong> filling<br />

defects seen during ERCP. Directed tissue biopsies can also<br />

be obtained with miniature cholangioscopic biopsy f<strong>or</strong>ceps.<br />

Shah et al [13] in 2006 evaluated 62 patients with suspected<br />

pancreatic <strong>or</strong> biliary malignancy that had pri<strong>or</strong> nondiagnostic<br />

studies. Cholangioscopy with either cholangioscopic-directed<br />

<strong>or</strong> assisted biopsies perf<strong>or</strong>med when applicable. Sixty-two<br />

patients underwent 72 examinations and 53 lesions were<br />

seen on cholangioscopy. Twenty-nine patients had either<br />

cholangioscopy-directed <strong>or</strong> assisted biopsies and 24 had<br />

both. Cholangiocarcinoma was identified in 14 patients. Two<br />

patients with intrahepatic cholangiocarcinomas were missed<br />

by cholangioscopy. In this study, the sensitivity and specificity<br />

f<strong>or</strong> cholangioscopy to detect malignancy was 89% and 96%,<br />

respectively.<br />

M<strong>or</strong>e recently, a single-operat<strong>or</strong> per<strong>or</strong>al cholangiopancreatoscopy<br />

system known as Spyglass has been<br />

developed [14,15] . Older cholangioscopes were fragile, had<br />

limited tip deflection, and had limited ability to clean<br />

the lens and visual field. In addition, they required two<br />

endoscopists, one to operate the duodenoscope and another<br />

to operate the cholangioscpe. With the Spyglass system,<br />

a single operat<strong>or</strong> can control both scopes, there is 4-way<br />

deflected steering, and there are separate irrigation channels.<br />

A single operat<strong>or</strong> system allows tight co<strong>or</strong>dination <strong>of</strong> the<br />

duodenoscope and cholangioscpe. Mastering the use <strong>of</strong><br />

the system does require experience and advanced skills.<br />

The increased maneuverability <strong>of</strong> the Spyglass system<br />

allows f<strong>or</strong> 4 quadrant biopsies. In bench stimulations,<br />

the Spyglass system had 100% success rates in obtaining<br />

target quadrant biopsies compared to 50% in conventional<br />

choledochoduodenoscopes. A feasibility study was<br />

perf<strong>or</strong>med with 35 patients, 22 <strong>of</strong> whom had indeterminate<br />

strictures. The procedure was successful in 91% <strong>of</strong> patients.<br />

Spyglass-directed biopsies were perf<strong>or</strong>med in 20 patients,<br />

and 19 had adequate tissue f<strong>or</strong> examination. The preliminary<br />

sensitivity and specificity <strong>of</strong> Spyglass to detect malignancy<br />

were 71% and 100%, respectively. In this study, 2 patients<br />

www.wjgnet.com

---

2998 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

(6%) developed complications; one developed ascending<br />

cholangitis and the other intrahepatic abscess. Both<br />

patients recovered without sequelae. Currently, prospective<br />

multicenter clinical trials are ongoing.<br />

ManagEMEnT<br />

Cholangiocarcinomas have a very po<strong>or</strong> prognosis with an<br />

average five-year survival <strong>of</strong> only 5%-10%. The only curative<br />

therapy f<strong>or</strong> cholangiocarcinomas is surgical resection. If<br />

patients are not candidates f<strong>or</strong> surgical resection, their<br />

median survival is 6.7-11.6 mo compared to 37.4-42.9 mo<br />

f<strong>or</strong> patients who undergo surgical resection [16,17] . Distal<br />

cholangiocarcinomas have the highest resectability rates <strong>of</strong><br />

about 91% while perihilar tum<strong>or</strong>s have the lowest at 56%.<br />

Based on the experience at Johns Hopkins Hospital over<br />

23 years, distal, intrahepatic, perihilar cholangiocarcinomas<br />

after resection have five-year survival rates <strong>of</strong> 28%, 44%, and<br />

11%, respectively [18] .<br />

Biliary decompression by placing a stent pri<strong>or</strong> to surgery<br />

is a controversial issue. A biliary stent may make it difficult<br />

to assess the proximal extent <strong>of</strong> the tum<strong>or</strong> intraoperatively<br />

and may increase the risk <strong>of</strong> infections postoperatively.<br />

However, elevated bilirubin levels and liver dysfunction<br />

are fact<strong>or</strong>s that adversely affect postoperative m<strong>or</strong>bidity.<br />

Indications f<strong>or</strong> biliary stent placement preoperatively include<br />

cholangitis <strong>or</strong> prevention <strong>of</strong> cholangitis after a diagnostic<br />

ERCP is perf<strong>or</strong>med <strong>or</strong> if surgery is to be delayed f<strong>or</strong> an<br />

extended amount <strong>of</strong> time [19,20] .<br />

Only about 10%-20% <strong>of</strong> patients are candidates f<strong>or</strong><br />

surgery at the time <strong>of</strong> diagnosis secondary to advanced<br />

disease <strong>or</strong> overall po<strong>or</strong> medical health. In these patients<br />

with unresectable disease, the survival is very po<strong>or</strong> and<br />

there is rapid progression with biliary obstruction. Biliary<br />

decompression f<strong>or</strong> palliative purposes can be accomplished<br />

surgically, radiologically <strong>or</strong> endoscopically.<br />

Unilateral versus bilateral stents<br />

In <strong>or</strong>der to provide palliation and relieve jaundice, only<br />

25% <strong>of</strong> the liver needs to be adequately drained. Theref<strong>or</strong>e,<br />

unilateral stents <strong>of</strong> either the left <strong>or</strong> the right system are<br />

typically sufficient. In a randomized controlled prospective<br />

trial, De Palma et al [21] evaluated 157 patients with malignant<br />

hilar biliary obstruction due to cholangiocarcinoma, gallbladder<br />

cancer <strong>or</strong> perip<strong>or</strong>tal metastatic lymphadenopathy. In patients<br />

with unilateral stenting, there was a higher success rate f<strong>or</strong><br />

stent insertion (89% vs 77%) and drainage (81% vs 73%)<br />

and, theref<strong>or</strong>e, a lower early complication rate (19% vs 27%)<br />

when compared to bilateral stenting <strong>of</strong> both hepatic lobes.<br />

Early complications included cholangitis and stent occlusion.<br />

No differences were found in survival <strong>or</strong> procedure-related<br />

m<strong>or</strong>tality.<br />

In <strong>or</strong>der to decrease the risk <strong>of</strong> cholangitis during an<br />

ERCP, it is imp<strong>or</strong>tant not to inject contrast above the level <strong>of</strong><br />

a stricture unless adequate drainage can be ensured. Selective<br />

cannulization with a guidewire above the level <strong>of</strong> the stricture<br />

should be perf<strong>or</strong>med. Following that, the catheter should<br />

be passed above the stricture bef<strong>or</strong>e injecting contrast. With<br />

the guidewire in place, a stent can be placed in the proper<br />

position ensuring that the contaminated segment will be<br />

properly drained (Figure 4).<br />

www.wjgnet.com<br />

A<br />

Plastic versus metal stents<br />

Both plastic and metal biliary stents are available. Numerous<br />

studies have compared plastic versus metal stents with regards<br />

to cost, complication rates, and survival [22-24] . There are no<br />

differences in survival with the use <strong>of</strong> either stents. Plastic<br />

stents have a higher risk <strong>of</strong> occlusion, with 30% occlusion<br />

rates after 3 mo and 70% after 6 mo [23] . In <strong>or</strong>der to prevent<br />

problems with occlusion and cholangitis, they need to be<br />

exchanged every 3 mo. Metal stents have a longer patency<br />

<strong>of</strong> approximately 12 mo due to the fact that they have larger<br />

diameters compared to plastic stents (10 mm vs 3.8 mm).<br />

However, once placed they are very difficult to manipulate <strong>or</strong><br />

remove. As far as cost effectiveness, the initial cost <strong>of</strong> a metal<br />

biliary stent is higher. However, with plastic stents, there are<br />

subsequent costs due to the need f<strong>or</strong> repeat procedures f<strong>or</strong><br />

stent exchange and hospitalization f<strong>or</strong> complications. Overall,<br />

there is no significant difference in the cost between metal<br />

and plastic stents. The decision to place a plastic versus metal<br />

stent should take into consideration the patients’ overall<br />

health, expected length <strong>of</strong> survival, quality <strong>of</strong> life and local<br />

expertise. Often, a plastic stent is placed initially while further<br />

diagnostic w<strong>or</strong>kup is underway. Once the diagnosis is made<br />

and the patient has unresectable disease and a life expectancy<br />

<strong>of</strong> m<strong>or</strong>e than 6 mo, then the plastic stent can be replaced<br />

with a metal stent. Placement <strong>of</strong> a metal stent eliminates the<br />

need f<strong>or</strong> repeated procedures and their associated risks.<br />

ConCLUsion<br />

B<br />

Figure 4 A: In this patient with a hilar mass, double stents were placed within<br />

the right and left hepatic systems to allow adequate drainage <strong>of</strong> contrast after<br />

cholangiogram was perf<strong>or</strong>med to decrease the risk <strong>of</strong> cholangitis; B: Endoscopic<br />

view <strong>of</strong> bilateral stents placed.<br />

The diagnosis <strong>of</strong> cholangiocarcinomas is <strong>of</strong>ten challenging.<br />

Multiple endoscopic modalities are available to evaluate<br />

strictures <strong>or</strong> masses <strong>of</strong> indeterminate <strong>or</strong>igin. ERCP with<br />

brush cytology using FISH <strong>or</strong> DIA technology along with<br />

EUS with FNA and cholangioscopy are available. Oftentimes,<br />

repeated procedures and a combination <strong>of</strong> these different<br />

techniques are necessary to achieve a tissue diagnosis.<br />

Having a cytologic diagnosis as well as knowing the stage<br />

<strong>of</strong> the disease plays an imp<strong>or</strong>tant role in decisions regarding<br />

management. Surgery is curative if the disease is detected at<br />

an early stage. When there is metastatic <strong>or</strong> advanced disease,<br />

endoscopic drainage plays a central role in providing palliation<br />

and improving quality <strong>of</strong> life. Placement <strong>of</strong> a unilateral stent<br />

is sufficient in providing adequate drainage and has lower<br />

m<strong>or</strong>bidity than bilateral stents. In patients who require sh<strong>or</strong>t-

---

Nguyen K et al . Endoscopy in diagnosis and management <strong>of</strong> cholangiocarcinoma 2999<br />

term drainage, plastic stents are a good option. Because long<br />

term survival is so po<strong>or</strong>, metal stents should be considered if<br />

patients are not surgical candidates.<br />

REFEREnCEs<br />

1 Ahrendt SA, Nakeeb A, Pitt HA. Cholangiocarcinoma. Clin<br />

Liver Dis 2001; 5: 191-218<br />

2 Patel T. Cholangiocarcinoma. Nat Clin Pract Gastroenterol Hepatol<br />

2006; 3: 33-42<br />

3 Guibaud L, Bret PM, Reinhold C, Atri M, Barkun AN. Bile<br />

duct obstruction and choledocholithiasis: diagnosis with MR<br />

cholangiography. Radiology 1995; 197: 109-115<br />

4 Rosch T, Meining A, Fruhm<strong>or</strong>gen S, Zillinger C, Schusdziarra<br />

V, Hellerh<strong>of</strong>f K, Classen M, Helmberger H. A prospective<br />

comparison <strong>of</strong> the diagnostic accuracy <strong>of</strong> ERCP, MRCP, CT, and<br />

EUS in biliary strictures. Gastrointest Endosc 2002; 55: 870-876<br />

5 Park MS, Kim TK, Kim KW, Park SW, Lee JK, Kim JS, Lee JH,<br />

Kim KA, Kim AY, Kim PN, Lee MG, Ha HK. Differentiation<br />

<strong>of</strong> extrahepatic bile duct cholangiocarcinoma from benign<br />

stricture: findings at MRCP versus ERCP. Radiology 2004; 233:<br />

234-240<br />

6 Fogel EL, deBellis M, McHenry L, Watkins JL, Chappo J,<br />

Cramer H, Schmidt S, Lazzell-Pannell L, Sherman S, Lehman<br />

GA. Effectiveness <strong>of</strong> a new long cytology brush in the<br />

evaluation <strong>of</strong> malignant biliary obstruction: a prospective<br />

study. Gastrointest Endosc 2006; 63: 71-77<br />

7 de Bellis M, Sherman S, Fogel EL, Cramer H, Chappo J,<br />

McHenry L Jr, Watkins JL, Lehman GA. Tissue sampling<br />

at ERCP in suspected malignant biliary strictures (Part 2).<br />

Gastrointest Endosc 2002; 56: 720-730<br />

8 de Bellis M, Fogel EL, Sherman S, Watkins JL, Chappo J,<br />

Younger C, Cramer H, Lehman GA. Influence <strong>of</strong> stricture<br />

dilation and repeat brushing on the cancer detection rate<br />

<strong>of</strong> brush cytology in the evaluation <strong>of</strong> malignant biliary<br />

obstruction. Gastrointest Endosc 2003; 58: 176-182<br />

9 Baron TH, Harewood GC, Rumalla A, Pochron NL, Stadheim<br />

LM, G<strong>or</strong>es GJ, Therneau TM, De Groen PC, Sebo TJ, Salomao<br />

DR, Kipp BR. A prospective comparison <strong>of</strong> digital image<br />

analysis and routine cytology f<strong>or</strong> the identification <strong>of</strong><br />

malignancy in biliary tract strictures. Clin Gastroenterol Hepatol<br />

2004; 2: 214-219<br />

10 Patel T, Singh P. Cholangiocarcinoma: emerging approaches to<br />

a challenging cancer. Curr Opin Gastroenterol 2007; 23: 317-323<br />

11 Fritscher-Ravens A, Broering DC, Knoefel WT, Rogiers X,<br />

Swain P, Thonke F, Bobrowski C, Topalidis T, Soehendra<br />

N. EUS-guided fine-needle aspiration <strong>of</strong> suspected hilar<br />

cholangiocarcinoma in potentially operable patients with<br />

negative brush cytology. Am J Gastroenterol 2004; 99: 45-51<br />

12 Eloubeidi MA, Chen VK, Jhala NC, Eltoum IE, Jhala D,<br />

Chhieng DC, Syed SA, Vickers SM, Mel Wilcox C. Endoscopic<br />

ultrasound-guided fine needle aspiration biopsy <strong>of</strong> suspected<br />

cholangiocarcinoma. Clin Gastroenterol Hepatol 2004; 2: 209-213<br />

13 Shah RJ, Langer DA, Antillon MR, Chen YK. Cholangioscopy<br />

and cholangioscopic f<strong>or</strong>ceps biopsy in patients with<br />

indeterminate pancreaticobiliary pathology. Clin Gastroenterol<br />

Hepatol 2006; 4: 219-225<br />

14 Chen YK. Preclinical characterization <strong>of</strong> the Spyglass<br />

per<strong>or</strong>al cholangiopancreatoscopy system f<strong>or</strong> direct access,<br />

visualization, and biopsy. Gastrointest Endosc 2007; 65: 303-311<br />

15 Chen YK, Pleskow DK. SpyGlass single-operat<strong>or</strong> per<strong>or</strong>al<br />

cholangiopancreatoscopy system f<strong>or</strong> the diagnosis and<br />

therapy <strong>of</strong> bile-duct dis<strong>or</strong>ders: a clinical feasibility study (with<br />

video). Gastrointest Endosc 2007; 65: 832-841<br />

16 Roayaie S, Guarrera JV, Ye MQ, Thung SN, Emre S, Fishbein<br />

TM, Guy SR, Sheiner PA, Miller CM, Schwartz ME. Aggressive<br />

surgical treatment <strong>of</strong> intrahepatic cholangiocarcinoma:<br />

predict<strong>or</strong>s <strong>of</strong> outcomes. J Am Coll Surg 1998; 187: 365-372<br />

17 Weber SM, Jarnagin WR, Klimstra D, DeMatteo RP, Fong Y,<br />

Blumgart LH. Intrahepatic cholangiocarcinoma: resectability,<br />

recurrence pattern, and outcomes. J Am Coll Surg 2001; 193:<br />

384-391<br />

18 Nakeeb A, Pitt HA, Sohn TA, Coleman J, Abrams RA,<br />

Piantadosi S, Hruban RH, Lillemoe KD, Yeo CJ, Cameron JL.<br />

Cholangiocarcinoma. A spectrum <strong>of</strong> intrahepatic, perihilar, and<br />

distal tum<strong>or</strong>s. Ann Surg 1996; 224: 463-473; discussion 473-475<br />

19 Strasberg SM. ERCP and surgical intervention in pancreatic<br />

and biliary malignancies. Gastrointest Endosc 2002; 56: S213-S217<br />

20 Freeman ML, Sielaff TD. A modern approach to malignant hilar<br />

biliary obstruction. Rev Gastroenterol Dis<strong>or</strong>d 2003; 3: 187-201<br />

21 De Palma GD, Gall<strong>or</strong>o G, Siciliano S, Iovino P, Catanzano C.<br />

Unilateral versus bilateral endoscopic hepatic duct drainage<br />

in patients with malignant hilar biliary obstruction: results <strong>of</strong><br />

a prospective, randomized, and controlled study. Gastrointest<br />

Endosc 2001; 53: 547-553<br />

22 Soderlund C, Linder S. Covered metal versus plastic stents f<strong>or</strong><br />

malignant common bile duct stenosis: a prospective, randomized,<br />

controlled trial. Gastrointest Endosc 2006; 63: 986-995<br />

23 Prat F, Chapat O, Ducot B, Ponchon T, Pelletier G, Fritsch<br />

J, Choury AD, Buffet C. A randomized trial <strong>of</strong> endoscopic<br />

drainage methods f<strong>or</strong> inoperable malignant strictures <strong>of</strong> the<br />

common bile duct. Gastrointest Endosc 1998; 47: 1-7<br />

24 Kaassis M, Boyer J, Dumas R, Ponchon T, Coumaros D,<br />

Delcenserie R, Canard JM, Fritsch J, Rey JF, Burtin P. Plastic <strong>or</strong><br />

metal stents f<strong>or</strong> malignant stricture <strong>of</strong> the common bile duct?<br />

Results <strong>of</strong> a randomized prospective study. Gastrointest Endosc<br />

2003; 57: 178-182<br />

S- Edit<strong>or</strong> Liu JN L- Edit<strong>or</strong> Alpini GD E- Edit<strong>or</strong> Liu Y<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3000-3005<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

TOPIC HIGHLIGHT<br />

Gianfranco D Alpini, PhD, Pr<strong>of</strong>ess<strong>or</strong>; Sharon DeM<strong>or</strong>row, Assistant Pr<strong>of</strong>ess<strong>or</strong>, Series Edit<strong>or</strong><br />

Diagnosis and initial management <strong>of</strong> cholangiocarcinoma<br />

with obstructive jaundice<br />

Takashi Tajiri, Hiroshi Yoshida, Yasuhiro Mamada, Nobuhiko Taniai, Shigeki Yokomuro, Yoshiaki Mizuguchi<br />

Takashi Tajiri, Hiroshi Yoshida, Yasuhiro Mamada, Nobuhiko<br />

Taniai, Shigeki Yokomuro, Yoshiaki Mizuguchi, Department<br />

<strong>of</strong> Surgery, Nippon Medical School, 1-1-5 Sendagi, Bunkyo-ku,<br />

Tokyo 113-8603, Japan<br />

Auth<strong>or</strong> contributions: Tajiri T and Yoshida H wrote the paper.<br />

Mamada Y, Taniai N, Yokomuro S, and Mizuguchi Y perf<strong>or</strong>med<br />

research.<br />

C<strong>or</strong>respondence to: Takashi Tajiri, Department <strong>of</strong> Surgery,<br />

Nippon Medical School, 1-1-5 Sendagi, Bunkyo-ku, Tokyo<br />

113-8603, Japan. tajirit@nms.ac.jp<br />

Telephone: 81-3-58146239 Fax: 81-3-56850989<br />

Received: November 28, 2007 Revised: January 31, 2008<br />

Abstract<br />

Cholangiocarcinoma is the second most common primary<br />

hepatic cancer. Despite advances in diagnostic techniques<br />

during the past decade, cholangiocarcinoma is usually<br />

encountered at an advanced stage. In this review,<br />

we describe the classification, diagnosis, and initial<br />

management <strong>of</strong> cholangiocarcinoma with obstructive<br />

jaundice.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Cholangiocarcinoma; Obstructive jaundice;<br />

Diagnosis; Treatment; Initial management<br />

Peer reviewers: Mitsuo Shimada, Pr<strong>of</strong>ess<strong>or</strong>, Department <strong>of</strong><br />

Digestive and Pediatric Surgery, Tokushima University, Kuramoto<br />

3-18-15, Tokushima 770-8503, Japan; Dusan M Jovanovic,<br />

Pr<strong>of</strong>ess<strong>or</strong>, Institute <strong>of</strong> Oncology, Institutski Put 4, Sremska<br />

Kamenica 21204, Serbia<br />

Tajiri T, Yoshida H, Mamada Y, Taniai N, Yokomuro S, Mizuguchi<br />

Y. Diagnosis and initial management <strong>of</strong> cholangiocarcinoma<br />

with obstructive jaundice. W<strong>or</strong>ld J Gastroenterol 2008;<br />

14(19): 3000-3005 Available from URL: http://www.wjgnet.<br />

com/1007-9327/14/3000.asp DOI: http://dx.doi.<strong>or</strong>g/10.3748/<br />

wjg.14.3000<br />

INTRODUCTION<br />

Cholangiocarcinoma is the second most common primary<br />

hepatic cancer. Despite advances in diagnostic techniques<br />

during the past decade, cholangiocarcinoma is usually<br />

encountered at an advanced stage. In this review, we<br />

www.wjgnet.com<br />

describe the classification, diagnosis, and initial management<br />

<strong>of</strong> cholangiocarcinoma with obstructive jaundice.<br />

CLASSIFICATION<br />

Cholangiocarcinomas are epithelial neoplasms that<br />

<strong>or</strong>iginate from cholangiocytes and can occur at any level<br />

<strong>of</strong> the biliary tree. These lesions are broadly classified into<br />

intrahepatic cholangiocarcinoma, hilar cholangiocarcinoma,<br />

and distal extrahepatic bile duct tum<strong>or</strong>s. Histologically,<br />

most cholangiocarcinomas (> 95%) are adenocarcinomas.<br />

They are pathologically classified into sclerosing, nodular,<br />

and papillary intraductal cancers [1] . A recent pathological<br />

classification applicable to both intrahepatic and<br />

extrahepatic cholangiocarcinomas divides these lesions into<br />

mass-f<strong>or</strong>ming (nodular), periductal-infiltrating (sclerosing),<br />

and intraductal-growing (papillary) cholangiocarcinomas [2] .<br />

DIAGNOSIS<br />

Lab<strong>or</strong>at<strong>or</strong>y data<br />

Liver test abn<strong>or</strong>malities reflecting obstruction <strong>of</strong> the bile<br />

duct are usually observed. Strikingly elevated CA19-9<br />

values in symptomatic patients usually signify advanced<br />

disease. Carcinoembryonic antigen (CEA) is also elevated<br />

in patients with cholangiocarcinoma, but is not diagnostic<br />

because <strong>of</strong> low sensitivity and specificity. Cholangitis and<br />

hepatolithiasis commonly lead to increased levels <strong>of</strong> tum<strong>or</strong><br />

markers. Cholangiocarcinoma should not be diagnosed on<br />

the basis <strong>of</strong> lab<strong>or</strong>at<strong>or</strong>y data alone.<br />

Ultrasonography<br />

Ultrasonography is the imaging technique <strong>of</strong> choice f<strong>or</strong><br />

the diagnosis <strong>of</strong> cholangiocarcinoma with obstructive<br />

jaundice. Visualization allows adequate diagnosis and<br />

staging in m<strong>or</strong>e than 90% <strong>of</strong> cases. The presence <strong>of</strong><br />

dilated ducts without clear communications within a liver<br />

lobe indicates the extension <strong>of</strong> tum<strong>or</strong> into the segmental<br />

bile ducts. Ultrasonography is useful f<strong>or</strong> evaluating the<br />

local extent <strong>of</strong> disease, but is <strong>of</strong> limited value f<strong>or</strong> staging<br />

distant metastases. Intrahepatic cholangiocarcinomas<br />

may be identified as mass lesions, sometimes associated<br />

with bile duct dilatation proximal to the obstructing<br />

lesion. Tum<strong>or</strong> vascularity is an imp<strong>or</strong>tant characteristic<br />

that can be assessed by col<strong>or</strong> Doppler ultrasonography.<br />

An abn<strong>or</strong>mal pulsed Doppler signal obtained from the<br />

p<strong>or</strong>tal venous system due to severe narrowing <strong>or</strong> occlusion

---

Tajili T et al. Cholangiocarcinoma with obstructive jaundice 3001<br />

strongly suggests maj<strong>or</strong> involvement and unresectable<br />

tum<strong>or</strong>. However, a n<strong>or</strong>mal pulsed Doppler signal does not<br />

exclude such involvement, if the tum<strong>or</strong> is contiguous with<br />

vessels showing interruption <strong>of</strong> the hyperechoic tum<strong>or</strong>vessel<br />

interface [3,4] .<br />

Endoscopic ultrasound (EUS) is useful f<strong>or</strong> assessing the<br />

extent <strong>of</strong> disease and perf<strong>or</strong>ming fine needle aspiration.<br />

Eloubeidi et al [5] rep<strong>or</strong>ted that EUS-guided fine needle<br />

aspiration biopsy is useful f<strong>or</strong> the diagnosis <strong>of</strong> suspected<br />

cholangiocarcinoma. The sensitivity, specificity, positive<br />

predictive value, negative predictive value, and accuracy<br />

were 86%, 100%, 100%, 57%, and 88%, respectively. EUSguided<br />

fine needle aspiration <strong>of</strong> lymph nodes facilitates<br />

staging <strong>of</strong> disease in addition to visualization <strong>of</strong> the biliary<br />

tree [6] .<br />

Computed tomography (CT)<br />

CT permits the identification <strong>of</strong> bile duct dilatation and<br />

assessment <strong>of</strong> the hepatic parenchyma and lymph nodes.<br />

However, the evaluation <strong>of</strong> h<strong>or</strong>izontal spread by diagnostic<br />

imaging via the bile duct remains challenging in patients<br />

with cholangiocarcinoma, especially on conventional CT<br />

examination. Recently, the development <strong>of</strong> multidetect<strong>or</strong><br />

row CT scanners has permitted a reduction in the voxel<br />

size and facilitated rapid image reconstruction, enhancing<br />

the value <strong>of</strong> CT as an interactive diagnostic tool. M<strong>or</strong>eover,<br />

innovative methods f<strong>or</strong> CT image reconstruction, including<br />

multiplanar reconstruction and three-dimensional images,<br />

were recently introduced f<strong>or</strong> the visualization <strong>of</strong> biliary<br />

structures [7] . CT angiography has been demonstrated to<br />

be useful f<strong>or</strong> the detection and assessment <strong>of</strong> vascular<br />

encasement [8-10] .<br />

Magnetic resonance imaging (MRI)<br />

MRI with concurrent magnetic resonance cholangiopancreatography<br />

(MRCP) is the radiologic technique<br />

<strong>of</strong> choice f<strong>or</strong> assessing the extent <strong>of</strong> disease [11,12] . The<br />

limitations <strong>of</strong> conventional imaging techniques have led<br />

to the increased use <strong>of</strong> MRCP, which is a noninvasive and<br />

highly accurate technique f<strong>or</strong> the evaluation <strong>of</strong> patients<br />

with biliary obstruction. MRCP is optimally suited f<strong>or</strong><br />

the visualization <strong>of</strong> both intrahepatic and extrahepatic<br />

cholangiocarcinomas, which appear as hypointense lesions<br />

on T1-weighted images and hyperintense lesions on T2weighted<br />

images. Images can be enhanced with the use<br />

<strong>of</strong> superparamagnetic iron <strong>or</strong> by delayed gadolinium<br />

enhancement [13,14] . The overall diagnostic accuracy f<strong>or</strong><br />

assessment <strong>of</strong> the level and cause <strong>of</strong> obstruction was<br />

96.3% and 89.7%, respectively [12] . MR angiography can be<br />

used to evaluate vascular involvement [15] .<br />

Cholangiography<br />

Bef<strong>or</strong>e the development <strong>of</strong> MRCP, direct cholangiography<br />

was only technique f<strong>or</strong> assessment <strong>of</strong> the biliary system.<br />

Direct cholangiography can be perf<strong>or</strong>med by either<br />

percutaneous transhepatic cholangiography <strong>or</strong> endoscopic<br />

retrograde cholangiography, and samples <strong>of</strong> the bile duct<br />

can be obtained [16,17] . Brushings are analyzed cytologically.<br />

In one study, the sensitivity, specificity, positive predictive<br />

value, negative predictive value, and accuracy <strong>of</strong> brush<br />

cytology were 75%, 100%, 100%, 12.5%, and 75.9%,<br />

respectively. Biopsy specimens <strong>of</strong> the bile duct are examined<br />

histologically [18] . The diagnostic perf<strong>or</strong>mance <strong>of</strong> transluminal<br />

f<strong>or</strong>ceps biopsy f<strong>or</strong> malignant biliary obstructions was as<br />

follows: sensitivity, 78.4%; specificity, 100%; and accuracy,<br />

79.2% [19] . Savader et al [20] compared the diagnostic accuracy<br />

<strong>of</strong> three different techniques f<strong>or</strong> percutaneous transhepatic<br />

intraductal biopsy: brush cytology, clamshell f<strong>or</strong>ceps under<br />

choledochoscopic guidance, and clamshell f<strong>or</strong>ceps under<br />

flu<strong>or</strong>oscopic guidance. The choledochoscope-directed<br />

biopsy technique had the highest sensitivity and specificity<br />

among the three techniques, but was not significantly better<br />

than either the brush <strong>or</strong> flu<strong>or</strong>oscopic clamshell techniques<br />

(P > 0.10). Multiple biopsies did not increase the overall<br />

sensitivity <strong>of</strong> intraductal biliary biopsy as a diagnostic<br />

technique. All three techniques were safe and easy to<br />

perf<strong>or</strong>m. In patients with malignant biliary obstruction,<br />

brush cytology was m<strong>or</strong>e sensitive f<strong>or</strong> the diagnosis<br />

<strong>of</strong> cholangiocarcinoma than f<strong>or</strong> the diagnosis <strong>of</strong> noncholangiocarcinoma<br />

(P < 0.05). The site <strong>of</strong> stenosis was<br />

unrelated to sensitivity and technical success (P > 0.05) [18,21] .<br />

Rotational cine cholangiography is used to diagnose<br />

bile duct carcinoma. Rotational cine cholangiography is<br />

a reliable technique f<strong>or</strong> detecting the confluence <strong>of</strong> the<br />

bile ducts, as well as f<strong>or</strong> diagnosing the longitudinal extent<br />

<strong>of</strong> cancer spread along the bile duct wall [22] . Furukawa<br />

et al [23] evaluated the usefulness <strong>of</strong> three-dimensional<br />

cholangiography and rotating cine cholangiography f<strong>or</strong><br />

depicting the anatomy <strong>of</strong> the hilar bile duct and tum<strong>or</strong><br />

extension, and f<strong>or</strong> planning surgical procedures f<strong>or</strong><br />

hilar cholangiocarcinoma. Three-dimensional and cine<br />

cholangiography allowed accurate assessment <strong>of</strong> the<br />

biliary system in patients with hilar cholangiocarcinoma,<br />

facilitating the planning <strong>of</strong> surgery.<br />

Angiography<br />

Angiography reveals the anatomy <strong>of</strong> the hepatic and<br />

biliary arteries. Angiography is a superb technique f<strong>or</strong><br />

the detection <strong>of</strong> vascular encasement. It is also useful f<strong>or</strong><br />

planning surgical procedures.<br />

Scintigraphy<br />

Technetium-99m galactosyl human serum albumin<br />

scintigraphy: Technetium-99m-diethylenetriaminepentaacetic<br />

acid-galactosyl-human serum albumin (99mTc-GSA) is an<br />

analog ligand <strong>of</strong> asialoglycoprotein that binds specifically<br />

to asialoglycoprotein recept<strong>or</strong>s (ASGP-R) residing in<br />

mammalian hepatocytes [24-26] . The hepatic uptake <strong>of</strong><br />

99mTc-GSA at 15 min <strong>or</strong> later reflects the recept<strong>or</strong><br />

population <strong>or</strong> functional hepatocyte mass [27] .<br />

Nanashima et al [28] studied the relation between<br />

m<strong>or</strong>phological measurements <strong>of</strong> hepatic volume on CT<br />

and functional volume on 99mTc-GSA scintigraphy. There<br />

were no significant differences in the volume measurements<br />

between these two volumetric techniques. Volumetric<br />

measurement by 99mTc-GSA scintigraphy is useful f<strong>or</strong><br />

detecting changes in the functional volume <strong>of</strong> individual<br />

lobes <strong>of</strong> the liver and is a m<strong>or</strong>e dynamic method than the<br />

assessment <strong>of</strong> m<strong>or</strong>phological changes on CT scanning.<br />

We confir med hemodynamic chang es in the<br />

distribution <strong>of</strong> splenic venous flow in the liver, especially<br />

in the cirrhotic liver, and demonstrated the participation<br />

www.wjgnet.com

---

3004 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

28 Nanashima A, Yamaguchi H, Shibasaki S, M<strong>or</strong>ino S, Ide N,<br />

Takeshita H, Tsuji T, Sawai T, Nakagoe T, Nagayasu T, Ogawa<br />

Y. Relationship between CT volumetry and functional liver<br />

volume using technetium-99m galactosyl serum albumin<br />

scintigraphy in patients undergoing preoperative p<strong>or</strong>tal vein<br />

embolization bef<strong>or</strong>e maj<strong>or</strong> hepatectomy: a preliminary study.<br />

Dig Dis Sci 2006; 51: 1190-1195<br />

29 Mineta S, Yoshida H, Mamada Y, Taniai N, Mizuguchi<br />

Y, Akimaru K, Kumita S, Kumazaki T, Tajiri T. Changes<br />

in distribution <strong>of</strong> splenic venous flow in the patients with<br />

cirrhotic liver. Hepatogastroenterology 2005; 52: 1313-1319<br />

30 Fritscher-Ravens A, Bohuslavizki KH, Broering DC, Jenicke<br />

L, Schafer H, Buchert R, Rogiers X, Clausen M. FDG PET in<br />

the diagnosis <strong>of</strong> hilar cholangiocarcinoma. Nucl Med Commun<br />

2001; 22: 1277-1285<br />

31 Kamiya S, Nagino M, Kanazawa H, Komatsu S, Mayumi T,<br />

Takagi K, Asahara T, Nomoto K, Tanaka R, Nimura Y. The<br />

value <strong>of</strong> bile replacement during external biliary drainage: an<br />

analysis <strong>of</strong> intestinal permeability, integrity, and micr<strong>of</strong>l<strong>or</strong>a.<br />

Ann Surg 2004; 239: 510-517<br />

32 Koivukangas V, Oikarinen A, Risteli J, Haukipuro K. Effect <strong>of</strong><br />

jaundice and its resolution on wound re-epithelization, skin<br />

collagen synthesis, and serum collagen propeptide levels in<br />

patients with neoplastic pancreaticobiliary obstruction. J Surg<br />

Res 2005; 124: 237-243<br />

33 Mann DV, Lam WW, Magnus Hjelm N, So NM, Yeung DK,<br />

Metreweli C, Lau WY. Biliary drainage f<strong>or</strong> obstructive jaundice<br />

enhances hepatic energy status in humans: a 31-phosph<strong>or</strong>us<br />

magnetic resonance spectroscopy study. Gut 2002; 50: 118-122<br />

34 Mizuguchi Y, Yoshida H, Yokomuro S, Arima Y, Mamada Y,<br />

Taniai N, Akimaru K, Tajiri T. Collagen IV is a predict<strong>or</strong> f<strong>or</strong><br />

clinical course in patients with malignant obstructive jaundice.<br />

Hepatogastroenterology 2005; 52: 672-677<br />

35 Ishizawa T, Hasegawa K, Sano K, Imamura H, Kokudo<br />

N, Makuuchi M. Selective versus total biliary drainage f<strong>or</strong><br />

obstructive jaundice caused by a hepatobiliary malignancy.<br />

Am J Surg 2007; 193: 149-154<br />

36 Hochwald SN, Burke EC, Jarnagin WR, Fong Y, Blumgart<br />

LH. Association <strong>of</strong> preoperative biliary stenting with<br />

increased postoperative infectious complications in proximal<br />

cholangiocarcinoma. Arch Surg 1999; 134: 261-266<br />

37 Cherqui D, Benoist S, Malassagne B, Humeres R, Rodriguez V,<br />

Fagniez PL. Maj<strong>or</strong> liver resection f<strong>or</strong> carcinoma in jaundiced<br />

patients without preoperative biliary drainage. Arch Surg 2000;<br />

135: 302-308<br />

38 Pitt HA, Gomes AS, Lois JF, Mann LL, Deutsch LS, Longmire<br />

WP Jr. Does preoperative percutaneous biliary drainage<br />

reduce operative risk <strong>or</strong> increase hospital cost? Ann Surg 1985;<br />

201: 545-553<br />

39 Takayama T, Makuuchi M. Preoperative p<strong>or</strong>tal vein<br />

embolization: is it useful? J Hepatobiliary Pancreat Surg 2004; 11:<br />

17-20<br />

40 Makuuchi M, Thai BL, Takayasu K, Takayama T, Kosuge T,<br />

Gunven P, Yamazaki S, Hasegawa H, Ozaki H. Preoperative<br />

p<strong>or</strong>tal embolization to increase safety <strong>of</strong> maj<strong>or</strong> hepatectomy<br />

f<strong>or</strong> hilar bile duct carcinoma: a preliminary rep<strong>or</strong>t. Surgery<br />

1990; 107: 521-527<br />

41 Abdalla EK, Barnett CC, Doherty D, Curley SA, Vauthey<br />

JN. Extended hepatectomy in patients with hepatobiliary<br />

malignancies with and without preoperative p<strong>or</strong>tal vein<br />

embolization. Arch Surg 2002; 137: 675-680; discussion 680-681<br />

42 Farges O, Belghiti J, Kianmanesh R, Regimbeau JM, Sant<strong>or</strong>o<br />

R, Vilgrain V, Denys A, Sauvanet A. P<strong>or</strong>tal vein embolization<br />

bef<strong>or</strong>e right hepatectomy: prospective clinical trial. Ann Surg<br />

2003; 237: 208-217<br />

43 Mamada Y, Tajiri T, Akimaru K, Yoshida H, Taniai N.<br />

Long-term prognosis after arterio-p<strong>or</strong>tal embolization f<strong>or</strong><br />

hepatocellular carcinoma. Hepatogastroenterology 2004; 51:<br />

234-236<br />

44 Kyokane T, Nagino M, Oda K, Nimura Y. An experimental<br />

study <strong>of</strong> selective intrahepatic biliary ablation with ethanol. J<br />

Surg Res 2001; 96: 188-196<br />

45 Shimizu T, Yoshida H, Mamada Y, Taniai N, Matsumoto<br />

www.wjgnet.com<br />

S, Mizuguchi Y, Yokomuro S, Arima Y, Akimaru K, Tajiri<br />

T. Postoperative bile leakage managed successfully by<br />

intrahepatic biliary ablation with ethanol. W<strong>or</strong>ld J Gastroenterol<br />

2006; 12: 3450-3452<br />

46 Khan SA, Davidson BR, Goldin R, Pereira SP, Rosenberg WM,<br />

Tayl<strong>or</strong>-Robinson SD, Thillainayagam AV, Thomas HC, Thursz<br />

MR, Wasan H. Guidelines f<strong>or</strong> the diagnosis and treatment <strong>of</strong><br />

cholangiocarcinoma: consensus document. Gut 2002; 51 Suppl<br />

6: VI1-VI9<br />

47 Liu CL, Fan ST, Lo CM, Tso WK, Lam CM, Wong J. Improved<br />

operative and survival outcomes <strong>of</strong> surgical treatment f<strong>or</strong> hilar<br />

cholangiocarcinoma. Br J Surg 2006; 93: 1488-1494<br />

48 Kosuge T, Yamamoto J, Shimada K, Yamasaki S, Makuuchi M.<br />

Improved surgical results f<strong>or</strong> hilar cholangiocarcinoma with<br />

procedures including maj<strong>or</strong> hepatic resection. Ann Surg 1999;<br />

230: 663-671<br />

49 Miyazaki M, Ito H, Nakagawa K, Ambiru S, Shimizu<br />

H, Okaya T, Shinmura K, Nakajima N. Parenchymapreserving<br />

hepatectomy in the surgical treatment <strong>of</strong> hilar<br />

cholangiocarcinoma. J Am Coll Surg 1999; 189: 575-583<br />

50 Miyazaki M, Ito H, Nakagawa K, Ambiru S, Shimizu H,<br />

Shimizu Y, Okuno A, Nozawa S, Nukui Y, Yoshitomi H,<br />

Nakajima N. Segments I and IV resection as a new approach f<strong>or</strong><br />

hepatic hilar cholangiocarcinoma. Am J Surg 1998; 175: 229-231<br />

51 Yoshida T, Matsumoto T, Sasaki A, M<strong>or</strong>ii Y, Aramaki M,<br />

Kitano S. Prognostic fact<strong>or</strong>s after pancreatoduodenectomy<br />

with extended lymphadenectomy f<strong>or</strong> distal bile duct cancer.<br />

Arch Surg 2002; 137: 69-73<br />

52 Heron DE, Stein DE, Eschelman DJ, Topham AK, Waterman<br />

FM, Rosato EL, Alden M, Anne PR. Cholangiocarcinoma: the<br />

impact <strong>of</strong> tum<strong>or</strong> location and treatment strategy on outcome.<br />

Am J Clin Oncol 2003; 26: 422-428<br />

53 Serafini FM, Sachs D, Bloomston M, Carey LC, Karl<br />

RC, Murr MM, Rosemurgy AS. Location, not staging,<br />

<strong>of</strong> cholangiocarcinoma determines the role f<strong>or</strong> adjuvant<br />

chem<strong>or</strong>adiation therapy. Am Surg 2001; 67: 839-843; discussion<br />

843-844<br />

54 Siegel JH, Pullano W, Kodsi B, Cooperman A, Ramsey<br />

W. Optimal palliation <strong>of</strong> malignant bile duct obstruction:<br />

experience with endoscopic 12 French prostheses. Endoscopy<br />

1988; 20: 137-141<br />

55 Siegel JH, Daniel SJ. Endoscopic and flu<strong>or</strong>oscopic transpapillary<br />

placement <strong>of</strong> a large caliber biliary endoprosthesis. Am J<br />

Gastroenterol 1984; 79: 461-465<br />

56 Coons HG, Carey PH. Large-b<strong>or</strong>e, long biliary endoprostheses<br />

(biliary stents) f<strong>or</strong> improved drainage. Radiology 1983; 148:<br />

89-94<br />

57 Gouma DJ, Wesd<strong>or</strong>p RI, Oostenbroek RJ, Soeters PB, Greep<br />

JM. Percutaneous transhepatic drainage and insertion <strong>of</strong> an<br />

endoprosthesis f<strong>or</strong> obstructive jaundice. Am J Surg 1983; 145:<br />

763-768<br />

58 Men S, Hekimoglu B, Kaderoglu H, Pinar A, Conkbayir I,<br />

Soylu SO, Bulut A, Yandakci K, Baran I, Aran Y. Palliation <strong>of</strong><br />

malignant obstructive jaundice. Use <strong>of</strong> self-expandable metal<br />

stents. Acta Radiol 1996; 37: 259-266<br />

59 Soderlund C, Linder S. Covered metal versus plastic stents<br />

f<strong>or</strong> malignant common bile duct stenosis: a prospective,<br />

randomized, controlled trial. Gastrointest Endosc 2006; 63:<br />

986-995<br />

60 Wagner HJ, Knyrim K. Relief <strong>of</strong> malignant obstructive<br />

jaundice by endoscopic <strong>or</strong> percutaneous insertion <strong>of</strong> metal<br />

stents. Bildgebung 1993; 60: 76-82<br />

61 Indar AA, Lobo DN, Gilliam AD, Gregson R, Davidson<br />

I, Whittaker S, D<strong>or</strong>an J, Rowlands BJ, Beckingham IJ.<br />

Percutaneous biliary metal wall stenting in malignant<br />

obstructive jaundice. Eur J Gastroenterol Hepatol 2003; 15: 915-919<br />

62 Yoshida H, Mamada Y, Taniai N, Mizuguchi Y, Shimizu T,<br />

Yokomuro S, Aimoto T, Nakamura Y, Uchida E, Arima Y,<br />

Watanabe M, Uchida E, Tajiri T. One-step palliative treatment<br />

method f<strong>or</strong> obstructive jaundice caused by unresectable<br />

malignancies by percutaneous transhepatic insertion <strong>of</strong> an<br />

expandable metallic stent. W<strong>or</strong>ld J Gastroenterol 2006; 12:<br />

2423-2426

---

Tajili T et al. Cholangiocarcinoma with obstructive jaundice 3005<br />

63 Tsai CC, Mo LR, Lin RC, Kuo JY, Chang KK, Yeh YH, Yang<br />

SC, Yueh SK, Tsai HM, Yu CY. Self-expandable metallic stents<br />

in the management <strong>of</strong> malignant biliary obstruction. J F<strong>or</strong>mos<br />

Med Assoc 1996; 95: 298-302<br />

64 Yoon WJ, Lee JK, Lee KH, Lee WJ, Ryu JK, Kim YT, Yoon<br />

YB. A comparison <strong>of</strong> covered and uncovered Wallstents<br />

f<strong>or</strong> the management <strong>of</strong> distal malignant biliary obstruction.<br />

Gastrointest Endosc 2006; 63: 996-1000<br />

65 Kocak Z, Ozkan H, Adli M, Garipagaoglu M, Kurtman C,<br />

Cakmak A. Intraluminal brachytherapy with metallic stenting<br />

in the palliative treatment <strong>of</strong> malignant obstruction <strong>of</strong> the bile<br />

duct. Radiat Med 2005; 23: 200-207<br />

66 Ishii H, Furuse J, Nagase M, Kawashima M, Ikeda H,<br />

Yoshino M. Relief <strong>of</strong> jaundice by external beam radiotherapy<br />

a n d i n t r a l u m i n a l b r a c h y t h e r a p y i n p a t i e n t s w i t h<br />

extrahepatic cholangiocarcinoma: results without stenting.<br />

Hepatogastroenterology 2004; 51: 954-957<br />

67 Bowling TE, Galbraith SM, Hatfield AR, Solano J, Spittle<br />

MF. A retrospective comparison <strong>of</strong> endoscopic stenting<br />

alone with stenting and radiotherapy in non-resectable<br />

cholangiocarcinoma. Gut 1996; 39: 852-855<br />

68 Hoevels J, Lunderquist A, Ihse I. Percutaneous transhepatic<br />

intubation <strong>of</strong> bile ducts f<strong>or</strong> combined internal-external<br />

drainage in preoperative and palliative treatment <strong>of</strong><br />

obstructive jaundice. Gastrointest Radiol 1978; 3: 23-31<br />

69 Mezawa S, Homma H, Sato T, Doi T, Miyanishi K, Takada K,<br />

Kukitsu T, Murase K, Yoshizaki N, Takahashi M, Sakamaki<br />

S, Niitsu Y. A study <strong>of</strong> carboplatin-coated tube f<strong>or</strong> the<br />

unresectable cholangiocarcinoma. Hepatology 2000; 32: 916-923<br />

70 Suzuki S, Kurachi K, Yokoi Y, Tsuchiya Y, Okamoto K,<br />

Okumura T, Inaba K, Konno H, Nakamura S. Intrahepatic<br />

cholangiojejunostomy f<strong>or</strong> unresectable malignant biliary<br />

tum<strong>or</strong>s with obstructive jaundice. J Hepatobiliary Pancreat Surg<br />

2001; 8: 124-129<br />

71 Guthrie CM, Banting SW, Garden OJ, Carter DC. Segment<br />

III cholangiojejunostomy f<strong>or</strong> palliation <strong>of</strong> malignant hilar<br />

obstruction. Br J Surg 1994; 81: 1639-1641<br />

72 Trayn<strong>or</strong> O, Castaing D, Bismuth H. Left intrahepatic<br />

cholangio-enteric anastomosis (round ligament approach): an<br />

effective palliative treatment f<strong>or</strong> hilar cancers. Br J Surg 1987;<br />

74: 952-954<br />

73 Martin RC 2nd, Vitale GC, Reed DN, Larson GM, Edwards<br />

MJ, McMasters KM. Cost comparison <strong>of</strong> endoscopic stenting<br />

vs surgical treatment f<strong>or</strong> unresectable cholangiocarcinoma.<br />

Surg Endosc 2002; 16: 667-670<br />

74 B<strong>or</strong>ies E, Pesenti C, Caillol F, Lopes C, Giovannini M.<br />

Transgastric endoscopic ultrasonography-guided biliary<br />

drainage: results <strong>of</strong> a pilot study. Endoscopy 2007; 39: 287-291<br />

75 Becker NS, Rodriguez JA, Barshes NR, O'Mahony CA,<br />

Goss JA, Aloia TA. Outcomes Analysis f<strong>or</strong> 280 Patients with<br />

Cholangiocarcinoma Treated with Liver Transplantation Over<br />

an 18-year Period. J Gastrointest Surg 2008; 12: 117-122<br />

76 Heimbach JK, G<strong>or</strong>es GJ, Haddock MG, Alberts SR, Nyberg SL,<br />

Ishitani MB, Rosen CB. Liver transplantation f<strong>or</strong> unresectable<br />

perihilar cholangiocarcinoma. Semin Liver Dis 2004; 24: 201-207<br />

77 Thelen A, Neuhaus P. Liver transplantation f<strong>or</strong> hilar<br />

cholangiocarcinoma. J Hepatobiliary Pancreat Surg 2007; 14:<br />

469-475<br />

S- Edit<strong>or</strong> Li DL L- Edit<strong>or</strong> Rippe RA E- Edit<strong>or</strong> Liu Y<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3006-3014<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

GASTRIC CANCER<br />

Investigation <strong>of</strong> transcriptional gene silencing and mechanism<br />

induced by shRNAs targeted to RUNX3 in vitro<br />

Xue-Zhi Feng, Xiu-Sheng He, Ying-Zhi Zhuang, Qiao Luo, Jun-Hao Jiang, Shuai Yang, Xue-Fang Tang, Ju-Lin Liu,<br />

Tao Chen<br />

Xue-Zhi Feng, Xiu-Sheng He, Qiao Luo, Jun-Hao Jiang,<br />

Shuai Yang, Xue-Fang Tang, Ju-Lin Liu, Tao Chen, Cancer<br />

Research Institute, Nanhua University <strong>of</strong> South China, Hengyang<br />

421001, Hunan Province, China<br />

Xue-Zhi Feng, Ying-Zhi Zhuang, Department <strong>of</strong> Oncology,<br />

First Affiliated Hospital <strong>of</strong> Nanhua University <strong>of</strong> South China,<br />

Hengyang 421001, Hunan Province, China<br />

Auth<strong>or</strong> contributions: Feng XZ designed and perf<strong>or</strong>med the<br />

research and wrote the paper; He XS contributed the acquisition <strong>of</strong><br />

funding; He XS and Zhuang YZ guided the research and revised<br />

the paper critically f<strong>or</strong> intellectual content; Qiao L contributed<br />

technology and materials supp<strong>or</strong>t; Jiang JH, Yang S, Tang XF, Liu<br />

JL and Chen T checked the statistical analysis <strong>of</strong> data.<br />

Supp<strong>or</strong>ted by Grants from the National Natural Science<br />

Foundation <strong>of</strong> China, No. 30470967 and the Natural Sciences<br />

Foundation <strong>of</strong> Hunan, No. 03Jjy3029<br />

C<strong>or</strong>respondence to: Xiu-Sheng He, MD, Cancer Research<br />

Institute, Nanhua University <strong>of</strong> South China, Hengyang 421001,<br />

Hunan Province, China. hexiusheng@hotmail.com<br />

Telephone: +86-734-8281725 Fax: +86-734-8281305<br />

Received: December 29, 2007 Revised: March 16, 2008<br />

Abstract<br />

AIM: To investigate transcriptional gene silencing<br />

induced by sh<strong>or</strong>t hairpin RNAs (shRNAs) that target gene<br />

prompter regions <strong>of</strong> RUNX3 gene, and whether shRNAs<br />

homologous to DNA sequences may serve as initiat<strong>or</strong>s<br />

f<strong>or</strong> methylation.<br />

METHODS: Acc<strong>or</strong>ding to the principle <strong>of</strong> RNAi design,<br />

pSilencer3.1-H1-shRNA/RUNX3 expression vect<strong>or</strong> was<br />

constructed, The recombinant plasmid shRNA was<br />

transfected into human stomach carcinoma cell line<br />

SGC7901 with Lip<strong>of</strong>ectamine 2000. Then, the positive cell<br />

clones were screened by G418. The mRNA and protein<br />

expression level <strong>of</strong> RUNX3 in the stable transfected cell<br />

line SGC7901 were determined by RT-PCR, Western<br />

blotting and immunocytochemistry. Characteristics <strong>of</strong> the<br />

cell lines including SGC7901, pSilencer3.1-H1/SGC7901<br />

and pSilencer3.1-H1-shRNA/RUNX3 /SGC7901 were<br />

analyzed with growth curves, clone f<strong>or</strong>mation rate and<br />

cell-cycle distribution. The activated level <strong>of</strong> RUNX3 was<br />

examined after treatment with the different density<br />

<strong>of</strong> 5’-aza-2’-deoxycytidine (5-Aza-CdR) by using semiquantitative<br />

RT-PCR and Western blotting.<br />

RESULTS: In the cell line SGC7901 transfected with<br />

pSilencer3.1-H1-shRNA/RUNX3 , mRNA and protein<br />

www.wjgnet.com<br />

expression <strong>of</strong> the RUNX3 gene was lost identified by RT-<br />

PCR, Western blotting and immunocytochemistry assay.<br />

The growth <strong>of</strong> pSilencer3.1-H1-shRNA/ RUNX3 /SGC7901<br />

cells without expression <strong>of</strong> RUNX3 was the fastest<br />

(P < 0.05), its rate <strong>of</strong> clone f<strong>or</strong>mation was the highest<br />

(P < 0.01), and the cell distribution in G0/G1 and S/M<br />

phases was lowest and highest, respectively (P < 0.05),<br />

compared with that <strong>of</strong> the transfected pSilencer3.1-H1<br />

and non-transfected cells. Through RT-PCR and Western<br />

blot assay, inactivated RUNX3 could not be reactivated<br />

by 5-Aza-CdR.<br />

CONCLUSION: We found that, although shRNAs targeted<br />

to gene prompter regions <strong>of</strong> RUNX3 could effectively<br />

induce transcriptional repression with chromatic changes<br />

characteristic <strong>of</strong> inaction promoters, this was independent<br />

<strong>of</strong> DNA methylation, and the presence <strong>of</strong> RNA-dependent<br />

transcriptional silencing showed that RNA-directed<br />

DNA methylation might be an existing gene regulat<strong>or</strong>y<br />

mechanism relative to the methylated in humans.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: RNA interference; Sh<strong>or</strong>t hairpin RNAs;<br />

Promoter; DNA methylation; RUNX3; Stomach carcinoma<br />

Peer reviewer: Yuan Yuan, Pr<strong>of</strong>ess<strong>or</strong>, Cancer Institute <strong>of</strong> China<br />

Medical University, 155 N<strong>or</strong>th Nanjing Street, Heping District,<br />

Shenyang 110001, Liaoning Province, China<br />

Feng XZ, He XS, Zhuang YZ, Luo Q, Jiang JH, Yang S, Tang XF,<br />

Liu JL, Chen T. Investigation <strong>of</strong> transcriptional gene silencing and<br />

mechanism induced by shRNAs targeted to RUNX3 in vitro. W<strong>or</strong>ld<br />

J Gastroenterol 2008; 14(19): 3006-3014 Available from: URL:<br />

http://www.wjgnet.com/1007-9327/14/3006.asp DOI: http://dx.doi.<br />

<strong>or</strong>g/10.3748/wjg.14.3006<br />

INTRODUCTION<br />

The human runt-related transcription fact<strong>or</strong> 3 gene<br />

(RUNX3), a novel tum<strong>or</strong> suppress<strong>or</strong>, was <strong>or</strong>iginally cloned<br />

as AML2 in human leukocythemia by Levanon in 1994<br />

and is located on human chromosome 1p36.1 [1] . RUNX3<br />

contains two promoters, p1 and p2, one at the beginning<br />

<strong>of</strong> exon 1 and the other in front <strong>of</strong> exon 2. The mRNA<br />

expression <strong>of</strong> RUNX3 comes from transcription by p2,<br />

which has a high GC content due to a large conserved

---

3008 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

(6 g/L) in three six-well plates. The cells were cultured at<br />

37℃ in a humidified atmosphere that contained 50 mL/L<br />

CO2 f<strong>or</strong> 10 d. Then, colonies that contained > 100 cells in<br />

s<strong>of</strong>t agar were counted under an inverted microscope and<br />

the rate <strong>of</strong> colony f<strong>or</strong>mation was calculated by the mean<br />

percentage <strong>of</strong> colonies.<br />

Flow cytometry (FCM) with propidium iodide (PI) staining<br />

The cells were passaged at a density <strong>of</strong> 5.0 × 10 5 /mL.<br />

After 4 h, they were treated with serum-free medium f<strong>or</strong><br />

12 h, followed by treatment with medium that contained<br />

calf serum (100 mL/L) f<strong>or</strong> 24 h. Cells were collected by<br />

trypsinization and prepared as a single cell suspension by<br />

mechanical blowing with PBS, washed with cold PBS twice,<br />

and fixed with 700 mL/L alcohol at 4℃ f<strong>or</strong> 24 h. Fixed<br />

cells were washed with PBS and stained with PI (50 μg/mL<br />

in PBS) f<strong>or</strong> 30 min at room temperature in the dark. DNA<br />

content in PI-stained cells was detected by FCM.<br />

Primers and real-time RT-PCR<br />

As shown in Table 1, specific primers f<strong>or</strong> RUNX3 and<br />

β-actin genes were designed <strong>based</strong> on sequence data from<br />

the GenBank database. The primers were purchased from<br />

Shanghai Biological Engineering. Conditions f<strong>or</strong> all PCRs<br />

were optimized on Cycler iQ (Bio-Rad, USA) and the<br />

optimum annealing temperature was 55℃. The following<br />

cycler running protocol was used: denaturation (95℃,<br />

2 min), amplification and quantification repeated 35<br />

times (94℃ f<strong>or</strong> 30 s, 55℃ f<strong>or</strong> 30 s, and 72℃ f<strong>or</strong> 1 min).<br />

In addition, a non-template control (ddH2O control) was<br />

analyzed f<strong>or</strong> each template. All samples were amplified<br />

simultaneously in triplicate.<br />

Western blot analysis<br />

Cells were collected, washed three times with PBS, lysed<br />

in cell lysate that contained 0.1 mol/L NaCl, 0.01 mol/L<br />

Tris-HCl (pH 7.6), 0.001 mol/L EDTA (pH 8.0), 1 μg/mL<br />

aprotinin and 100 μg/mL PMSF, and then centrifuged at<br />

13 000 × g f<strong>or</strong> 10 min at 4℃. The extracted protein sample<br />

(50 μg total protein/lane) was added to the same volume <strong>of</strong><br />

sample buffer and subjected to denaturation at 100℃ f<strong>or</strong> 10<br />

min. The samples were electroph<strong>or</strong>esed on 100 g/L SDS<br />

PAGE at 28 mA f<strong>or</strong> 30 min until they reached the bottom<br />

<strong>of</strong> the spacer gel, separated on the separation gel at 120 V<br />

f<strong>or</strong> 1.5 h, and finally transferred onto PVDF membrane at<br />

105 mA f<strong>or</strong> 3.5 h at 4℃. The PVDF membrane was treated<br />

with TBST that contained 50 g/L skimmed milk at room<br />

temperature f<strong>or</strong> 2 h, followed by incubation with the primary<br />

antibody RUNX3 (1:100 dilution) (Boaosen Biotechnology<br />

Company, Beijing China; bs-0378R) at 37℃ f<strong>or</strong> 2 h <strong>or</strong><br />

4℃ overnight. After being washed with TBST f<strong>or</strong> 30 min,<br />

the c<strong>or</strong>responding secondary antibody (1:2000 dilution)<br />

(Zhongsan Jinqiao Biotechnology Company, Beijing, China)<br />

was added and incubated at room temperature f<strong>or</strong> 1 h. The<br />

membrane was then washed three times f<strong>or</strong> 15 min each<br />

with TBST. Flu<strong>or</strong>escence was produced from solution A<br />

and B that contained a chemiluminescence generat<strong>or</strong>. Both<br />

RUNX3 and β-actin protein expression were quantitatively<br />

estimated by densitometric scanning perf<strong>or</strong>med with<br />

Imaginer 2200. RUNX3 protein concentration was<br />

www.wjgnet.com<br />

Table 1 Sequence <strong>of</strong> primers and amplified length <strong>of</strong> genes<br />

Gene Sequence Amplified length (bp)<br />

RUNX3 5’-GAGTTTCACCCTGACCA TCACTGTG-3’ 870<br />

5’-GCCCATCACTGGTCTTGAAGGTTGT-3’<br />

β-actin 5’-CTACAATGAGCTGCGTGTGC-3’ 500<br />

5’-AGGAGGACTTCTTCTCGAT-3’<br />

n<strong>or</strong>malized to β-actin level and expressed as a densitometric<br />

ratio.<br />

Immunohistochemistry<br />

Cells were seeded on the axenic cover glass in six-well<br />

plates at 1 × 10 5 cells/well, and were grown overnight.<br />

The cover glasses with adhered cells were washed three<br />

times with PBS, and fixed in 95% alcohol f<strong>or</strong> 10 min.<br />

After being rinsed three times in PBS, the endogenous<br />

peroxidase activity was suppressed by 30 mg/L hydrogen<br />

peroxide f<strong>or</strong> 15 min, followed by rinsing three times in PBS.<br />

Antigen repair was perf<strong>or</strong>med by immersing the sections<br />

in 10 mmol/L sodium citrate buffer (pH 6.0) and heating<br />

f<strong>or</strong> 15 min in a microwave oven. Non-specific binding<br />

was blocked by incubation with 30 mL/L bovine serum<br />

albumin (BSA) f<strong>or</strong> 40 min. The cells were treated f<strong>or</strong> 16 h<br />

with goat anti-human polyclonal IgG antibodies <strong>of</strong> RUNX3<br />

(Boaosen Biotechnology Company; bs-0378R) at 37℃<br />

f<strong>or</strong> 2 h <strong>or</strong> 4℃ overnight, acc<strong>or</strong>ding to the manufacturer’s<br />

recommended concentration (1:200 dilution). PBS was used<br />

as a negative control. After washing three times in PBS,<br />

the cover glasses were treated with biotinylated rabbit antigoat<br />

immunoglobulin (Zhongsan Jinqiao Biotechnology<br />

Company) f<strong>or</strong> 1 h at room temperature and then by<br />

h<strong>or</strong>seradish peroxidase-streptavidin complex (Man Xin<br />

Biotechnology Company, Huzhou, China) f<strong>or</strong> 30 min. The<br />

cover glasses were then washed three times in PBS and<br />

incubated in DAB f<strong>or</strong> 2 min. Next, the cover glasses were<br />

rinsed gently with distilled water and counterstained with<br />

hematoxylin f<strong>or</strong> 30 s, and dehydrated in alcohol pri<strong>or</strong> to<br />

mounting. Images were collected by Olympus DD70 BX51<br />

(Olympus, Japan) and analyzed by IMAGE-PRO plus 4.1<br />

s<strong>of</strong>tware (Media Cybernetics, USA). Eight visual fields in<br />

each section were randomly selected and the mean value <strong>of</strong><br />

relative OD was measured and calculated by taking the OD<br />

<strong>of</strong> background as 1. The extent <strong>of</strong> immunohistochemical<br />

staining was categ<strong>or</strong>ized as positive (1-1.5) and strongly<br />

positive (> 1.5).<br />

Statistical analysis<br />

Experimental data in each group were expressed as<br />

mean ± SD. Analysis <strong>of</strong> variance (ANOVA) was perf<strong>or</strong>med<br />

with the Statistical Package f<strong>or</strong> the Social Sciences (SPSS<br />

13.0) f<strong>or</strong> Windows by using one way ANOVA and pairwise<br />

comparison with Student’s t test. P < 0.05 was considered<br />

statistically significantly.<br />

RESULTS<br />

RUNX3 protein expression in human gastric carcinoma<br />

cell lines<br />

Western blot analysis showed that the relative densities

---

A B<br />

C<br />

Figure 5 RUNX3 expression in SGC7901 cells by immunohistochemistry (× 400).<br />

A: SGC7901 cells, the protein <strong>of</strong> RUNX3 expressed and located in the<br />

endochylema and the nucleus in the SGC7901 cell without transfection; B:<br />

pSilencer3.1-H1/SGC7901 cells, the protein <strong>of</strong> RUNX3 expressed and located in<br />

the endochylema and the nucleus in the SGC7901 cell with the plasmid DNA <strong>of</strong><br />

pSilencer3.1-H1; C: pSilencer3.1-H1-shRNA/RUNX3/SGC7901 cells, the protein<br />

<strong>of</strong> RUNX3 lost expression in the SGC790 cells transfected with the recombinated<br />

plasmid-pSilencer 3.1-H1-shRNA/RUNX3.<br />

Number <strong>of</strong> cells (1 × 10 4 )<br />

3010 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

180<br />

160<br />

140<br />

120<br />

100<br />

80<br />

60<br />

40<br />

20<br />

SGC7901<br />

pSilener3.1/SGC7901<br />

pSilener3.1-shRNA/RUNX3 /SGC7901<br />

0<br />

0 1 2 3 4 5 6 7 8 9<br />

t /d<br />

Figure 6 The growth effect <strong>of</strong> SGC7901 cell by silencing RUNX3 ( a P < 0.05).<br />

Expression <strong>of</strong> RUNX3 in transfected cells treated with<br />

5-Aza-CdR<br />

The pSilencer3.1-H1-shRNA/RUNX3/SGC7901 cells<br />

(1 × 10 6 /100 mL) were treated with 5 × 10 -6 mol/L and<br />

1 × 10 -5 mol/L 5-Aza-CdR. Cells were collected after 3 d<br />

treatment. The cells treated with 5 × 10 -6 mol/L 5-Aza-<br />

CdR were named experimental group 1, and those treated<br />

with 1 × 10 -5 mol/L 5-Aza-CdR were experimental group 2.<br />

www.wjgnet.com<br />

a<br />

Colony f<strong>or</strong>mation rate (%)<br />

A B<br />

C<br />

20<br />

18<br />

16<br />

14<br />

12<br />

10<br />

8<br />

6<br />

4<br />

2<br />

0<br />

Colony f<strong>or</strong>mation rate<br />

SGC7901 pSilencer3.1-H1 pSilencer3.1-H1-shRNA/<br />

/SGC7901 RUNX3 /SGC7901<br />

Figure 7 The colony f<strong>or</strong>mation assay <strong>of</strong> SGC7901 in the s<strong>of</strong>t agar (×100). A:<br />

SGC7901 cells, the cloning efficiency was 9.9% ± 0.3% in the SGC7901 cell without<br />

transfection; B: pSilencer3.1-H1/SGC7901 cells, the cloning efficiency was 9.7% ±<br />

0.6% in the SGC7901 cell with the plasmid DNA <strong>of</strong> pSilencer3.1-H1; C: pSilencer3.1-<br />

H1-shRNA/RUNX3/SGC 7901 cells, the cloning efficiency was 17.4% ± 0.31% in the<br />

SGC790 cells transfected with the recombinated plasmid-pSilencer3.1-H1-shRNA/<br />

RUNX3. A significant increase <strong>of</strong> the colony f<strong>or</strong>mation rate in the pSilencer3.1-H1shRNA/RUNX3/SGC790<br />

cells was discovered compared with the controls-the SGC-<br />

79011cells and pSilencer3.1-H1/SGC7901cells (P < 0.01).<br />

Table 2 Cell cycle distribution <strong>of</strong> three groups by FCM (n = 3,<br />

mean ± SD, %)<br />

Groups G0/G1 S G2/M<br />

SGC7901 43.2 ± 1.2 47.7 ± 1.1 9.0 ± 1.5<br />

pSilencer3.1-H1-shRNA/SGC7901 40.3 ± 2.0 49.3 ± 0.9 8.1 ± 0.3<br />

pSilencer3.1-H1-shRNA/RUNX3/<br />

SGC7901<br />

37.2 ± 1.9 60.5 ± 0.8 7.3 ± 0.9<br />

RT-PCR showed that the relative densities <strong>of</strong> RUNX3<br />

mRNA bands were 0.861 ± 0.167, 0.004 ± 0.001, 0.002 ± 0.001<br />

and 0.002 ± 0.001, respectively (Figure 9), and Western blot<br />

analysis that the band densities <strong>of</strong> RUNX3 were 1.013 ± 0.138,<br />

0.003 ± 0.001, 0.002 ± 0.001 and 0.005 ± 0.001, respectively<br />

(Figure 10).

---

A<br />

Cell number<br />

B<br />

Cell number<br />

C<br />

Cell number<br />

Feng XZ et al. Transcriptional gene silencing and mechanism 3011<br />

488<br />

407<br />

325<br />

244<br />

162<br />

81<br />

DISCUSSION<br />

DUI2.LMD PMT4 Lin<br />

0<br />

0 32 64 96 128 160 192 224 256<br />

PMT4 Lin<br />

464<br />

387<br />

309<br />

232<br />

154<br />

77<br />

KONG.LMD PMT4 Lin<br />

0<br />

0 32 64 96 128 160 192 224 256<br />

PMT4 Lin<br />

439<br />

365<br />

292<br />

219<br />

146<br />

73<br />

ZHUANG.LMD PMT4 Lin<br />

0<br />

0 32 64 96 128 160 192 224 256<br />

PMT4 Lin<br />

Diploid cycle<br />

Mean G1 = 86.3<br />

CV G1 = 13.7<br />

% G1 = 47.9<br />

Mean G2 = 155.2<br />

CV G2 = 13.7<br />

% G2 = 10.8<br />

(9.6-12.0)<br />

% S = 41.4<br />

(37.1-45.6)<br />

G2/G1 = 1.799<br />

% Tot = 95.6<br />

Chi Sq. = 1.4<br />

Apoptot. peak<br />

Mean = 53.0<br />

CV = 13.7<br />

% Tot = 4.4<br />

D.I. = 0.614<br />

Chi Sq. = 1.2<br />

Cell No. = 30 000<br />

Diploid cycle<br />

Mean G1 = 74.8<br />

CV G1 = 14.8<br />

% G1 = 42.7<br />

Mean G2 = 134.6<br />

CV G2 = 14.8<br />

% G2 = 14.9<br />

(13.7-16.1)<br />

% S = 42.3<br />

(38.7-46.0)<br />

G2/G1 = 1.799<br />

% Tot = 97.5<br />

Chi Sq. = 1.4<br />

Apoptot. peak<br />

Mean = 41.9<br />

CV = 14.8<br />

% Tot = 2.5<br />

D.I. = 0.560<br />

Chi Sq. = 1.0<br />

Cell No. = 30 000<br />

Diploid cycle<br />

Mean G1 = 77.1<br />

CV G1 = 15.1<br />

% G1 = 35.0<br />

Mean G2 = 150.4<br />

CV G2 = 15.1<br />

% G2 = 0.0<br />

(0.0-0.9)<br />

% S = 65.0<br />

(61.9-68.1)<br />

G2/G1 = 1.950<br />

% Tot = 98.9<br />

Chi Sq. = 1.4<br />

Apoptot. peak<br />

Mean = 39.7<br />

CV = 15.1<br />

% Tot = 1.1<br />

D.I. = 0.515<br />

Chi Sq. = 1.4<br />

Cell No. = 30 000<br />

Figure 8 The cell cycle analysis by FCM. A: SGC790 cells, the cell prop<strong>or</strong>tions <strong>of</strong><br />

G0/G1 and S stages were 43.2% ± 1.2% and 47.7% ± 1.1% in the SGC7901cell<br />

without transfection, respectively; B: pSilencer3.1-H1/SGC7901 cells, the cell<br />

prop<strong>or</strong>tions <strong>of</strong> G0/G1 and S stages were 40.3% ± 2.0% and 49.3% ± 0.9% in<br />

the SGC7901 cell with the plasmid DNA <strong>of</strong> pSilencer3.1-H1 respectively; C:<br />

pSilencer3.1-shRNA/RUNX3SGC7901 cells, the cell prop<strong>or</strong>tions <strong>of</strong> G0/G1 and S<br />

stages were 37.2% ± 1.9% and 60.5% ± 0.8% in the SGC790 cells transfected with<br />

the recombinated plasmid-pSilencer3.1-H1-shRNA/RUNX3 respectively. Compared<br />

with that <strong>of</strong> G0/G1 and S stages <strong>of</strong> two controls, the cell prop<strong>or</strong>tions <strong>of</strong> G0/G1 and<br />

S stages in the pSilencer3.1-H1-shRNA/RUNX3/SGC7901 cells decreased and<br />

increased obviously, respectively (P < 0.05).<br />

In the occurrence and development <strong>of</strong> gastric carcinoma,<br />

the mechanism <strong>of</strong> abn<strong>or</strong>mal silencing <strong>of</strong> anti-oncogenes<br />

mediated by epigenomics in the un-first-class structure<br />

M 1 2 3 4<br />

1000 bp → RUNX3<br />

500 bp →<br />

β-actin<br />

Figure 9 RUNX3 expresion detected by RT-PCR in the four groups <strong>of</strong> SGC7901<br />

cells. M: Marker; 1: Positive control, SGC7901 cells untreated with 5-Aza-CdR; 2:<br />

Negative control, pSilencer3.1-H1-shRNA/RUNX3/SGC7901cells untreated with<br />

5-Aza-CdR; 3: Experimental group 1, pSilencer3.1-H1-shRNA/RUNX3/SGC7901cells<br />

treated with 5 × 10 -6 mol/L 5-Aza-CdR; 4: Experimental group 2, pSilencer3.1-H1shRNA/RUNX3/SGC7901<br />

cells treated with 1 x 10 -5 mol/L 5-Aza-CdR.<br />

Relative expression density<br />

1.4<br />

1.2<br />

1.0<br />

0.8<br />

0.6<br />

0.4<br />

0.2<br />

0.0<br />

1 2 3 4<br />

Relative expression density<br />

RUNX3<br />

β-actin<br />

Positive Negative Experimental Experimental<br />

control control group 1 group 2<br />

Figure 10 RUNX3 protein detected by Western blotting in the four groups <strong>of</strong><br />

SGC7901 cells. 1: Positive control, SGC7901 cells untreated with 5-Aza-CdR; 2:<br />

Negative control, pSilencer3.1-H1-shRNA/RUNX3/SGC7901cells untreated with<br />

5-Aza-CdR; 3: Experimental group 1, pSilencer3.1-H1-shRNA/RUNX3/SGC7901cells<br />

treated with 5 × 10 -6 mol/L 5-Aza-CdR; 4: Experimental group 2, pSilencer3.1-H1shRNA/RUNX3/SGC7901<br />

cells treated with 1 × 10 -5 mol/L 5-Aza-CdR.<br />

levels <strong>of</strong> nucleotide sequence such as DNA methylation<br />

and histone modification, is still unclear. Many researchers<br />

have assumed that aberrant CpG island hypermethylation<br />

<strong>of</strong> the promoters <strong>of</strong> anti-oncogenes exists frequently in<br />

tum<strong>or</strong>s. However, it is still not known how the aberrant<br />

CpG island hypermethylation takes place. Recently, the<br />

phenomenon by which siRNA molecules that target gene<br />

prompter regions can induce transcriptional gene silencing<br />

in a DNA cytosine methylation-dependent manner has<br />

attracted much attention.<br />

siRNA can induce post-transcriptional gene silencing<br />

through RNA-RNA binding and transcriptional gene<br />

silencing through RNA-DNA binding. Transcriptional gene<br />

silencing refers to siRNA molecules that hinder production<br />

<strong>of</strong> mRNA from DNA bef<strong>or</strong>e gene transcription, by<br />

www.wjgnet.com

---

3012 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

modifying chromosomal DNA and histones. It include<br />

three patterns; RNA-directed DNA methylation, RNAdirected<br />

heterochromatinization and RNA-directed DNA<br />

ablation [8-10] . The idea <strong>of</strong> RNA-directed DNA methylation<br />

was obtained from a propagation study in Arabidopsis<br />

thaliana [11] . It is not known whether a similar mechanism<br />

exists in mammalian systems.<br />

Some elements, such as the required constituents<br />

<strong>of</strong> RNA-directed DNA methylation in plants, have<br />

been discovered in mammals. They contain three<br />

DNA methyltransferases (DNMT) 1, which play a<br />

role in maintaining methyltransferases. DNMT3A and<br />

DNMT3B can be let in the new methylated sites. The<br />

two processes including the methylated maintenance and<br />

repeated methylation might exist to affect genome DNA<br />

in mammals as in plants [12] . DNMT3A and DNMT3B<br />

have been observed to participate in the <strong>or</strong>ientation <strong>of</strong><br />

siRNA that target gene promoters [13] . As to human HeLa<br />

cells, the percentage <strong>of</strong> the mature-type miR-21 located<br />

in the cytoplasm and the nucleus were 80% and 20%,<br />

respectively. After transfection with flu<strong>or</strong>escently-labeled<br />

siRNA/miR-21, the flu<strong>or</strong>escence which siRNA/miR-21<br />

binds the complementary sequences was observed in the<br />

cytoplasm and the nucleus. A identical consequence has<br />

appeared in cells transfected with flu<strong>or</strong>escently-labeled<br />

siRNA/let-7a [14] .<br />

Some previous investigations have rep<strong>or</strong>ted that siRNA<br />

molecules that target gene prompter regions can induce<br />

transcriptional gene silencing and DNA cytosine methylation<br />

around the promoter region. In the study by M<strong>or</strong>ris et al,<br />

elongation fact<strong>or</strong> 1 α (EF1α) was knocked down by the<br />

prompter-directed siRNA in HEK293 cells by transfection.<br />

After treatment with 5-Aza-CdR (4 μmol/L) and trichostatin<br />

A (TSA, 0.05 mmol/L), deactivation <strong>of</strong> EF1α was reversed<br />

and detected through nuclear run-on assays and RT-PCR.<br />

Acc<strong>or</strong>ding to the above data, the transcriptional silencing<br />

<strong>of</strong> EF1a might be associated with DNA methylation <strong>of</strong> the<br />

targeted sequence [15] . Acc<strong>or</strong>ding to research by Castanotto<br />

et al, shRNAs, molecules homologous to DNA sequences<br />

in the prompter and early transcribed regions <strong>of</strong> RASSF1,<br />

can direct the partial gene silencing and low levels <strong>of</strong><br />

de novo DNA methylation. They used a methylation-specific<br />

polymerase chain reaction (MSP) and bisulfite sequencing<br />

in HeLa cells [16] . M<strong>or</strong>eover, Weinberg’s investigation showed<br />

that transcriptional silencing and DNA methylation <strong>of</strong> EF1a<br />

can be directed by antisense interference alone in human<br />

293T cells transfected with EF1α siRNA. This targets the<br />

promoter <strong>of</strong> it using the peptide MPG, which transp<strong>or</strong>ts<br />

siRNAs to the nucleus. This silencing is accompanied by<br />

increased methylation level in histone 3 lysine 9 (H3K9)<br />

and histone 3 lysine 27 (H3K27). Furtherm<strong>or</strong>e, siRNAs<br />

EF52 is associated with the transient expression <strong>of</strong> Flagtagged<br />

DNMT3A, the targeted EF1α promoter, and<br />

trimethylated H3K27 [17] . Previous studies have indicated<br />

that, in mammalian cells, the unique RNA endonuclease<br />

Dicer, which cuts long dsRNA to f<strong>or</strong>m siRNA, is situated<br />

in the cytoplasm [18-20] . RNA-induced silencing complex<br />

(RISC), which binds to siRNAs in the cell-substance, may<br />

gain access to the nucleus when caryotheca vanishes during<br />

cell division, <strong>or</strong> it may be transp<strong>or</strong>ted into the nucleus, as in<br />

www.wjgnet.com<br />

plants. Furtherm<strong>or</strong>e, siRNA can integrate the homologous<br />

DNA sequences (promoters) and induce transcriptional<br />

gene silencing in a DNA cytosine methylation-dependent<br />

manner [11,21] .<br />

We confirmed that aberrant CpG island hypermethylation<br />

<strong>of</strong> the promoter <strong>of</strong> RUNX3 is a critical<br />

pathway to cause down-regulation <strong>or</strong> loss <strong>of</strong> expression<br />

<strong>of</strong> the gene. How may the pathway be connected with the<br />

mechanism <strong>of</strong> RNA-directed DNA methylation? In our<br />

experiment, on the basis <strong>of</strong> the principle <strong>of</strong> RNAi design,<br />

pSilencer3.1-H1-shRNA/RUNX3 expression vect<strong>or</strong> was<br />

constructed, and transfected in SGC7901 cells by liposomes.<br />

RT-PCR, western blot and immunocytochemistry showed<br />

that mRNA and protein expression <strong>of</strong> RUNX3 were<br />

absent in the stable cell line SGC7901 transfected with<br />

the recombinant plasmid. M<strong>or</strong>eover, compared with those<br />

transfected with pSilencer3.1-H1 and non-transfected cells,<br />

cells transfected with pSilencer3.1-H1-shRNA/RUNX3<br />

grew most quickly. Both the clone number and size were<br />

largest following s<strong>of</strong>t-agar colony-f<strong>or</strong>mation assay (P < 0.01)<br />

and the number <strong>of</strong> cells in G0/G1 and S/M phases<br />

was lowest and highest following FCM (P < 0.05). The<br />

above results indicated that, through RNA-dependent<br />

transcriptional silencing (RdTS), knockdown <strong>of</strong> the gene<br />

at the transcriptional stage was feasible and effective. After<br />

loss <strong>of</strong> expression <strong>of</strong> RUNX3 protein, the proliferation<br />

rate <strong>of</strong> SGC7901 cells increased. These results, like the<br />

previous description [3-6] , suggested that RUNX3, a putative<br />

tum<strong>or</strong> suppress<strong>or</strong>, might have an imp<strong>or</strong>tant role in stomach<br />

tum<strong>or</strong>igenesis. However, after the deal with the different<br />

density <strong>of</strong> 5-Aza-CdR, which may reactivate anti-oncogenes<br />

silenced by de novo methylation, inactivated RUNX3 was<br />

not reactivated, as shown by RT-PCR and the silenced. The<br />

phenomenon was different from the RdDM described in<br />

plants. At the same time, similar results have been rep<strong>or</strong>ted.<br />

In two human glioblastoma cell lines, U-87 and U-118,<br />

siRNA homologous to the promoter region <strong>of</strong> huntingtin<br />

gene can repress transcriptional expression <strong>of</strong> the target<br />

gene. However, no CpG methylation has been observed<br />

on the target sequences by bisulfite-mediated genomic<br />

sequencing [21,22] . In the research <strong>of</strong> Ting et al, the human<br />

col<strong>or</strong>ectal cancer cells, HCT116, were transfected with two<br />

21-nucleotide-long dsRNAs (dsCDH1-1 and dsCDH1-2).<br />

The two sequences were homologous to the CpG island<br />

<strong>of</strong> the endogenous gene promoter <strong>of</strong> CDH1 but did not<br />

overlap any known transcribed sequences. The findings<br />

suggested that promoter-targeting dsRNAs could effectively<br />

silence CDH1 transcription, which results in a net decrease<br />

in mRNA and protein production, as demonstrated by RT-<br />

PCR and Western blot. Absence <strong>of</strong> DNA methylation at<br />

the targeted sequences was reviewed by MSP and bisulfite<br />

sequencing. Transfection <strong>of</strong> the human breast cancer cells,<br />

MCF-7, used a silencing strategy virtually identical to that<br />

above f<strong>or</strong> CDH1. The transcriptional silencing without<br />

DNA methylation was reviewed and the results were<br />

identical [23] .<br />

What accounts f<strong>or</strong> these opposing results? We believe<br />

the answer may lie in the types <strong>of</strong> DNA methylation<br />

assays perf<strong>or</strong>med. In the w<strong>or</strong>k by M<strong>or</strong>ris et al, the DNA<br />

methylation data remain to be verified because DNA

---

Feng XZ et al. Transcriptional gene silencing and mechanism 3013<br />

methylation was not as extensive, and there was indirect<br />

<strong>evidence</strong> f<strong>or</strong> 5-Aza-CdR and TSA, a histone-deacetylase<br />

inhibit<strong>or</strong>. Co-administration alleviating the silencing<br />

was difficult to interpret as the reason <strong>of</strong> the EF1α<br />

silencing. In other investigations, MSP distinguishes<br />

between non-methylated and methylated alleles by using<br />

two sets <strong>of</strong> primers to amplify either non-methylated<br />

<strong>or</strong> methylated sequences after bisulfite treatment, which<br />

specifically converts non-methylated cytosines to uracils.<br />

The sh<strong>or</strong>tcoming <strong>of</strong> MSP analysis is that it examines a<br />

few CpG sites in the sequences that are recognized by<br />

the primers, and the design <strong>of</strong> primers is very difficult.<br />

Mismatch sequencing was used to verify the overall<br />

target region by unbiased primers that did not contain<br />

CpG dinucleotides to amplify the bisulfite-converted<br />

promoter region. Due to the existence <strong>of</strong> incomplete<br />

mismatch conversions, unconverted cytosine residues in<br />

both CpG and CpG contexts remained as cytosine and<br />

created a false negative result. Furtherm<strong>or</strong>e, the PCR<br />

primers that were used previously to obtain the initial<br />

mismatch sequencing template that contains CpG sites<br />

may bias the amplification step and produce problematic<br />

mismatch sequencing results [5] . Such non-conversions<br />

may partly explain the different results in the mismatch<br />

sequencing. In the current study, the level <strong>of</strong> DNA<br />

methylation was testified preliminary and indirect. The<br />

finding that inactivation <strong>of</strong> RUNX3 was not reactivated<br />

with 5-Aza-CdR could not confirm sufficiently that the<br />

transcriptional silencing <strong>of</strong> RUNX3 was independent <strong>of</strong><br />

DNA methylation. Theref<strong>or</strong>e, further study is needed.<br />

Taken together, the presence <strong>of</strong> RdTS indicated that<br />

RdDM might be an existing gene regulat<strong>or</strong>y mechanism<br />

relevant to methylation in humans, even though we are<br />

currently unable to verify this. A recent study has shown<br />

that, in A. thaliana, RdDM is studied in the progeny <strong>of</strong><br />

plants being silenced, and DNA methylation may still be<br />

involved in a prolonged silencing event in human cells [24] .<br />

Theref<strong>or</strong>e, further experiments, which include a th<strong>or</strong>ough<br />

examination <strong>of</strong> the long-term and full-scale outcomes<br />

<strong>of</strong> RdTS, are needed to research RNA-directed DNA<br />

methylation in mammalian systems.<br />

COMMENTS<br />

Background<br />

Aberrant CpG island hypermethylation <strong>of</strong> the promoter <strong>of</strong> RUNX3, a tum<strong>or</strong><br />

suppress<strong>or</strong>, is associated with its transcriptional silencing and the loss <strong>of</strong> gene<br />

functions in stomach cancer. However, the mechanism <strong>of</strong> the aberrant CpG island<br />

hypermethylation is still unclear.<br />

Research frontiers<br />

In plants, siRNA molecules that target gene prompter regions can induce<br />

transcriptional gene silencing in a DNA cytosine methylation-dependent manner<br />

(RdDM). Whether a similar mechanism exists in mammalian systems is a vital and<br />

controversial issue. Recently, the RdDM the<strong>or</strong>y on gene regulation has attracted<br />

close attention from researchers and has become a highlight in tum<strong>or</strong> studies.<br />

Innovations and breakthroughs<br />

This article focuses on the relationship between siRNA molecules and aberrant<br />

CpG island hypermethylation in the promoter domain <strong>of</strong> RUNX3, through the RNA<br />

interference principle and gene transfection technology in human gastric cancer<br />

cell lines.<br />

Applications<br />

RUNX3 is an imp<strong>or</strong>tant anti-oncogene. Its mechanism <strong>of</strong> methylation may<br />

contribute to the study <strong>of</strong> the etiology <strong>of</strong> gastric cancer, and <strong>of</strong>fer a the<strong>or</strong>etical<br />

basis f<strong>or</strong> gene therapy <strong>of</strong> gastric cancer<br />

Terminology<br />

RNA interference is an evolutionarily conserved mechanism <strong>of</strong> gene silencing.<br />

It can affect transcriptional gene silencing induced by siRNA that target gene<br />

prompter regions in a DNA cytosine methylation-dependent manner.<br />

Peer review<br />

This is a good study in which the auth<strong>or</strong>s demonstrated that, shRNAs that<br />

targeted gene prompter regions <strong>of</strong> RUNX3 could effectively induce transcriptional<br />

repression with chromatic changes characteristic <strong>of</strong> inaction promoters, but it was<br />

independent <strong>of</strong> DNA methylation. The study was well designed and the results are<br />

convincing.<br />

REFERENCES<br />

1 Levanon D, Negreanu V, Bernstein Y, Bar-Am I, Avivi L,<br />

Groner Y. AML1, AML2, and AML3, the human members <strong>of</strong><br />

the runt domain gene-family: cDNA structure, expression, and<br />

chromosomal localization. Genomics 1994; 23: 425-432<br />

2 Li QL, Ito K, Sakakura C, Fukamachi H, Inoue K, Chi XZ,<br />

Lee KY, Nomura S, Lee CW, Han SB, Kim HM, Kim WJ,<br />

Yamamoto H, Yamashita N, Yano T, Ikeda T, Itohara S,<br />

Inazawa J, Abe T, Hagiwara A, Yamagishi H, Ooe A, Kaneda<br />

A, Sugimura T, Ushijima T, Bae SC, Ito Y. Causal relationship<br />

between the loss <strong>of</strong> RUNX3 expression and gastric cancer. Cell<br />

2002; 109: 113-124<br />

3 Wei D, Gong W, Oh SC, Li Q, Kim WD, Wang L, Le X,<br />

Yao J, Wu TT, Huang S, Xie K. Loss <strong>of</strong> RUNX3 expression<br />

significantly affects the clinical outcome <strong>of</strong> gastric cancer<br />

patients and its rest<strong>or</strong>ation causes drastic suppression <strong>of</strong><br />

tum<strong>or</strong> growth and metastasis. Cancer Res 2005; 65: 4809-4816<br />

4 Homma N, Tamura G, Honda T, Matsumoto Y, Nishizuka<br />

S, Kawata S, Motoyama T. Spreading <strong>of</strong> methylation within<br />

RUNX3 CpG island in gastric cancer. Cancer Sci 2006; 97:<br />

51-56<br />

5 So K, Tamura G, Honda T, Homma N, Endoh M, Togawa N,<br />

Nishizuka S, Motoyama T. Quantitative assessment <strong>of</strong> RUNX3<br />

methylation in neoplastic and non-neoplastic gastric epithelia<br />

using a DNA microarray. Pathol Int 2006; 56: 571-575<br />

6 Zeng C, He XS, Luo Q, Zhao S, Deng M, Li YN. The expression<br />

and the mechanism <strong>of</strong> the down regulation <strong>of</strong> RUNX3 in the<br />

gastric carcinoma. Shijie Huaren Xiaohua Zazhi 2006; 14: 250-255<br />

7 Wassenegger M, Heimes S, Riedel L, Sunger HL. RNAdirected<br />

de novo methylation <strong>of</strong> genomic sequences in plants.<br />

Cell 1994; 76: 567-576<br />

8 Kawasaki H, Taira K, M<strong>or</strong>ris KV. siRNA induced transcriptional<br />

gene silencing in mammalian cells. Cell Cycle 2005; 4:<br />

442-448<br />

9 Kawasaki H, Taira K. Transcriptional gene silencing by sh<strong>or</strong>t<br />

interfering RNAs. Curr Opin Mol Ther 2005; 7: 125-131<br />

10 Gaur RK, Rossi JJ. The diversity <strong>of</strong> RNAi and its applications.<br />

Biotechniques 2006; Suppl: 4-5<br />

11 Matzke MA, Birchler JA. RNAi-mediated pathways in the<br />

nucleus. Nat Rev Genet 2005; 6: 24-35<br />

12 Szyf M. DNA methylation and demethylation as targets f<strong>or</strong><br />

anticancer therapy. Biochemistry (Mosc) 2005; 70: 533-549<br />

13 M<strong>or</strong>ris KV. siRNA-mediated transcriptional gene silencing:<br />

the potential mechanism and a possible role in the histone<br />

code. Cell Mol Life Sci 2005; 62: 3057-3066<br />

14 Meister G, Landthaler M, Patkaniowska A, D<strong>or</strong>sett Y, Teng<br />

G, Tuschl T. Human Argonaute2 mediates RNA cleavage<br />

targeted by miRNAs and siRNAs. Mol Cell 2004; 15: 185-197<br />

15 M<strong>or</strong>ris KV, Chan SW, Jacobsen SE, Looney DJ. Small<br />

interfering RNA-induced transcriptional gene silencing in<br />

human cells. Science 2004; 305: 1289-1292<br />

16 Castanotto D, Tommasi S, Li M, Li H, Yanow S, Pfeifer<br />

www.wjgnet.com

---

3014 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

GP, Rossi JJ. Sh<strong>or</strong>t hairpin RNA-directed cytosine (CpG)<br />

methylation <strong>of</strong> the RASSF1A gene promoter in HeLa cells. Mol<br />

Ther 2005; 12: 179-183<br />

17 Weinberg MS, Villeneuve LM, Ehsani A, Amarzguioui M,<br />

Aagaard L, Chen ZX, Riggs AD, Rossi JJ, M<strong>or</strong>ris KV. The<br />

antisense strand <strong>of</strong> small interfering RNAs directs histone<br />

methylation and transcriptional gene silencing in human cells.<br />

RNA 2006; 12: 256-262<br />

18 Hutvagner G, McLachlan J, Pasquinelli AE, Balint E, Tuschl<br />

T, Zam<strong>or</strong>e PD. A cellular function f<strong>or</strong> the RNA-interference<br />

enzyme Dicer in the maturation <strong>of</strong> the let-7 small temp<strong>or</strong>al<br />

RNA. Science 2001; 293: 834-838<br />

19 Rossi JJ. Mammalian Dicer finds a partner. EMBO Rep 2005; 6:<br />

927-929<br />

20 Schmitter D, Filkowski J, Sewer A, Pillai RS, Oakeley EJ,<br />

Zavolan M, Svoboda P, Filipowicz W. Effects <strong>of</strong> Dicer and<br />

www.wjgnet.com<br />

Argonaute down-regulation on mRNA levels in human<br />

HEK293 cells. Nucleic Acids Res 2006; 34: 4801-4815<br />

21 Svoboda P, Stein P, Filipowicz W, Schultz RM. Lack <strong>of</strong><br />

homologous sequence-specific DNA methylation in response<br />

to stable dsRNA expression in mouse oocytes. Nucleic Acids<br />

Res 2004; 32: 3601-3606<br />

22 Park CW, Chen Z, Kren BT, Steer CJ. Double-stranded<br />

siRNA targeted to the huntingtin gene does not induce DNA<br />

methylation. Biochem Biophys Res Commun 2004; 323: 275-280<br />

23 Ting AH, Schuebel KE, Herman JG, Baylin SB. Sh<strong>or</strong>t doublestranded<br />

RNA induces transcriptional gene silencing in<br />

human cancer cells in the absence <strong>of</strong> DNA methylation. Nat<br />

Genet 2005; 37: 906-910<br />

24 Aufsatz W, Mette MF, Matzke AJ, Matzke M. The role <strong>of</strong><br />

MET1 in RNA-directed de novo and maintenance methylation<br />

<strong>of</strong> CG dinucleotides. Plant Mol Biol 2004; 54: 793-804<br />

S- Edit<strong>or</strong> Li DL L- Edit<strong>or</strong> Kerr C E- Edit<strong>or</strong> Ma WH

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3015-3020<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

Transplanted bone marrow stromal cells are not cellular<br />

<strong>or</strong>igin <strong>of</strong> hepatocellular carcinomas in a mouse model <strong>of</strong><br />

carcinogenesis<br />

Jin-Fang Zheng, Li-Jian Liang<br />

Jin-Fang Zheng, Department <strong>of</strong> Hepatobiliary Surgery, the<br />

People’s Hospital <strong>of</strong> Hainan Province, Haikou 570311, Hainan<br />

Province, China<br />

Li-Jian Liang, Department <strong>of</strong> Hepatobiliary Surgery, the First<br />

Affiliated Hospital, Sun Yat-Sen University, Guangzhou 510080,<br />

Guangdong Province, China<br />

Supp<strong>or</strong>ted by The Natural Science Foundation <strong>of</strong> Hainan<br />

Province, No. 805107<br />

Auth<strong>or</strong> contributions: Zheng JF and Liang LJ contributed equally<br />

to this w<strong>or</strong>k; Zheng JF and Liang LJ designed the research; Zheng<br />

JF perf<strong>or</strong>med the research; Liang LJ provided new reagents/analytic<br />

tools; Liang LJ analyzed data; and Zheng JF wrote the paper.<br />

C<strong>or</strong>respondence to: Dr. Jin-Fang Zheng, Department <strong>of</strong><br />

Hepatobiliary Surgery, the People’s Hospital <strong>of</strong> Hainan Province,<br />

19# Xiuhua Road, Haikou 570311, Hainan Province,<br />

China. zhengjf2000@hotmail.com<br />

Telephone: +86-898-68642216 Fax: +86-898-68661664<br />

Received: January 9, 2008 Revised: April 7, 2008<br />

Abstract<br />

AIM: To investigate the malignant potential <strong>of</strong> hepatic<br />

stem cells derived from the bone marrow stromal cells<br />

(BMSCs) in a mouse model <strong>of</strong> chemical hepatocarcinogenesis.<br />

METHODS: BMSCs from male BALB/c mice were harvested<br />

and cultured, then transplanted into female syngenic BALB/<br />

c mice via p<strong>or</strong>tal vein. Hepato-carcinogenesis was induced<br />

by 6 mo <strong>of</strong> treatment with diethylnitrosamine (DEN). Six<br />

months later, the liver was removed from each treated<br />

mouse and evaluated by immunohistochemistry and<br />

flu<strong>or</strong>escence in situ hybridization (FISH).<br />

RESULTS: Twenty-six percent <strong>of</strong> recipient mice survived<br />

and developed multiple hepatocellular carcinomas (HCCs).<br />

Immunohistochemically, HCC expressed placental f<strong>or</strong>m<br />

<strong>of</strong> glutathione-S-transferase (GST-P) and α-fetoprotein,<br />

but did not express cytokeratin 19. Y chromosome<br />

positive hepatocytes were detected by flu<strong>or</strong>escent in situ<br />

hybridization (FISH) in the liver <strong>of</strong> mice treated with DEN<br />

after BMSCs transplantation while no such hepatocytes<br />

were identified in the liver <strong>of</strong> mice not treated with DEN.<br />

No HCC was positive f<strong>or</strong> the Y chromosome by FISH.<br />

CONCLUSION: Hepatic stem cells derived from the bone<br />

marrow stromal cells have a low malignant potential in<br />

our mouse model <strong>of</strong> chemical hepatocarcinogenesis.<br />

© 2008 WJG . All rights reserved.<br />

LIVER CANCER<br />

Key w<strong>or</strong>ds: Bone marrow stromal cell; Stem cell;<br />

Hepatocarcinogenesis; Animal study<br />

Peer reviewers: T<strong>or</strong>u Hiyama, MD, Department <strong>of</strong> Health<br />

Service Center, Hiroshima University, 1-7-1 Kagamiyama,<br />

Hiagshihiroshima 7398521, Japan; Jean Rosenbaum, MD, Inserm<br />

E362, Universite Vict<strong>or</strong> Segalen B<strong>or</strong>deaux 2, B<strong>or</strong>deaux 33076,<br />

France<br />

Zheng JF, Liang LJ. Transplanted bone marrow stromal cells are<br />

not cellular <strong>or</strong>igin <strong>of</strong> hepatocellular carcinomas in a mouse model<br />

<strong>of</strong> carcinogenesis. W<strong>or</strong>ld J Gastroenterol 2008; 14(19): 3015-3020<br />

Available from: URL: http://www.wjgnet.com/1007-9327/14/3015.<br />

asp DOI: http://dx.doi.<strong>or</strong>g/10.3748/wjg.14.3015<br />

INTRODUCTION<br />

Hepatocellular carcinoma (HCC) is the fifth most common<br />

cancer in the w<strong>or</strong>ld [1] . Hepatitis B <strong>or</strong> C virus can induce<br />

chronic hepatitis and potentially result in liver cirrhosis and<br />

HCC, and these viral infections are frequently seen among<br />

HCC patients [2] . However, there is no clear <strong>evidence</strong> as<br />

to which cell is directly involved in the development <strong>of</strong><br />

HCCs [3-5] . Two cell lineages have been considered as candidates:<br />

the first is hepatic stem cell, and the second is mature<br />

hepatocyte.<br />

Oval cells are small, oval shaped epithelial cells identified<br />

as hepatic stem cells in the adult liver only following<br />

severe, repetitive liver injury [6] . There are increasing <strong>evidence</strong>s<br />

that oval cells are the cellular targets f<strong>or</strong> transf<strong>or</strong>mation<br />

in the development <strong>of</strong> HCC [7-8] . Oval cells might<br />

give rise to HCC as a result <strong>of</strong> the arrest <strong>of</strong> stem cell<br />

maturation [9] . Previous studies indicated that bone marrow<br />

cells can differentiate into oval cells in rodents and that a<br />

similar process could possibly take place in humans [10,11] .<br />

The incidence <strong>of</strong> plasticity has been shown to be very variable,<br />

from extremely rare to a range from 20% to 40% [12,13] .<br />

Although there is still controversy about which part <strong>of</strong><br />

bone marrow cells can differentiate into hepatocytes,<br />

the present study clearly shows that transplanted bone<br />

marrow cells may help rest<strong>or</strong>e the hepatic degenerative<br />

diseases and reduce CCl4-induced liver fibrosis [14] . Some<br />

studies readily demonstrated bone marrow stromal cells<br />

(BMSCs) differentiated into hepatocyte-like cells in culture<br />

www.wjgnet.com

---

3016 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

after HGF treatment in vitro [15] . Theref<strong>or</strong>e, BMSCs could<br />

be a valuable strategy f<strong>or</strong> future replacement therapy <strong>of</strong><br />

damaged <strong>or</strong> malfunctioned hepatocytes, because getting<br />

autologous BMSCs is easier than obtaining other tissuespecific<br />

stem cells. However, the safety and efficacy <strong>of</strong><br />

hepatic stem cells derived from bone marrow cells should<br />

be adequately confirmed bef<strong>or</strong>e any such therapies are<br />

tested in humans.<br />

Our aim was to study the malignant potential <strong>of</strong> hepatic<br />

stem cells derived from BMSCs in vivo. To identify<br />

hepatic stem cells, BMSCs <strong>of</strong> male mice were transplanted<br />

into recipient female mice. After BMSCs transplantation,<br />

HCC was induced in the recipients by chemical hepatocarcinogenic<br />

compounds and the presence <strong>of</strong> the Y chromosome<br />

was evaluated in HCC.<br />

MATERIALS AND METHODS<br />

Animals<br />

Six to eight week old BALB/c mice were purchased from<br />

the Animal Breeding Center <strong>of</strong> Sun Yat-Sen University<br />

(Guangzhou, China). Mice were bred and maintained in an<br />

air-conditioned animal house with specific pathogen-free<br />

conditions, using an alternate 12 h cycle <strong>of</strong> daylight and<br />

darkness, and unlimited access to chow and water. All animal<br />

experiments were perf<strong>or</strong>med in acc<strong>or</strong>dance with the<br />

guidelines <strong>of</strong> the Animal Care and Use Committee <strong>of</strong> Sun<br />

Yat-Sen University.<br />

Isolation and culture <strong>of</strong> bone marrow stromal cells (BMSCs)<br />

BMSCs were harvested from bone marrow <strong>of</strong> the femurs<br />

and tibias <strong>of</strong> male mice by inserting a 21-gauge needle into<br />

the shaft <strong>of</strong> the bone and flushing it with DMEM medium<br />

supplemented with heparin [16] . The cell suspension was<br />

centrifuged over a Ficoll step gradient (density 1.077 g/mL)<br />

(Sigma, St. Louis, MO) at 1500 r/min f<strong>or</strong> 10 min. The<br />

interface fraction was then collected and cultured in<br />

DMEM medium, supplemented with 10% fetal bovine<br />

serum, 2 mmol/L L-glutamine, 100 U/mL penicillin, and<br />

100 μg/mL streptomycin. Isolated cells were grown at<br />

37℃ and 5% CO2 f<strong>or</strong> 3 d. After removing the suspended<br />

cells, the adherent BMSCs were grown to 90% confluence<br />

and used between passages 3 and 4. After serum starvation<br />

f<strong>or</strong> 4 h, BMSCs were treated with human recombinant<br />

HGF (Sigma-Aldrich, USA) at a concentration <strong>of</strong> 50 μg/L.<br />

Cultures were maintained by media exchange every 3 d.<br />

On d 21, all cells were detached f<strong>or</strong> the next experiment.<br />

The above detached cells were coated on the glass<br />

slides and fixed with 4% paraf<strong>or</strong>maldehyde f<strong>or</strong> 10 min<br />

at room temperature, followed by methanol f<strong>or</strong> 2 min<br />

at -20℃, and permeabilized with 0.1% Triton X-100 f<strong>or</strong><br />

10 min. Slides were blocked f<strong>or</strong> 30 min using blocking<br />

and diluent solution, then incubated with rabbit anti-αfetoprotein<br />

antibody <strong>or</strong> goat anti-albumin antibody at<br />

4℃ overnight. The cells were reincubated sequentially<br />

f<strong>or</strong> 30 min with FITC-conjugated secondary antibody<br />

<strong>or</strong> PE-conjugated secondary antibody. The slides were<br />

counterstained with 4′,6-diamidino-2-phenylindole (DAPI,<br />

Sigma) bef<strong>or</strong>e mounting and observed under flu<strong>or</strong>escence<br />

microscope.<br />

www.wjgnet.com<br />

Transplantation <strong>of</strong> BMSCs<br />

BMSCs were harvested after cultured f<strong>or</strong> passages 3 <strong>or</strong><br />

4 and suspended in DMEM medium supplemented with<br />

penicillin/streptomycin. BMSCs were washed twice in<br />

DMEM medium bef<strong>or</strong>e intrap<strong>or</strong>tal injection. Cell viability<br />

(> 95%) was measured by trypan blue dye exclusion.<br />

Anesthesia was perf<strong>or</strong>med with ether and partial hepatectomy<br />

used the standard method f<strong>or</strong> two-thirds resection<br />

[17] . Briefly, after ligation <strong>of</strong> the pedicule and resection<br />

<strong>of</strong> the two largest lobes (median and left), the remaining<br />

liver was composed <strong>of</strong> the caudate and epiploic lobes.<br />

BMSCs were injected into the female liver via the superi<strong>or</strong><br />

mesenteric vein using insulin syringes after hepatectomy [18] .<br />

A total <strong>of</strong> 10 6 cells were injected per mouse.<br />

Diethylnitrosamine(DEN)-induced hepatocarcinogenesis<br />

After partial hepatectomy and BMSCs injection, mice were<br />

allowed to recover f<strong>or</strong> one week. Thereafter, DEN (Sigma)<br />

was continuously administered f<strong>or</strong> 12 wk through drinking<br />

water at a final concentration <strong>of</strong> 100 μg/L to induce hepatocarcinogenesis<br />

[3] .<br />

Sixty female BALB/c mice were randomly assigned<br />

to three groups. Ten mice in the n<strong>or</strong>mal control group<br />

were given BMSCs and non-supplemented drinking water.<br />

Twenty-five mice in the model group were continuously<br />

administered DEN in the drinking water. Twenty-five mice<br />

in the experimental group received BMSCs and DEN. The<br />

animals were sacrificed at 6 mo after the carcinogen regimen<br />

and the livers were fixed in 10% f<strong>or</strong>malin f<strong>or</strong> 24 h<br />

and embedded with paraffin. Routine histology was perf<strong>or</strong>med<br />

with haematoxylin-eosin staining. Serial sections<br />

were cut from liver samples with the macroscopically visible<br />

liver tum<strong>or</strong>s and the right lobe f<strong>or</strong> pathologic examination.<br />

Liver histopathology<br />

To identify characteristics <strong>of</strong> tum<strong>or</strong>s in the liver after<br />

BMSCs transplantation and DNE administration, placental<br />

f<strong>or</strong>m <strong>of</strong> glutathione-S-transferase (GST-P), α-fetoprotein,<br />

and cytokeratin 19 were assayed immunohistochemically<br />

f<strong>or</strong> these tum<strong>or</strong> nodules as previously described [19] .<br />

Briefly, after being deparaffinized with xylene, quenched<br />

with hydrogen peroxide and blocked with n<strong>or</strong>mal serum,<br />

the liver tissue sections were incubated f<strong>or</strong> 1 h with rabbit<br />

anti-α-fetoprotein polyclonal antibody (dilution 1:100;<br />

Santa Cruz, USA), goat anti-cytokeratin 19 monoclonal<br />

antibody (dilution 1:100; Santa Cruz), <strong>or</strong> goat anti-GST-P<br />

polyclonal antibody (dilution 1:1000; Stressgen, Canada).<br />

FITC-conjugated secondary antibody <strong>or</strong> PE-conjugated<br />

secondary antibody was added. Counterstaining <strong>of</strong> nuclei<br />

was perf<strong>or</strong>med with DAPI f<strong>or</strong> flu<strong>or</strong>escence staining.<br />

Flu<strong>or</strong>escent in situ hybridization (FISH)<br />

Because BMSCs transplantation was perf<strong>or</strong>med from male<br />

don<strong>or</strong> mice to female recipient mice, the transplanted<br />

bone marrow derived cells could be recognized in the<br />

recipient by the presence <strong>of</strong> the Y chromosome in the<br />

nucleus. Theref<strong>or</strong>e, FISH f<strong>or</strong> the mouse Y chromosome<br />

was conducted to detect the transplanted bone marrow derived<br />

cells acc<strong>or</strong>ding to the Cambio protocol (http://www.

---

A<br />

C<br />

Zheng JF et al . HCC from bone marrow cell 3017<br />

cambio.co.uk/). Paraffin-embedded slides were deparaffinized<br />

by baking in an oven overnight at 37℃ and cleared<br />

in xylene three times f<strong>or</strong> 10 min each; and they were then<br />

dehydrated and air-dried. Sections were incubated in<br />

1 mol/L sodium thiocyanate f<strong>or</strong> 10 min at 80℃, washed in<br />

PBS, and digested in pepsin (0.4% w/v) in 0.1 mol/L HCl<br />

at 37℃ f<strong>or</strong> 10 min. The protease was quenched in glycine<br />

(0.2% v/w) in 2 × PBS, post-fixed in paraf<strong>or</strong>maldehyde (4%<br />

w/v) in PBS, dehydrated through graded alcohols and airdried.<br />

A flu<strong>or</strong>escein isothiocyanate (FITC)-labeled Y-chromosome<br />

paint (Cambio, Cambridge, UK) was added to<br />

the sections, sealed under glass with rubber cement, heated<br />

to 80℃ f<strong>or</strong> 10 min, and incubated overnight at 37℃. The<br />

slides were washed in f<strong>or</strong>mamide (50% w/v)/2 × saline<br />

sodium citrate (SSC) at 37℃, washed with 2 × SSC and<br />

4 × SSC/Tween-20 (0.05% w/v) at 37℃. The slides were<br />

rinsed in 0.5 × SSC at 37℃. FITC amplification kit (Cambio)<br />

was used to amplify flu<strong>or</strong>escence signal. The slides were<br />

counterstained with DAPI bef<strong>or</strong>e mounting and observed<br />

under confocal microscope (Zeiss, German).<br />

Statistical analysis<br />

Data were presented as mean ± SD. Significant differences<br />

were determined using ANOVA in SPSS10.0. P < 0.05 was<br />

considered statistically significant.<br />

RESULTS<br />

Differentiation <strong>of</strong> BMSCs into hepatocytes in vitro<br />

To confir m the differentiation <strong>of</strong> BMSCs into<br />

hepatocytes, we selected cultural BMSCs with <strong>or</strong><br />

without treatment <strong>of</strong> HGF f<strong>or</strong> 21 d in culture and<br />

examined the expression <strong>of</strong> α-fetoprotein and<br />

albumin by immun<strong>of</strong>lu<strong>or</strong>escence. We found that<br />

B<br />

D<br />

F i g u r e 1 I m m u n o f l u o r e s c e n c e o f<br />

α-fetoprotein and albumin in bone marrow<br />

stromal cells, with <strong>or</strong> without treatment <strong>of</strong><br />

HGF in culture (× 400). A: α-fetoprotein<br />

expression was negative in the absence <strong>of</strong><br />

HGF; B: Albumin expression was negative<br />

in the absence <strong>of</strong> HGF; C: α-fetoprotein<br />

expression localized at the cytoplasm<br />

in hepatocyte-like BMSCs; D: Albumin<br />

expression localized at the cytoplasm in<br />

hepatocyte-like BMSCs.<br />

cultural BMSCs without treatment <strong>of</strong> HGF could not<br />

express α-fetoprotein and albumin (Figure 1A and B),<br />

while differentiated hepatocyte-like BMSCs with<br />

treatment <strong>of</strong> HGF expressed α-fetoprotein and albumin<br />

(Figure 1C and D).<br />

Survival rate<br />

We evaluated the survival rate <strong>of</strong> mice that underwent<br />

BMSCs transplantation and/<strong>or</strong> DEN treatment. All mice<br />

that underwent BMSCs transplantation were still alive at<br />

the end <strong>of</strong> the study. Thirteen (26.0%) <strong>of</strong> 50 mice induced<br />

with DEN survived at the end <strong>of</strong> the 6-month study period,<br />

including six mice in the model group and seven in<br />

the experimental group. The survival rates were similar<br />

between the model group and the experimental group<br />

(P > 0.05).<br />

Tum<strong>or</strong> development in the livers <strong>of</strong> recipient mice<br />

All <strong>of</strong> the survived recipient mice developed multiple<br />

HCCs. Thirteen mice developed HCCs including six mice<br />

in the model group and seven mice in the experiment<br />

group. These tum<strong>or</strong>s were evenly distributed among the<br />

liver lobes <strong>of</strong> mice. The average sizes <strong>of</strong> hepatic tum<strong>or</strong>s<br />

were not different between the two groups (4.8 ± 1.5 mm<br />

vs 4.4 ± 1.1 mm; P > 0.05).<br />

HE stained sections <strong>of</strong> these tum<strong>or</strong>s confirmed to be<br />

HCCs (Figure 2A) expressed GST-P and α-fetoprotein<br />

(Figure 2B and C), but not Cytokeratin 19 (Figure 2D). No<br />

other types <strong>of</strong> liver tum<strong>or</strong>s, such as hepatoblastoma <strong>or</strong> cholangiocellular<br />

carcinoma, were noted in our experiment.<br />

Repopulation and carcinogenesis <strong>of</strong> transplanted BMSCs<br />

To follow the repopulation and differentiation <strong>of</strong> BMSCs,<br />

we transplanted male BMSCs into the liver <strong>of</strong> n<strong>or</strong>mal and<br />

www.wjgnet.com

---

A<br />

C<br />

A<br />

C<br />

3018 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

Figure 3 Repopulation and carcinogenesis <strong>of</strong> male bone marrow-derived cells<br />

in female recipient liver tissues by FISH f<strong>or</strong> Y chromosome (× 400). A: n<strong>or</strong>mal<br />

male liver, positive Y-chromosome signals appeared as green dots in the nuclei<br />

stained with DAPI, a chromosomal marker that appears as blue flu<strong>or</strong>escence; B:<br />

Six months after BMSCs transplantation and DEN treatment, some <strong>of</strong> hepatocyte<br />

nuclei were positive f<strong>or</strong> the Y chromosome in the liver <strong>of</strong> female recipients; C: Six<br />

months after BMSCs transplantation without DEN treatment, none <strong>of</strong> hepatocyte<br />

nuclei was positive f<strong>or</strong> Y chromosome in the liver <strong>of</strong> female recipients; D: HCC was<br />

negative f<strong>or</strong> Y chromosome in nucleus.<br />

DEN-treated female mice. FISH was perf<strong>or</strong>med to detect<br />

Y chromosome in the female recipients. A positive FISH<br />

signal was detected in the nucleus which was confirmed<br />

www.wjgnet.com<br />

B<br />

D<br />

B<br />

D<br />

by counterstaining with DAPI. In male mouse liver,<br />

which served as positive control, most <strong>of</strong> the cells stained<br />

positive f<strong>or</strong> Y-chromosome with flu<strong>or</strong>escein signal in the<br />

nuclei (Figure 3A).<br />

We found that male BMSCs infused via p<strong>or</strong>tal vein into<br />

female syngeneic mouse liver could engraft and differentiate<br />

into hepatocytes after induction with DEN using FISH<br />

f<strong>or</strong> Y chromosome. Six months after BMSCs transplantation<br />

and DEN challenge, FISH revealed that 15% <strong>of</strong> hepatocyte<br />

nuclei were positive f<strong>or</strong> the Y chromosome in the<br />

liver <strong>of</strong> female recipients (Figure 3B). In addition, no nucleus<br />

showed two <strong>or</strong> m<strong>or</strong>e signals. However, don<strong>or</strong>-derived<br />

cells were not detected when BMSCs were transplanted<br />

to n<strong>or</strong>mal recipients without DEN treatment (Figure 3C).<br />

M<strong>or</strong>eover, no HCC was positive f<strong>or</strong> the Y chromosome by<br />

FISH (Figure 3D).<br />

DISCUSSION<br />

F i g u r e 2 H i s t o p a t h o l o g i c a l<br />

analysis <strong>of</strong> the tum<strong>or</strong>s in the liver<br />

serial sections <strong>of</strong> recipient mice<br />

after 6 mo <strong>of</strong> DEN treatment<br />

(× 400). A: HCC nodules deve-<br />

lopment at 6 mo stained with<br />

haematoxylin-eosin; B: HCC<br />

expressing GST-P appeared as<br />

red flu<strong>or</strong>escence by immun<strong>of</strong>lu<strong>or</strong>escence;<br />

C: HCC expressing<br />

α-fetoprotein appeared as green<br />

flu<strong>or</strong>escence by immun<strong>of</strong>lu<strong>or</strong>escence;<br />

D: HCC was negative<br />

f<strong>or</strong> cytokeratin 19 by immun<strong>of</strong>lu<strong>or</strong>escence.<br />

The liver is classified as a conditionally renewing tissue<br />

and hepatocytes proliferate quiescently and hepatic stem<br />

cells are not needed under n<strong>or</strong>mal circumstances. Oval<br />

cells reside within <strong>or</strong> adjacent to the canals <strong>of</strong> Hering and<br />

comprise a quiescent compartment <strong>of</strong> d<strong>or</strong>mant stem cells<br />

in adult livers [6] . They can be activated to proliferate and<br />

differentiate into hepatocytes <strong>or</strong> bile duct epithelial cells<br />

when there is severe hepatic liver damage and coexistent<br />

impaired hepatocyte regeneration.<br />

Accumulated <strong>evidence</strong> indicates that bone marrow<br />

cells can differentiate into specific cell types [20] . It has<br />

been rep<strong>or</strong>ted that 30%-50% liver regeneration with bone<br />

marrow-derived cells in the FAH mouse model <strong>of</strong>fers a<br />

selective proliferative advantage in the transplanted cells [21] .<br />

Bone marrow-derived hepatocytes may <strong>or</strong>iginate from the

---

Zheng JF et al . HCC from bone marrow cell 3019<br />

mesenchymal compartment, rather than the hematopoietic<br />

compartment [22] . However, other data demonstrate<br />

that bone marrow-derived hepatocyte is only a possible<br />

but rare event, even in the presence <strong>of</strong> very strong selection<br />

pressure [23] . Several rep<strong>or</strong>ts have demonstrated that<br />

cell fusion is the principal source <strong>of</strong> bone marrow-derived<br />

hepatocytes [24] , and bone marrow-derived hepatocytes<br />

are primarily <strong>of</strong> mature myelomonocytic cells which fuse<br />

spontaneously with host hepatocytes producing functional<br />

liver repopulation [14] .<br />

The identity <strong>of</strong> the specific cell types that differentiate<br />

to express hepatocyte characteristics remains undetermined.<br />

BMSCs comprise marrow stromal stem cells, sharing<br />

characteristics with other multi-potent stem cells such<br />

as neural stem cells and hematopoietic stem cells, because<br />

they possess the capability <strong>of</strong> self-renewal and progeny<br />

differentiation potentials [25] . Our study demonstrates that<br />

cultured BMSCs differentiated hepatocyte-like cells which<br />

expressed α-fetoprotein and albumin with the treatment<br />

<strong>of</strong> HGF in vitro. After BMSCs transplantation, Y chromosome<br />

positive cells appeared only in mice treated with<br />

DEN and not in mice who did not receive DEN. These<br />

results suggest that in our model, BMSCs can differentiate<br />

into hepatocytes under limited conditions. Bone marrowderived<br />

hepatic stem cells seem not to be required f<strong>or</strong> n<strong>or</strong>mal<br />

hepatocyte substitution. Indeed, in the present study,<br />

we found that in positive hepatocytes, no nucleus had two<br />

<strong>or</strong> m<strong>or</strong>e Y chromosomes by FISH. This finding indicates<br />

that transdifferentiation, rather than cell fusion, was the<br />

main process in our model.<br />

DEN is a DNA alkylating agent that is rapidly metabolized<br />

to reactive metabolites. These metabolites interact<br />

with DNA to f<strong>or</strong>m various DNA adducts, leading to<br />

genetic alterations [26] . GST-P is a highly expressed cytoplasmic<br />

protein during early and late steps <strong>of</strong> carcinogenesis<br />

and GST-P sensitivity is higher than that <strong>of</strong> other<br />

enzymes f<strong>or</strong> the detection <strong>of</strong> malignant transf<strong>or</strong>mation [27] .<br />

Seventy percent <strong>of</strong> HCCs were stained positively f<strong>or</strong><br />

α-fetoprotein in clinical cases. In our study, chronic exposure<br />

to DEN caused multiple HCCs. These HCCs express<br />

GST-P and α-fetoprotein, but not cytokeratin 19 which<br />

was expressed in cholangiocellular carcinoma.<br />

In this study, we focused our interest on the <strong>or</strong>iginal cell<br />

lineage <strong>of</strong> carcinogenesis. There are two maj<strong>or</strong> nonexclusive<br />

hypotheses <strong>of</strong> the cellular <strong>or</strong>igin <strong>of</strong> cancer: from stem cells<br />

due to maturation arrest <strong>or</strong> from dedifferentiation <strong>of</strong> mature<br />

cells. Debate has centered on whether hepatocytes are<br />

responsible f<strong>or</strong> HCCs through dedifferentiation, <strong>or</strong> whether<br />

oval cells are the prime target f<strong>or</strong> malignant changes after a<br />

differential “block” [3,5] . Oval cells are possibly involved in hepatocarcinogenesis<br />

<strong>based</strong> on the followings: (1) massive existence<br />

<strong>of</strong> oval cells in an animal rodent hepatocarcinogenic<br />

model [28] ; (2) development <strong>of</strong> HCC after transf<strong>or</strong>mation <strong>of</strong><br />

oval cells [8] ; and (3) occurrence <strong>of</strong> mixed hepatocellular and<br />

cholangiocarcinomatous tum<strong>or</strong>s (oval cell exhibits bipotential<br />

developmental ability) [29] . However, the relationship between<br />

oval cells and cancer is only circumstantial. In this study,<br />

no HCC was positive f<strong>or</strong> Y chromosome after long-term<br />

carcinogenic induction. However, as all hepatic stem cells<br />

might not be labeled by our method as mentioned above, we<br />

cannot completely exclude the stem cell the<strong>or</strong>y. Although<br />

our results may be limited to BMSCs transplanted mice<br />

treated with DEN, we can state that the malignant potential<br />

<strong>of</strong> the hepatic stem cell derived from bone marrow seems<br />

to be low. Further studies are needed to clarify the precise<br />

interaction <strong>of</strong> bone marrow cells with hepatic regeneration<br />

and carcinogenesis using other animal models <strong>or</strong> human<br />

studies.<br />

In conclusion, our study demonstrates that cultured<br />

BMSCs could differentiate hepatocyte-like cells with HGF<br />

treatment in vitro. BMSCs can differentiate into hepatocytes<br />

in our model. Hepatic stem cells derived from bone<br />

marrow stromal cells are not cellular <strong>or</strong>igin <strong>of</strong> hepatocellular<br />

carcinomas in the DEN model <strong>of</strong> carcinogenesis.<br />

Bone marrow cells may potentially be used in cell <strong>based</strong><br />

replacement therapy <strong>or</strong> gene delivery systems. Under these<br />

circumstances, our results indicate that hepatic stem cell<br />

therapy derived from bone marrow is safe.<br />

ACKNOWLEDGMENTS<br />

The auth<strong>or</strong>s thank Pr<strong>of</strong>ess<strong>or</strong> Xiu-Qing Xie f<strong>or</strong> help in<br />

histopathology, and the staff <strong>of</strong> Lab<strong>or</strong>at<strong>or</strong>y <strong>of</strong> General<br />

Surgery, the First Affiliated Hospital, Sun Yat-Sen University.<br />

COMMENTS<br />

Background<br />

Bone marrow stromal cells can differentiate into hepatic stem cells in rodents and<br />

in humans. Bone marrow stromal cells could be a valuable strategy f<strong>or</strong> future<br />

replacement therapy <strong>of</strong> damaged <strong>or</strong> malfunctioned hepatocytes, because getting<br />

autologous bone marrow cells is easier than obtaining other tissue-specific stem<br />

cells. However, the safety and efficacy <strong>of</strong> hepatic stem cells derived from bone<br />

marrow stromal cells should be adequately confirmed bef<strong>or</strong>e any such therapies<br />

are tested in humans.<br />

Research frontiers<br />

There are two maj<strong>or</strong> nonexclusive hypotheses <strong>of</strong> the cellular <strong>or</strong>igin <strong>of</strong> cancer:<br />

from stem cells due to maturation arrest <strong>or</strong> from dedifferentiation <strong>of</strong> mature cells.<br />

Debate has centered on whether hepatocytes are responsible f<strong>or</strong> hepatocellular<br />

carcinoma (HCC) through a process <strong>of</strong> dedifferentiation, <strong>or</strong> whether oval cells<br />

are the prime target f<strong>or</strong> malignant changes after a differential “block”. There are<br />

increasing <strong>evidence</strong>s that oval cells are the cellular targets f<strong>or</strong> transf<strong>or</strong>mation in<br />

the development <strong>of</strong> HCC. Accumulating <strong>evidence</strong>s indicate that bone marrow cells<br />

can differentiate into specific cell types. It has been rep<strong>or</strong>ted that 30%-50% liver<br />

regeneration with bone marrow-derived cells in the FAH mouse model <strong>of</strong>fers a<br />

selective proliferative advantage in the transplanted cells. Bone marrow-derived<br />

hepatocytes may <strong>or</strong>iginate from the mesenchymal compartment, rather than the<br />

hematopoietic compartment.<br />

Innovations and breakthroughs<br />

This study demonstrates that cultured bone marrow stromal cells could differentiate<br />

hepatocyte-like cells in vitro. Bone marrow stromal cells can differentiate into<br />

hepatocytes. Hepatic stem cells derived from bone marrow stromal cells are not<br />

cellular <strong>or</strong>igin <strong>of</strong> hepatocellular carcinomas in a mouse model <strong>of</strong> carcinogenesis.<br />

Bone marrow cells may potentially be used in cell <strong>based</strong> replacement therapy <strong>or</strong><br />

gene delivery systems. The results in this study indicate that hepatic stem cell<br />

therapy derived from bone marrow is safe.<br />

Applications<br />

Bone marrow stromal cells might be applicable f<strong>or</strong> future replacement therapy <strong>of</strong><br />

damaged <strong>or</strong> malfunctioned hepatocytes.<br />

Peer review<br />

This paper is interesting and the study appears well conducted. The conclusions,<br />

although <strong>of</strong> a limited scope given the design <strong>of</strong> the study, are in agreement with<br />

the results.<br />

www.wjgnet.com

---

3020 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

REFERENCES<br />

1 Kao JH, Chen DS. Changing disease burden <strong>of</strong> hepatocellular<br />

carcinoma in the Far East and Southeast Asia. Liver Int 2005; 25:<br />

696-703<br />

2 Perz JF, Armstrong GL, Farrington LA, Hutin YJ, Bell BP.<br />

The contributions <strong>of</strong> hepatitis B virus and hepatitis C virus<br />

infections to cirrhosis and primary liver cancer w<strong>or</strong>ldwide. J<br />

Hepatol 2006; 45: 529-538<br />

3 Bralet MP, Pichard V, Ferry N. Demonstration <strong>of</strong> direct<br />

lineage between hepatocytes and hepatocellular carcinoma in<br />

diethylnitrosamine-treated rats. Hepatology 2002; 36: 623-630<br />

4 Gournay J, Auvigne I, Pichard V, Ligeza C, Bralet MP,<br />

Ferry N. In vivo cell lineage analysis during chemical<br />

hepatocarcinogenesis in rats using retroviral-mediated gene<br />

transfer: <strong>evidence</strong> f<strong>or</strong> dedifferentiation <strong>of</strong> mature hepatocytes.<br />

Lab Invest 2002; 82: 781-788<br />

5 Lee JS, Heo J, Libbrecht L, Chu IS, Kaposi-Novak P, Calvisi<br />

DF, Mikaelyan A, Roberts LR, Demetris AJ, Sun Z, Nevens<br />

F, Roskams T, Th<strong>or</strong>geirsson SS. A novel prognostic subtype<br />

<strong>of</strong> human hepatocellular carcinoma derived from hepatic<br />

progenit<strong>or</strong> cells. Nat Med 2006; 12: 410-416<br />

6 K<strong>of</strong>man AV, M<strong>or</strong>gan G, Kirschenbaum A, Osbeck J, Hussain<br />

M, Swenson S, Theise ND. Dose- and time-dependent oval<br />

cell reaction in acetaminophen-induced murine liver injury.<br />

Hepatology 2005; 41: 1252-1261<br />

7 Yamamoto T, Uenishi T, Ogawa M, Ichikawa T, Hai S, Sakabe K,<br />

Tanaka S, Kato H, Mikami S, Ikebe T, Tanaka H, Ito S, Kaneda<br />

K, Hirohashi K, Kubo S. Immunohistologic attempt to find<br />

carcinogenesis from hepatic progenit<strong>or</strong> cell in hepatocellular<br />

carcinoma. Dig Surg 2005; 22: 364-370<br />

8 Dumble ML, Croager EJ, Yeoh GC, Quail EA. Generation and<br />

characterization <strong>of</strong> p53 null transf<strong>or</strong>med hepatic progenit<strong>or</strong><br />

cells: oval cells give rise to hepatocellular carcinoma.<br />

Carcinogenesis 2002; 23: 435-445<br />

9 Dumble ML, Knight B, Quail EA, Yeoh GC. Hepatoblastlike<br />

cells populate the adult p53 knockout mouse liver:<br />

<strong>evidence</strong> f<strong>or</strong> a hyperproliferative maturation-arrested stem cell<br />

compartment. Cell Growth Differ 2001; 12: 223-231<br />

10 Lagasse E, Conn<strong>or</strong>s H, Al-Dhalimy M, Reitsma M, Dohse<br />

M, Osb<strong>or</strong>ne L, Wang X, Finegold M, Weissman IL, Grompe<br />

M. Purified hematopoietic stem cells can differentiate into<br />

hepatocytes in vivo. Nat Med 2000; 6: 1229-1234<br />

11 Petersen BE, Bowen WC, Patrene KD, Mars WM, Sullivan AK,<br />

Murase N, Boggs SS, Greenberger JS, G<strong>of</strong>f JP. Bone marrow<br />

as a potential source <strong>of</strong> hepatic oval cells. Science 1999; 284:<br />

1168-1170<br />

12 Wagers AJ, Sherwood RI, Christensen JL, Weissman IL. Little<br />

<strong>evidence</strong> f<strong>or</strong> developmental plasticity <strong>of</strong> adult hematopoietic<br />

stem cells. Science 2002; 297: 2256-2259<br />

13 Theise ND, Wilmut I. Cell plasticity: flexible arrangement.<br />

Nature 2003; 425: 21<br />

14 Sakaida I, Terai S, Yamamoto N, Aoyama K, Ishikawa T,<br />

Nishina H, Okita K. Transplantation <strong>of</strong> bone marrow cells<br />

reduces CCl4-induced liver fibrosis in mice. Hepatology 2004; 40:<br />

1304-1311<br />

15 Wang PP, Wang JH, Yan ZP, Hu MY, Lau GK, Fan ST, Luk<br />

JM. Expression <strong>of</strong> hepatocyte-like phenotypes in bone marrow<br />

stromal cells after HGF induction. Biochem Biophys Res Commun<br />

www.wjgnet.com<br />

2004; 320: 712-716<br />

16 Luk JM, Wang PP, Lee CK, Wang JH, Fan ST. Hepatic potential<br />

<strong>of</strong> bone marrow stromal cells: development <strong>of</strong> in vitro coculture<br />

and intra-p<strong>or</strong>tal transplantation models. J Immunol<br />

Methods 2005; 305: 39-47<br />

17 Oertel M, Rosencrantz R, Chen YQ, Thota PN, Sandhu JS,<br />

Dabeva MD, Pacchia AL, Adelson ME, Dougherty JP, Shafritz<br />

DA. Repopulation <strong>of</strong> rat liver by fetal hepatoblasts and<br />

adult hepatocytes transduced ex vivo with lentiviral vect<strong>or</strong>s.<br />

Hepatology 2003; 37: 994-1005<br />

18 Kushida T, Inaba M, Hisha H, Ichioka N, Esumi T, Ogawa R,<br />

Iida H, Ikehara S. Crucial role <strong>of</strong> don<strong>or</strong>-derived stromal cells<br />

in successful treatment f<strong>or</strong> intractable autoimmune diseases in<br />

mrl/lpr mice by bmt via p<strong>or</strong>tal vein. Stem Cells 2001; 19: 226-235<br />

19 Vig P, Russo FP, Edwards RJ, Tadrous PJ, Wright NA, Thomas<br />

HC, Alison MR, F<strong>or</strong>bes SJ. The sources <strong>of</strong> parenchymal<br />

regeneration after chronic hepatocellular liver injury in mice.<br />

Hepatology 2006; 43: 316-324<br />

20 Alison MR, Poulsom R, Jeffery R, Dhillon AP, Quaglia A, Jacob<br />

J, Novelli M, Prentice G, Williamson J, Wright NA. Hepatocytes<br />

from non-hepatic adult stem cells. Nature 2000; 406: 257<br />

21 Jang YY, Collect<strong>or</strong> MI, Baylin SB, Diehl AM, Sharkis SJ.<br />

Hematopoietic stem cells convert into liver cells within days<br />

without fusion. Nat Cell Biol 2004; 6: 532-539<br />

22 Jiang Y, Jahagirdar BN, Reinhardt RL, Schwartz RE, Keene<br />

CD, Ortiz-Gonzalez XR, Reyes M, Lenvik T, Lund T, Blackstad<br />

M, Du J, Aldrich S, Lisberg A, Low WC, Largaespada DA,<br />

Verfaillie CM. Pluripotency <strong>of</strong> mesenchymal stem cells derived<br />

from adult marrow. Nature 2002; 418: 41-49<br />

23 Kanazawa Y, Verma IM. Little <strong>evidence</strong> <strong>of</strong> bone marrowderived<br />

hepatocytes in the replacement <strong>of</strong> injured liver. Proc<br />

Natl Acad Sci USA 2003; 100 Suppl 1: 11850-11853<br />

24 Wang X, Willenbring H, Akkari Y, T<strong>or</strong>imaru Y, Foster M, Al-<br />

Dhalimy M, Lagasse E, Finegold M, Olson S, Grompe M.<br />

Cell fusion is the principal source <strong>of</strong> bone-marrow-derived<br />

hepatocytes. Nature 2003; 422: 897-901<br />

25 Mangi AA, Noiseux N, Kong D, He H, Rezvani M, Ingwall JS,<br />

Dzau VJ. Mesenchymal stem cells modified with Akt prevent<br />

remodeling and rest<strong>or</strong>e perf<strong>or</strong>mance <strong>of</strong> infarcted hearts. Nat<br />

Med 2003; 9: 1195-1201<br />

26 Kagawa M, Sano T, Ishibashi N, Hashimoto M, Okuno<br />

M, M<strong>or</strong>iwaki H, Suzuki R, Kohno H, Tanaka T. An acyclic<br />

retinoid, NIK-333, inhibits N-diethylnitrosamine-induced<br />

rat hepatocarcinogenesis through suppression <strong>of</strong> TGF-alpha<br />

expression and cell proliferation. Carcinogenesis 2004; 25: 979-985<br />

27 Sakata K, Hara A, Hirose Y, Yamada Y, Kuno T, Katayama M,<br />

Yoshida K, Zheng Q, Murakami A, Ohigashi H, Ikemoto K,<br />

Koshimizu K, Tanaka T, M<strong>or</strong>i H. Dietary supplementation <strong>of</strong> the<br />

citrus antioxidant auraptene inhibits N,N-diethylnitrosamineinduced<br />

rat hepatocarcinogenesis. Oncology 2004; 66: 244-252<br />

28 Choudhury S, Zhang R, Frenkel K, Kawam<strong>or</strong>i T, Chung FL, Roy<br />

R. Evidence <strong>of</strong> alterations in base excision repair <strong>of</strong> oxidative<br />

DNA damage during spontaneous hepatocarcinogenesis in<br />

Long Evans Cinnamon rats. Cancer Res 2003; 63: 7704-7707<br />

29 Wakasa T, Wakasa K, Shutou T, Hai S, Kubo S, Hirohashi K,<br />

Umeshita K, Monden M. A histopathological study on combined<br />

hepatocellular and cholangiocarcinoma: cholangiocarcinoma<br />

component is <strong>or</strong>iginated from hepatocellular carcinoma.<br />

Hepatogastroenterology 2007; 54: 508-513<br />

S- Edit<strong>or</strong> Zhong XY L- Edit<strong>or</strong> Ma JY E- Edit<strong>or</strong> Liu Y

---

3022 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

in high-risk Asian populations. M<strong>or</strong>eover, two widely used<br />

screening programs demonstrated good sensitivity and<br />

specificity in detection <strong>of</strong> H pyl<strong>or</strong>i infection in Chinese [10,11] ,<br />

theref<strong>or</strong>e the question arises which screening program is<br />

m<strong>or</strong>e cost effective?<br />

This study was aimed to evaluate the clinical and<br />

economic effects associated with no screening, population<strong>based</strong><br />

H pyl<strong>or</strong>i serology screening, and population-<strong>based</strong><br />

13 C-Urea breath test (UBT) in Singap<strong>or</strong>e Chinese males<br />

using a Markov model.<br />

MATERIALS AND METHODS<br />

Model structure<br />

The decision analytical model compared three strategies:<br />

strategy 1, no screening and no eradication therapy;<br />

strategy 2, single serology screening f<strong>or</strong> H pyl<strong>or</strong>i and<br />

treating those tested positive with eradication therapy;<br />

and strategy 3, single screening f<strong>or</strong> H pyl<strong>or</strong>i using the<br />

UBT and treating those tested positive with the same<br />

eradication therapy as used in strategy 2. After the<br />

screening and treatment, both costs and outcomes <strong>of</strong><br />

the strategies were evaluated using a Markov model<br />

(Figure 1) [12,13] , which, from the public healthcare provider’s<br />

perspective, estimated the costs, number <strong>of</strong> gastric cancer<br />

cases prevented, life years saved, and quality-adjusted<br />

life years (QALYs) gained from screening age to death<br />

(either died <strong>of</strong> gastric cancer <strong>or</strong> other causes, <strong>or</strong> achieved<br />

full life expectancy [14] ). The distribution <strong>of</strong> people in the<br />

Markov states bef<strong>or</strong>e the simulation started (i.e. cycle 0) was<br />

determined by the sensitivity and specificity <strong>of</strong> the screening<br />

strategies and prevalence <strong>of</strong> H pyl<strong>or</strong>i infection. The<br />

transition probabilities and c<strong>or</strong>responding plausible ranges<br />

in the model were obtained from a critical review <strong>of</strong> the<br />

published literature on target population where available<br />

(Table 1). Probabilities were converted from available rates<br />

using the f<strong>or</strong>mula recommended [13] .<br />

Sensitivity analyses<br />

One-way sensitivity analyses were conducted by altering<br />

individual variables within the af<strong>or</strong>ementioned ranges.<br />

Based on the one-way sensitivity analyses, we additionally<br />

perf<strong>or</strong>med the best-case and the w<strong>or</strong>st-case analyses,<br />

which included the most optimistic and pessimistic values<br />

f<strong>or</strong> selected key variables.<br />

Incidence and prevalence rates<br />

We evaluated all Singap<strong>or</strong>e Chinese males aged from 35<br />

to 44 as the prevalence <strong>of</strong> H pyl<strong>or</strong>i infection at this age<br />

group increased substantially compared to the younger<br />

age [10,15] . Age-specific H pyl<strong>or</strong>i infection rate, gastric cancer<br />

incidence, and m<strong>or</strong>tality were applied when the coh<strong>or</strong>t<br />

aged in the model [10,16,17] . The relative risk in developing<br />

gastric cancer in H pyl<strong>or</strong>i infected persons compared to<br />

the uninfected was obtained from published literature [3,18] .<br />

Prop<strong>or</strong>tion <strong>of</strong> gastric cancer death among deaths from all<br />

causes was derived from local rep<strong>or</strong>ts [17] . The 1- to 5-year<br />

survival rates were estimated from a large prospective<br />

coh<strong>or</strong>t study in Chinese [19] . Persons who survived f<strong>or</strong> m<strong>or</strong>e<br />

www.wjgnet.com<br />

H pyl<strong>or</strong>i H pyl<strong>or</strong>i<br />

negative positive<br />

H pyl<strong>or</strong>i<br />

eradicated<br />

Death<br />

Gastric<br />

cancer cured<br />

1st yr <strong>of</strong><br />

gastric cancer<br />

2nd yr <strong>of</strong><br />

gastric cancer<br />

3rd yr <strong>of</strong><br />

gastric cancer<br />

4th yr <strong>of</strong><br />

gastric cancer<br />

5th yr <strong>of</strong><br />

gastric cancer<br />

Figure 1 Markov model schematic. H pyl<strong>or</strong>i eradicated referred to the state <strong>of</strong><br />

persons with positive screening test and the infection was successfully eradicated<br />

by the triple therapy.<br />

than 5 years after diagnosis <strong>of</strong> gastric cancer were assumed<br />

to be cured and theref<strong>or</strong>e achieved full life expectancy as<br />

the 5-year survival rate adequately reflected the curative<br />

success <strong>of</strong> gastric cancer treatment [7,20] .<br />

Screening and eradication therapy<br />

The screening strategies included 1 single serology<br />

screening by using enzyme-linked immunos<strong>or</strong>bent<br />

assay (ELISA) with a sensitivity and specificity <strong>of</strong><br />

93% and 79%, respectively (strategy 2) [10] and 1 single<br />

UBT using simple gas chromatograph-mass selective<br />

detect<strong>or</strong> with a sensitivity and specificity <strong>of</strong> 97.9% and<br />

95.8%, respectively (strategy 3) [11] . In both strategies,<br />

persons with positive test f<strong>or</strong> H pyl<strong>or</strong>i (including both<br />

true and false positive) were treated with a triple therapy<br />

(i.e. rabeprazole 20 mg, amoxicillin 1000 mg, clarithromycin<br />

500 mg, all twice a day f<strong>or</strong> 4 d) with an eradication<br />

rate <strong>of</strong> 91% [21,22] . This regimen was specifically chosen<br />

because it is safe and effective with less resistance rate in<br />

patients and is recommended by the Asia-Pacific consensus<br />

conference [23-25] . Persons who stopped the triple therapy<br />

due to side effects <strong>or</strong> did not comply with the regimen<br />

were considered as treatment failure and thus remained<br />

infected. Persons who remained infected despite attempts<br />

at eradication had life expectancies and other outcomes<br />

identical to the infected who did not undergo treatment.<br />

The reinfection rate <strong>of</strong> the persons whose infection had<br />

been successfully eradicated was assumed to be identical<br />

to the persons who had never been infected (i.e. 1%<br />

annually in the base-case analysis) [6,26] . Once the reinfection<br />

occurred, an individual’s gastric cancer risk was considered<br />

the same as that <strong>of</strong> an untreated, infected person <strong>of</strong> the<br />

same age.<br />

An underlying assumption <strong>of</strong> the present study is<br />

that eradication <strong>of</strong> H pyl<strong>or</strong>i infection can reduce only<br />

the certain level <strong>of</strong> excess risk <strong>of</strong> distal gastric cancer<br />

(60% <strong>of</strong> all gastric cancers) [4,27] . We conservatively<br />

assumed that persons cured <strong>of</strong> H pyl<strong>or</strong>i infection will

---

Xie F et al . CEA <strong>of</strong> H pyl<strong>or</strong>i screening 3023<br />

Table 1 Parameter estimates in the base-case analysis<br />

Input variable<br />

Incidence and prevalence rates<br />

Base-case analysis Range Ref.<br />

Age-specific prevalence <strong>of</strong> H pyl<strong>or</strong>i (%) 20.0-43.3 - [10]<br />

Age-specific prevalence <strong>of</strong> gastric cancer per 100 000 3-342 - [17]<br />

Gastric cancer in distal stomach (%) 60 50-80 [7]<br />

Relative risk <strong>of</strong> gastric cancer in persons with H pyl<strong>or</strong>i infection 3.6 2-12 [7]<br />

Age-specific m<strong>or</strong>tality from age <strong>of</strong> 25, per 1000 0.5-50.6 - [16]<br />

Gastric cancer death in deaths from all causes (%) 2.27 2.20-2.33 [14,17]<br />

Survival rate <strong>of</strong> gastric cancer after treatment (%) [19]<br />

1-yr 54.2 51-58<br />

2-yr 41.8 38-45<br />

3-yr 37.9 34-42<br />

4-yr 34.0 30-38<br />

5-yr<br />

Screening and treatment variables (%)<br />

30.5 27-35<br />

H pyl<strong>or</strong>i serology screening sensitivity 93 82-95 [10]<br />

H pyl<strong>or</strong>i serology screening specificity 79 70-92 [10]<br />

H pyl<strong>or</strong>i 13 C-Urea breath test sensitivity 97.9 90-100 [11]<br />

H pyl<strong>or</strong>i 13 C-Urea breath test specificity 95.8 90-100 [11]<br />

Effectiveness <strong>of</strong> H pyl<strong>or</strong>i eradication 92.0 87-98 [21]<br />

Probability <strong>of</strong> adverse effects related to eradication therapy<br />

necessitating medical intervention<br />

2.5 2-5 [6]<br />

Annual H pyl<strong>or</strong>i infection rate 1.0 1-3 [6,26]<br />

Excess gastric cancer risk reduction attributable to H pyl<strong>or</strong>i<br />

eradication<br />

Cost variables (2006USD)<br />

30 0-100 [6]<br />

1<br />

H pyl<strong>or</strong>i serology screening 26 10-50<br />

H pyl<strong>or</strong>i 13 C-urea breath test 83 60-100<br />

H pyl<strong>or</strong>i eradication (triple therapy) 30 20-50<br />

Gastric cancer treatment per annum 4358 328-59 000<br />

Eradication-related adverse effects<br />

Other variables<br />

50 5-100<br />

Annual discount rate f<strong>or</strong> costs and effectiveness (%) 3 0-7 [19,29]<br />

Life expectancy, years<br />

Utility<br />

77 76-80 [14]<br />

H pyl<strong>or</strong>i non-infected 1.00 0.95-1.00 [26]<br />

H pyl<strong>or</strong>i infected 0.90 0.80-1.00 [26]<br />

Gastric cancer 0.38 0.13-0.65 [26]<br />

Triple therapy: Rabeprazole 20 mg, amoxicillin 1000 mg, and clarithromycin 500 mg, twice a day f<strong>or</strong> 4 d. 1 All costs<br />

were estimated from the rec<strong>or</strong>ds <strong>of</strong> local public hospitals.<br />

have 30% <strong>of</strong> excess risk reduction compared to those<br />

H pyl<strong>or</strong>i infected persons in the base-case analysis, while<br />

a wide range <strong>of</strong> excess risk reduction from 10% to 100%<br />

was tested in one-way sensitivity analysis.<br />

Costs<br />

The present study was done from the public healthcare<br />

provider’s perspective. Thus, the model included direct<br />

medical costs <strong>of</strong> serology screening, the UBT, and triple<br />

therapy. Adverse effects associated with the triple therapy<br />

that necessitated medical intervention were also included<br />

(Table 1). Annual direct medical costs associated with<br />

treatment <strong>of</strong> gastric cancer were estimated at the average<br />

level across different stages <strong>of</strong> the cancer [28] . Nonmedical<br />

direct costs and indirect costs were not included. The<br />

costs were accrued from the time <strong>of</strong> screening until death.<br />

All costs were rep<strong>or</strong>ted in 2006 US dollars and annually<br />

discounted at 3% in all analyses [29] .<br />

Effectiveness<br />

Three health outcomes evaluated in this model included<br />

number <strong>of</strong> gastric cancer cases prevented, life years saved,<br />

and QALYs gained. All outcomes were also annually<br />

discounted at 3% in the base-case analysis [29] .<br />

Incremental cost-effectiveness ratio (ICER)<br />

ICER was expressed as US dollars per life year saved and<br />

US dollars per QALY gained, which were calculated f<strong>or</strong><br />

the two screening strategies compared to no screening<br />

strategy, as well as the UBT compared to the serology<br />

screening. The cost-effectiveness threshold was estimated<br />

at $28 000 per QALY gained in local context, which was<br />

derived from the conventional threshold <strong>of</strong> $50 000 per<br />

QALY gained used in the United States by comparing the<br />

gross national income per capita between the United States<br />

and Singap<strong>or</strong>e [28,30] .<br />

RESULTS<br />

There were a total <strong>of</strong> 237 900 Chinese males aged between<br />

35 and 44 in Singap<strong>or</strong>e [31] . In the base-case scenario,<br />

compared to no screening and no eradication therapy,<br />

strategy 2 that implemented the serology screening on all<br />

coh<strong>or</strong>t members with treatment f<strong>or</strong> those with positive test<br />

www.wjgnet.com

---

3024 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

Table 2 Incremental cost-effectiveness ratios <strong>of</strong> screening strategies at age 40 yr (compared to no<br />

screening strategy unless stated)<br />

US$/QALY Base-case Best-case 1<br />

W<strong>or</strong>st-case 1<br />

Serology UBT Serology UBT Serology UBT<br />

ICER per life year saved 16 166 38 792 Dominant Dominant 389 728 640 000<br />

477 079 2<br />

Dominant 2<br />

5 645 449 2<br />

ICER per QALY gained 13 571 32 525 Dominant Dominant 324 773 560 000<br />

390 337 2<br />

Dominant 2<br />

cost $9.8 million, which saved 523 life years <strong>or</strong> gained 623<br />

QALYs by preventing 272 gastric cancer cases. Strategy 3<br />

that implemented the UBT on this coh<strong>or</strong>t with treatment f<strong>or</strong><br />

those with positive test cost $23.0 million, which saved 550<br />

life years <strong>or</strong> gained 656 QALYs by preventing 281 gastric<br />

cancer cases. A total <strong>of</strong> 875 and 847 persons were screened<br />

f<strong>or</strong> each case <strong>of</strong> gastric cancer prevented in strategy 2 and<br />

3, respectively. The serology screening avoided $1.4 million<br />

<strong>of</strong> discounted expenditures on treatment <strong>of</strong> gastric cancer,<br />

while the UBT avoided $1.5 million. The ICER were<br />

$16 166 per life year saved and $13 571 per QALY gained<br />

f<strong>or</strong> the serology screening, and $38 792 per life year saved<br />

and $32 525 per QALY gained f<strong>or</strong> the UBT (Table 2). When<br />

compared to serology screening, the ICER was $477 079 per<br />

life year saved <strong>or</strong> $390 337 per QALY gained f<strong>or</strong> the UBT.<br />

In the one-way sensitivity analyses, the level <strong>of</strong> excess<br />

gastric cancer risk reduction attributable to H pyl<strong>or</strong>i<br />

eradication varied from 10% to 100% [6,7] . Using a $28 000<br />

per QALY gained as a threshold, the serology screening<br />

would be cost-effective if H pyl<strong>or</strong>i eradication reduced m<strong>or</strong>e<br />

than 15% <strong>of</strong> excess gastric cancer risk. In contrast, the UBT<br />

could be cost-effective only when the excess gastric cancer<br />

risk was reduced by 35% <strong>or</strong> m<strong>or</strong>e (Figure 2A).<br />

The ICER was sensitive to age at which population<strong>based</strong><br />

screening was carried out as shown in Figure 3.<br />

When screening age was m<strong>or</strong>e than 32 years, the ICER<br />

was less than $28 000 per QALY gained f<strong>or</strong> the serology<br />

screening. The UBT appeared cost-effective when the<br />

screening age was m<strong>or</strong>e than 45 years (Figure 2B).<br />

Relative risk <strong>of</strong> gastric cancer f<strong>or</strong> H pyl<strong>or</strong>i infected<br />

population had a significant impact on the ICER. When<br />

H pyl<strong>or</strong>i eradication was assumed to reduce 30% <strong>of</strong><br />

excess gastric cancer risk (as in the base-case analysis), the<br />

serology screening appeared cost-effective over the full<br />

range <strong>of</strong> the relative risk (i.e. from 2 to 12). In contrast,<br />

the UBT appeared cost-effective only with the relative risk<br />

above 5 (Figure 2C).<br />

Cost <strong>of</strong> annual gastric cancer treatment imposed a<br />

substantial impact on the cost-effectiveness <strong>of</strong> the strategies.<br />

F<strong>or</strong> both strategies, the cost had an approximately linear<br />

relation with the ICER that decreased dramatically with the<br />

increase in annual cost <strong>of</strong> the cancer treatment (Figure 2D).<br />

When the annual cost was $30 075, the one-time expenditure<br />

on serology screening and treatment <strong>of</strong> those with positive<br />

test would be fully <strong>of</strong>fset by the savings in preventing gastric<br />

Dominated 2<br />

ICER: Incremental cost-effectiveness ratio; QALY: Quality-adjusted life year; UBT: 13 C-Urea breath test. 1 Variables modified<br />

in best and w<strong>or</strong>st-case analyses were, gastric cancer risk reduction by eradication (100% and 10%, respectively), relative risk<br />

(12 and 2), cost <strong>of</strong> annual gastric cancer treatment ($59 000 and $328), cost <strong>of</strong> the serology screening ($10 and $50), cost <strong>of</strong><br />

the UBT ($60 and $100), and annual discount rate (0% and 7%); 2 The ICER was calculated by comparing the UBT with the<br />

serology screening.<br />

www.wjgnet.com<br />

cancers (Figure 2D). Cost <strong>of</strong> the serology screening and the<br />

UBT also had a moderate impact on the ICER. Each $5<br />

increment in cost <strong>of</strong> the serology screening and the UBT<br />

augmented the ICER by $2000 and $1800, respectively (data<br />

not shown).<br />

The ICER was also sensitive to the annual discount<br />

rate. With the increase in the annual discount rate, the<br />

ICER appeared less fav<strong>or</strong>able f<strong>or</strong> both strategies.<br />

Other variables had little impact on the cost-effectiveness<br />

within the ranges listed in Table 1, which included<br />

sensitivity and specificity <strong>of</strong> the serology screening and<br />

the UBT, effectiveness <strong>of</strong> H pyl<strong>or</strong>i eradication, probability<br />

and costs <strong>of</strong> adverse effects related to eradication therapy<br />

necessitating medical intervention, and utilities <strong>of</strong> each<br />

health state.<br />

In all these sensitivity analyses, the ICER was extremely<br />

less fav<strong>or</strong>able f<strong>or</strong> the UBT compared to the serology<br />

screening.<br />

In the best-case and w<strong>or</strong>st-case analyses, the most<br />

critical variables, including level <strong>of</strong> excess gastric cancer<br />

risk reduction, relative risk <strong>of</strong> gastric cancer in H pyl<strong>or</strong>i<br />

infected population, annual cost <strong>of</strong> gastric cancer<br />

treatment, cost <strong>of</strong> the serology screening and the UBT,<br />

and annual discount rate, were simultaneously varied.<br />

Both strategies achieved m<strong>or</strong>e health benefits (i.e. life<br />

years gained <strong>or</strong> QALYs) at a lower cost compared to<br />

no screening, and the UBT also received m<strong>or</strong>e health<br />

benefit at a lower cost compared to the serology screening<br />

in the best-case scenario (i.e. dominant) (Table 2).<br />

In contrast, the ICER was m<strong>or</strong>e than $300 000 f<strong>or</strong><br />

all comparisons in the w<strong>or</strong>se-case scenario. The UBT<br />

achieved the same gaining in QALYs but at an extra cost<br />

<strong>of</strong> $11 290 897 compared to the serology screening in the<br />

w<strong>or</strong>st case analysis (Table 2).<br />

DISCUSSION<br />

The present study modeled the life-time cost and<br />

effectiveness associated with population-<strong>based</strong><br />

H pyl<strong>or</strong>i screening and treatment f<strong>or</strong> those with positive<br />

test in Chinese males. Compared to no screening and no<br />

eradication therapy strategy, the serology screening was<br />

cost-effective, while the UBT was not cost-effective <strong>based</strong><br />

on the threshold <strong>of</strong> $28 000 per QALY gained. The UBT<br />

gained very little extra health benefits in terms <strong>of</strong> either

---

A<br />

C<br />

Xie F et al . CEA <strong>of</strong> H pyl<strong>or</strong>i screening 3025<br />

Incremental cost-effectiveness ratios (US$/<br />

QALY) (Compared to no screening strategy)<br />

Incremental cost-effectiveness ratios (US$/<br />

QALY) (Compared to no screening strategy)<br />

100 000<br />

90 000<br />

80 000<br />

70 000<br />

60 000<br />

50 000<br />

40 000<br />

30 000<br />

28 000<br />

20 000<br />

10 000<br />

60 000<br />

50 000<br />

40 000<br />

30 000<br />

28 000<br />

20 000<br />

10 000<br />

0<br />

0<br />

Serology screening<br />

13 C-Urea breath test<br />

0 10 20 30 40 50 60 70 80 90 100<br />

Gastric cancer risk reduction (%)<br />

Serology screening<br />

13 C-Urea breath test<br />

2 4 6 8 10 12<br />

Relative risk <strong>of</strong> gastric cancer<br />

Figure 2 A: Sensitivity analysis on excess gastric cancer risk reduction attributable to H pyl<strong>or</strong>i eradication; B: Sensitivity analysis on age at time <strong>of</strong> screening; C: Sensitivity<br />

analysis on relative risk <strong>of</strong> gastric cancer in H pyl<strong>or</strong>i infected people with 30% gastric cancer risk reduction attributable to eradication; D: Sensitivity analysis on annual cost<br />

<strong>of</strong> gastric cancer treatment.<br />

life years saved <strong>or</strong> QALYs gained but at a substantially<br />

higher cost compared to the serology screening. This<br />

suggests that the population-<strong>based</strong> serology screening f<strong>or</strong><br />

H pyl<strong>or</strong>i infection be adopted in this specific population,<br />

especially under the circumstances that the cost <strong>of</strong> gastric<br />

cancer treatment keeps arising due to the advances in new<br />

technologies. Also with this model, future clinical advances<br />

on the efficacy <strong>of</strong> H pyl<strong>or</strong>i eradication in prevention<br />

<strong>of</strong> gastric cancer can be easily translated into the costeffectiveness<br />

ratio, which is now playing an increasingly<br />

imp<strong>or</strong>tant role in inf<strong>or</strong>ming medical decision making.<br />

The serolog y screening was found to be costeffective<br />

in the present study, which is similar to the<br />

published studies using the similar model to estimate the<br />

economic and clinical effects <strong>of</strong> H pyl<strong>or</strong>i screening [6,7] .<br />

Nevertheless, the model used in the present study had<br />

several improvements which are w<strong>or</strong>th noting. First,<br />

we have a health state to identify the persons who were<br />

H pyl<strong>or</strong>i positive and successfully eradicated by the triple<br />

therapy (i.e. ‘H pyl<strong>or</strong>i eradicated’ in Figure 1). This is a<br />

health state in the Markov model which can allow f<strong>or</strong><br />

successful capturing <strong>of</strong> the economic and health benefits<br />

resulted from the screening strategies. Second, in line<br />

with the imp<strong>or</strong>tant assumption that the persons who<br />

survived m<strong>or</strong>e than 5 years after diagnosis <strong>of</strong> gastric<br />

B<br />

D<br />

Incremental cost-effectiveness ratios (US$/<br />

QALY) (Compared to no screening strategy)<br />

Incremental cost-effectiveness ratios (US$/<br />

QALY) (Compared to no screening strategy)<br />

120 000<br />

100 000<br />

80 000<br />

60 000<br />

40 000<br />

28 000<br />

20 000<br />

35 000<br />

30 000<br />

25 000<br />

20 000<br />

15 000<br />

10 000<br />

5 000<br />

0<br />

Serology screening<br />

13 C-Urea breath test<br />

25 30 35 40 45 50 55 60<br />

Age at screening (yr)<br />

Serology screening<br />

13 C-Urea breath test<br />

0<br />

0 10 000 20 000 30 000 40 000 50 000 60 000<br />

Annual cost <strong>of</strong> gastric cancer treatement (US$)<br />

cancer were assumed to be cured [7,20] , we used five tunnel<br />

states, instead <strong>of</strong> a single gastric cancer health state,<br />

to represent the status f<strong>or</strong> each <strong>of</strong> the first five years<br />

since diagnosed with gastric cancer. The m<strong>or</strong>talities f<strong>or</strong><br />

these tunnel states were different from each other <strong>based</strong><br />

on the epidemiological <strong>evidence</strong> [19] . This refinement<br />

may better simulate the real progress <strong>of</strong> gastric cancer<br />

and thus obtain m<strong>or</strong>e accurate estimations in cost and<br />

effectiveness. Third, this model is life-time estimation<br />

and every person remained in the model until death.<br />

Thus some parameters are time-sensitive including<br />

H pyl<strong>or</strong>i incidence, gastric cancer incidence, and m<strong>or</strong>tality<br />

(Table 1). Instead <strong>of</strong> fixed point estimates, age-specific<br />

estimates may be m<strong>or</strong>e appropriate and accurate to reflect<br />

the changes in these imp<strong>or</strong>tant parameters with the aging<br />

<strong>of</strong> the coh<strong>or</strong>t in the model.<br />

Besides, some differences between these two<br />

studies and the present study are notable. The cost<br />

and effectiveness <strong>of</strong> the screening strategies essentially<br />

stemmed from the actual number <strong>of</strong> gastric cancer<br />

cases prevented by the strategies. Theref<strong>or</strong>e, given the<br />

certain level <strong>of</strong> excess gastric cancer risk reduction by the<br />

eradication, cost <strong>of</strong> gastric cancer treatment and relative<br />

risk <strong>of</strong> gastric cancer in H pyl<strong>or</strong>i infected persons are<br />

deemed to have a very imp<strong>or</strong>tant and significant impact on<br />

www.wjgnet.com

---

3026 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

Incremental cost-effectiveness ratios (US$/<br />

QALY) (Compared to no screening strategy)<br />

90 000<br />

80 000<br />

70 000<br />

60 000<br />

50 000<br />

40 000<br />

30 000<br />

20 000<br />

10 000<br />

0<br />

Figure 3 Sensitivity analysis on annual discount rate.<br />

the estimated ICER. The screening strategies would save<br />

m<strong>or</strong>e money if the cost needed to treat a gastric cancer<br />

case increased and prevent m<strong>or</strong>e gastric cancer cases if<br />

relative risk <strong>of</strong> gastric cancer in H pyl<strong>or</strong>i infected persons<br />

increased. Furtherm<strong>or</strong>e, the economic and health benefits<br />

<strong>of</strong> prevention <strong>of</strong> gastric cancer cases may only occur in<br />

the future rather than in the present, which highlights<br />

the imp<strong>or</strong>tant role <strong>of</strong> discount rate used: the larger the<br />

discount rate used the less the benefits obtained (Figure 3).<br />

However, these parameters were not examined in some<br />

previous study [6] , <strong>or</strong> only little impact <strong>of</strong> these parameters<br />

was rep<strong>or</strong>ted [7] .<br />

The cost-effectiveness <strong>of</strong> the serology screening over<br />

the UBT study was robust to most <strong>of</strong> the parameters<br />

through the one-way sensitivity analyses. Nevertheless,<br />

some findings are w<strong>or</strong>th attention. As shown in Figure 3,<br />

the screening strategies would be m<strong>or</strong>e cost-effective<br />

if the starting age increased, which might be explicitly<br />

explained by the fact that both H pyl<strong>or</strong>i infection rate and<br />

gastric cancer incidence would increase with age. However,<br />

a recent large randomized controlled trial in Chinese<br />

revealed that persons with precancerous lesions (gastric<br />

atrophy, intestinal metaplasia, and dysplasia) significantly<br />

reduced the efficacy <strong>of</strong> H pyl<strong>or</strong>i eradication in prevention<br />

<strong>of</strong> gastric cancer compared to those without the lesions [32] .<br />

As the precancerous lesions increased significantly with age<br />

in Chinese [33] , this could be imp<strong>or</strong>tant <strong>evidence</strong> to supp<strong>or</strong>t<br />

the younger screening age. Thus, we suggested that the<br />

optimal screening age could be 35 years where there would<br />

be a substantial improvement on the ICER compared to<br />

younger age but only slight improvement compared to<br />

older age. Otherwise, if an older screening age was chosen,<br />

despite the increase in H pyl<strong>or</strong>i infection rate and gastric<br />

cancer incidence, the level <strong>of</strong> excess gastric cancer risk<br />

reduction (i.e. the efficacy <strong>of</strong> the eradication) would<br />

remain at the far lower end <strong>of</strong> the spectrum, fav<strong>or</strong>ing no<br />

screening against the serology screening (Figure 2).<br />

Prevention <strong>of</strong> gastric cancer will save the medical<br />

expenditures f<strong>or</strong> treatment <strong>of</strong> cancer and increase the<br />

life years and QALYs. However, this health benefit could<br />

be associated with additional medical expenditures (even<br />

the expenditures on daily living f<strong>or</strong> extended life years)<br />

www.wjgnet.com<br />

Serology screening<br />

13 C-Urea breath test<br />

0 1 2 3 4 5 6 7<br />

Annual discount rate (%)<br />

incurred during the extended life years, which will not<br />

occur in case <strong>of</strong> premature death. As including this cost<br />

component remains controversial, we did not take it into<br />

consideration in the present study. We also acknowledged<br />

that some parameters used in the model (e.g. survival rate<br />

<strong>of</strong> gastric cancer) were not available f<strong>or</strong> Chinese males in<br />

Singap<strong>or</strong>e, which may limit the accuracy <strong>of</strong> point estimates<br />

f<strong>or</strong> cost and effectiveness. Finally, the threshold f<strong>or</strong> ICER<br />

used in the present study was estimated from the US<br />

threshold using the ratio <strong>of</strong> gross national income between<br />

two countries, which is relative arbitrary and warrants<br />

further empirical local studies on this imp<strong>or</strong>tant topic.<br />

In summary, the population-<strong>based</strong> serology screening<br />

f<strong>or</strong> H pyl<strong>or</strong>i infection was m<strong>or</strong>e cost-effective than the<br />

UBT in prevention <strong>of</strong> gastric cancer in Singap<strong>or</strong>e Chinese<br />

males.<br />

COMMENTS<br />

Background<br />

H pyl<strong>or</strong>i infection has been recognized as an imp<strong>or</strong>tant risk fact<strong>or</strong> f<strong>or</strong> gastric<br />

cancer. Screening f<strong>or</strong> H pyl<strong>or</strong>i has been proposed as a cost-effective strategy in<br />

prevention <strong>of</strong> gastric cancer.<br />

Research frontiers<br />

A number <strong>of</strong> screening strategies are currently available. However, it is unknown<br />

which screening strategy is m<strong>or</strong>e cost-effective in high-risk populations, especially<br />

in Asian populations.<br />

Innovations and breakthroughs<br />

A separate health state was used to identify the persons who were H pyl<strong>or</strong>i positive<br />

and successfully eradicated by the triple therapy. This state can allow f<strong>or</strong> successful<br />

capturing <strong>of</strong> the economic and health benefits resulted from the screening strategies.<br />

Five tunnel states, instead <strong>of</strong> a single gastric cancer health state, were used in line<br />

with the imp<strong>or</strong>tant assumption that the persons who survived m<strong>or</strong>e than 5 years after<br />

diagnosis <strong>of</strong> gastric cancer were assumed to be cured.<br />

Applications<br />

The findings in this study will be useful and imp<strong>or</strong>tant f<strong>or</strong> decision makers<br />

to efficiently allocate scarce health resources f<strong>or</strong> population-<strong>based</strong> H pyl<strong>or</strong>i<br />

screening.<br />

Peer review<br />

The auth<strong>or</strong>s studied a clinically relevant issue. The manuscript is well written and<br />

is w<strong>or</strong>th <strong>of</strong> publication in the <strong>Journal</strong> as is. This study has a substantial element <strong>of</strong><br />

novelty. There is no data in literature concerning cost-effectiveness <strong>of</strong> serology<strong>based</strong><br />

screening strategy, particularly in countries with high prevalence <strong>of</strong> the<br />

infection, where the gastric cancer is a problem <strong>of</strong> special imp<strong>or</strong>tance.<br />

REFERENCES<br />

1 Kelley JR, Duggan JM. Gastric cancer epidemiology and risk<br />

fact<strong>or</strong>s. J Clin Epidemiol 2003; 56: 1-9<br />

2 Crew KD, Neugut AI. Epidemiology <strong>of</strong> gastric cancer. W<strong>or</strong>ld J<br />

Gastroenterol 2006; 12: 354-362<br />

3 F<strong>or</strong>man D, Newell DG, Fullerton F, Yarnell JW, Stacey<br />

AR, Wald N, Sitas F. Association between infection with<br />

Helicobacter pyl<strong>or</strong>i and risk <strong>of</strong> gastric cancer: <strong>evidence</strong> from a<br />

prospective investigation. BMJ 1991; 302: 1302-1305<br />

4 Parsonnet J, Friedman GD, Vandersteen DP, Chang Y,<br />

Vogelman JH, Orentreich N, Sibley RK. Helicobacter pyl<strong>or</strong>i<br />

infection and the risk <strong>of</strong> gastric carcinoma. N Engl J Med 1991;<br />

325: 1127-1131<br />

5 An international association between Helicobacter pyl<strong>or</strong>i<br />

infection and gastric cancer.The EUROGAST Study Group.<br />

Lancet 1993; 341: 1359-1362

---

Xie F et al . CEA <strong>of</strong> H pyl<strong>or</strong>i screening 3027<br />

6 Fendrick AM, Chernew ME, Hirth RA, Bloom BS, Bandekar<br />

RR, Scheiman JM. Clinical and economic effects <strong>of</strong> population-<strong>based</strong><br />

Helicobacter pyl<strong>or</strong>i screening to prevent gastric<br />

cancer. Arch Intern Med 1999; 159: 142-148<br />

7 Parsonnet J, Harris RA, Hack HM, Owens DK. Modelling<br />

cost-effectiveness <strong>of</strong> Helicobacter pyl<strong>or</strong>i screening to prevent<br />

gastric cancer: a mandate f<strong>or</strong> clinical trials. Lancet 1996; 348:<br />

150-154<br />

8 Roderick P, Davies R, Raftery J, Crabbe D, Pearce R, Patel P,<br />

Bhandari P. Cost-effectiveness <strong>of</strong> population screening f<strong>or</strong><br />

Helicobacter pyl<strong>or</strong>i in preventing gastric cancer and peptic<br />

ulcer disease, using simulation. J Med Screen 2003; 10: 148-156<br />

9 Miwa H, Go MF, Sato N. H. pyl<strong>or</strong>i and gastric cancer: the<br />

Asian enigma. Am J Gastroenterol 2002; 97: 1106-1112<br />

10 Kang JY, Yeoh KG, Ho KY, Guan R, Lim TP, Quak SH, Wee<br />

A, Teo D, Ong YW. Racial differences in Helicobacter pyl<strong>or</strong>i<br />

seroprevalence in Singap<strong>or</strong>e: c<strong>or</strong>relation with differences in<br />

peptic ulcer frequency. J Gastroenterol Hepatol 1997; 12: 655-659<br />

11 Lee HS, Gwee KA, Teng LY, Kang JY, Yeoh KG, Wee A, Chua<br />

BC. Validation <strong>of</strong> [13C]urea breath test f<strong>or</strong> Helicobacter pyl<strong>or</strong>i<br />

using a simple gas chromatograph-mass selective detect<strong>or</strong>. Eur<br />

J Gastroenterol Hepatol 1998; 10: 569-572<br />

12 Briggs A, Sculpher M. An introduction to Markov modelling<br />

f<strong>or</strong> economic evaluation. Pharmacoeconomics 1998; 13: 397-409<br />

13 Sonnenberg FA, Beck JR. Markov models in medical decision<br />

making: a practical guide. Med Decis Making 1993; 13: 322-338<br />

14 W<strong>or</strong>ld Health Organization. M<strong>or</strong>tality Country Fact Sheet<br />

2006 Singap<strong>or</strong>e. Geneva: W<strong>or</strong>ld Health Organization, 2006<br />

15 The Committee on Epidemic Diseases. Seroprevalence <strong>of</strong><br />

Helicobacter pyl<strong>or</strong>i infection in Singap<strong>or</strong>e. Epidemiological<br />

News Bulletin 1996; 22: 31-32<br />

16 Singap<strong>or</strong>e Department <strong>of</strong> Statistics. Yearbook <strong>of</strong> Statistics<br />

2006 Singap<strong>or</strong>e. Singap<strong>or</strong>e: Department <strong>of</strong> Statistics 2006<br />

17 Seow A, Koh WP, Chia KS, Shi LM, Lee HP, Shanmugaratnam<br />

K. Trends in Cancer Incidence in Singap<strong>or</strong>e 1968-2002.<br />

Singap<strong>or</strong>e: Singap<strong>or</strong>e Cancer Registry Rep<strong>or</strong>t No. 6, 2004<br />

18 F<strong>or</strong>man D, Webb P, Parsonnet J. H pyl<strong>or</strong>i and gastric cancer.<br />

Lancet 1994; 343: 243-244<br />

19 Tian J, Wang XD, Chen ZC. Survival <strong>of</strong> patients with stomach<br />

cancer in Changle city <strong>of</strong> China. W<strong>or</strong>ld J Gastroenterol 2004; 10:<br />

1543-1546<br />

20 Koga S, Kaibara N, Kishimoto H, Nishidoi H, Kimura O,<br />

Okamoto T, Tamura H. Comparison <strong>of</strong> 5- and 10-year survival<br />

rates in operated gastric cancer patients. Assessment <strong>of</strong> the<br />

5-year survival rate as a valid indicat<strong>or</strong> <strong>of</strong> postoperative<br />

curability. Langenbecks Arch Chir 1982; 356: 37-42<br />

21 Yang KC, Wang GM, Chen JH, Chen TJ, Lee SC. Comparison<br />

<strong>of</strong> rabeprazole-<strong>based</strong> four- and seven-day triple therapy and<br />

omeprazole-<strong>based</strong> seven-day triple therapy f<strong>or</strong> Helicobacter<br />

pyl<strong>or</strong>i infection in patients with peptic ulcer. J F<strong>or</strong>mos Med<br />

Assoc 2003; 102: 857-862<br />

22 Gambaro C, Bilardi C, Dulbecco P, Iiritano E, Zentilin<br />

P, Mansia C, Usai P, Vigneri S, Savarino V. Comparable<br />

Helicobacter pyl<strong>or</strong>i eradication rates obtained with 4- and<br />

7-day rabeprazole-<strong>based</strong> triple therapy: a preliminary study.<br />

Dig Liver Dis 2003; 35: 763-767<br />

23 Danese S, Armuzzi A, Romano A, Cremonini F, Candelli<br />

M, Franceschi F, Ojetti V, Venuti A, Pola P, Gasbarrini G,<br />

Gasbarrini A. Efficacy and tolerability <strong>of</strong> antibiotics in patients<br />

undergoing H pyl<strong>or</strong>i eradication. Hepatogastroenterology 2001;<br />

48: 465-467<br />

24 Lam SK, Talley NJ. Rep<strong>or</strong>t <strong>of</strong> the 1997 Asia Pacific Consensus<br />

Conference on the management <strong>of</strong> Helicobacter pyl<strong>or</strong>i<br />

infection. J Gastroenterol Hepatol 1998; 13: 1-12<br />

25 Stack WA, Knifton A, Thirlwell D, Cockayne A, Jenkins D,<br />

Hawkey CJ, Atherton JC. Safety and efficacy <strong>of</strong> rabeprazole in<br />

combination with four antibiotic regimens f<strong>or</strong> the eradication<br />

<strong>of</strong> Helicobacter pyl<strong>or</strong>i in patients with chronic gastritis with <strong>or</strong><br />

without peptic ulceration. Am J Gastroenterol 1998; 93: 1909-1913<br />

26 Wang Q, Jin PH, Lin GW, Xu SR, Chen J. Cost-effectiveness<br />

<strong>of</strong> Helicobacter pyl<strong>or</strong>i screening to prevent gastric cancer:<br />

Markov decision analysis. Zhonghua Liuxingbingxue Zazhi 2003;<br />

24: 135-139<br />

27 Eslick GD, Lim LL, Byles JE, Xia HH, Talley NJ. Association <strong>of</strong><br />

Helicobacter pyl<strong>or</strong>i infection with gastric carcinoma: a metaanalysis.<br />

Am J Gastroenterol 1999; 94: 2373-2379<br />

28 Dan YY, So JB, Yeoh KG. Endoscopic screening f<strong>or</strong> gastric<br />

cancer. Clin Gastroenterol Hepatol 2006; 4: 709-716<br />

29 Lipscomb J, Weinstein MC, T<strong>or</strong>rance GW. Time preference.<br />

In: Gold MR, Siegel JE, Russell LB, Weinstein MC. Cost-<br />

Effectiveness in Health and Medicine. New Y<strong>or</strong>k: Oxf<strong>or</strong>d<br />

University Press 1996: 214-246<br />

30 W<strong>or</strong>ld Bank. W<strong>or</strong>ld Development Indicat<strong>or</strong>s Database.: W<strong>or</strong>ld<br />

Bank, 2006<br />

31 Department <strong>of</strong> Statistics. Census <strong>of</strong> Population 2000<br />

Statistical Release 1: Demographic Characteristics. Singap<strong>or</strong>e:<br />

Department <strong>of</strong> Statistics, 2001<br />

32 Wong BC, Lam SK, Wong WM, Chen JS, Zheng TT, Feng RE,<br />

Lai KC, Hu WH, Yuen ST, Leung SY, Fong DY, Ho J, Ching<br />

CK, Chen JS. Helicobacter pyl<strong>or</strong>i eradication to prevent gastric<br />

cancer in a high-risk region <strong>of</strong> China: a randomized controlled<br />

trial. JAMA 2004; 291: 187-194<br />

33 You WC, Blot WJ, Li JY, Chang YS, Jin ML, Kneller R, Zhang L,<br />

Han ZX, Zeng XR, Liu WD. Precancerous gastric lesions in a<br />

population at high risk <strong>of</strong> stomach cancer. Cancer Res 1993; 53:<br />

1317-1321<br />

S- Edit<strong>or</strong> Zhong XY L- Edit<strong>or</strong> Kremer M E- Edit<strong>or</strong> Liu Y<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3028-3037<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

CLINICAL RESEARCH<br />

Endoscopic ultrasound: It’s accuracy in evaluating mediastinal<br />

lymphadenopathy? A meta-analysis and systematic review<br />

Srinivas R Puli, Jyotsna Batapati Krishna Reddy, Matthew L Bechtold, Jamal A Ibdah, Daphne Antillon, Shailender<br />

Singh, Mojtaba Olyaee, Main<strong>or</strong> R Antillon<br />

Srinivas R Puli, Jyotsna Batapati Krishna Reddy, Matthew L<br />

Bechtold, Jamal A Ibdah, Daphne Antillon, Main<strong>or</strong> R Antillon,<br />

Division <strong>of</strong> Gastroenterology and Hepatology, University <strong>of</strong><br />

Missouri- Columbia, Columbia, Missouri 65212, United states<br />

Shailender Singh, Mojtaba Olyaee, Division <strong>of</strong> Gastroenterology<br />

and Hepatology, University <strong>of</strong> Kansas School <strong>of</strong> Medicine, Kansas<br />

City, Kansas 66160, United states<br />

Auth<strong>or</strong> contributions: Puli SR designed the research; Puli<br />

SR and Batapati Krishna Reddy J collected the data; Puli SR<br />

contributed analytic tools; Puli SR analyzed data; Puli SR wrote<br />

the paper; and Puli SR, Batapati Krishna Reddy J, Bechtold ML,<br />

Ibdah JA, Antillon D, Singh S, Olyaee M, and Antillon MR helped<br />

edit the paper.<br />

C<strong>or</strong>respondence to: Main<strong>or</strong> R Antillon, MD, Division <strong>of</strong><br />

Gastroenterology, One Hospital Drive, M580a, Columbia, MO<br />

65212, United states. antillonmr@missouri.edu<br />

Telephone: +1-573-8821013 Fax: +1-573-8844595<br />

Received: September 3, 2007 Revised: January 3, 2008<br />

Abstract<br />

AIM: To evaluate the accuracy <strong>of</strong> endoscopic ultrasound<br />

(EUS), EUS-fine needle aspiration (FNA) in evaluating<br />

mediastinal lymphadenopathy.<br />

METHODS: Only EUS and EUS-FNA studies confirmed<br />

by surgery <strong>or</strong> with appropriate follow-up were selected.<br />

Articles were searched in Medline, Pubmed, and<br />

Cochrane control trial registry. Only studies from which a<br />

2 × 2 table could be constructed f<strong>or</strong> true positive, false<br />

negative, false positive and true negative values were<br />

included. Two reviewers independently searched and<br />

extracted data. The differences were resolved by mutual<br />

agreement. Meta-analysis f<strong>or</strong> the accuracy <strong>of</strong> EUS was<br />

analyzed by calculating pooled estimates <strong>of</strong> sensitivity,<br />

specificity, likelihood ratios, and diagnostic odds ratios.<br />

Pooling was conducted by both Mantel-Haenszel method<br />

(fixed effects model) and DerSimonian Laird method<br />

(random effects model). The heterogeneity <strong>of</strong> studies<br />

was tested using Cochran’s Q test <strong>based</strong> upon inverse<br />

variance weights.<br />

RESULTS: Data was extracted from 76 studies (n =<br />

9310) which met the inclusion criteria. Of these, 44<br />

studies used EUS alone and 32 studies used EUS-FNA.<br />

FNA improved the sensitivity <strong>of</strong> EUS from 84.7% (95%<br />

CI: 82.9-86.4) to 88.0% (95% CI: 85.8-90.0). With FNA,<br />

the specificity <strong>of</strong> EUS improved from 84.6% (95% CI:<br />

83.2-85.9) to 96.4% (95% CI: 95.3-97.4). The P f<strong>or</strong><br />

www.wjgnet.com<br />

chi-squared heterogeneity f<strong>or</strong> all the pooled accuracy<br />

estimates was > 0.10.<br />

CONCLUSION: EUS is highly sensitive and specific f<strong>or</strong><br />

the evaluation <strong>of</strong> mediastinal lymphadenopathy and FNA<br />

substantially improves this. EUS with FNA should be<br />

the diagnostic test <strong>of</strong> choice f<strong>or</strong> evaluating mediastinal<br />

lymphadenopathy.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Endoscopic ultrasound; EUS-fine needle<br />

aspiration; Mediastinal lymphadenopathy<br />

Peer reviewer: Damian Casadesus Rodriguez, MD, PhD, Calixto<br />

Garcia University Hospital, J and University, Vedado, Havana<br />

City, Cuba<br />

Puli SR, Batapati Krishna Reddy J, Bechtold ML, Ibdah JA,<br />

Antillon D, Singh S, Olyaee M, Antillon MR. Endoscopic<br />

u l t r a s o u n d : I t ' s a c c u r a c y i n e v a l u a t i n g m e d i a s t i n a l<br />

lymphadenopathy? A meta-analysis and systematic review. W<strong>or</strong>ld<br />

J Gastroenterol 2008; 14(19): 3028-3037 Available from: URL:<br />

http://www.wjgnet.com/1007-9327/14/3028.asp DOI: http://<br />

dx.doi.<strong>or</strong>g/10.3748/wjg.14.3028<br />

INTRODUCTION<br />

Management <strong>of</strong> patients with mediastinal lymphadenopathy<br />

depends on the etiology <strong>of</strong> lymphadenopathy.<br />

Differentiating inflammat<strong>or</strong>y from neoplastic processes<br />

in the mediastinal lymph nodes is not only imp<strong>or</strong>tant<br />

from the treatment standpoint, but also vital in predicting<br />

survival. Multiple diagnostic modalities are available<br />

to evaluate mediastinal lymphadenopathy. Computer<br />

tomography (CT) <strong>of</strong> the chest does not clearly image the<br />

a<strong>or</strong>topulmonary, subcarinal, and paraesophageal areas<br />

due to the lowering <strong>of</strong> image resolution because <strong>of</strong> the<br />

movement and partial volume effect <strong>of</strong> pulmonary vessels,<br />

a<strong>or</strong>tic arch, and left atrium [1] . Also, f<strong>or</strong> lesions smaller<br />

than 1 cm, the sensitivity <strong>of</strong> CT is low [2-5] , and the size<strong>based</strong><br />

criteria to diagnose metastatic involvement <strong>of</strong> the<br />

lymph nodes have lower accuracy [6] . Theref<strong>or</strong>e, other<br />

methods were introduced, including transbronchial biopsy,<br />

CT-guided transth<strong>or</strong>acic fine-needle aspiration (FNA),<br />

mediastinoscopy, <strong>or</strong> th<strong>or</strong>acoscopic biopsy.<br />

In the transbronchial technique, the FNA needle

---

Puli SR et al . EUS f<strong>or</strong> diagnosing mediastinal lymphadenopathy: A meta-analysis 3029<br />

is advanced blindly, reducing the yield <strong>of</strong> diagnosing<br />

subcarinal and paraesophageal nodes to approximately<br />

50% [7,8] . Due to the potential danger <strong>of</strong> inadvertent<br />

vascular puncture, transth<strong>or</strong>acic biopsy is avoided when<br />

the mass is close to maj<strong>or</strong> vessels. This procedure is<br />

also associated with significant complications, including<br />

bleeding and pneumoth<strong>or</strong>ax in up to 25%-35% <strong>of</strong><br />

cases [9,10] . Extended cer vical mediastinoscopy <strong>or</strong><br />

anteri<strong>or</strong> mediastinoscopy can be used to access level 5<br />

(a<strong>or</strong>topulmonary window) mediastinal nodes, which is<br />

not inspected by the standard methods [11-13] . Extended<br />

cervical mediastinoscopy has a sensitivity <strong>of</strong> 83% in<br />

examining the paraa<strong>or</strong>tic and suba<strong>or</strong>tic lymph node chains,<br />

but the subcarinal group is inaccessible [11] . Th<strong>or</strong>acoscopy<br />

can visualize the inferi<strong>or</strong> mediastinum effectively, but it<br />

is limited only to accessing the level <strong>of</strong> maj<strong>or</strong> bronchi,<br />

leaving the superi<strong>or</strong> mediastinum non-visualized [14] . Both<br />

procedures are invasive, require hospitalization and general<br />

anesthesia, and both have limitations.<br />

With the introduction <strong>of</strong> endoscopic ultrasonography<br />

(EUS), it is now possible to visualize not only the<br />

gastrointestinal tract but also surrounding structures.<br />

However, EUS is limited in its ability to distinguish<br />

an inflammat<strong>or</strong>y/reactive process from a malignancy,<br />

particularly within lymph nodes [15,16] . The accuracy <strong>of</strong><br />

EUS in diagnosing mediastinal lymphadenopathy has been<br />

varied [17-21] . FNA during EUS may be perf<strong>or</strong>med safely<br />

in a sh<strong>or</strong>t outpatient procedure setting without general<br />

anesthesia. It is not clear to what extent, if any, FNA adds<br />

in improving the accuracy <strong>of</strong> EUS to diagnose mediastinal<br />

lymphadenopathy [22-25] .<br />

The goal <strong>of</strong> this meta-analysis was to evaluate the<br />

accuracy <strong>of</strong> EUS alone and EUS with FNA in c<strong>or</strong>rectly<br />

diagnosing mediastinal lymphadenopathy. Due to multiple<br />

studies scattered in the literature and no published metaanalysis<br />

in this area, this meta-analysis was perf<strong>or</strong>med<br />

in an attempt to answer this essential clinical question.<br />

This meta-analysis and systematic review was written<br />

in acc<strong>or</strong>dance with the proposal f<strong>or</strong> rep<strong>or</strong>ting by the<br />

QUOROM (Quality <strong>of</strong> Rep<strong>or</strong>ting <strong>of</strong> Meta-analyses)<br />

statement [26] . Since this manuscript looks at diagnostic<br />

accuracy <strong>of</strong> a test, the study design f<strong>or</strong> this meta-analysis<br />

and systematic review conf<strong>or</strong>med to the guidelines <strong>of</strong><br />

Standards f<strong>or</strong> Rep<strong>or</strong>ting <strong>of</strong> Diagnostic Accuracy (STARD)<br />

initiative [27] .<br />

MATERIALS AND METHODS<br />

Study selection criteria<br />

Only EUS-FNA studies confir med by surgery <strong>or</strong><br />

appropriate follow-up were selected. From this pool, only<br />

studies from which a 2 × 2 table could be constructed f<strong>or</strong><br />

true positive, false negative, false positive and true negative<br />

values were included.<br />

Data collection and extraction<br />

Articles were searched in Medline, Pubmed, Ovid journals,<br />

Cumulative Index f<strong>or</strong> Nursing & Allied Health Literature,<br />

ACP journal club, DARE, International Pharmaceutical<br />

Abstracts, old Medline, Medline non-indexed citations,<br />

OVID Healthstar, and Cochrane Control Trial Registry.<br />

The search terms used were endoscopic ultrasound, EUS,<br />

ultrasound, mediastinal lymphadenopathy, nodal invasion,<br />

fine needle aspiration, FNA, staging, surgery, sensitivity,<br />

specificity, positive predictive value, and negative predictive<br />

value. 2 × 2 tables were constructed with the data extracted<br />

from each study. To give validity to the data, two auth<strong>or</strong>s<br />

(SP and JR) independently searched and extracted the data<br />

into an abstraction f<strong>or</strong>m. Any differences were resolved by<br />

mutual agreement.<br />

Quality <strong>of</strong> studies<br />

Clinical trial with a control arm can be assessed f<strong>or</strong> the<br />

quality <strong>of</strong> the study. A number <strong>of</strong> criteria have been used to<br />

assess this quality <strong>of</strong> a study (e.g. randomization, selection<br />

bias <strong>of</strong> the arms in the study, concealment <strong>of</strong> allocation, and<br />

blinding <strong>of</strong> outcome) [28,29] . There is no consensus on how to<br />

assess studies without a control arm. Hence, these criteria<br />

do no apply to studies without a control arm [29] . Theref<strong>or</strong>e,<br />

f<strong>or</strong> this meta-analysis and systematic review, studies were<br />

selected <strong>based</strong> on completeness <strong>of</strong> data and inclusion<br />

criteria.<br />

Statistical analysis<br />

Meta-analysis f<strong>or</strong> the accuracy <strong>of</strong> EUS in diagnosing the<br />

etiology <strong>of</strong> mediastinal lymphadenopathy was perf<strong>or</strong>med<br />

by calculating pooled estimates <strong>of</strong> sensitivity, specificity,<br />

likelihood ratios, and diagnostic odds ratios. EUS studies<br />

were grouped into time periods to standardize the<br />

change in EUS technology and EUS criteria f<strong>or</strong> lymph<br />

node involvement [30] . These time periods were 1988<br />

to 1994, 1995 to 1999, and 2000 to 2006. Pooling was<br />

conducted using both Mantel-Haenszel method (fixed<br />

effects model) and DerSimonian Laird method (random<br />

effects model). The confidence intervals were calculated<br />

using the F distribution method [31] . The width <strong>of</strong> the<br />

point estimates in the F<strong>or</strong>rest plots indicates the assigned<br />

weight to that study. F<strong>or</strong> 0 value cells, a 0.5 was added as<br />

described by Cox [32] . The heterogeneity <strong>of</strong> the sensitivities<br />

and specificities was tested by applying the likelihood<br />

ratio test [33] . The heterogeneity <strong>of</strong> likelihood ratios and<br />

diagnostic odds ratios were tested using Cochran’s Q test<br />

<strong>based</strong> upon inverse variance weights [34] . Heterogeneity<br />

among studies was also tested by using summary receiver<br />

operating characteristic (SROC) curves. SROC curves were<br />

used to calculate the area under the curve (AUC). The<br />

effect <strong>of</strong> publication and selection bias on the summary<br />

estimates was tested by Harb<strong>or</strong>d-Egger bias indicat<strong>or</strong> [35]<br />

and Begg-Mazumdar indicat<strong>or</strong> [36] . Also, funnel plots were<br />

constructed to evaluate potential publication bias using the<br />

standard err<strong>or</strong> and diagnostic odds ratio [37,38] .<br />

RESULTS<br />

The initial search using the search terms identified 4310<br />

reference articles. Among these, 460 relevant articles were<br />

selected and reviewed by two auth<strong>or</strong>s independently.<br />

Data was extracted from 76 studies (n = 9310) which<br />

met the inclusion criteria. Of these, 44 studies used EUS<br />

alone [17,18,39-80] and 32 studies used EUS-FNA [19-25,81-107] .<br />

Figure 1 shows the search results. Table 1 shows the<br />

characteristics f<strong>or</strong> EUS studies without FNA and Table 2<br />

www.wjgnet.com

---

3030 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

44 studies used EUS<br />

alone<br />

Initial search gave<br />

4310 potential articles<br />

Refining search gave<br />

460 relevant articles<br />

76 Studies met the<br />

inclusion criteria<br />

Figure 1 The search results.<br />

Table 1 Characteristics <strong>of</strong> studies included in this meta-analysis<br />

f<strong>or</strong> EUS without FNA<br />

Auth<strong>or</strong> Year <strong>of</strong><br />

publication<br />

Tio et al [71]<br />

Murata et al [57]<br />

Tio et al [69]<br />

Vilgrain et al [75]<br />

Tio et al [68]<br />

Rice et al [63]<br />

Heintz et al [52]<br />

Botet et al [40]<br />

Tio et al [70]<br />

Ziegler et al [80]<br />

Rosch et al [64]<br />

Fok et al [46]<br />

Yoshikane et al [79]<br />

Grimm et al [49]<br />

Dittler et al [45]<br />

Peters et al [61]<br />

Catalano et al [43]<br />

McLoughlin et al [18]<br />

Binmoeller et al [39]<br />

HunerBein et al [53]<br />

Hasegawa et al [50]<br />

Francois et al [47]<br />

Natsugoe et al [58]<br />

Milena et al [54]<br />

Vikers et al [73]<br />

Shimizu et al [67]<br />

Pham et al [62]<br />

Vikers et al [74]<br />

Salminen et al [65]<br />

Krasna et al [56]<br />

Browrey et al [41]<br />

Catalano et al [42]<br />

Giovannini et al [48]<br />

Nishimaki et al [60]<br />

Heidemann et al [51]<br />

Nesje et al [59]<br />

Vazquez-Sequeiros et al [105]<br />

Wiersema et al [77]<br />

Wakelin et al [76]<br />

Kienle et al [55]<br />

Schwartz et al [66]<br />

Wu et al [78]<br />

Arima et al [17]<br />

DeWitt et al [44]<br />

32 studies used EUS<br />

with FNA<br />

No. <strong>of</strong><br />

patients<br />

3850 articles did not<br />

look at mediastinum<br />

- 310 did not meet<br />

inclusion criteria<br />

- 54 studies did not have<br />

full data to construct<br />

2 × 2 table<br />

- 20 studies were in<br />

other languages<br />

Type <strong>of</strong><br />

recruitment<br />

Confirmat<strong>or</strong>y<br />

procedure<br />

1986 26 Prospective Surgery<br />

1988 173 Consecutive Surgery<br />

1989 75 Prospective Surgery<br />

1990 51 Consecutive Surgery<br />

1990 102 Consecutive Surgery<br />

1991 22 Consecutive Surgery<br />

1991 40 Consecutive Surgery<br />

1991 50 Consecutive Surgery<br />

1989 74 Prospective Surgery<br />

1991 52 Consecutive Surgery<br />

1992 44 Consecutive Surgery<br />

1992 54 Consecutive Surgery<br />

1993 28 Consecutive Surgery<br />

1993 63 Prospective Surgery<br />

1993 167 Consecutive Surgery<br />

1994 42 Consecutive Surgery<br />

1994 100 Consecutive Surgery<br />

1995 15 Consecutive Surgery<br />

1995 87 Prospective Surgery<br />

1996 19 Consecutive Surgery<br />

1996 22 Consecutive Surgery<br />

1996 29 Consecutive Surgery<br />

1996 37 Consecutive Surgery<br />

1997 40 Prospective Surgery<br />

1997 50 Consecutive Surgery<br />

1997 431 Consecutive Surgery<br />

1998 28 Consecutive Surgery<br />

1998 50 Prospective Surgery<br />

1999 32 Consecutive Surgery<br />

1999 88 Consecutive Surgery<br />

1999 98 Prospective Surgery<br />

1999 149 Prospective Surgery<br />

1999 198 Prospective Surgery<br />

1999 224 Consecutive Surgery<br />

2000 68 Consecutive Surgery<br />

2000 68 Prospective Surgery<br />

2001 37 Consecutive Surgery<br />

2001 82 Prospective Surgery<br />

2002 36 Consecutive Surgery<br />

2002 117 Prospective Surgery<br />

2002 188 Consecutive Surgery<br />

2003 31 Prospective Surgery<br />

2003 58 Consecutive Surgery<br />

2005 102 Prospective Surgery<br />

depicts characteristics <strong>of</strong> EUS studies with FNA. All the<br />

www.wjgnet.com<br />

Table 2 Characteristics <strong>of</strong> studies included in this meta-analysis<br />

f<strong>or</strong> EUS with FNA<br />

Auth<strong>or</strong> Year <strong>of</strong><br />

publication<br />

Kondo et al [6]<br />

Schuder et al [25]<br />

Silvestri et al [83]<br />

Giovannini et al [82]<br />

Pedersen et al [21]<br />

HunerBein et al [90]<br />

Gress et al [19]<br />

Wiersema et al [104]<br />

HunerBein et al [91]<br />

HunerBein et al [98]<br />

Fritscher-Ravens et al [101]<br />

Mishra et al [102]<br />

Giovannini et al [81]<br />

Williams et al [89]<br />

Fritscher-Ravens et al [84]<br />

Fritscher-Ravens et al [98]<br />

Savides et al [100]<br />

Fritscher-Ravens et al [103]<br />

Vazquez-Sequeiros et al [105]<br />

Wallace et al [91]<br />

Wiersema et al [85]<br />

Chhieng et al [96]<br />

Devereaux et al [22]<br />

Catalano et al [92]<br />

Schwartz et al [66]<br />

Arima et al [95]<br />

Pellise et al [23]<br />

Kramer et al [86]<br />

Walsh et al [97]<br />

Tournoy et al [88]<br />

Khoo et al [93]<br />

Beek et al [87]<br />

No. <strong>of</strong><br />

patients<br />

Type <strong>of</strong><br />

recruitment<br />

Confirmat<strong>or</strong>y<br />

procedure<br />

1990 503 Consecutive Surgery<br />

1991 32 Consecutive Surgery<br />

1995 27 Prospective Surgery<br />

1995 141 Prospective Surgery <strong>or</strong><br />

appropriate<br />

follow-up<br />

1996 9 Consecutive FNA and<br />

appropriate<br />

follow-up<br />

1996 19 Consecutive Surgery<br />

1997 52 Prospective Surgery<br />

1997 60 Consecutive FNA and<br />

appropriate<br />

follow-up<br />

1998 15 Consecutive Surgery<br />

1998 16 Consecutive Surgery<br />

1999 16 Consecutive FNA and<br />

appropriate<br />

follow-up<br />

1999 111 Consecutive FNA and<br />

appropriate<br />

follow-up<br />

1999 198 Prospective Surgery <strong>or</strong><br />

appropriate<br />

follow-up<br />

1999 333 Prospective Surgery <strong>or</strong><br />

appropriate<br />

follow-up<br />

2000 35 Prospective Surgery<br />

2000 35 Consecutive FNA and<br />

appropriate<br />

follow-up<br />

2000 54 Consecutive FNA and<br />

appropriate<br />

follow-up<br />

2000 153 Consecutive FNA and<br />

appropriate<br />

follow-up<br />

2001 37 Consecutive Surgery<br />

2001 43 Consecutive FNA and<br />

appropriate<br />

follow-up<br />

2001 82 Prospective Surgery<br />

2001 103 Consecutive Surgery<br />

2002 49 Consecutive Surgery<br />

2002 62 Consecutive Surgery<br />

2002 188 Consecutive Surgery<br />

2003 58 Consecutive Surgery<br />

2004 11 Consecutive Surgery<br />

2004 81 Prospective Surgery<br />

2005 27 Consecutive Surgery <strong>or</strong><br />

appropriate<br />

follow-up<br />

2005 67 Prospective Surgery<br />

2006 20 Prospective Surgery<br />

2006 43 Prospective Surgery<br />

76 selected studies were published as full-text articles<br />

in peer review journals. The pooled estimates given are<br />

estimates calculated by the fixed effect model.<br />

Accuracy <strong>of</strong> EUS with and without FNA<br />

Pooled sensitivity to diagnose the cause f<strong>or</strong> mediastinal<br />

lymphadenopathy was 84.7% (95% CI: 82.9-86.4) f<strong>or</strong>

---

A<br />

Puli SR et al . EUS f<strong>or</strong> diagnosing mediastinal lymphadenopathy: A meta-analysis 3031<br />

0.0 0.2 0.4 0.6 0.8 1.0<br />

Sensitivity<br />

Tio 1986<br />

Murata 1988<br />

Tio 1989<br />

Tio 1989<br />

Vilgrain 1990<br />

Tio 1990<br />

Rice 1991<br />

Ziegler 1991<br />

Heintz 1991<br />

Botet 1991<br />

Fok 1992<br />

Rosch 1992<br />

Grimm 1993<br />

Yoshikane 1993<br />

Dittler 1993<br />

Catalano 1994<br />

Peters 1994<br />

McLoughlin 1995<br />

Binmoeller 1995<br />

Francois 1996<br />

Hunerbein 1996<br />

Hasegawa 1996<br />

Natsugoe 1996<br />

Vikers 1997<br />

Shimizu 1997<br />

Milena 1997<br />

Vikers 1998<br />

Pham 1998<br />

Salminen 1999<br />

Giovannini 1999<br />

Catalano 1999<br />

Krasna 1999<br />

Nishimaki 1999<br />

Browrey 1999<br />

Heidemann 2000<br />

Nesje 2000<br />

Vazquez-Sequeiros 2001<br />

Wiersema 2001<br />

Kienle 2002<br />

Wakelin 2002<br />

Schwartz 2002<br />

Arima 2003<br />

Wu 2003<br />

DeWitt 2005<br />

Sensitivity (95% CI)<br />

1.00 (0.16-1.00)<br />

0.84 (0.78-0.89)<br />

0.98 (0.91-1.00)<br />

0.98 (0.89-1.00)<br />

0.84 (0.64-0.95)<br />

0.98 (0.88-1.00)<br />

0.70 (0.35-0.93)<br />

0.64 (0.43-0.82)<br />

0.87 (0.60-0.98)<br />

0.97 (0.85-1.00)<br />

0.85 (0.68-0.95)<br />

0.89 (0.67-0.99)<br />

0.97 (0.86-1.00)<br />

0.58 (0.28-0.85)<br />

0.84 (0.76-0.91)<br />

0.89 (0.79-0.95)<br />

0.92 (0.73-0.99)<br />

0.33 (0.01-0.91)<br />

0.90 (0.73-0.98)<br />

0.84 (0.60-0.97)<br />

0.93 (0.66-1.00)<br />

0.50 (0.07-0.93)<br />

0.80 (0.28-0.99)<br />

0.97 (0.86-1.00)<br />

0.53 (0.35-0.71)<br />

0.91 (0.71-0.99)<br />

0.97 (0.86-1.00)<br />

0.88 (0.62-0.98)<br />

0.90 (0.70-0.99)<br />

0.90 (0.55-1.00)<br />

0.79 (0.69-0.87)<br />

0.64 (0.31-0.89)<br />

0.80 (0.71-0.87)<br />

1.00 (0.48-1.00)<br />

0.70 (0.61-0.78)<br />

0.76 (0.61-0.88)<br />

0.64 (0.41-0.83)<br />

0.86 (0.65-0.97)<br />

0.85 (0.74-0.92)<br />

0.80 (0.44-0.97)<br />

1.00 (0.95-1.00)<br />

1.00 (0.87-1.00)<br />

0.68 (0.43-0.87)<br />

0.86 (0.74-0.94)<br />

Pooled Sensitivity = 0.85 (0.83-0.86)<br />

Figure 2 F<strong>or</strong>rest plots. A: Sensitivity <strong>of</strong> EUS alone in diagnosing mediastinal lymphadenopathy; B: Sensitivity <strong>of</strong> EUS-FNA in diagnosing mediastinal lymphadenopathy.<br />

EUS alone versus 88.0% (95% CI: 85.8-90.0) f<strong>or</strong> EUS with<br />

FNA. The F<strong>or</strong>rest plot showing the sensitivity <strong>of</strong> EUS<br />

with and without FNA in various studies is shown in<br />

Figure 2A and B, respectively. EUS without FNA had<br />

a pooled specificity <strong>of</strong> 84.6% (95% CI: 83.2-85.9) and<br />

with FNA was 96.4% (95% CI: 95.3-97.4). F<strong>or</strong>rest plots<br />

showing specificity from various studies with and without<br />

FNA is depicted in Figure 3A and B, respectively.<br />

The pooled positive likelihood ratio <strong>of</strong> EUS without<br />

FNA was 3.3 (95% CI: 2.6-4.3) and with FNA was 11.2<br />

(95% CI: 5.9-21.2). The pooled negative likelihood ratio<br />

was 0.24 (95% CI: 0.1-0.3) f<strong>or</strong> EUS without FNA and<br />

0.13 (95% CI: 0.1-0.2) f<strong>or</strong> EUS with FNA. The diagnostic<br />

odds ratio, the odds <strong>of</strong> having nodal metastasis in positive<br />

as compared to negative EUS studies, was 19.1 (95% CI:<br />

12.7-28.5) f<strong>or</strong> EUS without FNA and 106.9 (95% CI:<br />

54.4-210.3) f<strong>or</strong> EUS with FNA. Figure 4 shows a F<strong>or</strong>rest<br />

plot <strong>of</strong> various studies with FNA and their DOR. All the<br />

pooled estimates calculated by random effect models were<br />

similar to the estimates <strong>of</strong> fixed effect model.<br />

SROC curves f<strong>or</strong> EUS without FNA showed an area<br />

under the curve (AUC) <strong>of</strong> 0.91. EUS with FNA showed<br />

B<br />

0.0 0.2 0.4 0.6 0.8 1.0<br />

Sensitivity<br />

Kondo 1990<br />

Schuder 1991<br />

Giovannini 1995<br />

Silvestri 1995<br />

Hunerbein 1998<br />

Gress 1997<br />

Wiersema 1997<br />

Hunerbein 1998<br />

Hunerbein 1998<br />

Giovannini 1999<br />

Williams 1999<br />

Fritscher-Ravens 1999<br />

Mishra 1999<br />

Fritscher-Ravens 2000<br />

Fritscher-Ravens 2000<br />

Savides 2000<br />

Fritscher-Ravens 2000<br />

Chhieng 2001<br />

Wiersema 2001<br />

Wallace 2001<br />

Vazquez-Sequeiros 2001<br />

Schwartz 2002<br />

Devereaux 2002<br />

Catalano 2002<br />

Arima 2003<br />

Kramer 2004<br />

Pellise 2004<br />

Tournoy 2005<br />

Walsh 2005<br />

Beek 2006<br />

Pedersen 1996<br />

Sensitivity (95% CI)<br />

0.54 (0.41-0.66)<br />

0.75 (0.35-0.97)<br />

0.89 (0.77-0.96)<br />

0.89 (0.65-0.99)<br />

0.86 (0.42-1.00)<br />

0.86 (0.65-0.97)<br />

0.89 (0.76-0.96)<br />

0.91 (0.59-1.00)<br />

0.90 (0.55-1.00)<br />

0.90 (0.55-1.00)<br />

0.87 (0.75-0.94)<br />

0.90 (0.55-1.00)<br />

1.00 (0.59-1.00)<br />

1.00 (0.81-1.00)<br />

0.96 (0.80-1.00)<br />

0.97 (0.82-1.00)<br />

0.92 (0.84-0.97)<br />

1.00 (0.69-1.00)<br />

0.96 (0.85-0.99)<br />

0.90 (0.68-0.99)<br />

0.93 (0.78-0.99)<br />

1.00 (0.95-1.00)<br />

1.00 (0.92-1.00)<br />

0.89 (0.75-0.97)<br />

1.00 (0.87-1.00)<br />

0.78 (0.66-0.87)<br />

0.67 (0.30-0.93)<br />

0.78 (0.66-0.88)<br />

0.94 (0.71-1.00)<br />

0.92 (0.73-0.99)<br />

1.00 (0.54-1.00)<br />

Pooled Sensitivity = 0.88 (0.86-0.90)<br />

an AUC <strong>of</strong> 0.97. Figure 5 shows the SROC curve. The<br />

P f<strong>or</strong> Chi-squared heterogeneity f<strong>or</strong> all the pooled accuracy<br />

estimates was > 0.10. Table 3 shows the accuracy estimates<br />

<strong>of</strong> EUS alone and EUS-FNA.<br />

Effect <strong>of</strong> technology over time<br />

To standardize the criteria f<strong>or</strong> lymph node involvement<br />

and change in technology, the studies were grouped into<br />

three time periods [30] . These time periods were 1988 to<br />

1994, 1995 to 1999, and 2000 to 2006. During these time<br />

periods, the number <strong>of</strong> studies that met the inclusion<br />

criteria f<strong>or</strong> EUS alone were 17, 17, and 10, respectively.<br />

Studies that met inclusion criteria f<strong>or</strong> EUS-FNA were<br />

4, 10, and 18, respectively. F<strong>or</strong> the most recent time<br />

period, EUS alone had a sensitivity <strong>of</strong> 81.6% (95% CI:<br />

77.8-85.1) and specificity <strong>of</strong> 82.4% (95% CI: 78.2-86.1).<br />

During the same time period, EUS-FNA had a sensitivity<br />

<strong>of</strong> 91.7% (95% CI: 89.3-93.7) and specificity <strong>of</strong> 96.8%<br />

(95% CI: 94.9-98.2). All pooled estimates during the three<br />

time periods are given in Table 4. The P f<strong>or</strong> chi-squared<br />

heterogeneity f<strong>or</strong> all the pooled accuracy estimates was<br />

> 0.1.<br />

www.wjgnet.com

---

A<br />

3032 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

0.0 0.2 0.4 0.6 0.8 1.0<br />

Specificity<br />

Bias estimates<br />

The bias calculations using Harb<strong>or</strong>d-Egger bias indicat<strong>or</strong><br />

gave a value <strong>of</strong> 1.08 (95% CI: -0.79-2.95, P = 0.29) f<strong>or</strong><br />

EUS studies without FNA and 2.02 (95% CI: 0.29-3.74,<br />

P = 0.04) f<strong>or</strong> studies with FNA. The Begg-Mazumdar<br />

indicat<strong>or</strong> f<strong>or</strong> bias gave a Kendall’s tau b value <strong>of</strong> 0.13<br />

(P = 0.36) f<strong>or</strong> studies without FNA and -0.19 (P = 0.07)<br />

f<strong>or</strong> studies with FNA. The funnel plots f<strong>or</strong> the studies<br />

without and with FNA are shown in Figure 6A and B.<br />

DISCUSSION<br />

Tio 1986<br />

Murata 1988<br />

Tio 1989<br />

Tio 1989<br />

Vilgrain 1990<br />

Tio 1990<br />

Rice 1991<br />

Ziegler 1991<br />

Heintz 1991<br />

Botet 1991<br />

Fok 1992<br />

Rosch 1992<br />

Grimm 1993<br />

Yoshikane 1993<br />

Dittler 1993<br />

Catalano 1994<br />

Peters 1994<br />

McLoughlin 1995<br />

Binmoeller 1995<br />

Francois 1996<br />

Hunerbein 1996<br />

Hasegawa 1996<br />

Natsugoe 1996<br />

Vikers 1997<br />

Shimizu 1997<br />

Milena 1997<br />

Vikers 1998<br />

Pham 1998<br />

Salminen 1999<br />

Giovannini 1999<br />

Catalano 1999<br />

Krasna 1999<br />

Nishimaki 1999<br />

Browrey 1999<br />

Heidemann 2000<br />

Nesje 2000<br />

Vazquez-Sequeiros 2001<br />

Wiersema 2001<br />

Kienle 2002<br />

Wakelin 2002<br />

Schwartz 2002<br />

Arima 2003<br />

Wu 2003<br />

DeWitt 2005<br />

Specificity (95% CI)<br />

1.00 (0.86-1.00)<br />

0.88 (0.86-0.90)<br />

0.56 (0.35-0.75)<br />

0.54 (0.33-0.74)<br />

0.99 (0.96-1.00)<br />

0.75 (0.61-0.86)<br />

0.70 (0.35-0.93)<br />

0.75 (0.43-0.95)<br />

1.00 (0.59-1.00)<br />

0.64 (0.35-0.87)<br />

0.86 (0.64-0.97)<br />

0.42 (0.20-0.67)<br />

0.80 (0.59-0.93)<br />

0.85 (0.55-0.98)<br />

0.56 (0.43-0.68)<br />

0.75 (0.58-0.88)<br />

0.40 (0.12-0.74)<br />

0.75 (0.19-0.99)<br />

0.44 (0.14-0.79)<br />

1.00 (0.69-1.00)<br />

0.67 (0.09-0.99)<br />

0.80 (0.44-0.97)<br />

0.88 (0.71-0.96)<br />

0.57 (0.29-0.82)<br />

0.98 (0.96-0.99)<br />

0.94 (0.73-1.00)<br />

0.58 (0.28-0.85)<br />

0.58 (0.28-0.85)<br />

0.33 (0.10-0.65)<br />

1.00 (0.88-1.00)<br />

0.63 (0.49-0.76)<br />

0.61 (0.48-0.72)<br />

0.59 (0.45-0.72)<br />

0.80 (0.28-0.99)<br />

0.81 (0.70-0.89)<br />

0.75 (0.35-0.97)<br />

0.82 (0.48-0.98)<br />

0.57 (0.18-0.90)<br />

0.71 (0.57-0.83)<br />

0.68 (0.43-0.87)<br />

1.00 (0.97-1.00)<br />

0.90 (0.74-0.98)<br />

0.75 (0.43-0.95)<br />

0.61 (0.45-0.75)<br />

Pooled specificity = 0.85 (0.83 to 0.86)<br />

Diagnosing the c<strong>or</strong>rect etiology f<strong>or</strong> mediastinal lymphadenopathy<br />

helps direct precise therapy and prognosis.<br />

Th<strong>or</strong>acoscopic procedures f<strong>or</strong> tissue biopsy carry a risk <strong>of</strong><br />

complications in 25%-35% <strong>of</strong> cases [9,10] . The advantage <strong>of</strong><br />

EUS is the ability to perf<strong>or</strong>m FNA during the procedure<br />

f<strong>or</strong> tissue diagnosis. The procedure is, in comparison<br />

with other alternative options, safe, less invasive, and<br />

does not require general anesthesia <strong>or</strong> hospitalization [107] .<br />

The complication rate is extremely low (0.5%-2.3%)<br />

with several studies rep<strong>or</strong>ting no complications [48,77,83,107] .<br />

Modalities using FNA, such as transbronchial, computed<br />

B<br />

0.0 0.2 0.4 0.6 0.8 1.0<br />

Specificity<br />

Kondo 1990<br />

Specificity (95% CI)<br />

0.97 (0.96-0.99)<br />

Schuder 1991 0.71 (0.49-0.87)<br />

Giovannini 1995 1.00 (0.96-1.00)<br />

Silvestri 1995 1.00 (0.66-1.00)<br />

Hunerbein 1998 1.00 (0.48-1.00)<br />

Gress 1997<br />

0.83 (0.61-0.95)<br />

Wiersema 1997 0.93 (0.66-1.00)<br />

Hunerbein 1998 0.40 (0.05-0.85)<br />

Hunerbein 1998 0.40 (0.05-0.85)<br />

Giovannini 1999 1.00 (0.88-1.00)<br />

Williams 1999 1.00 (0.74-1.00)<br />

Fritscher-Ravens 1999 1.00 (0.54-1.00)<br />

Mishra 1999<br />

1.00 (0.97-1.00)<br />

Fritscher-Ravens 2000 0.94 (0.71-1.00)<br />

Fritscher-Ravens 2000 1.00 (0.66-1.00)<br />

Savides 2000 1.00 (0.86-1.00)<br />

Fritscher-Ravens 2000 1.00 (0.94-1.00)<br />

Chhieng 2001 1.00 (0.96-1.00)<br />

Wiersema 2001 1.00 (0.89-1.00)<br />

Wallace 2001 0.77 (0.56-0.91)<br />

Vazquez-Sequeiros 2001 0.50 (0.01-0.99)<br />

Schwartz 2002 1.00 (0.97-1.00)<br />

Devereaux 2002 0.33 (0.01-0.91)<br />

Catalano 2002 0.92 (0.75-0.99)<br />

Arima 2003<br />

0.90 (0.74-0.98)<br />

Kramer 2004<br />

1.00 (0.74-1.00)<br />

Pellise 2004<br />

0.50 (0.01-0.99)<br />

Tournoy 2005 1.00 (0.40-1.00)<br />

Walsh 2005<br />

1.00 (0.69-1.00)<br />

Beek 2006<br />

1.00 (0.82-1.00)<br />

Pedersen 1996 1.00 (0.29-1.00)<br />

Pooled specificity = 0.96 (0.95 to 0.97)<br />

Figure 3 F<strong>or</strong>rest plots. A: Specificity <strong>of</strong> EUS alone in diagnosing mediastinal lymphadenopathy. B: Specificity <strong>of</strong> EUS-FNA alone in diagnosing mediastinal lymphadenopathy.<br />

www.wjgnet.com<br />

tomography, <strong>or</strong> th<strong>or</strong>acoscopic procedure, cannot be used<br />

f<strong>or</strong> the entire mediastinum [2-13] . EUS has the ability to image<br />

the a<strong>or</strong>topulmonary window, the subcarinal nodes, inferi<strong>or</strong><br />

mediastinum, and entire posteri<strong>or</strong> part <strong>of</strong> the mediastinum.<br />

This meta-analysis and systematic review was written<br />

in acc<strong>or</strong>dance with the proposal f<strong>or</strong> rep<strong>or</strong>ting by the<br />

QUOROM (Quality <strong>of</strong> Rep<strong>or</strong>ting <strong>of</strong> Meta-analyses)<br />

statement [7] . This meta-analysis and systematic review<br />

shows that the pooled sensitivity <strong>of</strong> EUS f<strong>or</strong> mediastinal<br />

lymphadenopathy is high and use <strong>of</strong> FNA during the<br />

procedure, further increases such sensitivity. The pooled<br />

specificity f<strong>or</strong> diagnosing mediastinal lymphadenopathy<br />

is also high with substantial improvement if FNA is<br />

perf<strong>or</strong>med during the procedure (from 84.6% to 96.4%).<br />

Diagnostic odds ratio is defined as the odds <strong>of</strong> having a<br />

positive test in patients with true anatomic disease when<br />

compared to patients who do not have the disease. EUS<br />

has a very high diagnostic odds ratio f<strong>or</strong> mediastinal<br />

lymphadenopathy. F<strong>or</strong> example, if EUS indicates<br />

mediastinal lymphadenopathy and if FNA is perf<strong>or</strong>med on<br />

the enlarged nodes, the patient has odds <strong>of</strong> 106 times to<br />

have the c<strong>or</strong>rect etiology f<strong>or</strong> lymph node enlargement. If<br />

EUS shows mediastinal lymphadenopathy, then the nodes

---

0.001 1 1000.0<br />

Diagnostic odds ratio<br />

Sensitivity<br />

Puli SR et al . EUS f<strong>or</strong> diagnosing mediastinal lymphadenopathy: A meta-analysis 3033<br />

1.0<br />

0.9<br />

0.8<br />

0.7<br />

0.6<br />

0.5<br />

0.4<br />

0.3<br />

0.2<br />

0.1<br />

SROC curve<br />

Kondo 1990<br />

Schuder 1991<br />

Giovannini 1995<br />

Silvestri 1995<br />

Hunerbein 1996<br />

Gress 1997<br />

Wiersema 1997<br />

Hunerbein 1998<br />

Hunerbein 1998<br />

Giovannini 1999<br />

Williams 1999<br />

Fritscher-Ravens 1999<br />

Mishra 1999<br />

Fritscher-Ravens 2000<br />

Fritscher-Ravens 2000<br />

Savides 2000<br />

Fritscher-Ravens 2000<br />

Chhieng 2001<br />

Wiersema 2001<br />

Wallace 2001<br />

Vazquez-Sequeiros 2001<br />

Schwartz 2002<br />

Devereaux 2002<br />

Catalano 2002<br />

Arima 2003<br />

Kramer 2004<br />

Pellise 2004<br />

Tournoy 2005<br />

Walsh 2005<br />

Beek 2006<br />

Pedersen 1996<br />

0.0<br />

0.0 0.2 0.4 0.6 0.8 1.0<br />

1-Specificity<br />

Figure 5 SROC f<strong>or</strong> EUS to diagnose mediastinal lymphadenopathy.<br />

should be biopsied by FNA to improve the diagnostic<br />

accuracy.<br />

The positive likelihood ratio measures how well a test<br />

identifies a disease state. The higher the positive likelihood<br />

ratio, the better the test perf<strong>or</strong>ms in identifying the c<strong>or</strong>rect<br />

disease state. The negative likelihood ratio <strong>of</strong> the same test<br />

measures how well the test perf<strong>or</strong>ms in excluding a disease<br />

state. The lower the negative likelihood ratio, the better<br />

the test perf<strong>or</strong>ms in excluding a disease. F<strong>or</strong> mediastinal<br />

lymphadenopathy, EUS has a high positive likelihood ratio<br />

and low negative likelihood ratio. This indicates that EUS<br />

perf<strong>or</strong>ms better in diagnosing and excluding mediastinal<br />

lymphadenopathy. F<strong>or</strong> mediastinal lymphadenopathy, all<br />

the pooled accuracy estimates <strong>of</strong> EUS are higher if FNA<br />

Diagnostic OR (95% CI)<br />

44.57 (20.78-95.58)<br />

7.29 (1.17-45.26)<br />

1305.77 (72.01-23 678.38)<br />

125.40 (5.43-2895.91)<br />

47.67 (1.60-1422.71)<br />

30.08 (5.92-152.99)<br />

106.60 (11.40-997.17)<br />

6.67 (0.44-101.73)<br />

6.00 (0.39-92.28)<br />

386.33 (14.50-10 291.97)<br />

154.41 (8.34-2857.60)<br />

82.33 (2.88-2352.62)<br />

3135.00 (58.03-169 351.42)<br />

407.00 (15.49-10 694.83)<br />

323.00 (12.08-8637.17)<br />

969.00 (37.76-24 863.76)<br />

1353.67 (75.87-24 152.20)<br />

4347.00 (81.96-230 555.93)<br />

1219.40 (56.66-26 241.50)<br />

30.00 (5.36-167.93)<br />

14.00 (0.62-317.38)<br />

33 785.00 (663.07-1 721 422.20)<br />

55.80 (1.78-1747.72)<br />

102.00 (17.27-602.43)<br />

447.86 (22.09-9078.18)<br />

87.07 (4.86-1561.02)<br />

2.00 (0.09-44.35)<br />

31.67 (1.60-625.72)<br />

231.00 (8.58-6218.18)<br />

351.00 (15.87-7762.98)<br />

91.00 (1.46-5656.54)<br />

Pooled diagnostic odds ratio = 106.92 (54.36 to 210.29)<br />

Symmetric SROC<br />

AUC = 0.9592<br />

SE (AUC) = 0.0103<br />

Q* = 0.9034<br />

SE (Q*) = 0.0149<br />

Figure 4 F<strong>or</strong>rest plot showing diagnostic<br />

odds ratio <strong>of</strong> EUS-FNA in identifying mediastinal<br />

lymphadenopathy.<br />

Table 3 Pooled diagnostic accuracy estimates <strong>of</strong> EUS alone and<br />

EUS-FNA<br />

EUS EUS-FNA<br />

Studies 44 32<br />

Pooled sensitivity 84.7% (82.9-86.4) 88.0% (85.8-90.0)<br />

Pooled specificity 84.6% (83.2-85.9) 96.4% (95.3-97.4)<br />

Positive likelihood ratio 3.3 (2.6-4.3) 11.2 (5.9-21.2)<br />

Negative likelihood ratio 0.24 (0.1-0.3) 0.13 (0.1-0.2)<br />

Diagnostic odds ratio 19.1 (12.7-28.5) 106.9 (54.4-210.3)<br />

Area under the curve 0.91 0.97<br />

is perf<strong>or</strong>med during the procedure. Also, these pooled<br />

estimates give a baseline f<strong>or</strong> future study comparisons.<br />

The EUS studies with FNA were grouped into time<br />

periods and analyzed to standardize the criteria and the<br />

technology <strong>of</strong> EUS over the past two decades. Over the<br />

last two decades, the sensitivity and specificity <strong>of</strong> EUS<br />

with FNA has substantially improved.<br />

Due to the possibility <strong>of</strong> different studies using slightly<br />

different criteria f<strong>or</strong> diagnosis, heterogeneity among the<br />

studies was tested by drawing SROC curves and finding<br />

the AUC. An AUC <strong>of</strong> 1 f<strong>or</strong> any test indicates that the test<br />

is excellent. SROC curves f<strong>or</strong> EUS showed that the value<br />

f<strong>or</strong> AUC was very close to 1, indicating that EUS is an<br />

excellent test to diagnose mediastinal lymphadenopathy.<br />

Publication bias and selection bias may affect the summary<br />

estimates. Studies with statistically significant results tend<br />

to be published and cited. Smaller studies may show larger<br />

treatment effects due to fewer case-mix differences (e.g.<br />

patients with only early <strong>or</strong> late disease) than larger trials. This<br />

bias can be estimated by bias indicat<strong>or</strong>s and construction <strong>of</strong><br />

www.wjgnet.com

---

A<br />

Standard err<strong>or</strong><br />

3034 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

0.00<br />

0.75<br />

1.50<br />

1 LR+: Positive likelihood ratio; 2 LR-: Negative likelihood ratio; 3 DOR: Diagnostic odds ratio.<br />

funnel plots. Bias among studies can affect the shape <strong>of</strong> the<br />

funnel plot. In this meta-analysis and systematic review, bias<br />

calculations using Harb<strong>or</strong>d-Egger indicat<strong>or</strong> [36] and Begg-<br />

Mazumdar indicat<strong>or</strong> [37] showed no statistically significant<br />

bias f<strong>or</strong> EUS studies without FNA. Furtherm<strong>or</strong>e, funnel<br />

plot analyses showed no significant bias f<strong>or</strong> EUS without<br />

FNA and EUS-FNA studies (Figure 6B).<br />

In conclusion, EUS has high sensitivity and specificity to<br />

evaluate mediastinal lymphadenopathy. This meta-analysis<br />

demonstrates that FNA substantially improves the specificity<br />

<strong>of</strong> EUS in evaluating mediastinal lymphadenopathy. EUS<br />

with FNA should be the diagnostic test <strong>of</strong> choice f<strong>or</strong><br />

evaluating mediastinal lymphadenopathy.<br />

REFERENCES<br />

1 Genereux GP, Howie JL. N<strong>or</strong>mal mediastinal lymph node<br />

size and number: CT and anatomic study. AJR Am J Roentgenol<br />

1984; 142: 1095-1100<br />

2 Arita T, Kuramitsu T, Kawamura M, Matsumoto T, Matsunaga<br />

N, Sugi K, Esato K. Bronchogenic carcinoma: incidence <strong>of</strong><br />

metastases to n<strong>or</strong>mal sized lymph nodes. Th<strong>or</strong>ax 1995; 50:<br />

1267-1269<br />

3 Izbicki JR, Thetter O, Karg O, Kreusser T, Passlick B, Trupka<br />

A, Haussinger K, Woeckel W, Kenn RW, Wilker DK. Accuracy<br />

<strong>of</strong> computed tomographic scan and surgical assessment f<strong>or</strong><br />

staging <strong>of</strong> bronchial carcinoma. A prospective study. J Th<strong>or</strong>ac<br />

Cardiovasc Surg 1992; 104: 413-420<br />

4 McLoud TC, Bourgouin PM, Greenberg RW, Kosiuk JP,<br />

Templeton PA, Shepard JA, Mo<strong>or</strong>e EH, Wain JC, Mathisen DJ,<br />

Grillo HC. Bronchogenic carcinoma: analysis <strong>of</strong> staging in the<br />

mediastinum with CT by c<strong>or</strong>relative lymph node mapping<br />

and sampling. Radiology 1992; 182: 319-323<br />

5 McKenna RJ Jr, Libshitz HI, Mountain CE, McMurtrey<br />

MJ. Roentgenographic evaluation <strong>of</strong> mediastinal nodes f<strong>or</strong><br />

www.wjgnet.com<br />

Bias assessment plot<br />

2.25<br />

-4 -2 0 2 4 6<br />

Log (Odds ratio)<br />

B<br />

Standard err<strong>or</strong><br />

0.00<br />

0.75<br />

1.50<br />

Bias assessment plot<br />

2.25<br />

-5.0 -2.5 0.0 2.5 5.0<br />

Log (Odds ratio)<br />

Table 4 Pooled diagnostic accuracy estimates <strong>of</strong> EUS alone and EUS-FNA f<strong>or</strong> different time periods<br />

with 95% CI<br />

Time period No. <strong>of</strong> studies Pooled sensitivity Pooled specificity Pooled LR+1 Pooled LR-2 Pooled DOR3<br />

EUS without FNA<br />

1988 to 1994 17 88.0% (85.4-90.2) 85.2% (83.4-86.9) 3.6 (2.4-5.4) 0.2 (0.1-0.3) 27.5 (14.5-52.4)<br />

1995 to 1999 17 82.6% (78.8-85.9) 84.4% (81.6-86.9) 3.0 (2.0-4.5) 0.3 (0.2-0.4) 14.8 (7.5-29.3)<br />

2000 to 2005 10 81.6% (77.8-85.1) 82.4% (78.2-86.1) 3.4 (2.2-5.3) 0.3 (0.2-0.4) 14.9 (6.7-33.1)<br />

EUS-FNA<br />

1988 to 1994 4 71.8% (63.9-78.9) 96.8% (94.9-98.1) 15.5 (2.4-101.2) 0.3 (0.1-0.6) 61.8 (10.5-63.8)<br />

1995 to 1999 10 88.9% (83.5-93.0) 94.7% (90.7-97.3) 8.1 (2.8-23.3) 0.1 (0.1-0.2) 57.0 (20.7-57.1)<br />

2000 to 2005 18 91.7% (89.3-93.7) 96.8% (94.9-98.2) 12.5 (5.2-29.8) 0.1 (0.1-0.2) 17.7 (5.0-62.8)<br />

Figure 6 Funnel plots. A: Bias<br />

assessment f<strong>or</strong> EUS studies<br />

w i t h o u t F N A i n e x a m i n i n g<br />

mediastinal lymphadenopathy; B:<br />

Bias assessment f<strong>or</strong> EUS-FNA<br />

studies in examining mediastinal<br />

lymphadenopathy.<br />

preoperative assessment in lung cancer. Chest 1985; 88: 206-210<br />

6 Kondo D, Imaizumi M, Abe T, Naruke T, Suemasu K.<br />

Endoscopic ultrasound examination f<strong>or</strong> mediastinal lymph<br />

node metastases <strong>of</strong> lung cancer. Chest 1990; 98: 586-593<br />

7 Harrow EM, Oldenburg FA Jr, Lingenfelter MS, Smith AM Jr.<br />

Transbronchial needle aspiration in clinical <strong>practice</strong>. A fiveyear<br />

experience. Chest 1989; 96: 1268-1272<br />

8 Harrow EM, Wang KP. The staging <strong>of</strong> lung cancer by<br />

bronchoscopic transbronchial needle aspiration. Chest Surg<br />

Clin N Am 1996; 6: 223-235<br />

9 Salazar AM, Westcott JL. The role <strong>of</strong> transth<strong>or</strong>acic needle<br />

biopsy f<strong>or</strong> the diagnosis and staging <strong>of</strong> lung cancer. Clin Chest<br />

Med 1993; 14: 99-110<br />

10 Gardner D, vanSonnenberg E, D'Agostino HB, Casola G,<br />

Taggart S, May S. CT-guided transth<strong>or</strong>acic needle biopsy.<br />

Cardiovasc Intervent Radiol 1991; 14: 17-23<br />

11 Lopez L, Varela A, Freixinet J, Quevedo S, Lopez Pujol J,<br />

Rodriguez de Castro F, Salvatierra A. Extended cervical<br />

mediastinoscopy: prospective study <strong>of</strong> fifty cases. Ann Th<strong>or</strong>ac<br />

Surg 1994; 57: 555-557; discussion 557-558<br />

12 Barendregt WB, Deleu HW, Joosten HJ, Berg W, Janssen JP.<br />

The value <strong>of</strong> parasternal mediastinoscopy in staging bronchial<br />

carcinoma. Eur J Cardioth<strong>or</strong>ac Surg 1995; 9: 655-658<br />

13 Merav AD. The role <strong>of</strong> mediastinoscopy and anteri<strong>or</strong><br />

mediastinotomy in determining operability <strong>of</strong> lung cancer: a<br />

review <strong>of</strong> published questions and answers. Cancer Invest 1991;<br />

9: 439-442<br />

14 Landreneau RJ, Hazelrigg SR, Mack MJ, Fitzgibbon LD,<br />

Dowling RD, Acuff TE, Keenan RJ, Ferson PF. Th<strong>or</strong>acoscopic<br />

mediastinal lymph node sampling: useful f<strong>or</strong> mediastinal<br />

lymph node stations inaccessible by cervical mediastinoscopy.<br />

J Th<strong>or</strong>ac Cardiovasc Surg 1993; 106: 554-558<br />

15 Heintz A, Mildenberger P, Ge<strong>or</strong>g M, Braunstein S, Junginger<br />

T. Endoscopic ultrasonography in the diagnosis <strong>of</strong> regional<br />

lymph nodes in esophageal and gastric cancer--results <strong>of</strong><br />

studies in vitro. Endoscopy 1993; 25: 231-235<br />

16 Kaufman AR, Sivak MV Jr. Endoscopic ultrasonography in<br />

the differential diagnosis <strong>of</strong> pancreatic disease. Gastrointest

---

Puli SR et al . EUS f<strong>or</strong> diagnosing mediastinal lymphadenopathy: A meta-analysis 3035<br />

Endosc 1989; 35: 214-219<br />

17 Arima M, Tada M. Endoscopic ultrasound-guided fine needle<br />

aspiration biopsy in esophageal and mediastinal diseases:<br />

Clinical indications and results. Dig Endosc 2003; 15: 93-99<br />

18 McLoughlin RF, Cooperberg PL, Mathieson JR, St<strong>or</strong>dy SN,<br />

Halparin LS. High resolution endoluminal ultrasonography<br />

in the staging <strong>of</strong> esophageal carcinoma. J Ultrasound Med 1995;<br />

14: 725-730<br />

19 Gress FG, Savides TJ, Sandler A, Kesler K, Conces D,<br />

Cummings O, Mathur P, Ikenberry S, Bilderback S, Hawes R.<br />

Endoscopic ultrasonography, fine-needle aspiration biopsy<br />

guided by endoscopic ultrasonography, and computed<br />

tomography in the preoperative staging <strong>of</strong> non-small-cell lung<br />

cancer: a comparison study. Ann Intern Med 1997; 127: 604-612<br />

20 Schwartz DA, Unni KK, Levy MJ, Clain JE, Wiersema MJ.<br />

The rate <strong>of</strong> false-positive results with EUS-guided fine-needle<br />

aspiration. Gastrointest Endosc 2002; 56: 868-872<br />

21 Pedersen BH, Vilmann P, Folke K, Jacobsen GK, Krasnik M,<br />

Milman N, Hancke S. Endoscopic ultrasonography and realtime<br />

guided fine-needle aspiration biopsy <strong>of</strong> solid lesions <strong>of</strong><br />

the mediastinum suspected <strong>of</strong> malignancy. Chest 1996; 110:<br />

539-544<br />

22 Devereaux BM, Leblanc JK, Yousif E, Kesler K, Brooks J,<br />

Mathur P, Sandler A, Chappo J, Lehman GA, Sherman S,<br />

Gress F, Ciaccia D. Clinical utility <strong>of</strong> EUS-guided fine-needle<br />

aspiration <strong>of</strong> mediastinal masses in the absence <strong>of</strong> known<br />

pulmonary malignancy. Gastrointest Endosc 2002; 56: 397-401<br />

23 Pellise M, Castells A, Gines A, Agrelo R, Sole M, Castellvi-<br />

Bel S, Fernandez-Esparrach G, Llach J, Esteller M, B<strong>or</strong>das<br />

JM, Pique JM. Detection <strong>of</strong> lymph node micrometastases by<br />

gene promoter hypermethylation in samples obtained by<br />

endosonography- guided fine-needle aspiration biopsy. Clin<br />

Cancer Res 2004; 10: 4444-4449<br />

24 Kondo D, Imaizumi M, Abe T, Naruke T, Suemasu K.<br />

Endoscopic ultrasound examination f<strong>or</strong> mediastinal lymph<br />

node metastases <strong>of</strong> lung cancer. Chest 1990; 98: 586-593<br />

25 Schuder G, Isringhaus H, Kubale B, Seitz G, Sybrecht GW.<br />

Endoscopic ultrasonography <strong>of</strong> the mediastinum in the<br />

diagnosis <strong>of</strong> bronchial carcinoma. Th<strong>or</strong>ac Cardiovasc Surg 1991;<br />

39: 299-303<br />

26 Moher D, Cook DJ, Eastwood S, Olkin I, Rennie D, Stroup<br />

DF. Improving the quality <strong>of</strong> rep<strong>or</strong>ts <strong>of</strong> meta-analyses <strong>of</strong><br />

randomised controlled trials: the QUOROM statement. Quality<br />

<strong>of</strong> Rep<strong>or</strong>ting <strong>of</strong> Meta-analyses. Lancet 1999; 354: 1896-1900<br />

27 Bossuyt PM, Reitsma JB, Bruns DE, Gatsonis CA, Glasziou PP,<br />

Irwig LM, Lijmer JG, Moher D, Rennie D, de Vet HC. Towards<br />

complete and accurate rep<strong>or</strong>ting <strong>of</strong> studies <strong>of</strong> diagnostic<br />

accuracy: the STARD initiative. The Standards f<strong>or</strong> Rep<strong>or</strong>ting<br />

<strong>of</strong> Diagnostic Accuracy Group. Croat Med J 2003; 44: 635-638<br />

28 Jadad AR, Mo<strong>or</strong>e RA, Carroll D, Jenkinson C, Reynolds DJ,<br />

Gavaghan DJ, McQuay HJ. Assessing the quality <strong>of</strong> rep<strong>or</strong>ts <strong>of</strong><br />

randomized clinical trials: is blinding necessary? Control Clin<br />

Trials 1996; 17: 1-12<br />

29 Stroup DF, Berlin JA, M<strong>or</strong>ton SC, Olkin I, Williamson GD,<br />

Rennie D, Moher D, Becker BJ, Sipe TA, Thacker SB. Metaanalysis<br />

<strong>of</strong> observational studies in epidemiology: a proposal<br />

f<strong>or</strong> rep<strong>or</strong>ting. Meta-analysis Of Observational Studies in<br />

Epidemiology (MOOSE) group. JAMA 2000; 283: 2008-2012<br />

30 Puli SR, Singh S, Haged<strong>or</strong>n CH, Reddy J, Olyaee M.<br />

Diagnostic accuracy <strong>of</strong> EUS f<strong>or</strong> vascular invasion in pancreatic<br />

and periampullary cancers: a meta-analysis and systematic<br />

review. Gastrointest Endosc 2007; 65: 788-797<br />

31 Leemis LM, Trivedi KS. A Comparison <strong>of</strong> Approximate<br />

Interval Estimat<strong>or</strong>s f<strong>or</strong> the Bernoulli Parameter. Am Stat 1996;<br />

50: 63-68<br />

32 Cox DR. The analysis <strong>of</strong> binary data. London: Methuen, 1970<br />

33 Agresti A. Analysis <strong>of</strong> <strong>or</strong>dinal categ<strong>or</strong>ical data. New Y<strong>or</strong>k:<br />

John Wileys & Sons, 1984<br />

34 Deeks JJ. Systematic reviews <strong>of</strong> evaluations <strong>of</strong> diagnostic and<br />

screening tests. In: Egger M, Smith GD, Altman DG, edit<strong>or</strong>s.<br />

Systematic Reviews in Health Care: Meta-analysis in context.<br />

London: BMJ Books, 2001<br />

35 Harb<strong>or</strong>d RM, Egger M, Sterne JA. A modified test f<strong>or</strong> small-<br />

study effects in meta-analyses <strong>of</strong> controlled trials with binary<br />

endpoints. Stat Med 2006; 25: 3443-3457<br />

36 Begg CB, Mazumdar M. Operating characteristics <strong>of</strong> a rank<br />

c<strong>or</strong>relation test f<strong>or</strong> publication bias. Biometrics 1994; 50:<br />

1088-1101<br />

37 Sterne JA, Egger M, Smith GD. Systematic reviews in health<br />

care: Investigating and dealing with publication and other<br />

biases in meta-analysis. BMJ 2001; 323: 101-105<br />

38 Sterne JA, Egger M. Funnel plots f<strong>or</strong> detecting bias in metaanalysis:<br />

guidelines on choice <strong>of</strong> axis. J Clin Epidemiol 2001; 54:<br />

1046-1055<br />

39 Binmoeller KF, Seifert H, Seitz U, Izbicki JR, Kida M,<br />

Soehendra N. Ultrasonic esophagoprobe f<strong>or</strong> TNM staging <strong>of</strong><br />

highly stenosing esophageal carcinoma. Gastrointest Endosc<br />

1995; 41: 547-552<br />

40 Botet JF, Lightdale CJ, Zauber AG, Gerdes H, Urmacher C,<br />

Brennan MF. Preoperative staging <strong>of</strong> esophageal cancer:<br />

comparison <strong>of</strong> endoscopic US and dynamic CT. Radiology 1991;<br />

181: 419-425<br />

41 Bowrey DJ, Clark GW, Roberts SA, Maughan TS, Hawth<strong>or</strong>ne<br />

AB, Williams GT, Carey PD. Endosonographic staging <strong>of</strong> 100<br />

consecutive patients with esophageal carcinoma: introduction<br />

<strong>of</strong> the 8-mm esophagoprobe. Dis Esophagus 1999; 12: 258-263<br />

42 Catalano MF, Alcocer E, Chak A, Nguyen CC, Raijman I,<br />

Geenen JE, Lahoti S, Sivak MV Jr. Evaluation <strong>of</strong> metastatic<br />

celiac axis lymph nodes in patients with esophageal carcinoma:<br />

accuracy <strong>of</strong> EUS. Gastrointest Endosc 1999; 50: 352-356<br />

43 Catalano MF, Sivak MV Jr, Rice T, Gragg LA, Van Dam<br />

J. Endosonographic features predictive <strong>of</strong> lymph node<br />

metastasis. Gastrointest Endosc 1994; 40: 442-446<br />

44 DeWitt J, Kesler K, Brooks JA, LeBlanc J, McHenry L,<br />

McGreevy K, Sherman S. Endoscopic ultrasound f<strong>or</strong><br />

esophageal and gastroesophageal junction cancer: Impact <strong>of</strong><br />

increased use <strong>of</strong> primary neoadjuvant therapy on preoperative<br />

loc<strong>or</strong>egional staging accuracy. Dis Esophagus 2005; 18: 21-27<br />

45 Dittler HJ, Siewert JR. Role <strong>of</strong> endoscopic ultrasonography in<br />

esophageal carcinoma. Endoscopy 1993; 25: 156-161<br />

46 Fok M, Cheng SW, Wong J. Endosonography in patient<br />

selection f<strong>or</strong> surgical treatment <strong>of</strong> esophageal carcinoma.<br />

W<strong>or</strong>ld J Surg 1992; 16: 1098-1103; discussion 1103<br />

47 Francois E, Peroux J, Mouroux J, Chazalle M, Hastier P,<br />

Ferrero J, Simon J, Bourry J. Preoperative endosonographic<br />

staging <strong>of</strong> cancer <strong>of</strong> the cardia. Abdom Imaging 1996; 21: 483-487<br />

48 Giovannini M, Monges G, Seitz JF, Moutardier V, Bernardini<br />

D, Thomas P, Houvenaeghel G, Delpero JR, Giudicelli R,<br />

Fuentes P. Distant lymph node metastases in esophageal<br />

cancer: impact <strong>of</strong> endoscopic ultrasound-guided biopsy.<br />

Endoscopy 1999; 31: 536-540<br />

49 Grimm H, Binmoeller KF, Hamper K, Koch J, Henne-Bruns D,<br />

Soehendra N. Endosonography f<strong>or</strong> preoperative loc<strong>or</strong>egional<br />

staging <strong>of</strong> esophageal and gastric cancer. Endoscopy 1993; 25:<br />

224-230<br />

50 Hasegawa N, Niwa Y, Arisawa T, Hase S, Goto H, Hayakawa<br />

T. Preoperative staging <strong>of</strong> superficial esophageal carcinoma:<br />

comparison <strong>of</strong> an ultrasound probe and standard endoscopic<br />

ultrasonography. Gastrointest Endosc 1996; 44: 388-393<br />

51 Heidemann J, Schilling MK, Schmassmann A, Maurer CA,<br />

Buchler MW. Accuracy <strong>of</strong> endoscopic ultrasonography in<br />

preoperative staging <strong>of</strong> esophageal carcinoma. Dig Surg 2000;<br />

17: 219-224<br />

52 Heintz A, Hohne U, Schweden F, Junginger T. Preoperative<br />

detection <strong>of</strong> intrath<strong>or</strong>acic tum<strong>or</strong> spread <strong>of</strong> esophageal cancer:<br />

endosonography versus computed tomography. Surg Endosc<br />

1991; 5: 75-78<br />

53 Hunerbein M, Dohmoto M, Rau B, Schlag PM. Endosonography<br />

and endosonography-guided biopsy <strong>of</strong> upper-GI-tract tum<strong>or</strong>s<br />

using a curved-array echoendoscope. Surg Endosc 1996; 10:<br />

1205-1209<br />

54 Kallimanis GE, Gupta PK, al-Kawas FH, Tio LT, Benjamin<br />

SB, Bertagnolli ME, Nguyen CC, Gomes MN, Fleischer DE.<br />

Endoscopic ultrasound f<strong>or</strong> staging esophageal cancer, with <strong>or</strong><br />

without dilation, is clinically imp<strong>or</strong>tant and safe. Gastrointest<br />

Endosc 1995; 41: 540-546<br />

www.wjgnet.com

---

3036 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

55 Kienle P, Buhl K, Kuntz C, Dux M, Hartmann C, Axel B,<br />

Herfarth C, Lehnert T. Prospective comparison <strong>of</strong> endoscopy,<br />

endosonography and computed tomography f<strong>or</strong> staging <strong>of</strong><br />

tumours <strong>of</strong> the oesophagus and gastric cardia. Digestion 2002;<br />

66: 230-236<br />

56 Krasna MJ, Mao YS, Sonett J, Gamliel Z. The role <strong>of</strong><br />

th<strong>or</strong>acoscopic staging <strong>of</strong> esophageal cancer patients. Eur J<br />

Cardioth<strong>or</strong>ac Surg 1999; 16 Suppl 1: S31-S33<br />

57 Murata Y, Suzuki S, Hashimoto H. Endoscopic ultrasonography<br />

<strong>of</strong> the upper gastrointestinal tract. Surg Endosc 1988; 2: 180-183<br />

58 Natsugoe S, Yoshinaka H, M<strong>or</strong>inaga T, Shimada M, Baba M,<br />

Fukumoto T, Stein HJ, Aikou T. Ultrasonographic detection<br />

<strong>of</strong> lymph-node metastases in superficial carcinoma <strong>of</strong> the<br />

esophagus. Endoscopy 1996; 28: 674-679<br />

59 Nesje LB, Svanes K, Viste A, Laerum OD, Odegaard S.<br />

Comparison <strong>of</strong> a linear miniature ultrasound probe and a<br />

radial-scanning echoendoscope in TN staging <strong>of</strong> esophageal<br />

cancer. Scand J Gastroenterol 2000; 35: 997-1002<br />

60 Nishimaki T, Tanaka O, Ando N, Ide H, Watanabe H,<br />

Shinoda M, Takiyama W, Yamana H, Ishida K, Isono K, Endo<br />

M, Ikeuchi T, Mitomi T, Koizumi H, Imamura M, Iizuka T.<br />

Evaluation <strong>of</strong> the accuracy <strong>of</strong> preoperative staging in th<strong>or</strong>acic<br />

esophageal cancer. Ann Th<strong>or</strong>ac Surg 1999; 68: 2059-2064<br />

61 Peters JH, Hoeft SF, Heimbucher J, Bremner RM, DeMeester<br />

TR, Bremner CG, Clark GW, Kiyabu M, Parisky Y. Selection<br />

<strong>of</strong> patients f<strong>or</strong> curative <strong>or</strong> palliative resection <strong>of</strong> esophageal<br />

cancer <strong>based</strong> on preoperative endoscopic ultrasonography.<br />

Arch Surg 1994; 129: 534-539<br />

62 Pham T, Roach E, Falk GL, Chu J, Ngu MC, Jones DB.<br />

Staging <strong>of</strong> oesophageal carcinoma by endoscopic ultrasound:<br />

preliminary experience. Aust N Z J Surg 1998; 68: 209-212<br />

63 Rice TW, Boyce GA, Sivak MV. Esophageal ultrasound and<br />

the preoperative staging <strong>of</strong> carcinoma <strong>of</strong> the esophagus. J<br />

Th<strong>or</strong>ac Cardiovasc Surg 1991; 101: 536-543; discussion 543-544<br />

64 Rosch T, L<strong>or</strong>enz R, Zenker K, von Wichert A, Dancygier H,<br />

H<strong>of</strong>ler H, Siewert JR, Classen M. Local staging and assessment<br />

<strong>of</strong> resectability in carcinoma <strong>of</strong> the esophagus, stomach, and<br />

duodenum by endoscopic ultrasonography. Gastrointest Endosc<br />

1992; 38: 460-467<br />

65 Salminen JT, Farkkila MA, Ramo OJ, Toikkanen V, Simpanen<br />

J, Nuutinen H, Salo JA. Endoscopic ultrasonography<br />

in the preoperative staging <strong>of</strong> adenocarcinoma <strong>of</strong> the<br />

distal oesophagus and oesophagogastric junction. Scand J<br />

Gastroenterol 1999; 34: 1178-1182<br />

66 Schwartz DA, Unni KK, Levy MJ, Clain JE, Wiersema MJ.<br />

The rate <strong>of</strong> false-positive results with EUS-guided fine-needle<br />

aspiration. Gastrointest Endosc 2002; 56: 868-872<br />

67 Shimizu Y, Mera K, Tsukagoshi H, Takamasa M, Kawarazaki<br />

M, Watanabe Y, Nakasato T, Oohara M, Hosokawa M, Fujita<br />

M, Asaka M. Endoscopic Ultrasonography f<strong>or</strong> the Detection <strong>of</strong><br />

Lymph Node Metastasis in Superficial Esophageal Carcinoma.<br />

Dig Endosc 1997; 9: 178-182<br />

68 Tio TL, Coene PP, den Hartog Jager FC, Tytgat GN. Preoperative<br />

TNM classification <strong>of</strong> esophageal carcinoma by<br />

endosonography. Hepatogastroenterology 1990; 37: 376-381<br />

69 Tio TL, Coene PP, Schouwink MH, Tytgat GN. Esophagogastric<br />

carcinoma: preoperative TNM classification with endosonography.<br />

Radiology 1989; 173: 411-417<br />

70 Tio TL, Cohen P, Coene PP, Udding J, den Hartog Jager FC,<br />

Tytgat GN. Endosonography and computed tomography <strong>of</strong><br />

esophageal carcinoma. Preoperative classification compared<br />

to the new (1987) TNM system. Gastroenterology 1989; 96:<br />

1478-1486<br />

71 Tio TL, den Hartog Jager FC, Tytgat GN. The role <strong>of</strong> endoscopic<br />

ultrasonography in assessing local resectability <strong>of</strong> oesophagogastric<br />

malignancies. Accuracy, pitfalls, and predictability. Scand J<br />

Gastroenterol Suppl 1986; 123: 78-86<br />

72 Vazquez-Sequeiros E, N<strong>or</strong>ton ID, Clain JE, Wang KK, Affi A,<br />

Allen M, Deschamps C, Miller D, Salomao D, Wiersema MJ.<br />

Impact <strong>of</strong> EUS-guided fine-needle aspiration on lymph node<br />

staging in patients with esophageal carcinoma. Gastrointest<br />

Endosc 2001; 53: 751-757<br />

73 Vickers J, Alderson D. Influence <strong>of</strong> luminal obstruction on<br />

www.wjgnet.com<br />

oesophageal cancer staging using endoscopic ultrasonography.<br />

Br J Surg 1998; 85: 999-1001<br />

74 Vickers J. Role <strong>of</strong> endoscopic ultrasound in the preoperative<br />

assessment <strong>of</strong> patients with oesophageal cancer. Ann R Coll<br />

Surg Engl 1998; 80: 233-239<br />

75 Vilgrain V, Mompoint D, Palazzo L, Menu Y, Gayet B, Ollier<br />

P, Nahum H, Fekete F. Staging <strong>of</strong> esophageal carcinoma:<br />

comparison <strong>of</strong> results with endoscopic sonography and CT.<br />

AJR Am J Roentgenol 1990; 155: 277-281<br />

76 Wakelin SJ, Deans C, Cr<strong>of</strong>ts TJ, Allan PL, Plevris JN, Paterson-<br />

Brown S. A comparison <strong>of</strong> computerised tomography,<br />

laparoscopic ultrasound and endoscopic ultrasound in the<br />

preoperative staging <strong>of</strong> oesophago-gastric carcinoma. Eur J<br />

Radiol 2002; 41: 161-167<br />

77 Wiersema MJ, Vazquez-Sequeiros E, Wiersema LM. Evaluation<br />

<strong>of</strong> mediastinal lymphadenopathy with endoscopic US-guided<br />

fine-needle aspiration biopsy. Radiology 2001; 219: 252-257<br />

78 Wu LF, Wang BZ, Feng JL, Cheng WR, Liu GR, Xu XH, Zheng<br />

ZC. Preoperative TN staging <strong>of</strong> esophageal cancer: comparison<br />

<strong>of</strong> miniprobe ultrasonography, spiral CT and MRI. W<strong>or</strong>ld J<br />

Gastroenterol 2003; 9: 219-224<br />

79 Yoshikane H, Tsukamoto Y, Niwa Y, Goto H, Hase S, Shimodaira<br />

M, Maruta S, Miyata A, Yoshida M. Superficial esophageal<br />

carcinoma: evaluation by endoscopic ultrasonography. Am J<br />

Gastroenterol 1994; 89: 702-707<br />

80 Ziegler K, Sanft C, Zeitz M, Friedrich M, Stein H, Haring R,<br />

Riecken EO. Evaluation <strong>of</strong> endosonography in TN staging <strong>of</strong><br />

oesophageal cancer. Gut 1991; 32: 16-20<br />

81 Giovannini M, Monges G, Seitz JF, Moutardier V, Bernardini<br />

D, Thomas P, Houvenaeghel G, Delpero JR, Giudicelli R,<br />

Fuentes P. Distant lymph node metastases in esophageal<br />

cancer: impact <strong>of</strong> endoscopic ultrasound-guided biopsy.<br />

Endoscopy 1999; 31: 536-540<br />

82 Giovannini M, Seitz JF, Monges G, Perrier H, Rabbia I. Fineneedle<br />

aspiration cytology guided by endoscopic ultrasonography:<br />

results in 141 patients. Endoscopy 1995; 27: 171-177<br />

83 Silvestri GA, H<strong>of</strong>fman BJ, Bhutani MS, Hawes RH, Coppage L,<br />

Sanders-Cliette A, Reed CE. Endoscopic ultrasound with fineneedle<br />

aspiration in the diagnosis and staging <strong>of</strong> lung cancer.<br />

Ann Th<strong>or</strong>ac Surg 1996; 61: 1441-1445; discussion 1445-1446<br />

84 Fritscher-Ravens A, Soehendra N, Schirrow L, Sriram PV,<br />

Meyer A, Hauber HP, Pf<strong>or</strong>te A. Role <strong>of</strong> transesophageal<br />

endosonography-guided fine-needle aspiration in the diagnosis<br />

<strong>of</strong> lung cancer. Chest 2000; 117: 339-345<br />

85 Wiersema MJ, Vazquez-Sequeiros E, Wiersema LM.<br />

Evaluation <strong>of</strong> mediastinal lymphadenopathy with endoscopic<br />

US-guided fine-needle aspiration biopsy. Radiology 2001; 219:<br />

252-257<br />

86 Kramer H, van Putten JW, Post WJ, van Dullemen HM,<br />

Bongaerts AH, Pruim J, Suurmeijer AJ, Klinkenberg TJ, Groen<br />

H, Groen HJ. Oesophageal endoscopic ultrasound with fine<br />

needle aspiration improves and simplifies the staging <strong>of</strong> lung<br />

cancer. Th<strong>or</strong>ax 2004; 59: 596-601<br />

87 van Beek FT, Maas KW, Timmer R, Seldenrijk CA, de Bruin<br />

PC, Schramel FM. Oesophageal endoscopic ultrasound with<br />

fine-needle aspiration biopsy in the staging <strong>of</strong> non-small-cell<br />

lung carcinoma; results from 43 patients. Ned Tijdschr Geneeskd<br />

2006; 150: 144-150<br />

88 Tournoy KG, Praet MM, Van Maele G, Van Meerbeeck JP.<br />

Esophageal endoscopic ultrasound with fine-needle aspiration<br />

with an on-site cytopathologist: high accuracy f<strong>or</strong> the<br />

diagnosis <strong>of</strong> mediastinal lymphadenopathy. Chest 2005; 128:<br />

3004-3009<br />

89 Williams DB, Sahai AV, Aabakken L, Penman ID, van Velse<br />

A, Webb J, Wilson M, H<strong>of</strong>fman BJ, Hawes RH. Endoscopic<br />

ultrasound guided fine needle aspiration biopsy: a large single<br />

centre experience. Gut 1999; 44: 720-726<br />

90 Hunerbein M, Dohmoto M, Rau B, Schlag PM. Endosonography<br />

and endosonography-guided biopsy <strong>of</strong> upper-GI-tract tum<strong>or</strong>s<br />

using a curved-array echoendoscope. Surg Endosc 1996; 10:<br />

1205-1209<br />

91 Hunerbein M, Ghadimi BM, Haensch W, Schlag PM.<br />

Transesophageal biopsy <strong>of</strong> mediastinal and pulmonary

---

Puli SR et al . EUS f<strong>or</strong> diagnosing mediastinal lymphadenopathy: A meta-analysis 3037<br />

tum<strong>or</strong>s by means <strong>of</strong> endoscopic ultrasound guidance. J Th<strong>or</strong>ac<br />

Cardiovasc Surg 1998; 116: 554-559<br />

92 Catalano MF, Nayar R, Gress F, Scheiman J, Wassef W,<br />

Rosenblatt ML, Kochman M. EUS-guided fine needle<br />

aspiration in mediastinal lymphadenopathy <strong>of</strong> unknown<br />

etiology. Gastrointest Endosc 2002; 55: 863-869<br />

93 Khoo KL, Ho KY, Nilsson B, Lim TK. EUS-guided FNA<br />

immediately after unrevealing transbronchial needle<br />

aspiration in the evaluation <strong>of</strong> mediastinal lymphadenopathy:<br />

a prospective study. Gastrointest Endosc 2006; 63: 215-220<br />

94 Hunerbein M, Dohmoto M, Haensch W, Schlag PM.<br />

Endosonography-guided biopsy <strong>of</strong> mediastinal and pancreatic<br />

tum<strong>or</strong>s. Endoscopy 1998; 30: 32-36<br />

95 Arima M, Tada M. Endoscopic ultrasound-guided fine needle<br />

aspiration biopsy in esophageal and mediastinal diseases:<br />

Clinical indications and results. Dig Endosc 2003; 15: 93-99<br />

96 Chhieng DC, Jhala D, Jhala N, Eltoum I, Chen VK, Vickers S,<br />

Heslin MJ, Wilcox CM, Eloubeidi MA. Endoscopic ultrasoundguided<br />

fine-needle aspiration biopsy: a study <strong>of</strong> 103 cases.<br />

Cancer 2002; 96: 232-239<br />

97 Walsh PR, Williams DB. Mediastinal adenopathy: finding<br />

the answer with endoscopic ultrasound-guided fine-needle<br />

aspiration biopsy. Intern Med J 2005; 35: 392-398<br />

98 Fritscher-Ravens A, Sriram PV, Topalidis T, Hauber HP,<br />

Meyer A, Soehendra N, Pf<strong>or</strong>te A. Diagnosing sarcoidosis<br />

using endosonography-guided fine-needle aspiration. Chest<br />

2000; 118: 928-935<br />

99 Wallace MB, Kennedy T, Durkalski V, Eloubeidi MA,<br />

Etamad R, Matsuda K, Lewin D, Van Velse A, Hennesey W,<br />

Hawes RH, H<strong>of</strong>fman BJ. Randomized controlled trial <strong>of</strong> EUSguided<br />

fine needle aspiration techniques f<strong>or</strong> the detection <strong>of</strong><br />

malignant lymphadenopathy. Gastrointest Endosc 2001; 54:<br />

441-447<br />

100 Savides TJ, Binmoeller K and Sarlin R. Effectiveness <strong>of</strong> EUS/<br />

FNA f<strong>or</strong> diagnosing lung cancer in a managed care setting.<br />

Gastrointest Endosc 2005; 51: AB143<br />

101 Fritscher-Ravens A, Petrasch S, Reinacher-Schick A, Graeven<br />

U, Konig M, Schmiegel W. Diagnostic value <strong>of</strong> endoscopic<br />

ultrasonography-guided fine-needle aspiration cytology <strong>of</strong><br />

mediastinal masses in patients with intrapulmonary lesions<br />

and nondiagnostic bronchoscopy. Respiration 1999; 66: 150-155<br />

102 Mishra G, Sahai AV, Penman ID, Williams DB, Judson<br />

MA, Lewin DN, Hawes RH, H<strong>of</strong>fman BJ. Endoscopic<br />

ultrasonography with fine-needle aspiration: an accurate and<br />

simple diagnostic modality f<strong>or</strong> sarcoidosis. Endoscopy 1999; 31:<br />

377-382<br />

103 Fritscher-Ravens A, Sriram PV, Bobrowski C, Pf<strong>or</strong>te A, Topalidis<br />

T, Krause C, Jaeckle S, Thonke F, Soehendra N. Mediastinal<br />

lymphadenopathy in patients with <strong>or</strong> without previous<br />

malignancy: EUS-FNA-<strong>based</strong> differential cytodiagnosis in 153<br />

patients. Am J Gastroenterol 2000; 95: 2278-2284<br />

104 Wiersema MJ, Vilmann P, Giovannini M, Chang KJ,<br />

Wiersema LM. Endosonography-guided fine-needle aspiration<br />

biopsy: diagnostic accuracy and complication assessment.<br />

Gastroenterology 1997; 112: 1087-1095<br />

105 Vazquez-Sequeiros E, N<strong>or</strong>ton ID, Clain JE, Wang KK, Affi A,<br />

Allen M, Deschamps C, Miller D, Salomao D, Wiersema MJ.<br />

Impact <strong>of</strong> EUS-guided fine-needle aspiration on lymph node<br />

staging in patients with esophageal carcinoma. Gastrointest<br />

Endosc 2001; 53: 751-757<br />

106 Shimizu Y, Mera K, Tsukagoshi H, Takamasa M, Kawarazaki<br />

M, Watanabe Y, Tomohiko Nakasato, Oohara M, Hosokawa<br />

M, Fujita M, Asaka M. Endoscopic ultrasonography f<strong>or</strong> the<br />

detection <strong>of</strong> lymph node metastasis in superficial esophageal<br />

carcinoma. Dig Endosc 1997; 9: 178-182<br />

107 Vilmann P. Endoscopic ultrasonography-guided fine-needle<br />

aspiration biopsy <strong>of</strong> lymph nodes. Gastrointest Endosc 1996; 43:<br />

S24-S29<br />

S- Edit<strong>or</strong> Ma L L- Edit<strong>or</strong> Alpini GD E- Edit<strong>or</strong> Liu Y<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3038-3043<br />

wjg@wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

RAPID COMMUNICATION<br />

Sh<strong>or</strong>t-term intravenous interferon therapy f<strong>or</strong> chronic<br />

hepatitis B<br />

Hiroaki Okushin, T<strong>or</strong>u Ohnishi, Kazuhiko M<strong>or</strong>ii, Koichi Uesaka, Shiro Yuasa<br />

Hiroaki Okushin, T<strong>or</strong>u Ohnishi, Kazuhiko M<strong>or</strong>ii, Koichi<br />

Uesaka, Shiro Yuasa, Department <strong>of</strong> Internal Medicine, Himeji<br />

Red Cross Hospital, Hyogo, Japan<br />

C<strong>or</strong>respondence to: Hiroaki Okushin, MD, Department <strong>of</strong><br />

Internal Medicine, Himeji Red Cross Hospital, 1-12-1 Shimoteno,<br />

Himeji-shi, Hyogo 670-8540,<br />

Japan. hiroaki_okushin@hotmail.co.jp<br />

Telephone: +81-79-2942251 Fax: +81-79-2964050<br />

Received: October 23, 2007 Revised: March 25, 2008<br />

Abstract<br />

AIM: To investigate the therapeutic efficacy <strong>of</strong> sh<strong>or</strong>tterm,<br />

multiple daily dosing <strong>of</strong> intravenous interferon (IFN)<br />

in patients with hepatitis B e antigen (HBeAg)-positive<br />

chronic hepatitis B.<br />

METHODS: IFN-β was intravenously administered at a<br />

total dose <strong>of</strong> 102 million international units (MIU) over<br />

a period <strong>of</strong> 28 d in 26 patients positive f<strong>or</strong> HBeAg and<br />

HBV-DNA. IFN-beta was administered at doses <strong>of</strong> 2 MIU<br />

and 1 MIU on d 1, 3 MIU twice daily from d 2 to d 7,<br />

and 1 MIU thrice daily from d 8 to d 28. Patients were<br />

followed up f<strong>or</strong> 24 wk after the end <strong>of</strong> treatment.<br />

RESULTS: Six months after the end <strong>of</strong> the treatment,<br />

loss <strong>of</strong> HBV-DNA occurred in 13 (50.0%) <strong>of</strong> the 26<br />

patients, loss <strong>of</strong> HBeAg in 9 (34.6%), development <strong>of</strong><br />

anti-HBe in 10 (38.5%), HBeAg seroconversion in 8<br />

(30.8%), and n<strong>or</strong>malization <strong>of</strong> alanine aminotransferase<br />

(ALT) levels in 11 (42.0%).<br />

CONCLUSION: This 4-wk long IFN-β therapy, which<br />

was much sh<strong>or</strong>ter than conventional therapy lasting<br />

12 wk <strong>or</strong> even m<strong>or</strong>e than 1 year, produced therapeutic<br />

effects similar to those achieved by IFN-α <strong>or</strong> pegylated-<br />

IFN-α (peg-IFN). Fewer adverse effects, greater efficacy,<br />

and a sh<strong>or</strong>ter treatment period led to an improvement<br />

in patients’ quality <strong>of</strong> life. IFN-β is administered<br />

intravenously, whereas IFN-α is administered<br />

intramuscularly <strong>or</strong> subcutaneously. Because both<br />

interferons are known to bind to an identical recept<strong>or</strong><br />

and exert antiviral effects through intracellular signal<br />

transduction, the excellent results <strong>of</strong> IFN-β found in this<br />

study may be attributed to the multiple doses allowed by<br />

the intravenous route.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Chronic hepatitis B; Hepatitis B e antigen;<br />

www.wjgnet.com<br />

Hepatitis B virus; Interferon beta; Multiple daily dosing;<br />

Sh<strong>or</strong>t-term treatment; Intravenous injection<br />

Peer reviewers: Philip Abraham, Dr, Pr<strong>of</strong>ess<strong>or</strong>, Consultant<br />

Gastroenterologist & Hepatologist, P. D. Hinduja National<br />

Hospital & Medical Research Centre, Veer Savarkar Marg,<br />

Mahim, Mumbai 400 016, India; Richard A Rippe, Dr, Department<br />

<strong>of</strong> Medicine, The University <strong>of</strong> N<strong>or</strong>th Carolina at Chapel Hill,<br />

Chapel Hill, NC 27599-7038, United States<br />

Okushin H, Ohnishi T, M<strong>or</strong>ii K, Uesaka K, Yuasa S. Sh<strong>or</strong>t-term<br />

intravenous interferon therapy f<strong>or</strong> chronic hepatitis B. W<strong>or</strong>ld J<br />

Gastroenterol 2008; 14(19): 3038-3043 Available from: URL:<br />

http://www.wjgnet.com/1007-9327/14/3038.asp DOI: http://<br />

dx.doi.<strong>or</strong>g/10.3748/wjg.14.3038<br />

INTRODUCTION<br />

The increasing prevalence <strong>of</strong> chronic hepatitis caused by<br />

hepatitis B <strong>or</strong> C virus infection represents a concern in<br />

many regions w<strong>or</strong>ldwide. Interferons (IFN) are widely<br />

used in the treatment <strong>of</strong> the disease. With the recent<br />

launch <strong>of</strong> lamivudine, adefovir, and entecavir, the number<br />

<strong>of</strong> treatment options f<strong>or</strong> chronic hepatitis B has increased.<br />

Treatment with these <strong>or</strong>al nucleoside analogues has serious<br />

drawbacks, such as the development <strong>of</strong> resistant HBV<br />

strains [1,2] and the need f<strong>or</strong> years <strong>of</strong> treatment [3,4] <strong>or</strong> even<br />

a lifetime therapy. Thus, a large number <strong>of</strong> patients still<br />

require IFN therapy, which is effective in a relatively sh<strong>or</strong>t<br />

period <strong>of</strong> time. Recently, however, in some patients, the<br />

treatment with IFN is <strong>of</strong>ten prolonged up to 24-48 wk to<br />

improve efficacy [5-7] . IFN-α is administered intramuscularly<br />

<strong>or</strong> subcutaneously and may be associated with such adverse<br />

effects as fatigue, insomnia, an<strong>or</strong>exia, and alopecia [7,8] .<br />

These effects presumably result from prolonged elevation<br />

<strong>of</strong> blood IFN levels. Prolonged exposure to higher levels<br />

<strong>of</strong> the circulating drug may produce a greater therapeutic<br />

effect while inducing greater adverse effects [9,10] . Treatment<br />

f<strong>or</strong> a higher therapeutic effect without consideration <strong>of</strong><br />

the burden on patients is not a good therapeutic strategy.<br />

In Japan, IFN preparations f<strong>or</strong> the treatment<br />

<strong>of</strong> hepatitis B include IFN-α f<strong>or</strong> intramuscular <strong>or</strong><br />

subcutaneous administration and IFN-β f<strong>or</strong> intravenous<br />

administration [11] . Both IFN-α and IFN-β bind to the an<br />

identical IFN recept<strong>or</strong> and induce PKR and other antiviral<br />

proteins via intracellular signal transduction systems<br />

represented by JAK/STAT [12] . Because <strong>of</strong> the intravenous<br />

route, the blood concentration <strong>of</strong> IFN-β reaches its<br />

peak immediately after infusion and then decreases

---

Okushin H et al . Sh<strong>or</strong>t-term interferon f<strong>or</strong> hepatitis B 3039<br />

rapidly [13] . Decrease <strong>or</strong> loss <strong>of</strong> efficacy by recept<strong>or</strong> downregulation<br />

[14-16] and adverse effects with IFN therapy are<br />

less likely to occur because blood level <strong>of</strong> IFN-β does not<br />

maintain after signal transduction via the IFN recept<strong>or</strong>.<br />

The recept<strong>or</strong> function is maintained, and thus frequent<br />

dosing <strong>of</strong> IFN-β is likely to produce greater efficacy.<br />

Indeed, in patients with hepatitis C, we found that IFN-β<br />

in divided doses administered in the m<strong>or</strong>ning and evening<br />

was m<strong>or</strong>e effective than that administered once daily at the<br />

same total dose [17] .<br />

F<strong>or</strong> the development <strong>of</strong> sh<strong>or</strong>t-term IFN therapy f<strong>or</strong><br />

hepatitis B, in the present study we investigated a 4-wk,<br />

multiple daily dosing <strong>of</strong> intravenous IFN-β, a new regimen<br />

that produced therapeutic effects similar to those achieved<br />

by 24-wk <strong>or</strong> 1-year treatment with IFN-α.<br />

MATERIALS AND METHODS<br />

Patients<br />

Among Japanese adult patients with chronic hepatitis<br />

B who were positive f<strong>or</strong> HBeAg and HBV-DNA and<br />

presented at our hospital from 1996 to 2002, 26 patients<br />

were enrolled in this open-label study. The study was<br />

conducted in acc<strong>or</strong>dance with the Declaration <strong>of</strong><br />

Helsinki, and the patients consented to the experimental<br />

treatment <strong>of</strong> hepatitis B. Inclusion criteria were: age <strong>of</strong><br />

20 years <strong>or</strong> older, blood HBeAg positivity, blood HBV-<br />

DNA positivity, and persistent abn<strong>or</strong>mal elevation <strong>of</strong><br />

ALT levels. Exclusion criteria included: coinfection with<br />

hepatitis C virus <strong>or</strong> HIV, presence <strong>of</strong> hepatocellular<br />

carcinoma, symptoms caused by decompensated cirrhosis,<br />

alcoholic, autoimmune, drug-induced, <strong>or</strong> other non-viral<br />

liver dis<strong>or</strong>ders, and hypersensitivity to IFN-β. Any herbal<br />

medicines were discontinued during the treatment with<br />

IFN-β.<br />

Treatment methods<br />

Human fibroblast-derived natural IFN-β (FERON ® ,<br />

T<strong>or</strong>ay Industries Inc., Japan) was used; 1 to 3 MIU was<br />

dissolved in 100 mL <strong>of</strong> 5% glucose <strong>or</strong> isotonic saline<br />

solution f<strong>or</strong> injection and infused intravenously f<strong>or</strong> about<br />

10 minutes. The dosing schedule comprised 2 MIU in the<br />

m<strong>or</strong>ning and 1 MIU in the evening (twice daily) at d 1 <strong>of</strong><br />

treatment, 3 MIU in the m<strong>or</strong>ning and evening (twice daily)<br />

from d 2 through d 7, and 1 MIU each in the m<strong>or</strong>ning, in<br />

the afternoon, and at bedtime (thrice daily) from d 8 to<br />

d 28, with a total dose <strong>of</strong> 102 MIU administered over a<br />

treatment period <strong>of</strong> 28 d. Patients were followed up f<strong>or</strong><br />

24 wk after the end <strong>of</strong> the IFN-β therapy.<br />

Lab<strong>or</strong>at<strong>or</strong>y methods<br />

Blood samples were collected immediately bef<strong>or</strong>e the<br />

start <strong>of</strong> treatment, weekly during the treatment, and<br />

monthly during the follow-up period. Biochemical and<br />

hematological tests were perf<strong>or</strong>med each time. HBsAg was<br />

measured by reversed passive hemagglutination (R-PHA),<br />

anti-HBs was measured by passive hemagglutination<br />

(PHA), HBeAg and anti-HBe were measured by<br />

radioimmunoassay (RIA). HBV-DNA polymerase activity<br />

was measured by radioassay. Serum HBV-DNA was<br />

measured by branched DNA probe assay (Chiron C<strong>or</strong>p,<br />

USA) with a detection sensitivity <strong>of</strong> 0.70 megaequivalents<br />

(Meq) per milliliter. Anti-hepatitis C virus antibodies were<br />

measured by enzyme immunoassay (EIA). In addition,<br />

2’-,5’-oligoadenylate synthetase (2-5AS), an indicat<strong>or</strong> <strong>of</strong><br />

IFN activity, was quantitatively measured by RIA.<br />

Statistical analysis<br />

Values are given as either mean ± SD <strong>or</strong> median and<br />

range. F<strong>or</strong> comparison, Student’s t-test <strong>or</strong> the Chi-square<br />

test were used. Statistical tests were two-sided, and a<br />

P value <strong>of</strong> less than 0.05 was considered as statistically<br />

significant.<br />

RESULTS<br />

Patient population<br />

Clinical characteristics <strong>of</strong> the 26 patients with HBeAg<br />

positive chronic hepatitis B at beginning <strong>of</strong> the treatment<br />

are shown in Table 1. All patients received a total dose<br />

<strong>of</strong> 102 MIU <strong>of</strong> IFN-β over a period <strong>of</strong> 28 d, and none<br />

<strong>of</strong> them dropped out because <strong>of</strong> adverse effects <strong>or</strong> other<br />

reasons.<br />

Clinical outcomes<br />

Six months after the end <strong>of</strong> IFN administration, loss<br />

<strong>of</strong> HBV-DNA occurred in 13 (50.0%) patients, loss <strong>of</strong><br />

HBeAg in 9 (34.6%), loss <strong>of</strong> HBV-DNA and HBeAg in<br />

9 (34.6%), development <strong>of</strong> anti-HBe in 10 (38.5%), and<br />

HBe seroconversion in 8 (30.8%). The last parameter is a<br />

measure <strong>of</strong> the therapeutic effect, defined by the loss <strong>of</strong><br />

HBeAg and the subsequent development <strong>of</strong> anti-HBe.<br />

ALT levels n<strong>or</strong>malized in 11 (42.0%) <strong>of</strong> the 26 patients.<br />

The percentage <strong>of</strong> patients, which became negative f<strong>or</strong><br />

HBV-DNA, HBeAg, and the change in ALT levels<br />

during/after the treatment are shown in Table 2 and<br />

Figure 1, respectively.<br />

Baseline HBV DNA polymerase activity and virological<br />

response<br />

Patients were stratified acc<strong>or</strong>ding to baseline DNA<br />

polymerase activity (less than 1000 cpm vs 1000 cpm <strong>or</strong><br />

m<strong>or</strong>e), and virological responses were rec<strong>or</strong>ded. Among 15<br />

patients with an activity lower than 1000 cpm, 11 (73.3%)<br />

had a complete virological response, and 4 (26.7%) had<br />

no response. Among the 11 patients with an activity <strong>of</strong><br />

1000 cpm <strong>or</strong> m<strong>or</strong>e, 2 (18.2%) had a complete virological<br />

response, and 9 (81.8%) had no response.<br />

2-5AS<br />

Figure 2 shows the change in 2-5AS levels. The level <strong>of</strong><br />

2-5AS at baseline was 114.8 ± 102.1 (mean ± SD). The<br />

levels at wk 1, 2, and at the end <strong>of</strong> treatment were 389.9 ±<br />

205.3, 333.3 ± 133.4, and 344.3 ± 181.2, respectively.<br />

Adverse effects<br />

No patients discontinued treatment because <strong>of</strong> adverse<br />

effects, with a treatment completion rate <strong>of</strong> 100%. Fever<br />

was mild because antipyretic loxopr<strong>of</strong>en sodium was<br />

administered bef<strong>or</strong>e intravenous infusion to suppress IFN-<br />

www.wjgnet.com

---

Table 1 Clinical characteristics at the beginning <strong>of</strong> the treatment<br />

Characteristics Baseline<br />

Age (yr) 31.8 ± 7.0 1<br />

Sex (male/female) 19/7<br />

ALT (U/L) 246.9 ± 154.2 1<br />

HBV DNA (≥ 10/< 10 Meq/mL) 16/10<br />

HBV DNA polymerase (cpm) 750.5 (10-10 710) 2<br />

PLT (× 10 4 /mm 3 ) 19.3 ± 10.7 1<br />

1 mean ± SD; 2 Median (range).<br />

Table 2 Response rate in patients with HBeAg positive chronic<br />

hepatitis B by interferon-β treatment (%)<br />

induced fever. During treatment with IFN, no patients<br />

experienced depression. There was no proteinuria, severe<br />

thrombocytopenia <strong>or</strong> leukopenia (as shown in Figure 3).<br />

DISCUSSION<br />

wk 1 wk 2 End <strong>of</strong> the<br />

treatment<br />

6 mo after<br />

treatment<br />

HBV-DNA<br />

negative<br />

5/26 (19.2) 5/26 (19.2) 10/26 (38.5) 13/26 (50.0)<br />

HBeAg and<br />

4/26 (15.4) 9/26 (34.6)<br />

HBV-DNA negative<br />

ALT levels U/L<br />

700<br />

600<br />

500<br />

400<br />

300<br />

200<br />

100<br />

0<br />

600<br />

500<br />

400<br />

300<br />

200<br />

100<br />

0<br />

●<br />

●<br />

Pre 1 2 3 4 1 2 3 4 5 6<br />

During treatment (wk)<br />

●<br />

●<br />

● ●<br />

●<br />

Pretreatment 1 wk 2 wk End <strong>of</strong> treatment<br />

Figure 2 Change in 2’5’AS levels during treatment.<br />

After treatment (mo)<br />

Figure 1 Change in ALT levels during treatment with interferon-β and during the<br />

follow-up.<br />

2’5’AS levels pmol/dL<br />

3040 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

Approximately 10 years ago, the IFN therapy f<strong>or</strong> chronic<br />

hepatitis B was administered f<strong>or</strong> up to 4 wk in Japan.<br />

However, a 24-wk regimen has been recently used because<br />

www.wjgnet.com<br />

●<br />

●<br />

●<br />

●<br />

(mean ± SD)<br />

●<br />

●<br />

(mean ± SD)<br />

●<br />

●<br />

Platelet counts ( × 10 4 /mm 3 )<br />

WBC counts (/mm 3 )<br />

35<br />

30<br />

25<br />

20<br />

15<br />

10<br />

5<br />

0<br />

■<br />

Pre<br />

treatment<br />

8000<br />

7000<br />

6000<br />

5000 ●<br />

4000<br />

3000<br />

2000<br />

1000<br />

0<br />

Pre<br />

treatment<br />

Figure 3 Changes in platelet and WBC counts.<br />

■<br />

■<br />

1 wk 2 wk 3 wk End <strong>of</strong><br />

treatment<br />

●<br />

●<br />

1 wk 2 wk 3 wk End <strong>of</strong><br />

treatment<br />

a longer treatment seems to improve the efficacy. In<br />

the present study, we used a sh<strong>or</strong>t-term, intravenous<br />

therapy <strong>of</strong> 4 wk, which seems to be against the recent<br />

recommendations f<strong>or</strong> long-term regimens. However,<br />

4-wk multiple daily dosing <strong>of</strong> intravenous IFN-β used in<br />

our study produced therapeutic effects similar to those<br />

achieved by 12-wk <strong>or</strong> 24-wk IFN-α <strong>or</strong> 48-wk peg-IFN-α,<br />

which are indicated by the American Association f<strong>or</strong> the<br />

Study <strong>of</strong> Liver Diseases [18,19] . The HBe seroconversion rate<br />

with IFN-β in this study was 31%, which was higher than<br />

the rep<strong>or</strong>ted 12-18% with IFN-α [18,20] , lamivudine [18,21-23] , <strong>or</strong><br />

adefovir [19,24] , and which was almost equal to that achieved<br />

by a 48-wk therapy with peg-IFN-α [25] (Table 3). In the<br />

United States, the distribution <strong>of</strong> HBV genotypes was<br />

rep<strong>or</strong>ted as genotypes A (33%), B (21%), C (34%), D (9%),<br />

E (1%), F (1%), and G (1%) [26] . Given that the maj<strong>or</strong>ity<br />

(about 80%) <strong>of</strong> Japanese patients infected with HBV has<br />

IFN-resistant genotype C [27] , the multiple daily dosing<br />

<strong>of</strong> intravenous IFN-β used in this study appears to be a<br />

beneficial treatment.<br />

■<br />

●<br />

(mean ± SD)<br />

■<br />

(mean ± SD)<br />

●<br />

■<br />

After<br />

6 mo<br />

●<br />

After<br />

6 mo<br />

Table 3 Comparison <strong>of</strong> response rates in patients with HBeAg<br />

positive chronic hepatitis B at 6 mo after the treatment (%)<br />

INF-β<br />

(iv) 4 wk<br />

INF-α Lamivudine<br />

(sc <strong>or</strong> im)<br />

12-24 wk<br />

1 yr<br />

Adefovir<br />

dipivoxil<br />

48 wk<br />

Pegylated<br />

interferon-α<br />

48 wk<br />

Loss <strong>of</strong> serum<br />

HBV DNA<br />

50 37 44 21 32<br />

Loss <strong>of</strong> HBeAg 35 33 17-32 24 34<br />

HBeAg<br />

seroconversion<br />

31 Difference<br />

<strong>of</strong> 18<br />

16-18 12 32<br />

Loss <strong>of</strong> HBsAg 8 < 1 0 3<br />

N<strong>or</strong>malization 42 Difference 41-72 48 41<br />

<strong>of</strong> ALT<br />

<strong>of</strong> 23<br />

Histological<br />

improvement<br />

49-56 53 38<br />

Durability <strong>of</strong><br />

the response<br />

80-90 50-80 82

---

Okushin H et al . Sh<strong>or</strong>t-term interferon f<strong>or</strong> hepatitis B 3041<br />

DNA-p (cpm) 1338 64 2311 26 8 14 4<br />

HBV-DNA (Mep/mL) 710 9.3 > 3800 0.88 (-) (-) (-)<br />

500<br />

400<br />

300<br />

200<br />

100<br />

IFN-β<br />

●<br />

●<br />

●<br />

4<br />

wk<br />

●<br />

●●<br />

HBeAg anti-HBe<br />

●<br />

●<br />

●<br />

● ●<br />

ALT (IU/L)<br />

43<br />

●<br />

● ● ● ● ● ● ● ● ●<br />

0<br />

Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec<br />

Figure 4 Typical pattern <strong>of</strong> clinical course with transient increase in ALT level after<br />

treatment with interferon-β.<br />

Our results suggest that HBV DNA polymerase activity<br />

at baseline bef<strong>or</strong>e the treatment may be used to predict<br />

the therapeutic effect <strong>of</strong> IFN to some degree. Multiple<br />

daily dosing <strong>of</strong> IFN-β may be the regimen <strong>of</strong> first-line<br />

choice in patients with baseline HBV DNA polymerase<br />

activity less than 1000 cpm because 73.3% <strong>of</strong> those<br />

patients had a complete virological response. We believe<br />

that the direct antiviral effect <strong>of</strong> IFN on HBV is enough<br />

to achieve a complete response in those patients, whereas<br />

an appropriate host immune response are also needed in<br />

patients with a polymerase activity <strong>of</strong> 1000 cpm <strong>or</strong> m<strong>or</strong>e<br />

indicating rapid proliferation <strong>of</strong> HBV. A typical example<br />

is shown in Figure 4. The patient had an HBV DNA<br />

polymerase activity <strong>of</strong> 1338 cpm and an HBV-DNA level<br />

<strong>of</strong> 710 Meq/mL bef<strong>or</strong>e the IFN therapy. After the end<br />

<strong>of</strong> IFN-β administration, an increase in HBV-DNA and<br />

subsequent rapid increase in ALT levels (so-called Schub)<br />

occurred, followed by the loss <strong>of</strong> HBeAg, HBV-DNA,<br />

and DNA polymerase, n<strong>or</strong>malization <strong>of</strong> ALT levels, and<br />

development <strong>of</strong> anti-HB. The rapid increase in ALT levels<br />

probably resulted from the host’s immune response to<br />

the rapid increase in the HBV proliferation following the<br />

regimen and the subsequent rapid elimination <strong>of</strong> infected<br />

hepatocytes in an appropriate manner.<br />

Our dosing regimen had a good safety pr<strong>of</strong>ile with<br />

a low incidence <strong>of</strong> mild adverse effects and no serious<br />

adverse effects. This may be attributed to lower daily<br />

doses <strong>of</strong> 3 MIU from d 8 onward and a sh<strong>or</strong>t treatment<br />

period <strong>of</strong> 1 mo. Although platelet and leukocyte counts<br />

decreased at wk 1 compared with baseline levels, the<br />

counts remained unchanged thereafter until the end <strong>of</strong><br />

treatment and almost returned to baseline levels after<br />

completion <strong>of</strong> therapy. Our previous experience suggested<br />

that thrombocytopenia and proteinuria should be closely<br />

monit<strong>or</strong>ed during treatment with IFN-β at doses <strong>of</strong> 3<br />

MIU twice daily. However, cytopenia did not w<strong>or</strong>sen<br />

because <strong>of</strong> switching to 1 MIU thrice daily from d 8. The<br />

levels <strong>of</strong> 2-5AS in blood (mean ± SD) at baseline and<br />

wk 1, 2, and 4 <strong>of</strong> treatment were 133.9 ± 122.2, 445.0 ±<br />

209.7, 335.0 ± 139.9, and 387.8 ± 200.7, respectively, and<br />

remained elevated during treatment, suggesting that the<br />

dose regimen produced a potent and durable antiviral<br />

effect despite a modest cytopenia.<br />

In general, the pharmacokinetics <strong>of</strong> an intravenously<br />

administered drug are characterized by a higher blood<br />

elimination rate, higher peak blood concentration,<br />

and greater tissue distribution than an intramuscularly<br />

administered drug, and these are also true <strong>of</strong> IFN.<br />

Different types <strong>of</strong> IFN f<strong>or</strong>mulations are available f<strong>or</strong><br />

therapy, and human fibroblast IFN-β is applicable to<br />

intravenous administration f<strong>or</strong> the treatment <strong>of</strong> hepatitis<br />

in Japan.<br />

We chose intravenous administration and multiple<br />

daily dosing because <strong>of</strong> the following three reasons.<br />

First, intravenously administered IFN-β is rapidly<br />

eliminated from the blood and below the detection<br />

limit sh<strong>or</strong>tly after administration [13] . Compared with<br />

intramuscularly <strong>or</strong> subcutaneously administered IFN-α,<br />

IFN-β accumulates to a lesser degree and is likely to have<br />

less adverse effects [28] . Second, blood concentrations <strong>of</strong><br />

IFN administered intravenously in multiple daily doses<br />

fluctuate with high blood levels and rapid elimination rates.<br />

Acc<strong>or</strong>dingly, this regimen is likely to avoid persistently<br />

elevated blood IFN levels and resultant downregulation<br />

<strong>of</strong> the IFN recept<strong>or</strong> [14-16] , which is likely to occur after<br />

intramuscular <strong>or</strong> subcutaneous administration. The<br />

avoidance <strong>of</strong> the recept<strong>or</strong> downregulation allows effective<br />

binding <strong>of</strong> IFN and its recept<strong>or</strong>, and triggers the host<br />

defense mechanisms a few times a day to eliminate the<br />

virus. Third, the drug administered intravenously is m<strong>or</strong>e<br />

extensively distributed into <strong>or</strong>gans than that administered<br />

intramuscularly. F<strong>or</strong> elimination <strong>of</strong> HBV present in<br />

hepatocytes, intravenous dosing is considered as an<br />

effective route <strong>of</strong> administration, which allows extensive<br />

delivery <strong>of</strong> IFN to the liver. When IFN-α, which was<br />

induced by treating human leukocytes with the Sendai<br />

virus, was administered intravenously <strong>or</strong> intramuscularly<br />

to rats, IFN-α was detectable in the liver at 10 and 30 min<br />

but not at 1 h after intravenous administration whereas<br />

IFN levels remained below the detection limit f<strong>or</strong> 4 h<br />

in rats receiving an intramuscular administration [29] . In<br />

patients with hepatitis, a transient increase in ALT levels is<br />

<strong>of</strong>ten observed after intravenous administration <strong>of</strong> IFN [30] .<br />

Because IFN distributes in the liver at high concentrations<br />

after intravenous administration, extensive loss <strong>of</strong> infected<br />

hepatocytes may occur, resulting in an increase in ALT<br />

levels.<br />

When IFN <strong>or</strong> any other cytokine that exerts a<br />

pharmacological effect via recept<strong>or</strong> binding is administered,<br />

it is imp<strong>or</strong>tant to choose an appropriate route <strong>of</strong><br />

administration that ensures effective delivery <strong>of</strong> the drug<br />

to the target-cells. An ideal pharmacokinetic pr<strong>of</strong>ile should<br />

include a rapid increase to effective blood concentrations<br />

and a rapid elimination after recept<strong>or</strong> binding to<br />

avoid downregulation <strong>of</strong> the recept<strong>or</strong>. We believe that<br />

intravenous IFN therapy can also be used effectively<br />

f<strong>or</strong> the treatment <strong>of</strong> other diseases including cancer,<br />

infection with HIV, and SARS. However, intravenous IFN<br />

is now available only in Japan. F<strong>or</strong> further promotion <strong>of</strong><br />

research on the establishment <strong>of</strong> intravenous IFN therapy<br />

as a convenient, general way <strong>of</strong> treating these diseases,<br />

www.wjgnet.com

---

Okushin H et al . Sh<strong>or</strong>t-term interferon f<strong>or</strong> hepatitis B 3043<br />

with interferon. J Gastroenterol Hepatol 1989; 4: 419-427<br />

16 Nakajima S, Kuroki T, Shintani M, Kurai O, Takeda T,<br />

Nishiguchi S, Shiomi S, Seki S, Kobayashi K. Changes in<br />

interferon recept<strong>or</strong>s on peripheral blood mononuclear cells<br />

from patients with chronic hepatitis B being treated with<br />

interferon. Hepatology 1990; 12: 1261-1265<br />

17 Okushin H, M<strong>or</strong>ii K, Kishi F, Yuasa S. Efficacy <strong>of</strong> the<br />

combination therapy using twice-a-day IFN-beta followed by<br />

IFN-alpha-2b in treatment f<strong>or</strong> chronic hepatitis C. Kanzo 1997;<br />

38: 11-18<br />

18 Lok AS, McMahon BJ. Chronic hepatitis B. Hepatology 2001; 34:<br />

1225-1241<br />

19 Lok AS, McMahon BJ. Chronic hepatitis B: update <strong>of</strong><br />

recommendations. Hepatology 2004; 39: 857-861<br />

20 Wong DK, Cheung AM, O'Rourke K, Nayl<strong>or</strong> CD, Detsky AS,<br />

Heathcote J. Effect <strong>of</strong> alpha-interferon treatment in patients<br />

with hepatitis B e antigen-positive chronic hepatitis B. A metaanalysis.<br />

Ann Intern Med 1993; 119: 312-323<br />

21 Lai CL, Chien RN, Leung NW, Chang TT, Guan R, Tai DI, Ng<br />

KY, Wu PC, Dent JC, Barber J, Stephenson SL, Gray DF. A oneyear<br />

trial <strong>of</strong> lamivudine f<strong>or</strong> chronic hepatitis B. Asia Hepatitis<br />

Lamivudine Study Group. N Engl J Med 1998; 339: 61-68<br />

22 Dienstag JL, Schiff ER, Wright TL, Perrillo RP, Hann HW,<br />

Goodman Z, Crowther L, Condreay LD, Woessner M, Rubin M,<br />

Brown NA. Lamivudine as initial treatment f<strong>or</strong> chronic hepatitis<br />

B in the United States. N Engl J Med 1999; 341: 1256-1263<br />

23 Schalm SW, Heathcote J, Cianciara J, Farrell G, Sherman<br />

M, Willems B, Dhillon A, Mo<strong>or</strong>at A, Barber J, Gray DF.<br />

Lamivudine and alpha interferon combination treatment <strong>of</strong><br />

patients with chronic hepatitis B infection: a randomised trial.<br />

Gut 2000; 46: 562-568<br />

24 Marcellin P, Chang TT, Lim SG, Tong MJ, Sievert W, Shiffman<br />

ML, Jeffers L, Goodman Z, Wulfsohn MS, Xiong S, Fry J,<br />

Brosgart CL. Adefovir dipivoxil f<strong>or</strong> the treatment <strong>of</strong> hepatitis<br />

B e antigen-positive chronic hepatitis B. N Engl J Med 2003;<br />

348: 808-816<br />

25 Lau GK, Piratvisuth T, Luo KX, Marcellin P, Thongsawat S,<br />

Cooksley G, Gane E, Fried MW, Chow WC, Paik SW, Chang<br />

WY, Berg T, Flisiak R, McCloud P, Pluck N. Peginterferon<br />

Alfa-2a, lamivudine, and the combination f<strong>or</strong> HBeAg-positive<br />

chronic hepatitis B. N Engl J Med 2005; 352: 2682-2695<br />

26 Chu CJ, Lok AS. Clinical significance <strong>of</strong> hepatitis B virus<br />

genotypes. Hepatology 2002; 35: 1274-1276<br />

27 Orito E, Ichida T, Sakugawa H, Sata M, H<strong>or</strong>iike N, Hino K,<br />

Okita K, Okanoue T, Iino S, Tanaka E, Suzuki K, Watanabe H,<br />

Hige S, Mizokami M. Geographic distribution <strong>of</strong> hepatitis B<br />

virus (HBV) genotype in patients with chronic HBV infection<br />

in Japan. Hepatology 2001; 34: 590-594<br />

28 Festi D, Sandri L, Mazzella G, Roda E, Sacco T, Staniscia T,<br />

Capodicasa S, Vestito A, Colecchia A. Safety <strong>of</strong> interferon<br />

beta treatment f<strong>or</strong> chronic HCV hepatitis. W<strong>or</strong>ld J Gastroenterol<br />

2004; 10: 12-16<br />

29 Mura N, Matsuzawa H, Ueda H, Sakashita K, Nakamura K,<br />

Uemura H, Arao S, Hamanaka N, Chisaka T, Yagi N, Araki H,<br />

Koga J, Matsuo A. Pharmacokinetics <strong>of</strong> FPI-31. Jpn Pharmacol<br />

Ther 1993; 21: 2211-2226<br />

30 Fujim<strong>or</strong>i K, Mochida S, Matsui A, Ohno A, Fujiwara K.<br />

Possible mechanisms <strong>of</strong> elevation <strong>of</strong> serum transaminase<br />

levels during interferon-beta therapy in chronic hepatitis C<br />

patients. J Gastroenterol 2002; 37: 40-46<br />

S- Edit<strong>or</strong> Piscaglia AC L- Edit<strong>or</strong> Rippe R E- Edit<strong>or</strong> Lu W<br />

www.wjgnet.com

---

Soares RLS et al. SPT responses in two sub-types <strong>of</strong> IBS patients 3047<br />

<strong>of</strong> this association is not completely understood. Food antigens (FAs) can activate<br />

the mucosal system when there is disruption <strong>of</strong> the gut barrier. The rep<strong>or</strong>t <strong>of</strong> a<br />

significant c<strong>or</strong>relation among atopy and increased intestinal permeability suggests<br />

that at least a subset <strong>of</strong> IBS patients may have a systemic immunological dis<strong>or</strong>der.<br />

Research frontiers<br />

New inf<strong>or</strong>mation is useful f<strong>or</strong> a better understanding <strong>of</strong> the relationship between<br />

increased intestinal permeability, mucosal barrier defects, and intestinal<br />

inflammation in IBS patients. Studies are needed to clarify the potential pathogenic<br />

mechanisms underlying the association between IBS and allergy, and to determine<br />

if IBS is one <strong>or</strong> several dis<strong>or</strong>ders.<br />

Innovations and breakthroughs<br />

The results <strong>of</strong> skin prick tests (SPTs) f<strong>or</strong> IAs and FAs in two sub-types <strong>of</strong> IBS<br />

patients were compared. They confirmed a functional interface between the<br />

immune and sens<strong>or</strong>y mot<strong>or</strong> systems in the gut and suggest that in D-IBS, the<br />

epithelial function (intestinal permeability) in particular can be altered. Few studies<br />

regarding the subject are available in literature. This study provides valuable<br />

inf<strong>or</strong>mation about clinical and epidemiological aspects <strong>of</strong> IBS in Brazil.<br />

Applications<br />

The underlying cause <strong>of</strong> the pathophysiological changes encountered in IBS<br />

remains unclear. In clinical <strong>practice</strong>, the type and severity <strong>of</strong> symptoms determines<br />

the treatment <strong>of</strong> IBS. Our results add new inf<strong>or</strong>mation in answer to the question.<br />

Is IBS one <strong>or</strong> several dis<strong>or</strong>ders? Future clinical investigations will be useful f<strong>or</strong> a<br />

better understanding <strong>of</strong> the results obtained here.<br />

Peer review<br />

The article gives a clear delineation <strong>of</strong> the research background and provides<br />

imp<strong>or</strong>tant data about pathophysiological changes in IBS. The references are<br />

appropriate and updated.<br />

REFERENCES<br />

1 Jones R, Lydeard S. Irritable bowel syndrome in the general<br />

population. BMJ 1992; 304: 87-90<br />

2 Locke GR 3rd. The epidemiology <strong>of</strong> functional gastrointestinal<br />

dis<strong>or</strong>ders in N<strong>or</strong>th America. Gastroenterol Clin N<strong>or</strong>th Am 1996;<br />

25: 1-19<br />

3 Saito YA, Talley NJ. Irritable Bowel Syndrome. In: Talley NJ,<br />

Locke RG III, Saito YA, edit<strong>or</strong>s. GI Epidemiology, 1st ed. USA:<br />

Blackwell Publishing Press, 2007: 176-183<br />

4 Soares RL, dos Santos JM, Rocha VR. Prevalence <strong>of</strong> irritable<br />

bowel syndrome in a Brazilian Amazon community.<br />

Neurogastroenterol Motil 2005; 17: 883<br />

5 Talley NJ, Zinsmeister AR, Melton LJ 3rd. Irritable bowel<br />

syndrome in a community: symptom subgroups, risk fact<strong>or</strong>s,<br />

and health care utilization. Am J Epidemiol 1995; 142: 76-83<br />

6 Toner BB, Akman D. Gender role and irritable bowel<br />

syndrome: literature review and hypothesis. Am J Gastroenterol<br />

2000; 95: 11-16<br />

7 Uz E, Turkay C, Aytac S, Bavbek N. Risk fact<strong>or</strong>s f<strong>or</strong> irritable<br />

bowel syndrome in Turkish population: role <strong>of</strong> food allergy. J<br />

Clin Gastroenterol 2007; 41: 380-383<br />

8 Cooke HJ. Neurotransmitters in neuronal reflexes regulating<br />

intestinal secretion. Ann N Y Acad Sci 2000; 915: 77-80<br />

9 Downing JE, Miyan JA. Neural immun<strong>or</strong>egulation: emerging<br />

roles f<strong>or</strong> nerves in immune homeostasis and disease. Immunol<br />

Today 2000; 21: 281-289<br />

10 Mayer EA, Collins SM. Evolving pathophysiologic models <strong>of</strong><br />

functional gastrointestinal dis<strong>or</strong>ders. Gastroenterology 2002;<br />

122: 2032-2048<br />

11 Barbara G, De Gi<strong>or</strong>gio R, Stanghellini V, Cremon C,<br />

C<strong>or</strong>inaldesi R. A role f<strong>or</strong> inflammation in irritable bowel<br />

syndrome? Gut 2002; 51 Suppl 1: i41-i44<br />

12 McKeown ES, Parry SD, Stansfield R, Barton JR, Welfare MR.<br />

Postinfectious irritable bowel syndrome may occur after nongastrointestinal<br />

and intestinal infection. Neurogastroenterol<br />

Motil 2006; 18: 839-843<br />

13 Unno N, Fink MP. Intestinal epithelial hyperpermeability.<br />

Mechanisms and relevance to disease. Gastroenterol Clin N<strong>or</strong>th<br />

Am 1998; 27: 289-307<br />

14 Park MI, Camilleri M. Is there a role <strong>of</strong> food allergy in irritable<br />

bowel syndrome and functional dyspepsia? A systematic<br />

review. Neurogastroenterol Motil 2006; 18: 595-607<br />

15 Camilleri M, G<strong>or</strong>man H. Intestinal permeability and irritable<br />

bowel syndrome. Neurogastroenterol Motil 2007; 19: 545-552<br />

16 Dunlop SP, Hebden J, Campbell E, Naesdal J, Olbe L, Perkins<br />

AC, Spiller RC. Abn<strong>or</strong>mal intestinal permeability in subgroups<br />

<strong>of</strong> diarrhea-predominant irritable bowel syndromes. Am J<br />

Gastroenterol 2006; 101: 1288-1294<br />

17 Barbara G. Mucosal barrier defects in irritable bowel<br />

syndrome. Who left the do<strong>or</strong> open? Am J Gastroenterol 2006;<br />

101: 1295-1298<br />

18 Drossman DA, C<strong>or</strong>azziari E, Talley NJ. Rome III-A<br />

m u l t i n a t i o n a l c o n s e n s u s d o c u m e n t o n f u n c t i o n a l<br />

gastrointestinal dis<strong>or</strong>ders. Gastroenterology 2006; 130 1480-1491<br />

19 Drossman DA, C<strong>or</strong>azziari E, Talley NJ, Thompson WG,<br />

Whitehead WE Rome. The Functional Gastrointestinal<br />

Dis<strong>or</strong>ders. 2nd ed. McLean, VA: Degnon Associates, 2000<br />

20 Niec AM, Frankum B, Talley NJ. Are adverse food reactions<br />

linked to irritable bowel syndrome? Am J Gastroenterol 1998;<br />

93: 2184-2190<br />

21 Rhodes DY, Wallace M. Post-infectious irritable bowel<br />

syndrome. Curr Gastroenterol Rep 2006; 8: 327-332<br />

22 Locke GR 3rd, Zinsmeister AR, Talley NJ, Fett SL, Melton LJ.<br />

Risk fact<strong>or</strong>s f<strong>or</strong> irritable bowel syndrome: role <strong>of</strong> analgesics<br />

and food sensitivities. Am J Gastroenterol 2000; 95: 157-165<br />

23 Petitpierre M, Gumowski P, Girard JP. Irritable bowel<br />

syndrome and hypersensitivity to food. Ann Allergy 1985; 54:<br />

538-540<br />

24 Jones VA, McLaughlan P, Sh<strong>or</strong>thouse M, W<strong>or</strong>kman E, Hunter<br />

JO. Food intolerance: a maj<strong>or</strong> fact<strong>or</strong> in the pathogenesis <strong>of</strong><br />

irritable bowel syndrome. Lancet 1982; 2: 1115-1117<br />

25 Zwetchkenbaum J, Burak<strong>of</strong>f R. The irritable bowel syndrome<br />

and food hypersensitivity. Ann Allergy 1988; 61: 47-49<br />

26 Yazar A, Atis S, Konca K, Pata C, Akbay E, Calikoglu M, Hafta<br />

A. Respirat<strong>or</strong>y symptoms and pulmonary functional changes<br />

in patients with irritable bowel syndrome. Am J Gastroenterol<br />

2001; 96: 1511-1516<br />

27 Jun DW, Lee OY, Yoon HJ, Lee HL, Yoon BC, Choi HS, Lee<br />

MH, Lee DH, Kee CS. Bronchial hyperresponsiveness in<br />

irritable bowel syndrome. Dig Dis Sci 2005; 50: 1688-1691<br />

28 Roussos A, Koursarakos P, Patsopoulos D, Gerogianni I,<br />

Philippou N. Increased prevalence <strong>of</strong> irritable bowel syndrome<br />

in patients with bronchial asthma. Respir Med 2003; 97: 75-79<br />

29 Ozol D, Uz E, Bozalan R, Turkay C, Yildirim Z. Relationship<br />

between asthma and irritable bowel syndrome: role <strong>of</strong> food<br />

allergy. J Asthma 2006; 43: 773-775<br />

30 Soares RLS, Santos JM, Figueiredo HN, Rocha VRSR, Loyola<br />

RG. Respirat<strong>or</strong>y allergy and the response to the inhalant<br />

allergens skin prick test in patients with Irritable Bowel<br />

Syndrome (IBS). 2006 Joint International Society Meeting in<br />

Neurogastroenterology and GI Motility Neurogastroenterology<br />

& Motility 2006; 18: 663-798<br />

31 Atkinson W, Sheldon TA, Shaath N, Wh<strong>or</strong>well PJ. Food<br />

elimination <strong>based</strong> on IgG antibodies in irritable bowel<br />

syndrome: a randomised controlled trial. Gut 2004; 53:<br />

1459-1464<br />

32 Bernstein IL, St<strong>or</strong>ms WW. Practice parameters f<strong>or</strong> allergy<br />

diagnostic testing. Joint Task F<strong>or</strong>ce on Practice Parameters<br />

f<strong>or</strong> the Diagnosis and Treatment <strong>of</strong> Asthma.The American<br />

Academy <strong>of</strong> Allergy, Asthma and Immunology and the<br />

American College <strong>of</strong> Allergy, Asthma and Immunology. Ann<br />

Allergy Asthma Immunol 1995; 75: 543-625<br />

33 Ahmed T, Fuchs GJ. Gastrointestinal allergy to food: a review.<br />

J Diarrhoeal Dis Res 1997; 15: 211-223<br />

34 Brandtzaeg PE. Current understanding <strong>of</strong> gastrointestinal<br />

immun<strong>or</strong>egulation and its relation to food allergy. Ann N Y<br />

Acad Sci 2002; 964: 13-45<br />

35 Crowe SE, Perdue MH. Gastrointestinal food hypersensitivity:<br />

basic mechanisms <strong>of</strong> pathophysiology. Gastroenterology 1992;<br />

103: 1075-1095<br />

www.wjgnet.com

---

3048 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

36 Read NW. Food and hypersensitivity in functional dyspepsia.<br />

Gut 2002; 51 Suppl 1: i50-i53<br />

37 Dainese R, Galliani EA, De Lazzari F, Di Leo V, Naccarato<br />

R. Discrepancies between rep<strong>or</strong>ted food intolerance and<br />

sensitization test findings in irritable bowel syndrome patients.<br />

Am J Gastroenterol 1999; 94: 1892-1897<br />

38 Jun DW, Lee OY, Yoon HJ, Lee SH, Lee HL, Choi HS, Yoon<br />

BC, Lee MH, Lee DH, Cho SH. Food intolerance and skin prick<br />

test in treated and untreated irritable bowel syndrome. W<strong>or</strong>ld J<br />

Gastroenterol 2006; 12: 2382-2387<br />

39 Simonato B, De Lazzari F, Pasini G, Polato F, Giannattasio M,<br />

Gemignani C, Peruffo AD, Santucci B, Plebani M, Curioni A.<br />

IgE binding to soluble and insoluble wheat flour proteins in<br />

atopic and non-atopic patients suffering from gastrointestinal<br />

www.wjgnet.com<br />

symptoms after wheat ingestion. Clin Exp Allergy 2001; 31:<br />

1771-1778<br />

40 Zar S, Benson MJ, Kumar D. Food-specific serum IgG4 and IgE<br />

titers to common food antigens in irritable bowel syndrome.<br />

Am J Gastroenterol 2005; 100: 1550-1557<br />

41 Zuo XL, Li YQ, Li WJ, Guo YT, Lu XF, Li JM, Desmond PV.<br />

Alterations <strong>of</strong> food antigen-specific serum immunoglobulins<br />

G and E antibodies in patients with irritable bowel syndrome<br />

and functional dyspepsia. Clin Exp Allergy 2007; 37:<br />

823-830<br />

42 Soares RL, Figueiredo HN, Maneschy CP, Rocha VR, Santos<br />

JM. C<strong>or</strong>relation between symptoms <strong>of</strong> the irritable bowel<br />

syndrome and the response to the food extract skin prick test.<br />

Braz J Med Biol Res 2004; 37: 659-662<br />

S- Edit<strong>or</strong> Li DL L- Edit<strong>or</strong> Kerr C E- Edit<strong>or</strong> Ma WH

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3049-3053<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

Managing injuries <strong>of</strong> hepatic duct confluence variants after<br />

maj<strong>or</strong> hepatobiliary surgery: An alg<strong>or</strong>ithmic approach<br />

Ge<strong>or</strong>gios Fragulidis, Athanasios Marinis, Andreas Polyd<strong>or</strong>ou, Christos Konstantinidis, Ge<strong>or</strong>gios Anastasopoulos,<br />

John Contis, Dionysios V<strong>or</strong>os, Vassilios Smyrniotis<br />

Ge<strong>or</strong>gios Fragulidis, Athanasios Marinis, Andreas Polyd<strong>or</strong>ou,<br />

Christos Konstantinidis, Ge<strong>or</strong>gios Anastasopoulos, John<br />

Contis, Dionysios V<strong>or</strong>os and Vassilios Smyrniotis, Second<br />

Department <strong>of</strong> Surgery, Areteion University Hospital, Athens<br />

Medical School, University <strong>of</strong> Athens, 76 Vassilisis S<strong>of</strong>ia’s Ave.,<br />

Athens 11528, Greece<br />

Auth<strong>or</strong> contributions: Fragulidis G, Marinis A and Smyrniotis<br />

V wrote the paper; Konstantinidis C and Anastasopoulos G<br />

contributed equally to this w<strong>or</strong>k; Polyd<strong>or</strong>ou A, Fragulidis G,<br />

Contis J, V<strong>or</strong>os D and Smyrniotis V perf<strong>or</strong>med the operations,<br />

Polyd<strong>or</strong>ou A and Smyrniotis V reviewed the paper.<br />

C<strong>or</strong>respondence to: Athanasios Marinis, MD, Second<br />

Department <strong>of</strong> Surgery, Areteion University Hospital, Athens<br />

Medical School, University <strong>of</strong> Athens, 40 Ptolemaidos str, 13674,<br />

Acharnes, Athens 11528, Greece. sakisdoc@yahoo.com<br />

Telephone: +30-697-2335748 Fax: +30-210-2441689<br />

Received: January 9, 2008 Revised: March 26, 2008<br />

Abstract<br />

AIM:To investigate injuries <strong>of</strong> anatomy variants <strong>of</strong><br />

hepatic duct confluence during hepatobiliary surgery<br />

and their impact on m<strong>or</strong>bidity and m<strong>or</strong>tality <strong>of</strong><br />

these procedures. An alg<strong>or</strong>ithmic approach f<strong>or</strong> the<br />

management <strong>of</strong> these injuries is proposed.<br />

METHODS: During a 6-year period 234 patients who<br />

had undergone maj<strong>or</strong> hepatobiliary surgery were<br />

retrospectively reviewed in <strong>or</strong>der to study postoperative<br />

bile leakage. Diagnostic w<strong>or</strong>kup included endoscopic<br />

and magnetic retrograde cholangiopancreatography<br />

(E/MRCP), scintigraphy and fistulography.<br />

RESULTS: Thirty (12.8%) patients who developed<br />

postoperative bile leaks were identified. Endoscopic<br />

stenting and percutaneous drainage were successful in<br />

23 patients with bile leaks from the liver cut surface.<br />

In the rest seven patients with injuries <strong>of</strong> hepatic<br />

duct confluence, biliary variations were recognized<br />

and a stepwise therapeutic approach was considered.<br />

Conservative management was successful only in 2<br />

patients. Volume <strong>of</strong> the liver remnant and functional liver<br />

reserve as well as local sepsis were used as criteria f<strong>or</strong><br />

either resection <strong>of</strong> the c<strong>or</strong>responding liver segment <strong>or</strong><br />

construction <strong>of</strong> a biliary-enteric anastomosis. Two deaths<br />

occurred in this group <strong>of</strong> patients with hepatic duct<br />

confluence variants (m<strong>or</strong>tality rate 28.5%).<br />

CONCLUSION: Management <strong>of</strong> maj<strong>or</strong> biliary fistulae<br />

RAPID COMMUNICATION<br />

that are disconnected from the mainstream <strong>of</strong> the biliary<br />

tree and related to injury <strong>of</strong> variants <strong>of</strong> the hepatic duct<br />

confluence is extremely challenging. These patients have<br />

a grave prognosis and an early surgical procedure has to<br />

be considered.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Biliary aberrations; Bile duct injury; Postoperative<br />

bile leakage; Hepatic duct confluence; Hepatectomy<br />

Peer reviewers: Mitsuo Shimada, Pr<strong>of</strong>ess<strong>or</strong>, Department <strong>of</strong><br />

Digestive and Pediatric Surgery, Tokushima University, Kuramoto<br />

3-18-15, Tokushima 770-8503, Japan; Tadatoshi Takayama,<br />

Pr<strong>of</strong>ess<strong>or</strong>, Department <strong>of</strong> Digestive Surgery, Nihon University<br />

School <strong>of</strong> Medicine, 30-1 Oyaguchikami-machi, Itabashi-ku,<br />

Tokyo 173-8610, Japan; Kazuhiro Hanazaki, MD, Pr<strong>of</strong>ess<strong>or</strong> and<br />

Chairman, Department <strong>of</strong> Surgery, Kochi Medical School, Kochi<br />

University, Kohasu, Okohcho, Nankoku, Kochi 783-8505, Japan<br />

Fragulidis G, Marinis A, Polyd<strong>or</strong>ou A, Konstantinidis C,<br />

Anastasopoulos G, Contis J, V<strong>or</strong>os D, Smyrniotis V. Managing<br />

injuries <strong>of</strong> hepatic duct confluence variants after maj<strong>or</strong><br />

hepatobiliary surgery: An alg<strong>or</strong>ithmic approach. W<strong>or</strong>ld J<br />

Gastroenterol 2008; 14(19): 3049-3053 Available from: URL:<br />

http://www.wjgnet.com/1007-9327/14/3049.asp DOI: http://<br />

dx.doi.<strong>or</strong>g/10.3748/wjg.14.3049<br />

INTRODUCTION<br />

Dissection <strong>of</strong> the biliary tract constitutes the most<br />

crucial step in liver resections and every eff<strong>or</strong>t should<br />

aim to secure integrity and n<strong>or</strong>mal bile flow <strong>of</strong> the liver<br />

remnant. However, up to 40% <strong>of</strong> the patients are lacking<br />

the conventional biliary branching pattern and are m<strong>or</strong>e<br />

<strong>of</strong>ten exposed to sect<strong>or</strong>ial bile duct transection during liver<br />

resection [1] .<br />

The most frequent biliary variants are found in the<br />

right liver. The right posteri<strong>or</strong> sect<strong>or</strong>ial duct (RPSD) and<br />

the right anteri<strong>or</strong> sect<strong>or</strong>ial duct (RASD) may be joining the<br />

left hepatic duct (LHD), the common hepatic duct (CHD)<br />

<strong>or</strong> even the cystic duct [2-10] . Although biliary complications<br />

in liver resections occur approximately in 10%, they<br />

are responsible f<strong>or</strong> one third <strong>of</strong> the postoperative<br />

m<strong>or</strong>tality [11,12] . F<strong>or</strong>tunately, the maj<strong>or</strong>ity is amenable to non<br />

surgical treatment, but when reoperation is necessitated<br />

m<strong>or</strong>tality rate may reach up to 70% [13,14] . This high<br />

www.wjgnet.com

---

3052 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

<strong>of</strong> pure ethanol in an injured sect<strong>or</strong>ial duct resulting in<br />

atrophy <strong>of</strong> the c<strong>or</strong>responding liver segment and cessation<br />

<strong>of</strong> postoperative bile leak seems to be a minimally invasive<br />

approach to this devastating complication needing,<br />

however, further evaluation [30] . Postoperative persistent<br />

maj<strong>or</strong> biliary fistula that has been attributed from<br />

diagnostic w<strong>or</strong>kup to an injury <strong>of</strong> a variant <strong>of</strong> the hepatic<br />

duct confluence is initially treated conservatively by means<br />

<strong>of</strong> percutaneous drainage and management <strong>of</strong> ensuing<br />

sepsis usually in a critical care environment. This approach<br />

was effective in two <strong>of</strong> our seven patients and the bile leak<br />

resolved 2 mo and 4 mo after initial operation.<br />

Unf<strong>or</strong>tunately, conservative treatment may not settle<br />

the problem and ongoing intra-abdominal sepsis fuelled by<br />

the maj<strong>or</strong> bile leak is associated with high m<strong>or</strong>bidity and<br />

m<strong>or</strong>tality. Despite adequate biliary drainage and critical<br />

care supp<strong>or</strong>t, surgical treatment should be instituted<br />

in <strong>or</strong>der to manage this problem. A planned approach<br />

<strong>based</strong> upon patient’s general status, volume <strong>of</strong> future liver<br />

remnant and liver functional reserve, type and extent <strong>of</strong><br />

injury and the volume <strong>of</strong> the c<strong>or</strong>responding liver segment<br />

draining through the injured sect<strong>or</strong>ial bile duct are crucial<br />

f<strong>or</strong> decision making. Surgical treatment includes either a<br />

resection <strong>of</strong> the c<strong>or</strong>responding liver segment <strong>or</strong> a biliaryenteric<br />

anastomosis with a Roux-en-Y limb. In our series,<br />

two patients underwent a biliary-enteric anastomosis,<br />

which was not successful in one <strong>of</strong> them and resection <strong>of</strong><br />

the c<strong>or</strong>responding liver segment was additionally carried<br />

out. Resection <strong>of</strong> the liver segment, drained by the injured<br />

sect<strong>or</strong>ial bile duct, was carried out successfully in two<br />

m<strong>or</strong>e patients. Theref<strong>or</strong>e, in the case <strong>of</strong> injury <strong>of</strong> a variant<br />

<strong>of</strong> the hepatic duct confluence an alg<strong>or</strong>ithmic approach is<br />

proposed and depicted schematically in Figure 3.<br />

In conclusion, variants <strong>of</strong> hepatic duct confluence<br />

are frequently involved and injured during maj<strong>or</strong> hepatic<br />

surgery and seriously complicate postoperatively all patients<br />

due to delay <strong>of</strong> diagnosis and ongoing intra-abdominal<br />

sepsis. Preoperative imaging <strong>of</strong> the biliary branching<br />

pattern (ERCP, MRCP) remains the only way to recognize<br />

and address properly the problem posed by the variant <strong>of</strong><br />

biliary anatomy. MRCP <strong>of</strong>fers a reliable and non-invasive<br />

visualization <strong>of</strong> the biliary tree in a manner f<strong>or</strong> the surgical<br />

approach to be planned and adapted to prevent an injury<br />

<strong>of</strong> a variant <strong>of</strong> the hepatic duct confluence. However, if<br />

this occurs, conservative treatment is the initial approach<br />

in managing these patients. Failure to resolve the problem<br />

conservatively leads to a planned re-operation which<br />

includes either a biliary-enteric anastomosis <strong>or</strong> a resection<br />

<strong>of</strong> the c<strong>or</strong>responding to the injury liver segment.<br />

COMMENTS<br />

Background<br />

Hepatobiliary surgery is frequently encountered with variations in biliary anatomy.<br />

Injuries <strong>of</strong> variants <strong>of</strong> the hepatic duct confluence add significant m<strong>or</strong>bidity and<br />

m<strong>or</strong>tality after liver resections, due to the development <strong>of</strong> maj<strong>or</strong> bile leakage and<br />

ensuing septic sequelae.<br />

Research frontiers<br />

Preoperative evaluation <strong>of</strong> anatomical variants seems to be critical in avoiding<br />

inadvertent injury. Conservative treatment by means <strong>of</strong> minimally invasive<br />

techniques <strong>of</strong> injuries <strong>of</strong> variants <strong>of</strong> hilar biliary anatomy requires further<br />

www.wjgnet.com<br />

evaluation. Surgical treatment is still debatable whether to resect the compromised<br />

liver segment <strong>or</strong> to rest<strong>or</strong>e bile drainage to the gut by perf<strong>or</strong>ming a biliary-enteric<br />

anastomosis.<br />

Innovations and breakthroughs<br />

The proposal <strong>of</strong> an alg<strong>or</strong>ithmic approach to manage postoperatively the injuries <strong>of</strong><br />

the variants <strong>of</strong> hepatic duct confluence.<br />

Applications<br />

The implications <strong>of</strong> this study are f<strong>or</strong> further evaluation <strong>of</strong> newer conservative<br />

therapeutic techniques and/<strong>or</strong> decision-making regarding surgical management.<br />

Peer review<br />

The auth<strong>or</strong>’s proposed an alg<strong>or</strong>ithm to manage the injury <strong>of</strong> the biliary tract after<br />

hepatobiliary surgery. Their recommendation is <strong>of</strong> clinical value f<strong>or</strong> the patients<br />

who may have biliary anomaly. However, it is most imp<strong>or</strong>tant f<strong>or</strong> avoiding bile<br />

duct injuries during hepatic resection to evaluate accurate anatomy <strong>of</strong> bile duct<br />

preoperatively.<br />

REFERENCES<br />

1 Choi JW, Kim TK, Kim KW, Kim AY, Kim PN, Ha HK, Lee<br />

MG. Anatomic variation in intrahepatic bile ducts: an analysis<br />

<strong>of</strong> intraoperative cholangiograms in 300 consecutive don<strong>or</strong>s<br />

f<strong>or</strong> living don<strong>or</strong> liver transplantation. K<strong>or</strong>ean J Radiol 2003; 4:<br />

85-90<br />

2 Couinaud C, Le foie. Etudes anatomiques et chirurgicales.<br />

Paris: Masson, 1957: 187-208<br />

3 Poston GJ, Blumgart LH. Surgical anatomy <strong>of</strong> the liver<br />

and bile ducts. In: Poston GJ, Blumgart LH eds. Surgical<br />

management <strong>of</strong> hepatobiliary and pancreatic dis<strong>or</strong>ders.<br />

London: Martin Dunitz, 2003: 1-18<br />

4 Icoz G, Kilic M, Zeytunlu M, Celebi A, Ersoz G, Killi R, Memis<br />

A, Karasu Z, Yuzer Y, Tokat Y. Biliary reconstructions and<br />

complications encountered in 50 consecutive right-lobe living<br />

don<strong>or</strong> liver transplantations. Liver Transpl 2003; 9: 575-580<br />

5 Cheng YF, Huang TL, Chen CL, Chen YS, Lee TY. Variations<br />

<strong>of</strong> the intrahepatic bile ducts: application in living related<br />

liver transplantation and splitting liver transplantation. Clin<br />

Transplant 1997; 11: 337-340<br />

6 Ohkubo M, Nagino M, Kamiya J, Yuasa N, Oda K, Arai T,<br />

Nishio H, Nimura Y. Surgical anatomy <strong>of</strong> the bile ducts at the<br />

hepatic hilum as applied to living don<strong>or</strong> liver transplantation.<br />

Ann Surg 2004; 239: 82-86<br />

7 Heloury Y, Leb<strong>or</strong>gne J, Rogez JM, Robert R, Lehur PA,<br />

Pannier M, Barbin JY. Radiological anatomy <strong>of</strong> the bile ducts<br />

<strong>based</strong> on intraoperative investigation in 250 cases. Anat Clin<br />

1985; 7: 93-102<br />

8 Yoshida J, Chijiiwa K, Yamaguchi K, Yokohata K, Tanaka M.<br />

Practical classification <strong>of</strong> the branching types <strong>of</strong> the biliary<br />

tree: an analysis <strong>of</strong> 1,094 consecutive direct cholangiograms. J<br />

Am Coll Surg 1996; 182: 37-40<br />

9 Varotti G, Gondolesi GE, Goldman J, Wayne M, Fl<strong>or</strong>man SS,<br />

Schwartz ME, Miller CM, Sukru E. Anatomic variations in<br />

right liver living don<strong>or</strong>s. J Am Coll Surg 2004; 198: 577-582<br />

10 Hribernik M, Gadzijev EM, Mlakar B, Ravnik D. Variations<br />

<strong>of</strong> intrahepatic and proximal extrahepatic bile ducts.<br />

Hepatogastroenterology 2003; 50: 342-348<br />

11 Shimada M, Matsumata T, Akazawa K, Kamakura T,<br />

Itasaka H, Sugimachi K, Nose Y. Estimation <strong>of</strong> risk <strong>of</strong> maj<strong>or</strong><br />

complications after hepatic resection. Am J Surg 1994; 167:<br />

399-403<br />

12 Bismuth H, Chiche L, Castaing D. Surgical treatment <strong>of</strong><br />

hepatocellular carcinomas in noncirrhotic liver: experience<br />

with 68 liver resections. W<strong>or</strong>ld J Surg 1995; 19: 35-41<br />

13 Pace RF, Blenkharn JI, Edwards WJ, Orl<strong>of</strong>f M, Blumgart LH,<br />

Benjamin IS. Intra-abdominal sepsis after hepatic resection.<br />

Ann Surg 1989; 209: 302-306<br />

14 Lam CM, Lo CM, Liu CL, Fan ST. Biliary complications during<br />

liver resection. W<strong>or</strong>ld J Surg 2001; 25: 1273-1276<br />

15 Smyrniotis V, Arkadopoulos N, Kostopanagiotou G, Farantos

---

Fragulidis G et al . Injuries <strong>of</strong> hepatic duct confluence 3053<br />

C, Vassiliou J, Contis J, Karvouni E. Sharp liver transection<br />

versus clamp crushing technique in liver resections: a<br />

prospective study. Surgery 2005; 137: 306-311<br />

16 Smyrniotis V, Arkadopoulos N, Theod<strong>or</strong>aki K, V<strong>or</strong>os D,<br />

Vassiliou I, Polyd<strong>or</strong>ou A, Dafnios N, Gamaletsos E, Daniilidou<br />

K, Kannas D. Association between biliary complications and<br />

technique <strong>of</strong> hilar division (extrahepatic vs. intrahepatic) in<br />

maj<strong>or</strong> liver resections. W<strong>or</strong>ld J Surg Oncol 2006; 4: 59<br />

17 Ayuso JR, Ayuso C, Bombuy E, De Juan C, Llovet JM, De<br />

Caralt TM, Sanchez M, Pages M, Bruix J, Garcia-Valdecasas JC.<br />

Preoperative evaluation <strong>of</strong> biliary anatomy in adult live liver<br />

don<strong>or</strong>s with volumetric mangafodipir trisodium enhanced<br />

magnetic resonance cholangiography. Liver Transpl 2004; 10:<br />

1391-1397<br />

18 Nery JR, Fragulidis GP, Scagnelli T, Weppler D, Webb MG,<br />

Khan MF, Tzakis AG. Don<strong>or</strong> biliary variations: an overlooked<br />

problem? Clin Transplant 1997; 11: 582-587<br />

19 Reed DN Jr, Vitale GC, Wrightson WR, Edwards M,<br />

McMasters K. Decreasing m<strong>or</strong>tality <strong>of</strong> bile leaks after elective<br />

hepatic surgery. Am J Surg 2003; 185: 316-318<br />

20 Cheng YF, Lee TY, Chen CL, Huang TL, Chen YS, Lui<br />

CC. Three-dimensional helical computed tomographic<br />

cholangiography: application to living related hepatic<br />

transplantation. Clin Transplant 1997; 11: 209-213<br />

21 Kitami M, Takase K, Murakami G, Ko S, Tsuboi M, Saito H,<br />

Higano S, Nakajima Y, Takahashi S. Types and frequencies<br />

<strong>of</strong> biliary tract variations associated with a maj<strong>or</strong> p<strong>or</strong>tal<br />

venous anomaly: analysis with multi-detect<strong>or</strong> row CT<br />

cholangiography. Radiology 2006; 238: 156-166<br />

22 Izuishi K, Toyama Y, Nakano S, Goda F, Usuki H, Masaki T,<br />

Maeta H. Preoperative assessment <strong>of</strong> the aberrant bile duct<br />

using multislice computed tomography cholangiography. Am<br />

J Surg 2005; 189: 53-55<br />

23 Wang ZJ, Yeh BM, Roberts JP, Breiman RS, Qayyum A,<br />

Coakley FV. Living don<strong>or</strong> candidates f<strong>or</strong> right hepatic lobe<br />

transplantation: evaluation at CT cholangiography--initial<br />

experience. Radiology 2005; 235: 899-904<br />

24 Khalid TR, Casillas VJ, Montalvo BM, Centeno R, Levi JU.<br />

Using MR cholangiopancreatography to evaluate iatrogenic<br />

bile duct injury. AJR Am J Roentgenol 2001; 177: 1347-1352<br />

25 Lee VS, Krinsky GA, Nazzaro CA, Chang JS, Babb JS,<br />

Lin JC, M<strong>or</strong>gan GR, Teperman LW. Defining intrahepatic<br />

biliary anatomy in living liver transplant don<strong>or</strong> candidates<br />

at mangafodipir trisodium-enhanced MR cholangiography<br />

versus conventional T2-weighted MR cholangiography.<br />

Radiology 2004; 233: 659-666<br />

26 Fulcher AS, Szucs RA, Bassignani MJ, Marcos A. Right lobe<br />

living don<strong>or</strong> liver transplantation: preoperative evaluation <strong>of</strong><br />

the don<strong>or</strong> with MR imaging. AJR Am J Roentgenol 2001; 176:<br />

1483-1491<br />

27 Goldman J, Fl<strong>or</strong>man S, Varotti G, Gondolesi GE, Gerning A,<br />

Fishbein T, Kim L, Schwartz ME. Noninvasive preoperative<br />

evaluation <strong>of</strong> biliary anatomy in right-lobe living don<strong>or</strong>s with<br />

mangafodipir trisodium-enhanced MR cholangiography.<br />

Transplant Proc 2003; 35: 1421-1422<br />

28 Ijichi M, Takayama T, Toyoda H, Sano K, Kubota K,<br />

Makuuchi M. Randomized trial <strong>of</strong> the usefulness <strong>of</strong> a bile<br />

leakage test during hepatic resection. Arch Surg 2000; 135:<br />

1395-1400<br />

29 Figueras J, Llado L, Miro M, Ramos E, T<strong>or</strong>ras J, Fabregat J,<br />

Serrano T. Application <strong>of</strong> fibrin glue sealant after hepatectomy<br />

does not seem justified: results <strong>of</strong> a randomized study in 300<br />

patients. Ann Surg 2007; 245: 536-542<br />

30 Shimizu T, Yoshida H, Mamada Y, Taniai N, Matsumoto<br />

S, Mizuguchi Y, Yokomuro S, Arima Y, Akimaru K, Tajiri<br />

T. Postoperative bile leakage managed successfully by<br />

intrahepatic biliary ablation with ethanol. W<strong>or</strong>ld J Gastroenterol<br />

2006; 12: 3450-3452<br />

S- Edit<strong>or</strong> Zhong XY L- Edit<strong>or</strong> Rippe RA E- Edit<strong>or</strong> Yin DH<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3054-3058<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

RAPID COMMUNICATION<br />

Inhibit<strong>or</strong>y effect <strong>of</strong> dimeric β peptide on the recurrence and<br />

metastasis <strong>of</strong> hepatocellular carcinoma in vitro and in mice<br />

Song-Mei Wang, Jun Zhu, Luan-Feng Pan, Yin-Kun Liu<br />

Song-Mei Wang, Luan-Feng Pan, Lab<strong>or</strong>at<strong>or</strong>y <strong>of</strong> Molecular<br />

Biology, Shanghai Medical College, Fudan University, Shanghai<br />

200032, China<br />

Jun Zhu, Department <strong>of</strong> Pharmacy, Shanghai Chest Hospital,<br />

Shanghai 200031, China<br />

Yin-Kun Liu, Liver Cancer Institute, Fudan University, Shanghai<br />

200032, China<br />

Supp<strong>or</strong>ted by National High-Tech Program <strong>of</strong> China, No.<br />

2001AA215411 and No. 2004AA215201, and Shanghai Science<br />

and Technology Developing Program, No. 024319212<br />

C<strong>or</strong>respondence to: Pr<strong>of</strong>ess<strong>or</strong> Jun Zhu, Department <strong>of</strong><br />

Pharmacy, Shanghai Chest Hospital, Shanghai 200031,<br />

China. jone_zhu@126.net<br />

Telephone: +86-21-62821990-20111 Fax: +86-21-62801109<br />

Received: June 21, 2007 Revised: March 25, 2008<br />

Abstract<br />

AIM: To block the adhesion <strong>of</strong> tum<strong>or</strong> cells to the extracellular<br />

matrix, and prevent tum<strong>or</strong> metastasis and recurrence,<br />

the dimer <strong>of</strong> the β peptide (DLYYLMDLSYSMKG-<br />

GDLYYLMDLSYSMK, β2) was designed and synthesized<br />

and its anti-adhesion and anti-invasion effects on hepatocellular<br />

carcinoma cells were assessed. Additionally,<br />

its influence on the metastasis and recurrence <strong>of</strong> mouse<br />

hepatocellular carcinoma was measured.<br />

METHODS: The anti-adhesion effect <strong>of</strong> β2 on the highly<br />

metastatic hepatocellular carcinoma cell line HCCLM6<br />

cells and fibronectin (FN) was assayed by the MTT assay.<br />

The inhibition <strong>of</strong> invasion <strong>of</strong> HCCLM6 cells by β2 was<br />

observed using a Transwell (modified Boyden chamber)<br />

and matrigel. Using the hepatocellular carcinoma metastasis<br />

model and LCI-D20 nude mice, the influence <strong>of</strong> β2<br />

on the metastasis and recurrence <strong>of</strong> hepatocellular carcinoma<br />

after early resection was investigated.<br />

RESULTS: HCCLM6 cells co-incubated with 100 mmol/L,<br />

50 mmol/L, 20 mmol/L <strong>or</strong> 10 mmol/L β2 f<strong>or</strong> 3 h showed<br />

an obvious decrease in adhesion to FN. The adhesion<br />

inhibition ratios were 11.8%, 21.7%, 29.6% and 48.7%,<br />

respectively. Additionally, HCCLM6 cells cultured with<br />

100 mmol/L β2 had a dramatic decrease in cell invasion.<br />

β2 was also observed to inhibit the incisal edge recurrence<br />

and the distant metastasis <strong>of</strong> nude mice hepatocellular<br />

carcinoma after early resection (P < 0.05).<br />

CONCLUSION: The β2 peptide can specifically block the<br />

adhesion and invasion <strong>of</strong> HCCLM6 cells, and can inhibit<br />

HCC recurrence and metastasis <strong>of</strong> LCI-D20 model pos-<br />

www.wjgnet.com<br />

thepatectomy in vivo . Thus, β2 should be further studied<br />

as a new anti-tum<strong>or</strong> drug.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: β peptide; Hepatocellular carcinoma; Antiadhesion;<br />

Invasion; Metastasis; Recurrence<br />

Peer reviewer: Jean-Francois Dufour, Pr<strong>of</strong>ess<strong>or</strong>, Department<br />

<strong>of</strong> Clinical Pharmacology Inselspital, University <strong>of</strong> Berne35<br />

Murtenstrasse3010 Berne, Switzerland<br />

Wang SM, Zhu J, Pan LF, Liu YK. Inhibit<strong>or</strong>y effect <strong>of</strong> dimeric<br />

β peptide on the recurrence and metastasis <strong>of</strong> hepatocellular<br />

carcinoma in vitro and in mice. W<strong>or</strong>ld J Gastroenterol 2008;<br />

14(19): 3054-3058 Available from: URL: http://www.wjgnet.<br />

com/1007-9327/14/3054.asp DOI: http://dx.doi.<strong>or</strong>g/10.3748/<br />

wjg.14.3054<br />

INTRODUCTION<br />

Despite significant advances in the treatment <strong>of</strong> human<br />

hepatocellular carcinoma (HCC) and the prevention<br />

<strong>of</strong> postoperative metastasis, the 5-year postoperative<br />

recurrence rate <strong>of</strong> HCC is still very high [1,2] . Many eff<strong>or</strong>ts<br />

have been made to develop a m<strong>or</strong>e efficient treatment to<br />

inhibit and prevent tum<strong>or</strong> metastasis, as the recurrence<br />

and metastasis <strong>of</strong> HCC is still a large problem in clinical<br />

<strong>practice</strong>. It is well known that the metastatic process is<br />

very complex, including tum<strong>or</strong> cells dissociating from the<br />

primary locus, invading the surrounding tissue, entering<br />

and extravasating from the circulation, and growing in<br />

distant <strong>or</strong>gans [3,4] . During this process, cell adhesion is one<br />

<strong>of</strong> the most imp<strong>or</strong>tant events [5] . Many studies have been<br />

focused on the synthesized anti-adhesion peptides [6-8] .<br />

However, the application <strong>of</strong> these sh<strong>or</strong>t peptides is limited<br />

due to their sh<strong>or</strong>t half-life and high dosage required.<br />

To prolong the peptide's half-life, the polymer and a<br />

derivative <strong>of</strong> synthesized peptides were designed [9-11] . The<br />

anti-tum<strong>or</strong> metastasis effect <strong>of</strong> the repeat sequence <strong>of</strong><br />

synthesized peptides was stronger than that <strong>of</strong> non-repeat<br />

peptides [12,13] .<br />

Integrins are a family <strong>of</strong> adhesion molecules located on<br />

cells and in the extracellular matrix. The expression level <strong>of</strong><br />

integrins is related closely to a cell’s migration ability [14,15] .<br />

The anti-adhesion peptide β (DLYYLMDLSYSMK, β1) was<br />

designed by Liu et al [16] , acc<strong>or</strong>ding to the conserved sequence<br />

<strong>of</strong> the integrin α and β unit. This peptide can block the

---

Wang SM et al . Inhibit<strong>or</strong>y effect <strong>of</strong> peptide on hepatocellular carcinoma 3055<br />

interaction between tum<strong>or</strong> cells and the extracellular matrix<br />

and can also inhibit intrahepatic and pulmonary metastases<br />

after carcinosectomy in a nude mouse model with human<br />

HCC <strong>of</strong> high metastatic potential (LCI-D20) [17-21] . On<br />

the basis <strong>of</strong> these studies, here we have designed and<br />

synthesized the dimeric peptide β (β2). The effects <strong>of</strong> β2<br />

on the adhesion <strong>of</strong> human liver cancer cell line HCCLM6<br />

cells to fibronectin (FN), the invasion <strong>of</strong> HCCLM6 cells to<br />

reconstituted basement membrane, as well as liver cancer<br />

recurrence and metastasis after hepatectomy in a nude<br />

mouse model were investigated.<br />

MATERIALS AND METHODS<br />

Cell culture<br />

The highly metastatic hepatocellular carcinoma cell line<br />

HCCLM6, initially established and preserved by the<br />

Liver Cancer Institute, Fudan University, was cultured in<br />

Dulbecco’s modified eagle’s medium (DMEM, Gibco, UK),<br />

supplemented with 10% fetal bovine serum, 100 U/mL<br />

penicillin and grown at 37℃ under an atmosphere <strong>of</strong> 5%<br />

CO2. The medium was replenished every three days to<br />

maintain cell growth.<br />

Coating the 96 well high bind microplate with FN<br />

Ten mg/mL FN (Sigma, USA) solution (containing 10 mg/mL<br />

FN, 20 mmol/L Tris-Cl, pH 7.4, 150 mmol/L NaCl,<br />

1 mmol/L MgCl2, 1 mmol/L CaCl2, 1 mmol/L MnCl2)<br />

was added to a 96-well high bind microplate (C<strong>or</strong>ning,<br />

USA) (100 mL per well), and allowed to incubate at 4℃<br />

overnight. The plate was then incubated with blocking<br />

buffer (10 mmol/L Hepes, pH 7.4, 140 mmol/L NaCl,<br />

5.4 mmol/L KCl, 5.56 mmol/L glucose, 3% BSA,<br />

1 mmol/L MgCl2, 2 mmol/L CaCl2, 1 mmol/L MnCl2) at<br />

37℃ f<strong>or</strong> 2 h and air dried f<strong>or</strong> further use.<br />

Cell adhesion assay<br />

β2 peptide was designed in our lab<strong>or</strong>at<strong>or</strong>y using the<br />

sequence DLYYLMDLSYSMKGGDLYYLMDLSYS<br />

MK. The peptide was synthesized by Shanghai Sangon<br />

Bioengineering Company. 100 mL <strong>of</strong> a HCCLM6<br />

suspension (2 × 10 5 /mL) was plated in each well <strong>of</strong> an<br />

FN coated 96-well high bind microplate. 100 mL DMEM<br />

medium containing β2 at a concentration <strong>of</strong> 200 mmol/L,<br />

100 mmol/L, 40 mmol/L <strong>or</strong> 20 mmol/L was added to<br />

the cells concomitantly. The same volume <strong>of</strong> cell culture<br />

medium in place <strong>of</strong> β2 was added to the control group.<br />

200 mL <strong>of</strong> cell culture medium only was added in the<br />

plate f<strong>or</strong> the blank group. The assay was conducted in<br />

quintuplicate f<strong>or</strong> each sample. After incubation f<strong>or</strong> 3 h at<br />

37℃, under an atmosphere <strong>of</strong> 5% CO2, the unattached<br />

cells were gently washed away with HANKS buffer. The<br />

attached cell number in each well was measured by MTT.<br />

The inhibition rate <strong>of</strong> β2 on cell adhesion to FN was<br />

calculated with the following equation: Cell adhesion<br />

inhibit<strong>or</strong>y rate = (average OD <strong>of</strong> control well-average OD<br />

<strong>of</strong> β2-treated well)/(average OD <strong>of</strong> control well-average<br />

OD <strong>of</strong> blank well) × 100%<br />

MTT assay<br />

The number <strong>of</strong> attached cells in each well was examined by<br />

the MTT assay, as previously described [22] , and quantified<br />

by a micro-titer plate reader (Amersham, USA). Briefly,<br />

after incubation f<strong>or</strong> 3 h at 37℃ in 5% CO2, the unattached<br />

cells were removed by gentle washing with HANKS<br />

buffer. 100 mL DMEM and 20 mL MTT (5 mg/mL) (Sigma,<br />

USA) were added to each well. After incubation at 37℃<br />

f<strong>or</strong> 4 h, the medium was discarded. 200 mL <strong>of</strong> 0.04 mol/L<br />

hydrochl<strong>or</strong>ic acid in isopropanol was added to each well.<br />

The amount <strong>of</strong> MTT f<strong>or</strong>mazan product, which reflects<br />

the number <strong>of</strong> cells adhering to FN, was determined by<br />

measuring abs<strong>or</strong>bance with a microplate reader at a test<br />

wavelength <strong>of</strong> 570 nm and a reference wavelength <strong>of</strong><br />

630 nm.<br />

Invasion assay<br />

Invasion assays were perf<strong>or</strong>med as described previously [23] .<br />

Briefly, the upper p<strong>or</strong>tion <strong>of</strong> Transwell chambers (C<strong>or</strong>ning,<br />

USA) were coated with 75 mL <strong>of</strong> Matrigel (BD, USA)<br />

diluted 1:10 in serum-free DMEM and incubated at 37℃<br />

f<strong>or</strong> 2 h. The supernatants <strong>of</strong> HCCLM6 cells containing<br />

DMEM with 10% FCS were harvested after the cells<br />

had grown to confluence, and after adding FN at a final<br />

concentration <strong>of</strong> 5 mg/mL, resulting in conditioned<br />

medium. The trypsinized cells were harvested and diluted<br />

to a 2 × 10 6 /mL cell suspension with serum-free DMEM.<br />

100 mL <strong>of</strong> the cell suspension and 100 mL <strong>of</strong> 200 mmol/L<br />

β2 peptides in serum-free DMEM <strong>or</strong> serum-free DMEM<br />

only as a control were added in the upper chambers.<br />

Concurrently, 600 mL <strong>of</strong> conditioned medium was added<br />

to the bottom chamber <strong>of</strong> the Transwell plate. After<br />

incubation at 37℃ f<strong>or</strong> 48 h under a 5% CO2 atmosphere,<br />

the non-invading cells and the gel were gently removed<br />

from the upper chamber with cotton-tipped swabs. Cells<br />

were rinsed with PBS, and the cells on the filters were<br />

fixed with F<strong>or</strong>maldehyde and stained in Giemsa staining<br />

solution f<strong>or</strong> 30 min. The number <strong>of</strong> invaded cells on the<br />

filters was counted in 5 randomly selected high-powered<br />

(× 200) fields per filter under a microscope (Leica,<br />

Switzerland). Invasion inhibit<strong>or</strong>y rate was expressed as the<br />

following equation: Invasion inhibit<strong>or</strong>y rate = [1 - (invaded<br />

cell number in β2 chamber/invaded cell number in control<br />

chamber)] × 100%.<br />

Animal model and treatment<br />

Twelve 5-wk-old male nude mice (BALB/cA) weighing<br />

17-20 g were obtained from the Shanghai Institute <strong>of</strong><br />

Materia Medica, Chinese Academy <strong>of</strong> Sciences. The<br />

nude mouse model <strong>of</strong> human hepatocellular carcinoma<br />

with high metastatic potential (LCI-D20), which was<br />

established in Zhongshan Hospital Liver Cancer Institute,<br />

Fudan University, was used in this study. A tum<strong>or</strong> block <strong>of</strong><br />

LCI-D20 nude mice human liver cancer metastasis model<br />

was implanted into the left lobe <strong>of</strong> the nude mouse liver<br />

as described previously [24] . Briefly, a left upper abdominal<br />

transverse incision was made under anesthesia; the left lobe<br />

<strong>of</strong> the liver was exposed and a part <strong>of</strong> the liver surface was<br />

mechanically injured with sciss<strong>or</strong>s. Next, a tum<strong>or</strong> block<br />

<strong>of</strong> 0.2 cm × 0.2 cm × 0.2 cm was fixed within the liver<br />

tissue. After the operation, mice were kept in laminar-flow<br />

cabinets under specific-pathogen-free conditions and given<br />

free access to mouse chow. Liver cancer early resection<br />

www.wjgnet.com

---

3056 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

Table 1 The inhibit<strong>or</strong>y effects <strong>of</strong> β2 on the invasion ability <strong>of</strong><br />

HCCLM6 cells (n = 5)<br />

Group Mean <strong>of</strong> invaded cell (SD) Invasion inhibit<strong>or</strong>y rate (%)<br />

Control group 19.30 (9.3) -<br />

β2 group 12.20 (6.2) 36.80%<br />

Table 2 Liver cancer recurrences in incisal margins in nude<br />

mouse models after early resection<br />

Group Number <strong>of</strong><br />

mice tested<br />

was perf<strong>or</strong>med 0.2 cm from the edge <strong>of</strong> the cancer at day<br />

10 after implantation, pri<strong>or</strong> to metastasis. At day 1 after<br />

resection, the animals were subcutaneously administrated<br />

100 mL <strong>of</strong> 1 mg/mL <strong>of</strong> β2 <strong>or</strong> NS as a control every<br />

other day f<strong>or</strong> 10 doses. Mice were harvested at day 55<br />

postimplantation, and lungs were fixed in 10% f<strong>or</strong>malin,<br />

embedded in paraffin, cut into 5 mm slides and metastatic<br />

nodes were observed and counted under a microscope. If<br />

recurrence <strong>of</strong> the incisal margin <strong>of</strong> cancer was found, the<br />

lesion would be resected and weighed.<br />

All <strong>of</strong> the animal experiments were conducted in strict<br />

acc<strong>or</strong>dance with the National Institute <strong>of</strong> Health Guide<br />

f<strong>or</strong> the Care and Use <strong>of</strong> Lab<strong>or</strong>at<strong>or</strong>y Animals.<br />

Statistical analysis<br />

All data were entered into Excel spreadsheets (Excel,<br />

Micros<strong>of</strong>t, Seattle, USA). We used the SAS program (SAS<br />

Institute Inc., Cary, NC, USA) f<strong>or</strong> statistical analysis.<br />

Comparisons f<strong>or</strong> dimensional outcomes employed the<br />

Student’s t-test, <strong>or</strong> the Mann Whitney U test when the data<br />

were not n<strong>or</strong>mally distributed. Values <strong>of</strong> P < 0.05 in a twotailed<br />

fashion were considered to be statistically significant.<br />

RESULTS<br />

Mean weight <strong>of</strong><br />

recurrent lesion (g)<br />

(SD)<br />

Number <strong>of</strong> mice<br />

with recurrent lesion<br />

Control group 6 2.31 (0.64) 6<br />

β2 group 6 0.50 (0.41) a<br />

4<br />

a P < 0.05 vs control group.<br />

The inhibit<strong>or</strong>y effect <strong>of</strong> β2 on the adhesion <strong>of</strong> HCCLM6<br />

cells to FN<br />

The inhibit<strong>or</strong>y effect <strong>of</strong> β2 on the adhesion <strong>of</strong> HCCLM6<br />

cells to FN is shown in Figure 1. HCCLM6 cells coincubated<br />

with 100 mmol/L, 50 mmol/L, 20 mmol/L<br />

and 10 mmol/L β2 f<strong>or</strong> 3 h led to an obvious decrease in<br />

cellular adhesion. The adhesion inhibition ratios were<br />

11.8%, 21.7%, 29.6% and 48.7%, respectively. This<br />

observation indicates that β2 is able to inhibit the adhesion<br />

<strong>of</strong> HCCLM6 cells to FN, and thus β2 might obstruct the<br />

invasion <strong>of</strong> HCC cells to paratum<strong>or</strong> liver parenchyma.<br />

The inhibit<strong>or</strong>y effect <strong>of</strong> β2 on the invasion ability <strong>of</strong> HCCLM6<br />

cells<br />

After incubation with 100 mmol/L β2, the number <strong>of</strong><br />

invaded HCCLM6 cells was decreased. The inhibit<strong>or</strong>y rate<br />

www.wjgnet.com<br />

Mean <strong>of</strong> OD value<br />

0.8<br />

0.7<br />

0.6<br />

0.5<br />

0.4<br />

0.3<br />

0.2<br />

0.1<br />

0.0<br />

was 36.8% (Table 1). Thus, β2 might block HCC cells<br />

from invading the surrounding tissue and entering and<br />

extravasating from the circulation in vivo.<br />

The influence <strong>of</strong> β2 on the intrahepatic recurrence <strong>of</strong> the<br />

LCI-D20 model after early resection<br />

On the 10th d post-tum<strong>or</strong>-implantation, LCI-D20 tum<strong>or</strong>s<br />

were resected, and β2 <strong>or</strong> the same volume <strong>of</strong> saline was<br />

subcutaneously injected. On day 55, mice were sacrificed<br />

to check f<strong>or</strong> intrahepatic recurrence. The recurrent<br />

tum<strong>or</strong> was located around the incisal margins. Compared<br />

with the control group, the weight <strong>of</strong> the intrahepatic<br />

recurrent tum<strong>or</strong> <strong>of</strong> the β2 group was markedly decreased<br />

and statistically significant. There were 4 (4/6) mice<br />

with intrahepatic recurrent tum<strong>or</strong> in the β2 group, while<br />

there were 6 (6/6) mice with an intrahepatic recurrent<br />

tum<strong>or</strong> in the control group (Figure 1 and Table 2).<br />

These results indicate that β2 have inhibit<strong>or</strong>y effects on<br />

tum<strong>or</strong> recurrence in the incisal margin.<br />

The inhibit<strong>or</strong>y effects <strong>of</strong> β2 on metastasis <strong>of</strong> liver cancer<br />

in nude mouse models after early resection<br />

On the 55th day after tum<strong>or</strong> implantation, the number <strong>of</strong><br />

metastatic nodes was calculated under a microscope. The<br />

result showed that there were fewer metastatic nodes in<br />

the β2 treatment group compared to the control group,<br />

and there was a statistical difference between the β2<br />

group and the control group. Furtherm<strong>or</strong>e, all <strong>of</strong> the 6<br />

mice in the control group (6/6) had metastatic nodes, but<br />

only 4 (4/6) mice had metastatic nodes in the β2 group.<br />

These results indicate that β2 have a significant preventive<br />

and therapeutic effect on the metastasis <strong>of</strong> liver cancer<br />

(Table 3).<br />

DISCUSSION<br />

Mean <strong>of</strong> OD value<br />

Adhesion inhibition rate (%)<br />

0 10 20 50 100<br />

Concentration <strong>of</strong> beta peptide (mmol/L)<br />

Figure 1 The inhibit<strong>or</strong>y effect <strong>of</strong> β2 on the adhesion <strong>of</strong> HCCLM6 cells to<br />

fibronectin (n = 5).<br />

The adhesion molecules on the surface <strong>of</strong> both tum<strong>or</strong> cells<br />

and endothelial cells are associated with tum<strong>or</strong> metastasis<br />

and recurrence. Blocking the interaction between tum<strong>or</strong><br />

cell adhesion molecules and their ligands is a maj<strong>or</strong><br />

target in the prevention <strong>of</strong> cancer metastasis [25,26] . Many<br />

studies have focused on the synthesized anti-adhesion<br />

peptides [27,28] . One such peptide is RGD [29,30] , derived from<br />

the common conserved sequence <strong>of</strong> the main matrix<br />

60<br />

50<br />

40<br />

30<br />

20<br />

10<br />

0<br />

Adhesion inhibition rate (%)

---

Wang SM et al . Inhibit<strong>or</strong>y effect <strong>of</strong> peptide on hepatocellular carcinoma 3057<br />

Table 3 The lung metastasis in liver cancer nude mouse models<br />

after early resection<br />

Number<br />

(n )<br />

The total number <strong>of</strong> The number <strong>of</strong> mice with<br />

metastatic nodes in lung lung metastatic nodes<br />

Control group 6 30 4<br />

β2 group 6 11 a<br />

2<br />

a P < 0.05 vs control group.<br />

proteins such as fibronectin, collagen and fibrinogen. A<br />

second peptide is YIGSR [31] , which <strong>or</strong>iginated from the<br />

basement membrane protein laminin. The third peptide<br />

is EILDV [32] , which stemmed from the c<strong>or</strong>e sequence <strong>of</strong><br />

fibronectin. The application <strong>of</strong> these sh<strong>or</strong>t peptides was<br />

limited due to their sh<strong>or</strong>t half-life, the ease with which they<br />

are degraded and the requirement f<strong>or</strong> a high dosage. To<br />

prolong the peptides’ half-life, the polymer and derivative<br />

<strong>of</strong> synthesized peptides were designed. The anti-tum<strong>or</strong><br />

metastatic effect <strong>of</strong> repeat sequence <strong>of</strong> synthesized<br />

peptides was stronger compared to non-repeat peptides.<br />

The m<strong>or</strong>e times the sequence is repeated, the stronger the<br />

anti-metastasis effect is.<br />

FN is an imp<strong>or</strong>tant cell adhesion molecule in the<br />

extracellular matrix. It mediates cell adhesion and<br />

migration, and plays a significant role in tum<strong>or</strong> invasion<br />

and metastasis. Assaying FN adhesion to tum<strong>or</strong> cells is a<br />

method commonly used f<strong>or</strong> studying tum<strong>or</strong> cell metastasis.<br />

In this study, the extracellular matrix was simulated<br />

by coating cell culture plates with FN, after which the<br />

inhibit<strong>or</strong>y effects <strong>of</strong> β2 peptide on FN adhesion to liver<br />

cancer cells were investigated. The results demonstrated<br />

that after co-culturing the peptides with HCCLM6 cells f<strong>or</strong><br />

3 h, a distinct and specific inhibit<strong>or</strong>y effect <strong>of</strong> β2 peptide<br />

on FN adhesion to tum<strong>or</strong> cells was observed.<br />

Tum<strong>or</strong> cells must penetrate the basement membrane f<strong>or</strong><br />

at least three times during metastasis; i.e. dislodging from the<br />

<strong>or</strong>iginal site, entering blood circulation, and migrating from<br />

blood flow into remote sites. Matrigel, used as a basement<br />

membrane matrix, is produced from mouse Engelbreth-<br />

Holm-Swarm sarcoma rich in extracellular matrix protein.<br />

The artificial basement membrane is plated on a Millip<strong>or</strong>e<br />

filter in Transwell culture chambers, and f<strong>or</strong>ms a membrane<br />

structure similar to natural basement membrane. Invasive,<br />

metastatic tum<strong>or</strong> cells can penetrate the membrane under<br />

the induction <strong>of</strong> chemotactics, simulating tum<strong>or</strong> cells’<br />

invasion <strong>of</strong> the basement membrane in vivo. The results<br />

indicated that β2 exerted significant inhibit<strong>or</strong>y effects on the<br />

invasion <strong>of</strong> HCCLM6 cells.<br />

Metastasis and recurrence <strong>of</strong> liver cancer is a maj<strong>or</strong><br />

determinant f<strong>or</strong> the prognosis and long-term survival<br />

<strong>of</strong> liver cancer patients. Polypeptide therapy is a newly<br />

developed treatment f<strong>or</strong> tum<strong>or</strong>s [31] , but its clinical application<br />

is restricted by the degradation <strong>of</strong> these peptides. β peptides<br />

can inhibit the metastasis and recurrence <strong>of</strong> human liver<br />

cancer in nude mouse models after early excision, and can<br />

also block the recurrence <strong>of</strong> cancer at the incisal margins.<br />

The β peptide blocked tum<strong>or</strong> cell adhesion to FN<br />

through two possible mechanisms. First, the β peptide<br />

took up the integrin binding site competently through<br />

binding to the RGD sequence <strong>of</strong> the matrix protein. Next,<br />

the β peptide also interacted with integrin because the β<br />

peptide was designed acc<strong>or</strong>ding to the conserved sequence<br />

<strong>of</strong> the integrin α and β unit.<br />

Taken together, these cell and animal studies<br />

demonstrated that the β2 peptide can prevent and treat liver<br />

cancer adhesion and metastasis and recurrence. Theref<strong>or</strong>e,<br />

the β peptide is w<strong>or</strong>thy <strong>of</strong> further investigation, as it is a<br />

potential drug f<strong>or</strong> blocking tum<strong>or</strong> metastasis and recurrence.<br />

COMMENTS<br />

Background<br />

Despite significant advances in the treatment <strong>of</strong> human hepatocellular carcinoma<br />

(HCC), metastasis and recurrence remain the main obstacles f<strong>or</strong> HCC patients<br />

gaining a better outcome and long-term survival. It is well known that during<br />

the metastatic process, cell adhesion is one <strong>of</strong> the most imp<strong>or</strong>tant events. The<br />

adhesion molecules on the surface <strong>of</strong> both tum<strong>or</strong> cells and endothelial cells are<br />

associated with tum<strong>or</strong> metastasis and recurrence. So, blocking the interaction<br />

between tum<strong>or</strong> cell adhesion molecules and their ligands has become a maj<strong>or</strong><br />

target in prevention cancer metastasis.<br />

Research frontiers<br />

To prevent tum<strong>or</strong> metastasis and recurrence through inhibiting the adhesion<br />

<strong>of</strong> tum<strong>or</strong> cells, many studies have focused on the synthesized anti-adhesion<br />

peptides such as RGD, YIGSR and EILDV. These peptides are derived from the<br />

common conserved sequence <strong>of</strong> the main matrix proteins such as fibronectin,<br />

collagen, fibrinogen and laminin. Liu et al designed a new anti-adhesion peptide<br />

β (DLYYLMDLSYSMK, β1) acc<strong>or</strong>ding to the conserved sequence <strong>of</strong> the α and β<br />

unit <strong>of</strong> integrins. These peptides can inhibit the adhesion <strong>of</strong> tum<strong>or</strong> cells and cancer<br />

metastasis and recurrence. But their application is limited due to the sh<strong>or</strong>t half-life<br />

and high dosage required.<br />

Innovations and breakthroughs<br />

On the basis <strong>of</strong> Liu’s study, to prolong the peptide’s half-life, the dimmer <strong>of</strong> β<br />

peptide (DLYYLMDLSYSMKGGDLYYLMDLSYSMK, β2) was designed and<br />

synthesized and the anti-adhesion and anti-invasion effect <strong>of</strong> it on hepatocellular<br />

carcinoma cells, as well as it’s influence to the metastasis and recurrence <strong>of</strong> mouse<br />

hepatocellular carcinoma were measured. The result showed that β2 can inhibit the<br />

adhesion <strong>of</strong> HCCLM6 cells to FN in dose-effect manner. And the number <strong>of</strong> invaded<br />

HCCLM6 cells was decreased when incubated together with 100 mmol/L β2.<br />

Compared with the control group, the weight <strong>of</strong> the intrahepatic recurrent tum<strong>or</strong> and<br />

the number <strong>of</strong> metastatic nodes in lung <strong>of</strong> the β2 group were markedly decreased.<br />

Applications<br />

β2 might obstruct the invasion <strong>of</strong> HCC cells to paratum<strong>or</strong> liver parenchyma<br />

and block HCC cells from invading the surrounding tissue and entering and<br />

extravasating from the circulation in vivo. In addition, β2 have inhibit<strong>or</strong>y effects on<br />

tum<strong>or</strong> recurrence in the incisal margin and a significant preventive and therapeutic<br />

effect on the metastasis <strong>of</strong> liver cancer. Taken together, these cell and animal<br />

studies demonstrated that the β2 peptide can prevent and treat liver cancer<br />

adhesion, metastasis and recurrence.<br />

Peer review<br />

On the basis <strong>of</strong> previous w<strong>or</strong>k, the β2 peptide (DLYYLMDLSYSMKGGDLYYLM<br />

DLSYSMK, β2) was designed and synthesized. After co-culturing with HCCLM6<br />

cells f<strong>or</strong> 3 h, a distinct and specific inhibit<strong>or</strong>y effect <strong>of</strong> β2 peptide on FN adhesion<br />

to tum<strong>or</strong> cells was observed. And also β2 showed significant inhibit<strong>or</strong>y effects on<br />

the invasion <strong>of</strong> HCCLM6 cells. Furtherm<strong>or</strong>e, β2 peptides can inhibit the metastasis<br />

and recurrence <strong>of</strong> human liver cancer in nude mouse models after early excision,<br />

and can also block the recurrence <strong>of</strong> cancer at the incisal margins. These results<br />

indicate that β2 have a significant preventive and therapeutic effect on the<br />

metastasis <strong>of</strong> liver cancer.<br />

REFERENCES<br />

1 Fang WQ, Li SP, Zhang CQ, Xu L, Shi M, Chen MS, Li JQ.<br />

www.wjgnet.com

---

3058 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

[Prophylaxis and clinical treatment f<strong>or</strong> surgical margin<br />

recurrence <strong>of</strong> small primary hepatocellular carcinoma] Ai<br />

Zheng 2005; 24: 834-836<br />

2 Lee WC, Jeng LB, Chen MF. Estimation <strong>of</strong> prognosis after<br />

hepatectomy f<strong>or</strong> hepatocellular carcinoma. Br J Surg 2002; 89:<br />

311-316<br />

3 Wyke JA. Overview--burgeoning promise in metastasis<br />

research. Eur J Cancer 2000; 36: 1589-1594<br />

4 Liotta LA, Steeg PS, Stetler-Stevenson WG. Cancer metastasis<br />

and angiogenesis: an imbalance <strong>of</strong> positive and negative<br />

regulation. Cell 1991; 64: 327-336<br />

5 Chu XY, Chen LB. Cellular adhesive molecular and the<br />

invasion and metastasis <strong>of</strong> neoplasm. Yixue Yanjiusheng Xuebao<br />

2000; 13: 42-45<br />

6 Li FH. The inhibit<strong>or</strong>y effect <strong>of</strong> bioactive peptides on neoplasm<br />

metastasis. Kouqiang Hemian Waike Zazhi 1999; 9: 231-234<br />

7 Liu LY, Chen ZY , Zhao TH. Investigations <strong>of</strong> a peptide with<br />

RGD and YIGSR fragments: synthesis and its anti-tum<strong>or</strong><br />

invasion activities. Zhongguo Xinyao Zazhi 2005; 14: 729-731<br />

8 Saiki I, Yoneda J, Kobayashi H, Igarashi Y, Komazawa H,<br />

Ishizaki Y, Kato I, Azuma I. Antimetastatic effect by antiadhesion<br />

therapy with cell-adhesive peptide <strong>of</strong> fibronectin in<br />

combination with anticancer drugs. Jpn J Cancer Res 1993; 84:<br />

326-335<br />

9 Zhang HQ, Shinohara H, Gu N, Sasaki H, Sisido M. Cell<br />

Adhesion Inhibition by RGD Peptides Linked with a<br />

Photoisomerizable Nonnatural Amino Acid. J Southeast Univ<br />

2001; 17: 22-26<br />

10 Liu LY, Chen ZY , Zhao TH. Synthesis <strong>of</strong> RGD identical-f<strong>or</strong>kpeptide<br />

derivative with inhibitive effecton adhesiveness <strong>of</strong><br />

advanced metastatic tum<strong>or</strong> cells. Zhongguo Xinyao Zazhi 2006;<br />

15: 1661-1663<br />

11 Zhao M, Wang C, Jiang X, Pen S. Synthesis <strong>of</strong> RGD containing<br />

peptides and their bioactivities. Prep Biochem Biotechnol 2002;<br />

32: 363-380<br />

12 Cao K, Zhao TH, Chen ZY, Gao W, Yang HS, Shi B. The<br />

invasive capacity <strong>of</strong> human lung great cellular xancerous<br />

PG cells on ref<strong>or</strong>med basement membrane and inhibition <strong>of</strong><br />

synthetic peptides. Zhongliu Fangzhi Yanjiu 2002; 29: 20-22<br />

13 Okroj M, Dobrzaska-Paprocka Z, Rolka K, Bigda J. In vitro<br />

and in vivo analyses <strong>of</strong> the biological activity <strong>of</strong> RGD peptides<br />

towards Ab Bomirski melanoma. Cell Mol Biol Lett 2003; 8:<br />

873-884<br />

14 Heyder C, Gl<strong>or</strong>ia-Maercker E, Hatzmann W, Niggemann B,<br />

Zanker KS, Dittmar T. Role <strong>of</strong> the beta1-integrin subunit in the<br />

adhesion, extravasation and migration <strong>of</strong> T24 human bladder<br />

carcinoma cells. Clin Exp Metastasis 2005; 22: 99-106<br />

15 Liu YK, Wu WZ, Wu X, Jiang Y, Zhou XD. Liver cancer<br />

metastasis and signal transduction. In: Tang ZY. Metastasis<br />

and recurrence <strong>of</strong> hepatocellular carcinoma--basic and clinical<br />

studies. Shanghai: Shanghai scientific and technological<br />

education public house, 2003: 93-104<br />

16 Liu YK, Nemoto A, Feng Y, Uemura T. The binding ability<br />

to matrix proteins and the inhibit<strong>or</strong>y effects on cell adhesion<br />

<strong>of</strong> synthetic peptides derived from a conserved sequence <strong>of</strong><br />

integrins. J Biochem 1997; 121: 67-74<br />

17 Uemura T, Nemoto A, Liu YK. Synthetic peptide derived from<br />

www.wjgnet.com<br />

a conserved sequence <strong>of</strong> integrin β subunit. Res. Adv in Biosci<br />

& Bioeng 2000; 23: 65-83<br />

18 Sun JJ, Zhou XD, He JY, Liu YK, Tang ZY. Inhibition <strong>of</strong> the<br />

nude mice liver cancer metastasis and recurrence by beta<br />

peptide. Zhonghua Shiyan Waike Zazhi 2000; 17: 418-420<br />

19 Sun JJ, Zhou XD, Liu YK, Tang ZY, Shi JY, Bao WH, Xue Q.<br />

An experimental study on preventing and treating metastasis<br />

and recurrence <strong>of</strong> human liver cancer with anti-adhesive<br />

drugs in nude mice. Zhonghua Xiaohua Zazhi 2000; 20: 53-54<br />

20 Sun JJ, Zhou XD, Liu YK, Tang ZY. An experimental study<br />

<strong>of</strong> the effect <strong>of</strong> β peptide on liver cancer recurrence and<br />

metastasis. Zhonghua Putong Waike Zazhi 2000; 15: 27-31<br />

21 Sun JJ, Zhou XD, Liu YK, Tang ZY, Sun RX, Zhao Y, Uemura<br />

T. Inhibit<strong>or</strong>y effects <strong>of</strong> synthetic beta peptide on invasion and<br />

metastasis <strong>of</strong> liver cancer. J Cancer Res Clin Oncol 2000; 126:<br />

595-600<br />

22 Sun DX, Zhang L, Chen XQ. In vitro test <strong>of</strong> cell proliferation<br />

and cytotoxic. In: Zhu LP, Chen XQ. General methods <strong>of</strong><br />

immunologic experiment. Beijing: People’s Military Medical<br />

Press, 2000: 193<br />

23 Knutson JR, Iida J, Fields GB, McCarthy JB. CD44/chondroitin<br />

sulfate proteoglycan and alpha 2 beta 1 integrin mediate<br />

human melanoma cell migration on type IV collagen and<br />

invasion <strong>of</strong> basement membranes. Mol Biol Cell 1996; 7: 383-396<br />

24 Sun FX, Tang ZY, Lui KD, Ye SL, Xue Q, Gao DM, Ma ZC.<br />

Establishment <strong>of</strong> a metastatic model <strong>of</strong> human hepatocellular<br />

carcinoma in nude mice via <strong>or</strong>thotopic implantation <strong>of</strong><br />

histologically intact tissues. Int J Cancer 1996; 66: 239-243<br />

25 Syrigos KN, Karayiannakis AJ. Adhesion molecules as targets<br />

f<strong>or</strong> the treatment <strong>of</strong> neoplastic diseases. Curr Pharm Des 2006;<br />

12: 2849-2861<br />

26 Jiang CG, Xu HM. Research and application <strong>of</strong> anti-adhesion<br />

therapy in cancer metastasis. Guowai Yixue (Zhongliuxue<br />

Fence) 2005; 32: 31-34<br />

27 Okroj M, Dobrzaska-Paprocka Z, Rolka K, Bigda J. In vitro<br />

and in vivo analyses <strong>of</strong> the biological activity <strong>of</strong> RGD peptides<br />

towards Ab Bomirski melanoma. Cell Mol Biol Lett 2003; 8:<br />

873-884<br />

28 Wang YH, Liu YK, Li WC, Ye SL, Tang ZY. Inhibit<strong>or</strong>y effect<br />

<strong>of</strong> anti-adhesion peptides on invasion/metastasis ability <strong>of</strong><br />

hepatocellular carcinoma cells. Zhonghua Shiyan Waike Zazhi<br />

2004; 21: 1168-1169<br />

29 Liu J, Guo SX, Tang JG. Research progress <strong>of</strong> RGD-peptide f<strong>or</strong><br />

cancer therapy. Guowai Yixue (Zhongliuxue Fence) 2003; 30:<br />

193-197<br />

30 Maeda M, Izuno Y, Kawasaki K, Kaneda Y, Mu Y, Tsutsumi<br />

Y, Nakagawa S, Mayumi T. Amino acids and peptides. XXXI.<br />

Preparation <strong>of</strong> analogs <strong>of</strong> the laminin-related peptide YIGSR<br />

and their inhibit<strong>or</strong>y effect on experimental metastasis. Chem<br />

Pharm Bull (Tokyo) 1998; 46: 347-350<br />

31 Kaneda Y, Yamamoto Y, Okada N, Tsutsuml Y, Nakagawa S,<br />

Kakiuch M, Maeda M, Kawasaki K, Mayumi T. Antimetastatic<br />

effect <strong>of</strong> synthetic Glu-Ile-Leu-Asp-Val peptide derivatives<br />

containing D-amino acids. Anticancer Drugs 1997; 8: 702-707<br />

32 Feng ZH, Huang B, Zhang GM, Li D, Wang HT. Inducement<br />

<strong>of</strong> antitum<strong>or</strong>-immunity by DC activated by Hsp70-H22 tum<strong>or</strong><br />

antigen peptide. Chin J Cancer Res 15: 79-85<br />

S- Edit<strong>or</strong> Ge X L- Edit<strong>or</strong> Alpini GD E- Edit<strong>or</strong> Liu Y

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3059-3063<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

RAPID COMMUNICATION<br />

A case-control study <strong>of</strong> the relationship between hepatitis<br />

B virus DNA level and risk <strong>of</strong> hepatocellular carcinoma in<br />

Qidong, China<br />

Tao-Tao Liu, Ying Fang, Hui Xiong, Tao-Yang Chen, Zheng-Pin Ni, Jian-Feng Luo, Nai-Qing Zhao, Xi-Zhong Shen<br />

Tao-Tao Liu, Xi-Zhong Shen, Department <strong>of</strong> Gastroenterology,<br />

Zhongshan Hospital, Fudan University, Shanghai 200032, China<br />

Ying Fang, Endoscopy Center, Huadong Hospital, Fudan<br />

University, Shanghai 200040, China<br />

Hui Xiong, Chinese National Human Genome Center at Shanghai,<br />

Shanghai 201203, China<br />

Tao-Yang Chen, Zheng-Pin Ni, Qidong Liver Cancer Institute,<br />

Qidong 226200, Jiangsu Province, China<br />

Jian-Feng Luo, Nai-Qing Zhao, Department <strong>of</strong> Health Statistics<br />

and Community Medicine, Fudan University, Shanghai 200032,<br />

China<br />

Auth<strong>or</strong> contributions: Liu TT, Xiong H and Shen XZ designed<br />

the research; Liu TT and Fang Y perf<strong>or</strong>med the research; Chen TY<br />

and Ni ZP contributed samples and materials; Zhao NQ and Ruo JF<br />

analyzed the data; and Liu TT and Shen XZ wrote the paper.<br />

Supp<strong>or</strong>ted by The National High Technology Research and<br />

Development Program <strong>of</strong> China 863 Project, No. 2006AA02Z4C5<br />

C<strong>or</strong>respondents: Pr<strong>of</strong>ess<strong>or</strong> Xi-Zhong Shen, MD, Department<br />

<strong>of</strong> Gastroenterology, Zhongshan Hospital, Fudan University, 180#<br />

Fenglin Road, Shanghai 200032, China. shenxz99@yahoo.com<br />

Telephone: +86-21-64041990 Fax: +86-21-64038038<br />

Received: December 4, 2007 Revised: February 25, 2008<br />

Abstract<br />

AIM: To investigate the role <strong>of</strong> hepatitis B virus (HBV)<br />

replication in the development <strong>of</strong> hepatocellular<br />

carcinoma (HCC), a nested case-control study was<br />

perf<strong>or</strong>med to study the relationship between HBV DNA<br />

level and risk <strong>of</strong> HCC.<br />

METHODS: One hundred and seventy cases <strong>of</strong> HCC<br />

and 276 control subjects free <strong>of</strong> HCC and cirrhosis<br />

were selected f<strong>or</strong> this study. Serum HBV DNA level was<br />

measured using flu<strong>or</strong>escein quantitative polymerase<br />

chain reaction at study entry and the last visit.<br />

RESULTS: In a binary unconditional logistic regression<br />

analysis adjusted f<strong>or</strong> age, cigarette smoking, alcohol<br />

consumption and family hist<strong>or</strong>y <strong>of</strong> chronic liver diseases,<br />

the adjusted odds ratios (95% confidence intervals) <strong>of</strong><br />

HCC in patients with increasing HBV DNA level were<br />

2.834 (1.237-6.492), 48.403 (14.392-162.789), 42.252<br />

(14.784-120.750), and 14.819 (6.992-31.411) f<strong>or</strong> HBV DNA<br />

levels ≥ 10 4 to < 10 5 ; ≥ 10 5 to < 10 6 ; ≥ 10 6 to < 10 7 ;<br />

≥ 10 7 copies/mL, respectively. F<strong>or</strong>ty-six HCC cases were<br />

selected to compare the serums viral loads <strong>of</strong> HBV DNA<br />

at study entry with those at the last visit. The HBV DNA<br />

levels measured at the two time points did not differ<br />

significantly.<br />

CONCLUSION: The findings <strong>of</strong> this study provide<br />

strong longitudinal <strong>evidence</strong> <strong>of</strong> an increased risk <strong>of</strong> HCC<br />

associated with persistent elevation <strong>of</strong> serum HBV DNA<br />

level in the 10 4 -10 7 range.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Hepatitis B surface antigen; Viral replication;<br />

Asymptomatic carriers; Viral load<br />

Peer reviewer: Xin-Xin Zhang, Department <strong>of</strong> Infectious Disease,<br />

Ruijin Hospital, 197, Ruijin Er Road, Shanghai 200025, China<br />

Liu TT, Fang Y, Xiong H, Chen TY, Ni ZP, Luo JF, Zhao NQ,<br />

Shen XZ. A case-control study <strong>of</strong> the relationship between<br />

hepatitis B virus DNA level and risk <strong>of</strong> hepatocellular carcinoma<br />

in Qidong, China. W<strong>or</strong>ld J Gastroenterol 2008; 14(19): 3059-3063<br />

Available from: URL: http://www.wjgnet.com/1007-9327/14/3059.<br />

asp DOI: http://dx.doi.<strong>or</strong>g/10.3748/wjg.14.3059<br />

INTRODUCTION<br />

Chronic hepatitis B virus (HBV) infection is still a<br />

w<strong>or</strong>ldwide health problem [1] , with approximate 400 million<br />

patients persistently infected [2,3] . Although most <strong>of</strong> the HBV<br />

carriers are asymptomatic, about one-third (25%-40%) die<br />

from cirrhotic complications <strong>or</strong> hepatocellular carcinoma<br />

(HCC) [4] . The relative risk <strong>of</strong> HBV carriers f<strong>or</strong> the<br />

development <strong>of</strong> HCC is up to 200:1, which is one <strong>of</strong> the<br />

highest relative risks known f<strong>or</strong> a human malignancy [5] . Due<br />

to the high incidence <strong>of</strong> recurrence and secondary primary<br />

tum<strong>or</strong>, the survival rate <strong>of</strong> HCC after any treatment is still<br />

low [6] . Theref<strong>or</strong>e, looking f<strong>or</strong> the predictive fact<strong>or</strong>s f<strong>or</strong> HCC<br />

in patients with chronic Hepatitis B will have a pr<strong>of</strong>ound<br />

impact on the prevention and treatment <strong>of</strong> chronic HBV<br />

infection.<br />

The precise mechanisms by which chronic Hepatitis B<br />

leads to HCC are not clearly understood. Viral, host (sex,<br />

age and genetic susceptibility) and environmental fact<strong>or</strong>s<br />

may play interactive roles in hepatocarcinogenesis [7-12] .<br />

Recent studies have indicated that serum level <strong>of</strong> HBV<br />

DNA may be a risk fact<strong>or</strong> f<strong>or</strong> HCC [13-16] . Tang et al [17]<br />

have previously rep<strong>or</strong>ted that adult HBV carriers who<br />

maintain high-titer serum HBV DNA are at higher risk<br />

f<strong>or</strong> development <strong>of</strong> HCC. In Taiwan, a 12-year follow-up<br />

study <strong>of</strong> 4841 men who were Hepatitis B surface antigen<br />

www.wjgnet.com

---

3060 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

(HBsAg) positive has demonstrated that the risk <strong>of</strong> HCC<br />

is 2.7-10.7-fold higher in patients with baseline HBV DNA<br />

levels <strong>of</strong> 4.0 log10 copies/mL to ≥ 6.0 log10 copies/mL [18] .<br />

However, it is imp<strong>or</strong>tant to study different endemic<br />

regions to verify the relationship between active HBV<br />

replication and development <strong>of</strong> HCC, because there is a<br />

geographic distribution <strong>of</strong> HBV genotypes. In particular,<br />

the data are largely lacking in mainland <strong>of</strong> China, where<br />

chronic HBV infection is highly endemic and accounts f<strong>or</strong><br />

half <strong>of</strong> the chronic hepatitis B in the w<strong>or</strong>ld.<br />

The township <strong>of</strong> Qidong, at the mouth <strong>of</strong> the Yangtze<br />

River, is one <strong>of</strong> the highest endemic regions f<strong>or</strong> chronic<br />

HBV infection and HCC in China [19] . Between October<br />

1996 and February 2006, we followed a total <strong>of</strong> 2387<br />

HBsAg-positive adult residents in Qidong city. The aims<br />

<strong>of</strong> this study were to determine whether chronic HBV<br />

carriers who maintain high serum HBV DNA level are at<br />

higher risk f<strong>or</strong> development <strong>of</strong> HCC in Chinese patients<br />

with chronic Hepatitis B.<br />

MATERIALS AND METHODS<br />

Study population<br />

In October 1996, about 18 000 male residents between<br />

the ages <strong>of</strong> 20 and 65 yr living in 17 townships in<br />

Qidong county, China were invited to participate in a<br />

prospective study. All <strong>of</strong> those invited were tested f<strong>or</strong><br />

serum HBsAg, alanine aminotransferase (ALT) and<br />

α-fetoprotein (AFP). A total <strong>of</strong> 2387 participants who<br />

were seropositive f<strong>or</strong> HBsAg and confirmed to be free<br />

<strong>of</strong> HCC by AFP level and abdominal ultrasonography<br />

were followed up with abdominal ultrasonography and<br />

serological tests including ALT, AFP, HBV serological<br />

markers (HBsAg) and anti-Hepatitis C virus (HCV)<br />

antibody until February 2006. Each study participant<br />

provided inf<strong>or</strong>med written consent and a structured<br />

questionnaire on sociodemographic characteristics, habits<br />

<strong>of</strong> alcohol and tobacco consumption and family hist<strong>or</strong>ies.<br />

A serum specimen was collected from each participant<br />

at every interview. All <strong>of</strong> the serum samples were st<strong>or</strong>ed<br />

at -30℃ bef<strong>or</strong>e analysis. This study was approved by the<br />

research ethics committee at Zhongshan Hospital, Fudan<br />

University, Shanghai, China.<br />

Lab<strong>or</strong>at<strong>or</strong>y testing<br />

Serum HBsAg and anti-HCV antibody were tested by<br />

commercially available enzyme immunoassay kits (Shanghai<br />

Kehua Bio-engineering Co. Ltd., China). Serum ALT level<br />

was determined by ultraviolet-lactate dehydrogenase (UV-<br />

LDH) method and serum AFP level was determined by<br />

ELISA (Shanghai Kehua Bio-engineering Co. Ltd).<br />

Flu<strong>or</strong>escein quantitative polymerase chain reaction<br />

(FQ-PCR)<br />

The serum HBV DNA levels were determined using<br />

the FQ-PCR detection system (Taqmen; Roche USA),<br />

acc<strong>or</strong>ding to the manufacturer’s instructions. HBV DNA<br />

was extracted using the commercial Kit (Shanghai Shenyou<br />

Biotech Company) from 50 μL serum. The PCR reaction<br />

was carried out as follows: 37℃ f<strong>or</strong> 120 s, 94℃ f<strong>or</strong> 180 s,<br />

followed by 40 cycles <strong>of</strong> 94℃ f<strong>or</strong> 10 s, 55℃ f<strong>or</strong> 30 s and<br />

www.wjgnet.com<br />

72℃ f<strong>or</strong> 40 s. The lower limit <strong>of</strong> detection <strong>of</strong> this assay was<br />

500 copies/mL with a linear range <strong>of</strong> up to 10 8 copies/mL.<br />

Statistical analysis<br />

The χ 2 test was used to compare baseline characteristics<br />

between patients and controls subjects. Wilcoxon signed<br />

ranks test has been used to compare the constancy <strong>of</strong><br />

the viral replication at two time points. F<strong>or</strong> statistical<br />

comparisons, a value <strong>of</strong> 500 copies/mL was assigned,<br />

the detection limit <strong>of</strong> the assay, to samples that had<br />

undetectable levels <strong>of</strong> HBV DNA. Samples <strong>of</strong> the two<br />

groups were divided into six subgroups, acc<strong>or</strong>ding to the<br />

level <strong>of</strong> serum HBV DNA expressed as the logarithmic<br />

equivalent (LGE) per milliliter, subgroup 1 (< 500 copies/<br />

mL, undetectable), subgroup 2 (2.69 log10 to 3.99 log10<br />

copies/mL), subgroup 3 (4.0 log10 to 4.99 log10 copies/mL),<br />

subg roup 4 (5.0 log10 to 5.99 log10 copies/mL),<br />

subgroup 5 (6.0 log10 to 6.99 log10 copies/mL), and subgroup<br />

6 (≥ 7.0 log10 copies/mL). Binary unconditional logistic<br />

regression analysis was used to evaluate relative risks. Potential<br />

confounders including age, cigarette smoking, alcohol<br />

consumption and family hist<strong>or</strong>y <strong>of</strong> chronic liver diseases were<br />

adjusted. SPSS 13.0 f<strong>or</strong> Windows was used f<strong>or</strong> all statistical<br />

analyses. P < 0.05 was considered statistically significant.<br />

RESULTS<br />

Demographic characteristic <strong>of</strong> HCC and control patients<br />

No participants had any clinical <strong>evidence</strong> <strong>of</strong> HCC at<br />

study entry. By December 31, 2004, 243 participants died<br />

<strong>of</strong> HCC. The data were obtained from medical rec<strong>or</strong>ds<br />

and searches <strong>of</strong> computer files <strong>of</strong> death certification and<br />

cancer registry systems. To ensure complete ascertainment,<br />

we also contacted relatives by mail to identify cases. HCC<br />

was diagnosed on the basis <strong>of</strong> either surgical biopsy <strong>or</strong><br />

an elevated serum AFP level (≥ 400 ng/mL), combined<br />

with at least one positive image on sonography, computed<br />

tomography and/<strong>or</strong> magnetic resonance imaging. Seventythree<br />

patients diagnosed with HCC within the first two<br />

years <strong>of</strong> our study probably had subclinical HCC at study<br />

entry, and were theref<strong>or</strong>e, excluded from the analysis,<br />

which left 170 cases <strong>of</strong> HCC. The paired serum samples<br />

were available only in 46 cases, both at study entry and at<br />

the time <strong>of</strong> HCC, f<strong>or</strong> determining the change in serum<br />

HBV DNA level over time. Two hundred and seventysix<br />

subjects with chronic Hepatitis B infection and n<strong>or</strong>mal<br />

ALT level at each follow-up, and free <strong>of</strong> <strong>evidence</strong> <strong>of</strong><br />

cirrhosis <strong>or</strong> HCC, were selected as controls.<br />

At baseline, there were no significant differences in<br />

age, cigarette smoking and alcohol consumption between<br />

HCC and control patients, while the family hist<strong>or</strong>ies <strong>of</strong><br />

HBV-associated chronic liver diseases were significantly<br />

different between the two groups. 85/170 (50%) <strong>of</strong> cases<br />

had a family hist<strong>or</strong>y, while only 92/276 (33.3%) <strong>of</strong> control<br />

subjects had (Table 1).<br />

Baseline serum HBV DNA level in HCC patients and controls<br />

186/276 (67.4%) samples <strong>of</strong> control subjects had<br />

undetectable levels <strong>of</strong> serum HBV DNA. Compared with<br />

those with undetectable levels <strong>of</strong> serum HBV DNA, the<br />

adjusted odds ratios <strong>of</strong> HCC f<strong>or</strong> subjects with increasing

---

Liu TT et al . A study on HBV DNA and risk <strong>of</strong> HCC 3061<br />

Table 1 Demographic data in HCC and control patients n (%)<br />

Age at recruitment<br />

(yr)<br />

HBV DNA level were 0.465 (95% CI 0.172-1.259),<br />

2.834 (1.237-6.492), 48.403 (14.392-162.789), 42.252<br />

(14.784-120.750), and 14.819 (6.992-31.411). The analysis<br />

has been adjusted f<strong>or</strong> age, cigarette smoking, alcohol<br />

consumption and family hist<strong>or</strong>y <strong>of</strong> chronic liver diseases.<br />

The risk <strong>of</strong> HCC was increased with increasing HBV viral<br />

load in 4.0 log10 to 7.0 log10 copies/mL (Table 2).<br />

Change <strong>of</strong> serum HBV DNA level over time<br />

All the control subjects in our study were followed up f<strong>or</strong><br />

10 years with persistently n<strong>or</strong>mal ALT level, and had no<br />

hist<strong>or</strong>y <strong>of</strong> interferon-α <strong>or</strong> nucleoside analogue therapy.<br />

HBV DNA levels were compared between entry and last<br />

visit in asymptomatic HBV carriers (controls). There was a<br />

statistically significant difference in serum HBV DNA level<br />

at the two time points (Table 3). F<strong>or</strong> the 46 patients f<strong>or</strong><br />

whom the serum samples were collected both at study entry<br />

and at <strong>or</strong> after the time <strong>of</strong> HCC diagnosis, the time interval<br />

between collection <strong>of</strong> the two samples ranged from 24 to<br />

94 mo. The log HBV DNA levels measured at the two time<br />

points did not have a statistically significant difference.<br />

DISCUSSION<br />

HCC patients Control patients χ 2<br />

(n = 170) (n = 276)<br />

P value<br />

8.347 P > 0.05<br />

20-29 6 (3.5) 15 (5.4)<br />

30-39 52 (30.6) 88 (31.9)<br />

40-49 72 (42.4) 87 (31.5)<br />

50-59 35 (20.6) 68 (24.6)<br />

≥ 60 5 (2.9) 18 (6.5)<br />

Smoking 0.131 P > 0.05<br />

Yes 88 (51.8) 138 (50.0)<br />

No 82 (48.2) 138 (50.0)<br />

Alcohol use 0.989 P > 0.05<br />

Yes 103 (60.6) 154 (55.8)<br />

No 67 (39.4) 122 (44.2)<br />

Family hist<strong>or</strong>y 12.209 P < 0.01<br />

Yes 85 (50.0) 92 (33.3)<br />

No 85 (50.0) 184 (66.7)<br />

Table 2 Association between HBV DNA level at study entry<br />

and subsequent risk <strong>of</strong> HCC n (%)<br />

HBV DNA level<br />

(log10 copies/<br />

mL)<br />

HCC patients<br />

(n = 170)<br />

Control<br />

patients<br />

(n = 276)<br />

Adjusted<br />

odds ratio<br />

(95% CI)<br />

1 undetectable 44 (25.9) 186 (67.4) 1.000 (reference)<br />

2 (2.69-3.99) 5 (2.9) 46 (16.7) 0.465 (0.172-1.259)<br />

3 (4.00-4.99) 12 (7.1) 19 (6.9) 2.834 (1.237-6.492)<br />

4 (5.00-5.99) 30 (17.6) 4 (1.4) 48.403 (14.392-162.789)<br />

5 (6.00-6.99) 38 (22.4) 5 (1.8) 42.252 (14.784-120.750)<br />

6 (≥ 7.00) 41 (24.1) 16 (5.8) 14.819 (6.992–31.411)<br />

Adjusted f<strong>or</strong> age at enrollment (continuous variable), cigarette smoking,<br />

alcohol consumption and family hist<strong>or</strong>y <strong>of</strong> chronic liver diseases.<br />

Family hist<strong>or</strong>y <strong>of</strong> liver carcinoma is one <strong>of</strong> the main risk<br />

Table 3 Comparison <strong>of</strong> serum levels <strong>of</strong> HBV DNA at study entry<br />

and at last visit in asymptomatic HBV carriers (controls) n (%)<br />

HBV DNA level<br />

(log10 copies/mL)<br />

At study entry<br />

(n = 276)<br />

At last visit<br />

(n = 276)<br />

Z P value<br />

1 undetectable 186 (67.4) 221 (80.1) - 4.904 P < 0.01<br />

2 (2.69-3.99) 46 (16.7) 30 (10.9)<br />

3 (4.00-4.99) 19 (6.9) 9 (3.3)<br />

4 (5.00-5.99) 4 (1.4) 6 (2.2)<br />

5 (6.00-6.99) 5 (1.8) 3 (1.1)<br />

6 (≥ 7.00) 16 (5.8) 7 (2.5)<br />

fact<strong>or</strong>s f<strong>or</strong> HCC, especially in the Chinese population [20-22] .<br />

In our study, 85/170 (50%) <strong>of</strong> cases had a family hist<strong>or</strong>y<br />

<strong>of</strong> HBV-associated chronic liver diseases. However, only<br />

92/276 (33.3%) <strong>of</strong> control subjects did.<br />

In China, HBV DNA levels > 5.0 log10 copies/mL have<br />

been considered clinically significant, and are suggested<br />

by clinical <strong>practice</strong> guidelines f<strong>or</strong> making a decision on<br />

antiviral therapy in chronic carriers <strong>of</strong> Hepatitis B. The<br />

guidelines are supp<strong>or</strong>ted by the findings <strong>of</strong> a meta-analysis<br />

<strong>of</strong> 26 trials <strong>of</strong> statistical significance and consistent<br />

c<strong>or</strong>relations between viral load and histological grading,<br />

and biochemical and serological response [23] . However,<br />

the relationship between different levels, especially lower<br />

levels, <strong>of</strong> HBV DNA and risk <strong>of</strong> HCC remains uncertain.<br />

During the past 10 years, longitudinal studies have been<br />

used to evaluate HBV DNA level as risk fact<strong>or</strong>s <strong>of</strong> HCC<br />

in HBV carriers. A significant biological gradient <strong>of</strong> HCC<br />

risk by serum HBV DNA level from 4.0 log10 to 7.0 log10<br />

copies/mL was observed in our coh<strong>or</strong>t. Similar to previous<br />

results [24] , the HCC risk started to increase significantly<br />

at a serum HBV DNA level <strong>of</strong> 4.0 log10 copies/mL,<br />

which is much lower than the level <strong>of</strong> 5.0 log10 copies/mL<br />

suggested by clinical <strong>practice</strong> guidelines f<strong>or</strong> making<br />

decisions on antiviral therapy in carriers <strong>of</strong> chronic<br />

Hepatitis B. Viral loads < 4.0 log10 copies/mL have been<br />

thought to be characteristic <strong>of</strong> an inactive carrier state and<br />

a much lower risk <strong>of</strong> HCC. M<strong>or</strong>eover, it is imp<strong>or</strong>tant to<br />

know that compared to viral loads between 5.0 log10 and 7.0<br />

log10 copies/mL, patients with HBV DNA levels > 7.0 log10<br />

copies/mL were at lower risk <strong>of</strong> developing HCC. Chronic<br />

HBV carriers with mid-high viral loads (4.0 log10 to 7.0<br />

log10 copies/mL) tended to be in the phase <strong>of</strong> immune<br />

clearance, while the maj<strong>or</strong>ity <strong>of</strong> those with viral load<br />

levels <strong>of</strong> 7.0 log10 copies/mL were immunotolerant and<br />

at lower risk <strong>of</strong> HCC. Our findings are partly consistent<br />

with studies in different areas. In Japan, Ohata et al [25]<br />

have investigated the risk fact<strong>or</strong>s f<strong>or</strong> HCC in 73 patients<br />

with HBV-associated liver disease. A high viral load <strong>of</strong><br />

HBV DNA, together with age and histological fibrosis,<br />

were found to be linked to the occurrence <strong>of</strong> HCC. Yang<br />

et al [26] have rep<strong>or</strong>ted that HCC risk increased with the<br />

increasing HBV viral load above 7.5 log10 copies/mL.<br />

They have also found that HCC risk is associated with<br />

Hepatitis B e antigen (HBeAg) positivity among HBsAgpositive<br />

men in Taiwan. Based on these results, the<br />

serum level <strong>of</strong> HBV DNA may be used as a prominent<br />

risk predict<strong>or</strong> f<strong>or</strong> HCC, independent <strong>of</strong> age, histological<br />

www.wjgnet.com

---

3062 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

fibrosis and HBeAg status.<br />

To the best <strong>of</strong> our knowledge, there have been few<br />

studies on longitudinal stability <strong>of</strong> HBV DNA level in<br />

HBV carriers over time in mainland China. In the 276<br />

control subjects in our study, all the HBV DNA levels<br />

in samples at the last visit were compared with those<br />

collected at study entry. 186/276 (67.4%) samples <strong>of</strong><br />

control subjects had undetectable levels <strong>of</strong> serum HBV<br />

DNA at study entry, while 221/276 (80.1%) samples had<br />

undetectable levels <strong>of</strong> serum HBV DNA at the last visit.<br />

During a follow-up period <strong>of</strong> 10 years, the HBV DNA<br />

levels <strong>of</strong> those asymptomatic carriers tended to decrease.<br />

F<strong>or</strong>ty-six case patients were selected whose serum samples<br />

were collected both at study entry and after the time <strong>of</strong><br />

HCC diagnosis. Compared with serum HBV DNA levels<br />

at study entry, viral load after HCC onset remained at high<br />

levels. This implied that f<strong>or</strong> chronic HBV carriers free <strong>of</strong><br />

antiviral therapy, HCC was preceded by persistently high<br />

replication activity <strong>of</strong> HBV and viral levels did not decline<br />

with progression <strong>of</strong> HCC.<br />

It is generally agreed that antiviral treatment is suitable in<br />

patients with active HBV replication (≥ 5.0 log10 copies/mL)<br />

and elevated ALT level (at least twice the upper limit <strong>of</strong><br />

the n<strong>or</strong>mal range) [27] <strong>or</strong> advanced fibrosis present upon<br />

liver biopsy. In clinical trials, among patients with chronic<br />

Hepatitis B and advanced stage fibrosis, longer term<br />

lamivudine therapy reduces the risk <strong>of</strong> HCC [28,29] . Although<br />

individuals with low viral load (< 4.0 log10 copies/mL) are<br />

at decreased risk f<strong>or</strong> HCC, continued monit<strong>or</strong>ing is essential<br />

because <strong>of</strong> the fluctuating nature <strong>of</strong> chronic HBV infection.<br />

Treatment choices f<strong>or</strong> patients with serum HBV DNA levels<br />

< 5.0 log10 copies/mL are still controversial. In our study,<br />

HBV carriers with HBV DNA levels > 4.0 log10 copies/mL<br />

have 2.834 times excess risk <strong>of</strong> HCC compared with HBV<br />

carriers with lower HBV DNA levels. Theref<strong>or</strong>e, among<br />

patients with HBV DNA levels > 4.0 log10 copies/mL,<br />

liver tests should be carefully monit<strong>or</strong>ed at 3-4-mo intervals,<br />

irrespective <strong>of</strong> age and ALT levels. Antiviral treatment<br />

should be advised when hepatitis flares and/<strong>or</strong> advanced<br />

fibrosis is present upon liver biopsy.<br />

In conclusion, serum HBV DNA levels were found<br />

to be associated with increased risk <strong>of</strong> HCC. F<strong>or</strong> chronic<br />

HBV carriers without antiviral therapy, HBV DNA levels<br />

changed little with the progression <strong>of</strong> HCC. Based on<br />

these findings, it is conceivable that patients with a high<br />

viral load have a high potential f<strong>or</strong> hepatocarcinogenesis,<br />

and should be subjected to closer clinical monit<strong>or</strong>ing [30]<br />

and even antiviral treatment.<br />

ACKNOWLEDGMENTS<br />

We thank He-Jun Yuan, MD <strong>of</strong> the University <strong>of</strong> Texas<br />

Southwestern Medical School f<strong>or</strong> his helpful comments<br />

and suggestions.<br />

COMMENTS<br />

Background<br />

Chronic Hepatitis B virus (HBV) infection is still a w<strong>or</strong>ldwide health problem.<br />

The precise mechanisms by which chronic Hepatitis B leads to hepatocellular<br />

carcinoma (HCC) are not clearly understood. Viral, host (sex, age and<br />

genetic susceptibility) and environmental fact<strong>or</strong>s may play interactive roles in<br />

www.wjgnet.com<br />

hepatocarcinogenesis. Recent studies have indicated that serum level <strong>of</strong> HBV DNA<br />

may be a risk fact<strong>or</strong> f<strong>or</strong> HCC. However, the data are largely lacking in mainland<br />

China, where chronic HBV infection is highly endemic and accounts f<strong>or</strong> half <strong>of</strong> the<br />

chronic Hepatitis B in the w<strong>or</strong>ld. It is imp<strong>or</strong>tant to study different endemic regions<br />

to verify the relationship between active HBV replication and development <strong>of</strong> HCC,<br />

because there is geographic distribution <strong>of</strong> HBV genotypes.<br />

Research frontiers<br />

Study on the prognostic fact<strong>or</strong>s in patients with chronic Hepatitis B, the relationship<br />

between Hepatitis B virus genotype and HBV DNA level, and HCC and treatment<br />

<strong>of</strong> chronic Hepatitis B patients who are resistant to antiviral therapy.<br />

Innovations and breakthroughs<br />

The township <strong>of</strong> Qidong, at the mouth <strong>of</strong> the Yangtze River, is one <strong>of</strong> the highest<br />

endemic regions f<strong>or</strong> chronic HBV infection and HCC in China. However, this is<br />

believed to be the first study <strong>of</strong> the relationship between HBV replication and<br />

development <strong>of</strong> HCC in that region.<br />

Applications<br />

Base on our current findings, it is conceivable that patients with a high viral load<br />

have a high potential f<strong>or</strong> hepatocarcinogenesis, and should be subjected to<br />

closer clinical monit<strong>or</strong>ing and even antiviral treatment. The results provide a datasupp<strong>or</strong>ted<br />

approach to patients with Hepatitis B.<br />

Peer review<br />

This case-control study examined the relationship <strong>of</strong> HBV DNA quantitative levels<br />

and the risk <strong>of</strong> HCC in Qidong, China. They confirm other studies from Taiwan and<br />

elsewhere that demonstrate the risk <strong>of</strong> HCC occurs across a gradient <strong>of</strong> HBV DNA<br />

levels. This study is imp<strong>or</strong>tant.<br />

REFERENCES<br />

1 Safioleas M, Lygidakis NJ, Manti C. Hepatitis B today.<br />

Hepatogastroenterology 2007; 54: 545-548<br />

2 McMahon BJ. Epidemiology and natural hist<strong>or</strong>y <strong>of</strong> hepatitis B.<br />

Semin Liver Dis 2005; 25 Suppl 1: 3-8<br />

3 Mast EE, Mahoney FJ, Alter MJ, Margolis HS. Progress toward<br />

elimination <strong>of</strong> hepatitis B virus transmission in the United<br />

States. Vaccine 1998; 16 Suppl: S48-S51<br />

4 Farrell GC, Teoh NC. Management <strong>of</strong> chronic hepatitis B virus<br />

infection: a new era <strong>of</strong> disease control. Intern Med J 2006; 36:<br />

100-113<br />

5 Feitelson MA, Duan LX. Hepatitis B virus X antigen in the<br />

pathogenesis <strong>of</strong> chronic infections and the development <strong>of</strong><br />

hepatocellular carcinoma. Am J Pathol 1997; 150: 1141-1157<br />

6 Kaib<strong>or</strong>i M, Matsui Y, Saito T, Kamiyama Y. Risk fact<strong>or</strong>s<br />

f<strong>or</strong> different patterns <strong>of</strong> recurrence after resection <strong>of</strong><br />

hepatocellular carcinoma. Anticancer Res 2007; 27: 2809-2816<br />

7 Tong MJ, Blatt LM, Kao JH, Cheng JT, C<strong>or</strong>ey WG. Basal c<strong>or</strong>e<br />

promoter T1762/A1764 and prec<strong>or</strong>e A1896 gene mutations in<br />

hepatitis B surface antigen-positive hepatocellular carcinoma: a<br />

comparison with chronic carriers. Liver Int 2007; 27: 1356-1363<br />

8 Kao JH, Chen PJ, Lai MY, Chen DS. Basal c<strong>or</strong>e promoter mutations<br />

<strong>of</strong> hepatitis B virus increase the risk <strong>of</strong> hepatocellular carcinoma in<br />

hepatitis B carriers. Gastroenterology 2003; 124: 327-334<br />

9 Jee SH, Ohrr H, Sull JW, Samet JM. Cigarette smoking, alcohol<br />

drinking, hepatitis B, and risk f<strong>or</strong> hepatocellular carcinoma in<br />

K<strong>or</strong>ea. J Natl Cancer Inst 2004; 96: 1851-1856<br />

10 London WT, Evans AA, McGlynn K, Buetow K, An P, Gao L,<br />

Lustbader E, Ross E, Chen G, Shen F. Viral, host and environmental<br />

risk fact<strong>or</strong>s f<strong>or</strong> hepatocellular carcinoma: a prospective study in<br />

Haimen City, China. Intervirology 1995; 38: 155-161<br />

11 Evans AA, Chen G, Ross EA, Shen FM, Lin WY, London WT.<br />

Eight-year follow-up <strong>of</strong> the 90 000-person Haimen City coh<strong>or</strong>t:<br />

I. Hepatocellular carcinoma m<strong>or</strong>tality, risk fact<strong>or</strong>s, and gender<br />

differences. Cancer Epidemiol Biomarkers Prev 2002; 11: 369-376<br />

12 Fattovich G. Natural hist<strong>or</strong>y and prognosis <strong>of</strong> hepatitis B.<br />

Semin Liver Dis 2003; 23: 47-58<br />

13 Ikeda K, Arase Y, Kobayashi M, Someya T, Hosaka T, Saitoh<br />

S, Sezaki H, Akuta N, Suzuki F, Suzuki Y, Kumada H.

---

Liu TT et al . A study on HBV DNA and risk <strong>of</strong> HCC 3063<br />

Hepatitis B virus-related hepatocellular carcinogenesis and its<br />

prevention. Intervirology 2005; 48: 29-38<br />

14 Liaw YF. Hepatitis B virus replication and liver disease<br />

progression: the impact <strong>of</strong> antiviral therapy. Antivir Ther 2006;<br />

11: 669-679<br />

15 Mahmood S, Niiyama G, Kamei A, Izumi A, Nakata K, Ikeda<br />

H, Suehiro M, Kawanaka M, Togawa K, Yamada G. Influence<br />

<strong>of</strong> viral load and genotype in the progression <strong>of</strong> Hepatitis<br />

B-associated liver cirrhosis to hepatocellular carcinoma. Liver<br />

Int 2005; 25: 220-225<br />

16 Tong MJ, Blatt LM, Kao JH, Cheng JT, C<strong>or</strong>ey WG. Prec<strong>or</strong>e/<br />

basal c<strong>or</strong>e promoter mutants and hepatitis B viral DNA levels<br />

as predict<strong>or</strong>s f<strong>or</strong> liver deaths and hepatocellular carcinoma.<br />

W<strong>or</strong>ld J Gastroenterol 2006; 12: 6620-6626<br />

17 Tang B, Kruger WD, Chen G, Shen F, Lin WY, Mboup S,<br />

London WT, Evans AA. Hepatitis B viremia is associated with<br />

increased risk <strong>of</strong> hepatocellular carcinoma in chronic carriers.<br />

J Med Virol 2004; 72: 35-40<br />

18 Yu MW, Yeh SH, Chen PJ, Liaw YF, Lin CL, Liu CJ, Shih WL,<br />

Kao JH, Chen DS, Chen CJ. Hepatitis B virus genotype and<br />

DNA level and hepatocellular carcinoma: a prospective study<br />

in men. J Natl Cancer Inst 2005; 97: 265-272<br />

19 Ming L, Th<strong>or</strong>geirsson SS, Gail MH, Lu P, Harris CC, Wang N,<br />

Shao Y, Wu Z, Liu G, Wang X, Sun Z. Dominant role <strong>of</strong> hepatitis<br />

B virus and c<strong>of</strong>act<strong>or</strong> role <strong>of</strong> aflatoxin in hepatocarcinogenesis in<br />

Qidong, China. Hepatology 2002; 36: 1214-1220<br />

20 Luo RH, Zhao ZX, Zhou XY, Gao ZL, Yao JL. Risk fact<strong>or</strong>s<br />

f<strong>or</strong> primary liver carcinoma in Chinese population. W<strong>or</strong>ld J<br />

Gastroenterol 2005; 11: 4431-4434<br />

21 Yu MW, Chang HC, Chen PJ, Liu CJ, Liaw YF, Lin SM, Lee SD,<br />

Lin SC, Lin CL, Chen CJ. Increased risk f<strong>or</strong> hepatitis B-related<br />

liver cirrhosis in relatives <strong>of</strong> patients with hepatocellular<br />

carcinoma in n<strong>or</strong>thern Taiwan. Int J Epidemiol 2002; 31:<br />

1008-1015<br />

22 Yu MW, Chang HC, Liaw YF, Lin SM, Lee SD, Liu CJ, Chen<br />

PJ, Hsiao TJ, Lee PH, Chen CJ. Familial risk <strong>of</strong> hepatocellular<br />

carcinoma among chronic hepatitis B carriers and their<br />

relatives. J Natl Cancer Inst 2000; 92: 1159-1164<br />

23 Mommeja-Marin H, Mondou E, Blum MR, Rousseau F. Serum<br />

HBV DNA as a marker <strong>of</strong> efficacy during therapy f<strong>or</strong> chronic<br />

HBV infection: analysis and review <strong>of</strong> the literature. Hepatology<br />

2003; 37: 1309-1319<br />

24 Chen CJ, Yang HI, Su J, Jen CL, You SL, Lu SN, Huang GT,<br />

Iloeje UH. Risk <strong>of</strong> hepatocellular carcinoma across a biological<br />

gradient <strong>of</strong> serum hepatitis B virus DNA level. JAMA 2006;<br />

295: 65-73<br />

25 Ohata K, Hamasaki K, T<strong>or</strong>iyama K, Ishikawa H, Nakao K,<br />

Eguchi K. High viral load is a risk fact<strong>or</strong> f<strong>or</strong> hepatocellular<br />

carcinoma in patients with chronic hepatitis B virus infection.<br />

J Gastroenterol Hepatol 2004; 19: 670-675<br />

26 Yang HI, Lu SN, Liaw YF, You SL, Sun CA, Wang LY, Hsiao<br />

CK, Chen PJ, Chen DS, Chen CJ. Hepatitis B e antigen and the<br />

risk <strong>of</strong> hepatocellular carcinoma. N Engl J Med 2002; 347: 168-174<br />

27 Lai CL, Yuen MF. The natural hist<strong>or</strong>y and treatment <strong>of</strong> chronic<br />

hepatitis B: a critical evaluation <strong>of</strong> standard treatment criteria<br />

and end points. Ann Intern Med 2007; 147: 58-61<br />

28 Liaw YF, Sung JJ, Chow WC, Farrell G, Lee CZ, Yuen H,<br />

Tanwandee T, Tao QM, Shue K, Keene ON, Dixon JS, Gray<br />

DF, Sabbat J. Lamivudine f<strong>or</strong> patients with chronic hepatitis B<br />

and advanced liver disease. N Engl J Med 2004; 351: 1521-1531<br />

29 Yuen MF, Seto WK, Chow DH, Tsui K, Wong DK, Ngai VW,<br />

Wong BC, Fung J, Yuen JC, Lai CL. Long-term lamivudine<br />

therapy reduces the risk <strong>of</strong> long-term complications <strong>of</strong> chronic<br />

hepatitis B infection even in patients without advanced<br />

disease. Antivir Ther 2007; 12: 1295-1303<br />

30 Liaw YF. Prevention and surveillance <strong>of</strong> hepatitis B virusrelated<br />

hepatocellular carcinoma. Semin Liver Dis 2005; 25<br />

Suppl 1: 40-47<br />

S- Edit<strong>or</strong> Li DL L- Edit<strong>or</strong> Kerr C E- Edit<strong>or</strong> Liu Y<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3064-3068<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

RAPID COMMUNICATION<br />

Predictive value <strong>of</strong> MTT assay as an in vitro chemosensitivity<br />

testing f<strong>or</strong> gastric cancer: One institution's experience<br />

Bin Wu, Jin-Shui Zhu, Yi Zhang, Wei-Ming Shen, Qiang Zhang<br />

Bin Wu, Yi Zhang, Wei-Ming Shen, Department <strong>of</strong> Pharmacy,<br />

Shanghai Sixth Hospital Affiliated to Shanghai Jiaotong<br />

University, Shanghai 200223, China<br />

Jin-Shui Zhu, Qiang Zhang, Department <strong>of</strong> Gastroenterology,<br />

Shanghai Sixth Hospital Affiliated to Shanghai Jiaotong<br />

University, Shanghai 200223, China<br />

Auth<strong>or</strong> contributions: Wu B and Zhang Q designed and<br />

perf<strong>or</strong>med the research; Zhu JS contributed to the statistical<br />

advices; Zhang Y supplied the MTT assay data; Shen WM <strong>of</strong>fered<br />

the MTT assay advices.<br />

C<strong>or</strong>respondence to: Dr. Qiang Zhang, MD, Department <strong>of</strong><br />

Gastroenterology, Shanghai Sixth Hospital Affiliated to Shanghai<br />

Jiaotong University, Yishang Road 600, Shanghai 200223,<br />

China. qzsjtu@yahoo.cn<br />

Telephone: +86-21-64369181 Fax: +86-21-64701361<br />

Received: February 4, 2008 Revised: March 24, 2008<br />

Abstract<br />

AIM: To investigate the predictive clinical value <strong>of</strong> in vitro<br />

3-(4,5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium<br />

bromide (MTT) assay f<strong>or</strong> directing chemosensitivity in<br />

patients with gastric cancer.<br />

METHODS: Results <strong>of</strong> a total <strong>of</strong> 353 consecutive<br />

patients with gastric cancer treated with MTT-directed<br />

chemotherapy <strong>or</strong> physician’s empirical chemotherapy<br />

from July 1997 to April 2003 were reviewed and analyzed<br />

retrospectively.<br />

RESULTS: The overall 5-year survival rate <strong>of</strong> MTTsensitive<br />

group (MSG) and control group (CG) was<br />

47.5% and 45.1%, respectively. The results <strong>of</strong> subgroup<br />

analysis with Cox prop<strong>or</strong>tional-hazards model were<br />

fav<strong>or</strong>able f<strong>or</strong> the MSG-sensitive group. However, no<br />

statistically significant difference in survival rate was<br />

observed between the two groups.<br />

CONCLUSION: Individualized chemotherapy <strong>based</strong><br />

on in vitro MTT assay is beneficial, but needs to be<br />

confirmed by further randomized controlled trials.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Gastric cancer; Chemosensitivity testing;<br />

Chemotherapy; MTT assay; Survival rate<br />

Peer reviewer: T<strong>or</strong>u Ishikawa, MD, Department <strong>of</strong> Gastroenterology,<br />

Saiseikai Niigata Second Hospital, Teraji 280-7, Niigata,<br />

Niigata 950-1104, Japan<br />

www.wjgnet.com<br />

Wu B, Zhu JS, Zhang Y, Shen WM, Zhang Q. Predictive value<br />

<strong>of</strong> MTT assay as an in vitro chemosensitivity testing f<strong>or</strong> gastric<br />

cancer: One institution’s experience. W<strong>or</strong>ld J Gastroenterol 2008;<br />

14(19): 3064-3068 Available from: URL: http://www.wjgnet.<br />

com/1007-9327/14/3064.asp DOI: http://dx.doi.<strong>or</strong>g/10.3748/<br />

wjg.14.3064<br />

INTRODUCTION<br />

Gastric cancer ranks second <strong>of</strong> all cancers and is the<br />

leading cause <strong>of</strong> cancer-related deaths w<strong>or</strong>ldwide [1,2] .<br />

The incidence <strong>of</strong> gastric cancer w<strong>or</strong>ldwide is rep<strong>or</strong>ted to<br />

be especially high in Asia, South America, and Eastern<br />

Europe [2-5] . Gastric cancer patients are treated in clinical<br />

<strong>practice</strong> with various therapies, such as chemotherapy<br />

and radiation, though further improvement and progress<br />

would be required. With the development <strong>of</strong> new anticancer<br />

drugs, such as taxanes, CPT-11, oxaliplatin,<br />

gefitinib and S-1, significant improvements in the efficacy<br />

<strong>of</strong> chemotherapies against gastric cancer have been<br />

achieved [4,6-8] . However, some patients still fail to respond<br />

to chemotherapy and finally die <strong>of</strong> the critical toxicity<br />

<strong>of</strong> intensive chemotherapy [9] . Thus, new therapies and<br />

technologies are desperately needed f<strong>or</strong> the treatment<br />

<strong>of</strong> gastric cancer. Advances in this area would have a<br />

maj<strong>or</strong> impact on the outcome <strong>of</strong> a large number <strong>of</strong><br />

patients with this disease. Hence, chemosensitivity assay<br />

has been developed to individualize chemotherapy f<strong>or</strong><br />

gastric cancer patients [10] . 3-(4,5-dimethylthiazolyl-2)-2,<br />

5-diphenyltetrazolium bromide (MTT) assay is a rapid and<br />

quantitative col<strong>or</strong>imetric method f<strong>or</strong> determination <strong>of</strong> cell<br />

viability by measuring the anticancer drug effectiveness<br />

on human tum<strong>or</strong> cells. Several studies on advanced gastric<br />

cancer using this approach revealed that in vitro sensitivities<br />

are associated with in vivo tum<strong>or</strong> responses [11-15] . However,<br />

most <strong>of</strong> these studies were small-scale trials (< 100<br />

patients).<br />

In this study, MTT assay was used to predict the<br />

efficacy <strong>of</strong> individualized assay-directed chemotherapy<br />

f<strong>or</strong> Chinese gastric cancer patients, and to prove whether<br />

in vitro chemosensitivities are associated with in vivo tum<strong>or</strong><br />

responses by survival analysis.<br />

MATERIALS AND METHODS<br />

Patients<br />

This was a retrospective study. The medical rec<strong>or</strong>ds <strong>of</strong>

---

3068 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

3 Plummer M, Franceschi S, Munoz N. Epidemiology <strong>of</strong> gastric<br />

cancer. IARC Sci Publ 2004: 311-326<br />

4 Wainess RM, Dimick JB, Upchurch GR Jr, Cowan JA,<br />

Mulholland MW. Epidemiology <strong>of</strong> surgically treated gastric<br />

cancer in the United States, 1988-2000. J Gastrointest Surg 2003;<br />

7: 879-883<br />

5 Goh KL. Changing trends in gastrointestinal disease in the<br />

Asia-Pacific region. J Dig Dis 2007; 8: 179-185<br />

6 Schipper DL, Wagener DJ. Chemotherapy <strong>of</strong> gastric cancer.<br />

Anticancer Drugs 1996; 7: 137-149<br />

7 Jackson C, Mochlinski K, Cunningham D. Therapeutic options<br />

in gastric cancer: neoadjuvant chemotherapy vs postoperative<br />

chem<strong>or</strong>adiotherapy. Oncology (Williston Park) 2007; 21:<br />

1084-1087; discussion 1090, 1096-1098, 1101<br />

8 Macdonald JS. Gastric cancer--new therapeutic options. N<br />

Engl J Med 2006; 355: 76-77<br />

9 Zhang D, Fan D. Multidrug resistance in gastric cancer: recent<br />

research advances and ongoing therapeutic challenges. Expert<br />

Rev Anticancer Ther 2007; 7: 1369-1378<br />

10 Kim R, Emi M, Tanabe K, Uchida Y, Toge T. Chemosensitivity<br />

testing f<strong>or</strong> gastrointestinal cancer: survival benefit potential<br />

and limitations. Anticancer Drugs 2003; 14: 715-723<br />

11 Nakamura R, Saikawa Y, Kubota T, Kumagai A, Kiyota T,<br />

Ohashi M, Yoshida M, Otani Y, Kumai K, Kitajima M. Role<br />

<strong>of</strong> the MTT chemosensitivity test in the prognosis <strong>of</strong> gastric<br />

cancer patients after postoperative adjuvant chemotherapy.<br />

Anticancer Res 2006; 26: 1433-1437<br />

12 Iwahashi M, Nakam<strong>or</strong>i M, Nakamura M, Noguchi K, Ueda K,<br />

Nakatani Y, Ojima T, Ishida K, Naka T, Yamaue H. Individualized<br />

adjuvant chemotherapy guided by chemosensitivity test<br />

sequential to extended surgery f<strong>or</strong> advanced gastric cancer.<br />

Anticancer Res 2005; 25: 3453-3459<br />

13 Mitsuhashi Y, Inaba M, Sugiyama Y, Kobayashi T. In vitro<br />

measurement <strong>of</strong> chemosensitivity <strong>of</strong> human small cell<br />

lung and gastric cancer cell lines toward cell cycle phasenonspecific<br />

agents under the clinically equivalent area under<br />

the curve. Cancer 1992; 70: 2540-2546<br />

14 Kurihara N, Kubota T, Furukawa T, Watanabe M, Otani Y,<br />

Kumai K, Kitajima M. Chemosensitivity testing <strong>of</strong> primary<br />

tum<strong>or</strong> cells from gastric cancer patients with liver metastasis<br />

can identify effective antitum<strong>or</strong> drugs. Anticancer Res 1999; 19:<br />

5155-5158<br />

15 Noguchi K, Iwahashi M, Tani M, Nakamura M, Nakam<strong>or</strong>i<br />

M, Nakatani Y, Ueda K, Ishida K, Naka T, Ojima T, Hotta<br />

T, Mizobata S, Yamaue H. Evaluation <strong>of</strong> chemosensitivity<br />

testing with highly purified tum<strong>or</strong> cells in 435 patients with<br />

www.wjgnet.com<br />

gastric carcinoma using an MTT assay. Anticancer Res 2005; 25:<br />

931-937<br />

16 Sastre J, Garcia-Saenz JA, Diaz-Rubio E. Chemotherapy f<strong>or</strong><br />

gastric cancer. W<strong>or</strong>ld J Gastroenterol 2006; 12: 204-213<br />

17 Furue H. Chemotherapy f<strong>or</strong> gastric cancer in Japan. Gan To<br />

Kagaku Ryoho 1997; 24 Suppl 1: 120-125<br />

18 Roukos DH. Current status and future perspectives in gastric<br />

cancer management. Cancer Treat Rev 2000; 26: 243-255<br />

19 Cunningham SC, Schulick RD. Palliative management <strong>of</strong><br />

gastric cancer. Surg Oncol 2007; 16: 267-275<br />

20 Roukos DH, Kappas AM. Perspectives in the treatment <strong>of</strong><br />

gastric cancer. Nat Clin Pract Oncol 2005; 2: 98-107<br />

21 Mercer SJ, Somers SS, Knight LA, Whitehouse PA, Sharma S,<br />

Di Nicolantonio F, Glaysher S, Toh S, Cree IA. Heterogeneity<br />

<strong>of</strong> chemosensitivity <strong>of</strong> esophageal and gastric carcinoma.<br />

Anticancer Drugs 2003; 14: 397-403<br />

22 Blumenthal RD, Goldenberg DM. Methods and goals f<strong>or</strong><br />

the use <strong>of</strong> in vitro and in vivo chemosensitivity testing. Mol<br />

Biotechnol 2007; 35: 185-197<br />

23 Tayl<strong>or</strong> CG, Sargent JM, Elgie AW, Williamson CJ, Lewandowicz<br />

GM, Chappatte O, Hill JG. Chemosensitivity testing predicts<br />

survival in ovarian cancer. Eur J Gynaecol Oncol 2001; 22:<br />

278-282<br />

24 Ugurel S, Tilgen W, Reinhold U. Chemosensitivity testing in<br />

malignant melanoma. Recent Results Cancer Res 2003; 161:<br />

81-92<br />

25 Xu JM, Song ST, Tang ZM, Jiang ZF, Liu XQ, Zhou L, Zhang J,<br />

Liu XW. Predictive chemotherapy <strong>of</strong> advanced breast cancer<br />

directed by MTT assay in vitro. Breast Cancer Res Treat 1999;<br />

53: 77-85<br />

26 Kubota T, Egawa T, Otani Y, Furukawa T, Saikawa Y, Yoshida<br />

M, Watanabe M, Kumai K, Kitajima M. Cancer chemotherapy<br />

chemosensitivity testing is useful in evaluating the appropriate<br />

adjuvant cancer chemotherapy f<strong>or</strong> stages III/IV gastric cancers<br />

without peritoneal dissemination. Anticancer Res 2003; 23: 583-587<br />

27 Hwu P, Bedikian AY, Grimm EA. Challenges <strong>of</strong> chemosensitivity<br />

testing. Clin Cancer Res 2006; 12: 5258-5259<br />

28 Blumenthal RD. An overview <strong>of</strong> chemosensitivity testing.<br />

Methods Mol Med 2005; 110: 3-18<br />

29 Idbaih A, Omuro A, Ducray F, Hoang-Xuan K. Molecular<br />

genetic markers as predict<strong>or</strong>s <strong>of</strong> response to chemotherapy in<br />

gliomas. Curr Opin Oncol 2007; 19: 606-611<br />

30 Park DJ, Lenz HJ. Determinants <strong>of</strong> chemosensitivity in gastric<br />

cancer. Curr Opin Pharmacol 2006; 6: 337-344<br />

31 Covell DG. Connecting chemosensitivity, gene expression<br />

and disease. Trends Pharmacol Sci 2008; 29: 1-5<br />

S- Edit<strong>or</strong> Li DL L- Edit<strong>or</strong> Wang XL E- Edit<strong>or</strong> Lu W

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3069-3073<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

Significance <strong>of</strong> Bcl-xL in human colon carcinoma<br />

You-Li Zhang, Li-Qun Pang, Ying Wu, Xiao-Yan Wang, Chong-Qiang Wang, Yu Fan<br />

You-Li Zhang, Ying Wu, Xiao-Yan Wang, Department <strong>of</strong><br />

Gastroenterology, Affiliated Hospital <strong>of</strong> Jiangsu University,<br />

Zhenjiang 212001, Jiangsu Province, China<br />

Li-Qun Pang, Department <strong>of</strong> General Surgery, Affiliated Hospital<br />

<strong>of</strong> Jiangsu University, Zhenjiang 212001, Jiangsu Province, China<br />

Chong-Qiang Wang, Yu Fan, Cancer Institute, Department <strong>of</strong><br />

Chemotherapy, Affiliated People’s Hospital <strong>of</strong> Jiangsu University,<br />

Zhenjiang 212002, Jiangsu Province, China<br />

Auth<strong>or</strong> contributions: Zhang YL and Fan Y contributed equally<br />

to this w<strong>or</strong>k; Fan Y designed this w<strong>or</strong>k; Zhang YL perf<strong>or</strong>med<br />

this w<strong>or</strong>k and wrote the paper; Pang LQ and Wu Y perf<strong>or</strong>med the<br />

research; Wang XY and Wang CQ analyzed the data.<br />

Supp<strong>or</strong>ted by The Program <strong>of</strong> Science and Technology <strong>of</strong><br />

Zhenjiang City, No. SH2005037, SH2006019<br />

C<strong>or</strong>respondence to: Yu Fan, Department <strong>of</strong> Chemotherapy,<br />

Affiliated People’s Hospital <strong>of</strong> Jiangsu University, Zhenjiang<br />

212002, Jiangsu Province, China. yufanzh99@sina.com<br />

Telephone: +86-511-85797359 Fax: +86-511-85026387<br />

Received: October 15, 2007 Revised: January 24, 2008<br />

Abstract<br />

AIM: To investigate the clinical significance <strong>of</strong> Bcl-xL<br />

gene in the pathogenesis <strong>of</strong> human colon carcinoma.<br />

METHODS: Fifty-six pair tissue samples from patients<br />

with colon cancer were collected, and protein level <strong>of</strong><br />

the Bcl-xL gene was measured by immunohistochemistry<br />

method. The c<strong>or</strong>relation <strong>of</strong> Bcl-xL expression with clinical<br />

index was evaluated. After human colon cancer cell line<br />

HT29 was transfected with Bcl-xL small interfering RNA<br />

(siRNA), the anch<strong>or</strong>age-independent growth <strong>of</strong> cancer<br />

cells was detected by colony f<strong>or</strong>mation in s<strong>of</strong>t agar and<br />

invasion ability <strong>of</strong> cancer cells was determined by a<br />

transwell model.<br />

RESULTS: The Bcl-xL expression was higher in cancerous<br />

tissue samples than in n<strong>or</strong>mal tissue samples (38.78 ±<br />

11.36 vs 0.89 ± 0.35, P < 0.001), and was associated<br />

with the pathological grade, lymphnode metastasis and<br />

Duke’s stage <strong>of</strong> col<strong>or</strong>ectal carcinoma. Transfection with<br />

Bcl-xL siRNA inhibited the colony f<strong>or</strong>mation and invasion<br />

ability <strong>of</strong> human colon cancer cell line HT29 in vitro .<br />

CONCLUSION: Bcl-xL gene plays an imp<strong>or</strong>tant role in<br />

carcinogenesis <strong>of</strong> human col<strong>or</strong>ectal carcinoma and is<br />

associated with malignant biological behavi<strong>or</strong>s <strong>of</strong> human<br />

col<strong>or</strong>ectal carcinoma.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Col<strong>or</strong>ectal carcinoma; Bcl-xL; Clinical significance<br />

RAPID COMMUNICATION<br />

Peer reviewers: Amedeo Columbano, Dipartimento di Tossicologia,<br />

Sezione di Oncologia e Patologia Molecolare, Via P<strong>or</strong>cell<br />

4, 09124 Cagliari, Italy; Peter L Lakatos, MD, PhD, Assistant<br />

Pr<strong>of</strong>ess<strong>or</strong>, 1st Department <strong>of</strong> Medicine, Semmelweis University,<br />

K<strong>or</strong>anyi S 2A, Budapest H1083, Hungary<br />

Zhang YL, Pang LQ, Wu Y, Wang XY, Wang CQ, Fan Y.<br />

Significance <strong>of</strong> Bcl-xL in human colon carcinoma. W<strong>or</strong>ld J<br />

Gastroenterol 2008; 14(19): 3069-3073 Available from: URL:<br />

http://www.wjgnet.com/1007-9327/14/3069.asp DOI: http://dx.doi.<br />

<strong>or</strong>g/10.3748/wjg.14.3069<br />

INTRODUCTION<br />

Col<strong>or</strong>ectal cancer is the third most common malignant<br />

neoplasm w<strong>or</strong>ldwide [1] and the second leading cause<br />

<strong>of</strong> cancer-related death [2] . Despite recent advances in<br />

diagnostic and therapeutic measures, the prognosis <strong>of</strong><br />

col<strong>or</strong>ectal cancer patients with distant metastasis still<br />

remains po<strong>or</strong>. Enhanced understanding <strong>of</strong> the signaling<br />

mechanisms that regulate metastasis <strong>of</strong> colon cancer may<br />

provide imp<strong>or</strong>tant insights into m<strong>or</strong>e effective therapeutic<br />

strategies.<br />

Cells harb<strong>or</strong>ing multiple genetic alterations are<br />

n<strong>or</strong>mally eliminated by apoptosis. Diminished apoptosis<br />

plays a critical role in tum<strong>or</strong> initiation, invasion, metastasis,<br />

progression, and drug resistance. Results <strong>of</strong> numerous<br />

scientific and clinical studies link altered expression <strong>of</strong><br />

apoptosis-regulat<strong>or</strong>y proteins to the development <strong>of</strong> a lot<br />

<strong>of</strong> cancer cells. Among them, the Bcl-2 family <strong>of</strong> genes,<br />

which share sequence homology domains, plays a key<br />

role in the regulation <strong>of</strong> apoptotic cell death induced by<br />

a wide variety <strong>of</strong> therapeutic stimuli [3] . These genes can<br />

f<strong>or</strong>m homodimers and/<strong>or</strong> heterodimers that modulate one<br />

another’s function, whereby their relative concentrations<br />

function as a rheostat f<strong>or</strong> the apoptotic program [4] . Of<br />

them, Bcl-xL gene has been well characterized as a<br />

potential gene involved in the apoptotic signal pathway.<br />

Bcl-xL, a mitochondrial membrane protein, promotes<br />

cell survival by regulating the electrical and osmotic<br />

homeostasis <strong>of</strong> mitochondria in response to a variety <strong>of</strong><br />

stimuli [5,6] . Over-expression <strong>of</strong> Bcl-xL is rep<strong>or</strong>ted to confer<br />

a multidrug resistance phenotype [7,8] . M<strong>or</strong>eover, inhibition<br />

<strong>of</strong> Bcl-xL expression by some ways results in an altered<br />

ratio <strong>of</strong> BAX to Bcl-xL and subsequent mitochondriamediated<br />

cell death [9] . Thus, Bcl-xL might serve as an ideal<br />

molecular target <strong>of</strong> anticancer therapy<br />

However, previous studies about Bcl-xL gene have<br />

mainly focused on the regulation <strong>of</strong> apoptosis and drug<br />

resistance. There is little inf<strong>or</strong>mation about the linkage <strong>of</strong><br />

Bcl-xL with invasion in cancer cells. Increasing data show<br />

www.wjgnet.com

---

3070 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

that Bcl-xL over-expression might be related to invasion<br />

and metastasis <strong>of</strong> some solid tum<strong>or</strong>s, such as breast<br />

cancer [10,11] , hepatocellular carcinoma [12] , ovarian<br />

cancer [13] , glioma [14] , and lung carcinoma [15] . We have<br />

found in previous w<strong>or</strong>ks that human colon cancer cells<br />

transfected with signal transducer and activat<strong>or</strong> <strong>of</strong><br />

transcription 3 (STAT3) small interfering RNA (siRNA)<br />

can inhibit the invasion ability <strong>of</strong> cancer cells. Meanwhile,<br />

expression <strong>of</strong> Bcl-xL protein is also markedly downregulated<br />

in transfected cancer cells [16] . However, the<br />

possible role <strong>of</strong> Bcl-xL in invasion <strong>of</strong> human colon cancer<br />

is not clear.<br />

In the present study, we investigated the linkage <strong>of</strong><br />

Bcl-xL with the invasion <strong>of</strong> human colon cancer in vivo<br />

and in vitro.<br />

MATERIALS AND METHODS<br />

Tissue samples<br />

A total <strong>of</strong> 56 paired colon cancer tissue and distant n<strong>or</strong>mal<br />

colon tissue samples were obtained from 56 patients<br />

undergone surgical operation. Tum<strong>or</strong> histotype and grade<br />

<strong>of</strong> differentiation were defined acc<strong>or</strong>ding to the WHO<br />

criteria. The clinical and pathological stages were defined<br />

acc<strong>or</strong>ding to Duke’s staging. These patients did not receive<br />

any chemotherapy <strong>or</strong> radiotherapy bef<strong>or</strong>e operation. This<br />

study was approved by the Medical Ethical Committee <strong>of</strong><br />

Affiliated Hospital <strong>of</strong> Jiangsu University, and all patients<br />

provided their written inf<strong>or</strong>med consent to participate in<br />

the study. All the specimens were fixed in 10% neutralbuffered<br />

f<strong>or</strong>malin, dehydrated in ascending series <strong>of</strong><br />

ethanol and routinely embedded in paraplast. Sections<br />

were cut at 4 μm, stained with hematoxylin and eosin f<strong>or</strong><br />

histopathological and immunohistochemical evaluation.<br />

The clinicopathological parameters are summarized in<br />

Table 1.<br />

Immunohistochemical analysis and quantitative evaluation<br />

All the tissue sections were deparaffinized, rehydrated and<br />

incubated in a citrate buffer (0.01 mol/L, pH 6.0) f<strong>or</strong> 1 min<br />

at 121℃. The endogenous peroxidase activity was blocked<br />

by covering the sections with 3% H2O2/methanol f<strong>or</strong><br />

15 min. The sections were then incubated in a 1:100<br />

dilution <strong>of</strong> goat antihuman Bcl-xL IgG at 4℃ overnight.<br />

After washed with PBS containing 0.05% Tween, the tissue<br />

sections were incubated in a 1:50 dilution <strong>of</strong> biotinylated<br />

donkey anti-goat IgG (Santa Cruz) f<strong>or</strong> 30 min. The SABC<br />

reagents were used to amplify the immun<strong>or</strong>eactivity<br />

that was detected using 3’-diaminobenzidine acc<strong>or</strong>ding<br />

to the manufacturer’s instructions. The sections were<br />

counterstained with hematoxylin. The positive uniT (PU)<br />

represents the relative concentration <strong>of</strong> positive staining<br />

acc<strong>or</strong>ding to previous data [17] . Each section was observed<br />

randomly at five areas and the mean PU was assembled<br />

and calculated.<br />

Sequence <strong>of</strong> Bcl-xL siRNAs<br />

The anti-sense sequence <strong>of</strong> siRNA (5'-CTCTGAT<br />

ATGCTGTCCCTG-3') c<strong>or</strong>responding to Bcl-xL mRNA<br />

with dTdT on 3’-overhangs was designed and chemically<br />

www.wjgnet.com<br />

Table 1 Relationship between Bcl-xL expression and clinical<br />

parameter in 56 cases <strong>of</strong> col<strong>or</strong>ectal carcinoma (mean ± SD)<br />

Characteristic n Bcl-xL PU P<br />

Sex > 0.05<br />

Male 30 39.22 ± 11.35<br />

Female 26 37.36 ± 12.18<br />

Age (yr) > 0.05<br />

≤ 55 25 39.89 ± 15.78<br />

> 55 31 38.66 ± 12.56<br />

Tum<strong>or</strong> differentiation < 0.05<br />

Well 12 31.58 ± 12.69<br />

Moderate 19 39.77 ± 16.55<br />

Po<strong>or</strong> 25 53.95 ± 17.89<br />

Lymph node metastasis < 0.05<br />

Negative 27 32.19 ± 13.35<br />

Positive 29 56.36 ± 11.95<br />

Duke’s staging < 0.05<br />

A + B 28 31.55 ± 12.39<br />

C + D 28 58.78 ± 11.68<br />

synthesized acc<strong>or</strong>ding to the recommendation <strong>of</strong> the<br />

manufacturer (Dharmacon Research, USA). The scrambled<br />

siRNA served as a control, and its sequences are 5'-UUCU<br />

CCGAACGUGUCACGUTdTd-3' and 5'-ACGUGACAC<br />

GUUCGGAGAATdTdT-3'.<br />

Cell culture and Bcl-xL siRNA transfection<br />

Human colon cancer cell line HT29 (Institute <strong>of</strong> Cell<br />

Biology, Shanghai, China) was cultured in RPMI 1640<br />

(Invitrogen, Inc.) supplemented with 10% fetal bovine<br />

serum (FBS) in an atmosphere containing 50 mL/L CO2<br />

at 37℃. siRNA was transfected with a commercial reagent,<br />

olig<strong>of</strong>ectamine (Invitrogen, USA) in 6-well plates following<br />

its manufacturer’s instructions. Briefly, On the day bef<strong>or</strong>e<br />

transfection, confluent layers <strong>of</strong> cells were trypsinized,<br />

counted and re-suspended. Cells (1 × 10 5 ) were plated into<br />

each well <strong>of</strong> the 6-well plates, so that they could become<br />

about 70% confluence next day at the time <strong>of</strong> transfection.<br />

Olig<strong>of</strong>ectamine was diluted in serum-free RPMI 1640 and<br />

mixed with siRNA at a 1:2 ratio (4 μL <strong>of</strong> 20 μmol/L <strong>of</strong><br />

siRNA f<strong>or</strong>mulated with 8 μL <strong>of</strong> olig<strong>of</strong>ectamine). The cells<br />

were then incubated f<strong>or</strong> other 48 h. The number <strong>of</strong> cells<br />

was determined using a hemocytometer bef<strong>or</strong>e subsequent<br />

assays.<br />

RNA isolation and complementary DNA synthesis<br />

Total cellular RNA was isolated from cancer cell lines<br />

using Trizol. Final RNA pellets were dissolved in 20 μL<br />

<strong>of</strong> diethyl pyrocarbonate-treated water. RNA yield was<br />

determined by spectroscopy. F<strong>or</strong> complementary DNA<br />

(cDNA) synthesis, 2 μg <strong>of</strong> total RNA was transcribed<br />

with cDNA transcription reagents using 0.2 μg <strong>of</strong> the<br />

oligo(dT)18 primer f<strong>or</strong> subsequent quantitative, real-time<br />

polymerase chain reaction (RT-PCR).<br />

Real time transcription polymerase chain reaction (RT-PCR)<br />

Real-time RT-PCR analyses were perf<strong>or</strong>med on an ABI<br />

Prism 7700 sequence detection system (Perkin-Elmer Applied<br />

Biosystems, Foster City, CA). F<strong>or</strong> Bcl-xL amplification,<br />

primers with the sequences 5'-TCCTTGTCTACGCTTT<br />

CCACG-3' and 5'-GGTCGCATTGTGGCCTTT-3' were

---

Zhang YL et al . Bcl-xL in human colon carcinoma 3071<br />

used in combination with a sequence 5'-ACAGTGCCC<br />

CGCCGAAGGAGA-3'. Primers, Taqman and TaqMan<br />

probes were designed by the Primer Express TM 1.0<br />

(Applied Biosystems) s<strong>of</strong>tware and the probes were labeled<br />

at 5’ end with the rep<strong>or</strong>ter dye molecule FAM (6-carboxyflu<strong>or</strong>escein)<br />

and at 3’ end with the quencher dye molecule<br />

TAMARA (6-carboxytetramethyl-rhodamine). Real-time<br />

PCR was conducted in a total volume <strong>of</strong> 50 μL with<br />

1 × TaqMan Master Mix (Applied Biosystems) and primers.<br />

Thermal cycle parameters included one cycle at 95℃ f<strong>or</strong><br />

3 min, and 45 cycles involving denaturation at 95℃ f<strong>or</strong> 30 s,<br />

annealing at 52℃ f<strong>or</strong> 45 s, extension at 72℃ f<strong>or</strong> 45 s,<br />

followed by a final extension at 72℃ f<strong>or</strong> 10 min. The relative<br />

amount <strong>of</strong> each cDNA in each sample was calculated<br />

by dividing the CT value with the c<strong>or</strong>responding value<br />

<strong>of</strong> the housekeeping gene glyceraldehyde-3-phosphate<br />

dehydrogenase (GAPDH). All reactions were perf<strong>or</strong>med in<br />

triplicate.<br />

Western blotting analysis f<strong>or</strong> Bcl-xL protein<br />

HT29 cells were harvested and lysed in a buffer containing<br />

10 mmol/L Tris-HCl (pH 8.0), 150 mmol/L NaCl, 1%<br />

NP40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mmol/L<br />

EDTA (pH 8.0), 2 mmol/L phenylmethylsulfonyl flu<strong>or</strong>ide,<br />

2 mg/L aprotinin, 2 mg/L leupeptin, and 1 mmol/L<br />

Na3VO4. F<strong>or</strong> Western blotting analysis, 30 μg <strong>of</strong> total<br />

extracted proteins was applied per lane bef<strong>or</strong>e SDS-PAGE.<br />

Following transfer to nitrocellulose membranes, protein<br />

expression levels were detected using anti-Bcl-xL (Alpha<br />

Diagnostics International, TX). The expression <strong>of</strong> b-actin<br />

(Sigma-Aldrich, MO) was used as a n<strong>or</strong>malization control<br />

f<strong>or</strong> protein loading.<br />

Anch<strong>or</strong>age-independent growth assay<br />

F<strong>or</strong> the anch<strong>or</strong>age-independent growth experiments,<br />

HT29 cells (8 × 10 3 cells/well) were seeded in 0.3% Difco<br />

Bactoagar (Difco, MI) supplemented with a complete<br />

culture medium. This suspension was layered over 0.5 mL<br />

<strong>of</strong> 0.8% agar-medium base layer in 24 multiwell cluster<br />

dishes (Becton Dickinson, Italy). After 15 d, the colonies<br />

were stained with nitroblue tetrazolium, and colonies<br />

larger than 50 μm were acquired with a micro-Scopeman<br />

camera system (M<strong>or</strong>itex Europe Ltd, Italy) and analyzed<br />

with Image-Pro Plus (Media Cybernetics, MD) computer<br />

program.<br />

Cell invasion assay<br />

Transwell invasion assays were perf<strong>or</strong>med using HT29<br />

cells cultured in 12-well plates containing either 8 μm p<strong>or</strong>e<br />

matrigel-coated inserts acc<strong>or</strong>ding to the manufacturer’s<br />

instructions (Becton Dickinson, Bedf<strong>or</strong>d, MA). The<br />

membranes were rehydrated with warm serum-free (SF)<br />

Dulbecco’s modified Eagle’s medium (DMEM) (1.0 mL/<br />

chamber) f<strong>or</strong> 2 h. The upper chamber was filled with<br />

1 × 10 5 cells in L-15 medium containing 5% FBS. The<br />

lower chamber was filled with L-15 medium containing<br />

25% FBS as a chemo-attractant. After the chambers were<br />

incubated f<strong>or</strong> 24 h at 37℃ in an atmosphere containing<br />

50 mL/L CO2, non-invading cells were removed from<br />

the upper surface <strong>of</strong> the membrane by scrubbing, and<br />

invading cells on the lower surface <strong>of</strong> the membrane<br />

were fixed and stained with HE. The number <strong>of</strong> cells<br />

penetrating the filter was counted by a technician blinded<br />

to the experimental settings in four microscopic fields<br />

<strong>of</strong> each filter, under × 20 magnification. The percentage<br />

<strong>of</strong> invasion was expressed as the ratio <strong>of</strong> the mean cell<br />

number from the invasion chamber to the mean cell<br />

number from the control chamber acc<strong>or</strong>ding to the<br />

manufacturer’s recommendation.<br />

Statistical analysis<br />

All analyses were perf<strong>or</strong>med with t test and ANOVA using<br />

SPSS 11.5 s<strong>of</strong>tware (Statistical Package f<strong>or</strong> Social Science).<br />

P < 0.05 was considered statistically significant.<br />

RESULTS<br />

Expression <strong>of</strong> Bcl-xL PU in human colon cancerous and<br />

n<strong>or</strong>mal tissue samples<br />

Bcl-xL expression was rarely expressed in n<strong>or</strong>mal large<br />

intestinal mucosa. However, Bcl-xL was mainly expressed in<br />

cytoplasm <strong>of</strong> the para-cancerous <strong>or</strong> cancer cells. The nuclei<br />

were stained brownish yellow, located sp<strong>or</strong>adically <strong>or</strong> in the<br />

f<strong>or</strong>m <strong>of</strong> sheets. Quantitative immunohistochemistry analysis<br />

is summarized in Table 1. Bcl-xL PU was significantly higher<br />

in cancerous tissue samples than in n<strong>or</strong>mal tissue samples<br />

(38.78 ± 11.36 vs 0.89 ± 0.35, P < 0.001).<br />

Relationship between Bcl-xL PU and clinicopathological<br />

parameters<br />

C<strong>or</strong>relation <strong>of</strong> Bcl-xL expression with clinicopathological<br />

parameters was evaluated. Bcl-xL PU, positive lymph<br />

nodes and Duke’s C/D stage were higher in cancerous<br />

tissue samples with low differentiation than in cancerous<br />

tissue samples with high differentiation (P < 0.05, Table 1).<br />

However, Bcl-xL expression was not c<strong>or</strong>related with sex,<br />

age <strong>of</strong> the patients.<br />

Suppression o f Bcl-xL by siRNA<br />

To further clarity the role <strong>of</strong> Bcl-xL gene, siRNA was<br />

used to knockdown the Bcl-xL expression in human colon<br />

cancer cells. Bcl-xL siRNA was transfected into the colon<br />

cancer cell line HT29. The ability <strong>of</strong> siRNA to downregulate<br />

Bcl-xL expression was quantified by real time RT-<br />

PCR analysis and Western blot assay, respectively. siRNA<br />

significantly reduced the Bcl-xL mRNA and protein level in<br />

a dose- and time- dependent manner (Figure 1). However,<br />

the control scrambled siRNA treatment had no effect<br />

on Bcl-xL expression, thus supp<strong>or</strong>ting the specificity <strong>of</strong><br />

Bcl-xL siRNA.<br />

Bcl-xL siRNA inhibited anch<strong>or</strong>age-independent growth <strong>of</strong><br />

human colon cancer cells<br />

Next we evaluated the biological effects <strong>of</strong> Bcl-xL<br />

suppression on human colon cancer HT29 cells using<br />

several different types <strong>of</strong> assays. Colony f<strong>or</strong>mation in<br />

s<strong>of</strong>t agar is a property closely associated with malignancy.<br />

Treatment with Bcl-xL siRNA significantly inhibited the<br />

anch<strong>or</strong>age-independent growth <strong>of</strong> human colon cancer cells<br />

in a dose-dependent manner (Figure 2A).<br />

www.wjgnet.com

---

A<br />

Relative expression <strong>of</strong><br />

mRNA (%) n (%)<br />

B<br />

Bcl-xL/actin (%)<br />

3072 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

100<br />

80<br />

60<br />

40<br />

20<br />

0<br />

1<br />

0.8<br />

0.6<br />

0.4<br />

0.2<br />

0<br />

Figure 1 Effects <strong>of</strong> siRNA on Bcl-xL expression in human colon cancer HT29<br />

cells. A: Bcl-xL mRNA level; B: Bcl-xL protein level.<br />

Down-regulation <strong>of</strong> Bcl-xL decreased the ability <strong>of</strong> human<br />

colon cancer cells to grow in vitro<br />

Given the known role <strong>of</strong> Bcl-xL siRNA in downregulation<br />

<strong>of</strong> anch<strong>or</strong>age-independent HT29 cell growth,<br />

we attempted further to evaluate whether the Bcl-xL gene<br />

contributes to cell invasion <strong>of</strong> colon cancer cells. Cell<br />

invasion studies were perf<strong>or</strong>med using the matrigel matrix<br />

assays. The results showed that Bcl-xL siRNA treatment<br />

resulted in a dramatic low level <strong>of</strong> invasion potential<br />

<strong>of</strong> HT29 cells (Figure 2B), but not scrambled siRNA<br />

treatment.<br />

DISCUSSION<br />

24 48 72<br />

t /h<br />

24 48 72<br />

Scr siRNA<br />

3.125 nmol/L<br />

6.125 nmol/L<br />

12.5 nmol/L<br />

Scr siRNA<br />

3.125 nmol/L<br />

6.125 nmol/L<br />

12.5 nmol/L<br />

The Bcl-2 family is characterized by the presence <strong>of</strong> Bcl-2<br />

homology domains and falls into two main groups: antiapoptotic<br />

proteins, such as Bcl-2, Bcl-xL, Bcl-w, Mcl-1, A1,<br />

and proapoptotic proteins, such as Bax, Bak, Bad, Bid, and<br />

Bcl-xS [6] . The Bcl-x gene encodes two proteins, a long f<strong>or</strong>m<br />

(Bcl-xL) and a sh<strong>or</strong>t f<strong>or</strong>m (Bcl-xS), through an alternative<br />

splicing mechanism. Bcl-xL, displaying remarkable amino<br />

acids and an overall structural homology to Bcl-2, can<br />

effectively block apoptosis, whereas Bcl-xS, lacking 63<br />

amino acids in Bcl-xL, is a dominant inhibit<strong>or</strong> <strong>of</strong> Bcl-2<br />

activity and thereby acts as a proapoptotic fact<strong>or</strong> [9] .<br />

Although there is <strong>evidence</strong> <strong>of</strong> cell apoptosis and Bcl-xL<br />

gene, the relationship between Bcl-xL and invasion <strong>of</strong><br />

malignant tum<strong>or</strong>s remains unclear. It was rep<strong>or</strong>ted that<br />

Bcl-xL is related to the invasion and metastasis <strong>of</strong> some<br />

solid tum<strong>or</strong>s. Zhang et al [18] and Takada et al [19] have<br />

rep<strong>or</strong>ted the inhibition <strong>of</strong> invasion <strong>of</strong> cancer cells after<br />

treated with the Bcl-xL gene. Our previous study showed<br />

that STAT3 siRNA tranfection inhibits the invasion ability<br />

<strong>of</strong> human colon cancer cell line HT29 and that the BclxL<br />

protein is significantly inhibited in transfected cancer<br />

www.wjgnet.com<br />

t /h<br />

A<br />

Colony f<strong>or</strong>mation in<br />

s<strong>of</strong>t agar (colonies)<br />

B<br />

Cell invasion (%)<br />

30<br />

25<br />

20<br />

15<br />

10<br />

5<br />

0<br />

30<br />

25<br />

20<br />

15<br />

10<br />

5<br />

0<br />

HT29 Scr siRNA 3.125 nmol/L 6.25 nmol/L 12.5 nmol/L<br />

HT29 Scr siRNA 3.125 nmol/L 6.25 nmol/L 12.5 nmol/L<br />

Figure 2 Effects <strong>of</strong> Bcl-xL siRNA on anch<strong>or</strong>age-independent growth (A) and<br />

invasion ability (B) <strong>of</strong> human colon cancer HT29 cell.<br />

cells [16] , suggesting that Bcl-xL contributes to the invasion<br />

<strong>of</strong> human colon cancer cells. To verify it, we studied the<br />

relationship between Bcl-xL and invasion <strong>of</strong> human colon<br />

cancer in vivo and in vitro.<br />

The expression <strong>of</strong> Bcl-xL protein in human colon<br />

cancer was determined by immunohistochemistry assay,<br />

showing that Bcl-xL protein was over-expressed in colon<br />

cancer tissue samples compared to n<strong>or</strong>mal tissue samples<br />

(P < 0.001). Meanwhile, Bcl-xL expression had no<br />

significant c<strong>or</strong>relation with sex and age <strong>of</strong> the patients,<br />

but was greatly c<strong>or</strong>related with differentiation stage, lymph<br />

node metastasis, and Duke’s stage <strong>of</strong> col<strong>or</strong>ectal carcinoma<br />

(P < 0.05), indicating that Bcl-xL over-expression is related<br />

to the development and invasion <strong>of</strong> human colon cancer.<br />

In <strong>or</strong>der to further investigate the relationship between<br />

Bcl-xL and invasion <strong>of</strong> human colon cancer cells, we studied<br />

the effects <strong>of</strong> Bcl-xL down-regulated by siRNA on the<br />

invasion ability <strong>of</strong> human colon cancer cells. SiRNA is a<br />

sh<strong>or</strong>t oligonucleotide consisting <strong>of</strong> 21-23 nucleotides that<br />

can be used in vitro to induce sequence specific gene silencing<br />

<strong>of</strong> mammalian cells [20] . To elucidate the role <strong>of</strong> Bcl-xL gene<br />

in human colon cancer, siRNA was used to knockdown the<br />

Bcl-xL expression in human colon cancer cell line HT29.<br />

Real time RT-PCR and Western blot analysis showed that<br />

the expression <strong>of</strong> Bcl-xL in HT29 cancer cells transfected<br />

with siRNA was significantly reduced in a dose- and timedependent<br />

manner. In addition, tranfection <strong>of</strong> human colon<br />

cancer HT29 cells with Bcl-xL siRNA decreased the invasion<br />

ability and anch<strong>or</strong>age-independent growth <strong>of</strong> human colon<br />

cancer cells. The data in vitro suggest that the Bcl-xL gene plays<br />

an imp<strong>or</strong>tant role in regulating the invasion <strong>of</strong> human colon<br />

cancer cell.<br />

In conclusion, the Bcl-xL gene is relevant to the invasion<br />

and progression <strong>of</strong> human colon cancer, and can be used<br />

in evaluating the carcinogenesis <strong>of</strong> human colon cancer.<br />

However, the precise mechanism <strong>of</strong> Bcl-xL underlying the

---

Zhang YL et al . Bcl-xL in human colon carcinoma 3073<br />

carcinogenesis <strong>of</strong> human colon cancer is still unclear, and<br />

further study is needed.<br />

COMMENTS<br />

Background<br />

Despite recent advances in diagnostic and therapeutic measures, the prognosis<br />

<strong>of</strong> col<strong>or</strong>ectal cancer patients with distant metastasis still remains po<strong>or</strong>. Enhanced<br />

understanding <strong>of</strong> the signaling mechanism underlying metastasis <strong>of</strong> colon cancer<br />

may provide imp<strong>or</strong>tant insights into m<strong>or</strong>e effective therapeutic strategies.<br />

Research frontiers<br />

The results <strong>of</strong> this study indicate that the Bcl-xL gene plays an imp<strong>or</strong>tant role in<br />

the carcinogenesis <strong>of</strong> human col<strong>or</strong>ectal carcinoma and is associated with the<br />

malignant biological behavi<strong>or</strong>s <strong>of</strong> col<strong>or</strong>ectal carcinoma.<br />

Innovations and breakthroughs<br />

The results <strong>of</strong> the present study suggest that the Bcl-xL gene is relevant to the<br />

invasion and progression <strong>of</strong> human colon cancer and can be used in evaluating<br />

the carcinogenesis <strong>of</strong> human colon cancer.<br />

Applications<br />

The paper helps to clarify the mechanism underlying the invasion and metastasis<br />

<strong>of</strong> colon cancer and contributes to the choice <strong>of</strong> therapeutic strategies.<br />

Peer review<br />

This interesting article indicates that the Bcl-xL gene is relevant to the invasion<br />

and progression <strong>of</strong> human colon cancer, and might be used in evaluating the<br />

carcinogenesis <strong>of</strong> human colon cancer.<br />

REFERENCES<br />

1 Shike M, Winawer SJ, Greenwald PH, Bloch A, Hill MJ,<br />

Swaroop SV. Primary prevention <strong>of</strong> col<strong>or</strong>ectal cancer. The<br />

WHO Collab<strong>or</strong>ating Centre f<strong>or</strong> the Prevention <strong>of</strong> Col<strong>or</strong>ectal<br />

Cancer. Bull W<strong>or</strong>ld Health Organ 1990; 68: 377-385<br />

2 Winawer SJ, Fletcher RH, Miller L, Godlee F, Stolar MH,<br />

Mulrow CD, Woolf SH, Glick SN, Ganiats TG, Bond JH, Rosen<br />

L, Zapka JG, Olsen SJ, Giardiello FM, Sisk JE, Van Antwerp R,<br />

Brown-Davis C, Marciniak DA, Mayer RJ. Col<strong>or</strong>ectal cancer<br />

screening: clinical guidelines and rationale. Gastroenterology<br />

1997; 112: 594-642<br />

3 Nunez G, Clarke MF. The Bcl-2 family <strong>of</strong> proteins: regulat<strong>or</strong>s<br />

<strong>of</strong> cell death and survival. Trends Cell Biol 1994; 4: 399-403<br />

4 Chao DT, K<strong>or</strong>smeyer SJ. BCL-2 family: regulat<strong>or</strong>s <strong>of</strong> cell<br />

death. Annu Rev Immunol 1998; 16: 395-419<br />

5 Vander Heiden MG, Chandel NS, Williamson EK, Schumacker<br />

PT, Thompson CB. Bcl-xL regulates the membrane potential<br />

and volume homeostasis <strong>of</strong> mitochondria. Cell 1997; 91: 627-637<br />

6 Gottlieb E, Vander Heiden MG, Thompson CB. Bcl-x(L)<br />

prevents the initial decrease in mitochondrial membrane<br />

potential and subsequent reactive oxygen species production<br />

during tum<strong>or</strong> necrosis fact<strong>or</strong> alpha-induced apoptosis. Mol<br />

Cell Biol 2000; 20: 5680-5689<br />

7 Minn AJ, Rudin CM, Boise LH, Thompson CB. Expression<br />

<strong>of</strong> bcl-xL can confer a multidrug resistance phenotype. Blood<br />

1995; 86: 1903-1910<br />

8 Kharbanda S, Pandey P, Sch<strong>of</strong>ield L, Israels S, Roncinske R,<br />

Yoshida K, Bharti A, Yuan ZM, Saxena S, Weichselbaum R,<br />

Nalin C, Kufe D. Role f<strong>or</strong> Bcl-xL as an inhibit<strong>or</strong> <strong>of</strong> cytosolic<br />

cytochrome C accumulation in DNA damage-induced<br />

apoptosis. Proc Natl Acad Sci USA 1997; 94: 6939-6942<br />

9 Zhang L, Yu J, Park BH, Kinzler KW, Vogelstein B. Role <strong>of</strong><br />

BAX in the apoptotic response to anticancer agents. Science<br />

2000; 290: 989-992<br />

10 Fernández Y, España L, Mañas S, Fabra A, Sierra A. Bcl-xL<br />

promotes metastasis <strong>of</strong> breast cancer cells by induction <strong>of</strong><br />

cytokines resistance. Cell Death Differ 2000; 7: 350-359<br />

11 España L, Fernández Y, Rubio N, T<strong>or</strong>regrosa A, Blanco J,<br />

Sierra A. Overexpression <strong>of</strong> Bcl-xL in human breast cancer<br />

cells enhances <strong>or</strong>gan-selective lymph node metastasis. Breast<br />

Cancer Res Treat 2004; 87: 33-44<br />

12 Watanabe J, Kushihata F, Honda K, Sugita A, Tateishi N,<br />

Mominoki K, Matsuda S, Kobayashi N. Prognostic significance<br />

<strong>of</strong> Bcl-xL in human hepatocellular carcinoma. Surgery 2004;<br />

135: 604-612<br />

13 Frankel A, Rosen K, Filmus J, Kerbel RS. Induction <strong>of</strong> anoikis<br />

and suppression <strong>of</strong> human ovarian tum<strong>or</strong> growth in vivo by<br />

down-regulation <strong>of</strong> Bcl-X(L). Cancer Res 2001; 61: 4837-4841<br />

14 Weiler M, Bahr O, Hohlweg U, Naumann U, Rieger J, Huang H,<br />

Tabatabai G, Krell HW, Ohgaki H, Weller M, Wick W. BCL-xL:<br />

time-dependent dissociation between modulation <strong>of</strong> apoptosis<br />

and invasiveness in human malignant glioma cells. Cell Death<br />

Differ 2006; 13: 1156-1169<br />

15 Sánchez-Ceja SG, Reyes-Maldonado E, Vázquez-Manríquez<br />

ME, López-Luna JJ, Belmont A, Gutiérrez-Castellanos S.<br />

Differential expression <strong>of</strong> STAT5 and Bcl-xL, and high<br />

expression <strong>of</strong> Neu and STAT3 in non-small-cell lung carcinoma.<br />

Lung Cancer 2006; 54: 163-168<br />

16 Fan Y, Zhang YL, Wu Y, Zhang W, Wang YH, Cheng ZM, Li H.<br />

Inhibition <strong>of</strong> signal transducer and activat<strong>or</strong> <strong>of</strong> transcription<br />

3 expression by RNA interference suppresses invasion<br />

through inducing anoikis in human colon cancer cells. W<strong>or</strong>ld J<br />

Gastroenterol 2008; 14: 428-434<br />

17 Tan HY, Liu J, Wu SM, Luo HS. Expression <strong>of</strong> a novel<br />

apoptosis inhibit<strong>or</strong>-survivin in col<strong>or</strong>ectal carcinoma. W<strong>or</strong>ld J<br />

Gastroenterol 2005; 11: 4689-4692<br />

18 Zhang X, Xu Q, Saiki I. Quercetin inhibits the invasion and<br />

mobility <strong>of</strong> murine melanoma B16-BL6 cells through inducing<br />

apoptosis via decreasing Bcl-2 expression. Clin Exp Metastasis<br />

2000; 18: 415-421<br />

19 Takada Y, Kobayashi Y, Aggarwal BB. Evodiamine abolishes<br />

constitutive and inducible NF-kappaB activation by inhibiting<br />

IkappaBalpha kinase activation, thereby suppressing NFkappaB-regulated<br />

antiapoptotic and metastatic gene expression,<br />

up-regulating apoptosis, and inhibiting invasion. J Biol Chem<br />

2005; 280: 17203-17212<br />

20 Elbashir SM, Harb<strong>or</strong>th J, Lendeckel W, Yalcin A, Weber K, Tuschl<br />

T. Duplexes <strong>of</strong> 21-nucleotide RNAs mediate RNA interference in<br />

cultured mammalian cells. Nature 2001; 411: 494-498<br />

S- Edit<strong>or</strong> Yang RH L- Edit<strong>or</strong> Wang XL E- Edit<strong>or</strong> Liu Y<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3074-3080<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

RAPID COMMUNICATION<br />

Detection <strong>of</strong> RASSF1A promoter hypermethylation in serum<br />

from gastric and col<strong>or</strong>ectal adenocarcinoma patients<br />

Yu-Cai Wang, Zheng-Hong Yu, Chang Liu, Li-Zhi Xu, Wen Yu, Jia Lu, Ren-Min Zhu, Guo-Li Li, Xin-Yi Xia,<br />

Xiao-Wei Wei, Hong-Zan Ji, Heng Lu, Yong Gao, Wei-Min Gao, Long-Bang Chen<br />

Yu-Cai Wang, Zheng-Hong Yu, Chang Liu, Long-Bang Chen,<br />

Department <strong>of</strong> Medical Oncology, Jinling Hospital, Nanjing<br />

210002, Jiangsu Province, China<br />

Yu-Cai Wang, Li-Zhi Xu, Wen Yu, Xiao-Wei Wei, Long-Bang<br />

Chen, Medical School <strong>of</strong> Nanjing University, Nanjing 210093,<br />

Jiangsu Province, China<br />

Yu-Cai Wang, Department <strong>of</strong> Experimental Radiation Oncology,<br />

The University <strong>of</strong> Texas M.D. Anderson Cancer Center, The<br />

University <strong>of</strong> Texas Graduate School <strong>of</strong> Biomedical Sciences at<br />

Houston, Houston TX 77030, United States<br />

Jia Lu, Department <strong>of</strong> Molecular Pathology, The University<br />

<strong>of</strong> Texas M. D. Anderson Cancer Center, Houston TX 77030,<br />

United States<br />

Ren-Min Zhu, Hong-Zan Ji, Heng Lu, Department <strong>of</strong><br />

Gastroenterology, Jinling Hospital, Nanjing 210002, Jiangsu<br />

Province, China<br />

Guo-Li Li, Xiao-Wei Wei, Yong Gao, Institute <strong>of</strong> General<br />

Surgery, Jinling Hospital, Nanjing 210002, Jiangsu Province,<br />

China<br />

Xin-Yi Xia, Institute <strong>of</strong> Lab<strong>or</strong>at<strong>or</strong>y Medicine, Jinling Hospital,<br />

Nanjing 210002, Jiangsu Province, China<br />

Wei-Min Gao, Department <strong>of</strong> Environmental Toxicology, The<br />

Institute <strong>of</strong> Environmental and Human Health, Texas Tech<br />

University, Lubbock TX 79409, United States<br />

Auth<strong>or</strong> contributions: Wang YC and Yu ZH contributed equally<br />

to this w<strong>or</strong>k; Wang YC, Yu ZH, Gao WM and Chen LB designed<br />

the research; Wang YC, Liu C, Xu LZ, Yu W, Zhu RM, Li GL,<br />

Xia XY, Wei XW, Ji HZ, Lu H and Gao Y perf<strong>or</strong>med the research;<br />

Wang YC and Lu J analyzed the data; Wang YC, Yu ZH, Lu J and<br />

Chen LB wrote the paper.<br />

C<strong>or</strong>respondence to: Dr. Long-Bang Chen, Department <strong>of</strong><br />

Medical Oncology, Jinling Hospital, 305 East Zhongshan Road,<br />

Nanjing 210002, Jiangsu Province,<br />

China. chenlongbang@yeah.net<br />

Telephone: +86-25-80860123 Fax: +86-25-84824051<br />

Received: February 26, 2008 Revised: April 27, 2008<br />

Abstract<br />

AIM: To evaluate the diagnostic role <strong>of</strong> serum RASSF1A<br />

promoter hypermethylation in gastric and col<strong>or</strong>ectal adenocarcinoma.<br />

METHODS: Methylation-specific polymerase chain reaction<br />

(MSPCR) was used to examine the promoter methylation<br />

status <strong>of</strong> the serum RASSF1A gene in 47 gastric<br />

adenocarcinoma patients, 45 col<strong>or</strong>ectal adenocarcinoma<br />

patients, 60 patients with benign gastrointestinal disease<br />

(30 with benign gastric disease and 30 with benign<br />

col<strong>or</strong>ectal disease), and 30 healthy don<strong>or</strong> controls. A<br />

www.wjgnet.com<br />

paired study <strong>of</strong> RASSF1A promoter methylation status in<br />

primary tum<strong>or</strong>, adjacent n<strong>or</strong>mal tissue, and postoperative<br />

serum were conducted in 25 gastric and col<strong>or</strong>ectal<br />

adenocarcinoma patients who later were underwent surgical<br />

therapy.<br />

RESULTS: The frequencies <strong>of</strong> detection <strong>of</strong> serum<br />

RASSF1A promoter hypermethylation in gastric (34.0%)<br />

and col<strong>or</strong>ectal (28.9%) adenocarcinoma patients were<br />

significantly higher than those in patients with benign<br />

gastric (3.3%) <strong>or</strong> col<strong>or</strong>ectal (6.7%) disease <strong>or</strong> in healthy<br />

don<strong>or</strong>s (0%) (P < 0.01). The methylation status <strong>of</strong><br />

RASSF1A promoter in serum samples was consistent<br />

with that in paired primary tum<strong>or</strong>s, and the MSPCR<br />

results f<strong>or</strong> RASSF1A promoter methylation status in<br />

paired preoperative samples were consistent with those<br />

in postoperative serum samples. The serum RASSF1A<br />

promoter hypermethylation did not c<strong>or</strong>relate with patient<br />

sex, age, tum<strong>or</strong> differentiation grade, surgical therapy,<br />

<strong>or</strong> serum carcinoembryonic antigen level. Although the<br />

serum RASSF1A promoter hypermethylation frequency<br />

tended to be higher in patients with distant metastases,<br />

there was no c<strong>or</strong>relation between methylation status and<br />

metastasis.<br />

CONCLUSION: Aberrant CpG island methylation within<br />

the promoter region <strong>of</strong> RASSF1A is a promising biomarker<br />

f<strong>or</strong> gastric and col<strong>or</strong>ectal cancer.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Gastric cancer; Col<strong>or</strong>ectal cancer; Gene<br />

methylation; RASSF1A<br />

Peer reviewers: Yoshiharu Motoo, MD, PhD, FACP, FACG,<br />

Pr<strong>of</strong>ess<strong>or</strong> and Chairman, Department <strong>of</strong> Medical Oncology,<br />

Kanazawa Medical University,1-1 Daigaku, Uchinada, Ishikawa<br />

920-0293, Japan; Qin Su, Pr<strong>of</strong>ess<strong>or</strong>, Department <strong>of</strong> Pathology,<br />

Cancer Hospital and Cancer Institute, Chinese Academy <strong>of</strong> Medical<br />

Sciences and Peking Medical College, PO Box 2258, Beijing<br />

100021, China<br />

Wang YC, Yu ZH, Liu C, Xu LZ, Yu W, Lu J, Zhu RM, Li GL,<br />

Xia XY, Wei XW, Ji HZ, Lu H, Gao Y, Gao WM, Chen LB. Detection<br />

<strong>of</strong> RASSF1A promoter hypermethylation in serum from gastric<br />

and col<strong>or</strong>ectal adenocarcinoma patients. W<strong>or</strong>ld J Gastroenterol<br />

2008; 14(19): 3074-3080 Available from: URL: http://www.wjgnet.<br />

com/1007-9327/14/3074.asp DOI: http://dx.doi.<strong>or</strong>g/10.3748/<br />

wjg.14.3074

---

Table 2 Sequences <strong>of</strong> the primers used in MSP<br />

Primer Sequence (5'-3') Amplicon location 1 Annealing temperature Product size (bp)<br />

MF GGGTTTTGCGAGAGCGCG 17 882-18 050 64℃ 169<br />

MR GCTAACAAACGCGAACCG<br />

UF GGTTTTGTGAGAGTGTGTTTAG 17 883-18 051 59℃ 169<br />

UR CACTAACAAACACAAACCAAAC<br />

1 GenBank accession number <strong>of</strong> RASSF1A is AC002481. F: F<strong>or</strong>ward; R: Reverse; M: Methylated; U: Unmethylated.<br />

A<br />

Marker<br />

B<br />

Marker<br />

3076 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

Positive<br />

control<br />

Negative<br />

control<br />

GC#9 GC#26 CC#21<br />

M U M U M U M U M U<br />

Positive Negative<br />

control control GC#13T GC#13N GC#13T CC#31N<br />

M U M U M U M U M U M U<br />

169 bp<br />

169 bp<br />

Figure 1 Representative results showing RASSF1A promoter methylation status<br />

identified by MSPCR in gastric and adenocarcinoma patients. Identification<br />

<strong>of</strong> RASSF1A promoter methylation status in serum samples from gastric and<br />

col<strong>or</strong>ectal adenocarcinoma patients (A) and in paired tum<strong>or</strong> and adjacent n<strong>or</strong>mal<br />

tissue from gastric and col<strong>or</strong>ectal adenocarcinoma patients (B). A 100-bp DNA<br />

ladder marker (TaKaRa, Shiga, Japan) was used. Lanes M and U indicate the<br />

amplified products with primers recognizing specific methylated and unmethylated<br />

sequences, respectively. GC: Gastric adenocarcinoma; CC: Col<strong>or</strong>ectal<br />

adenocarcinoma; T: Tum<strong>or</strong> tissue; N: Paired adjacent n<strong>or</strong>mal tissue.<br />

DNA extraction and bisulfite treatment<br />

Serum DNA, extracted with the QIAamp blood mini kit<br />

(Qiagen, Hilden, Germany) acc<strong>or</strong>ding to the manufacturer’s<br />

instructions, was st<strong>or</strong>ed at -80℃ until use. Genomic DNA<br />

isolated from tissue samples was prepared using standard<br />

phenol/chl<strong>or</strong><strong>of</strong><strong>or</strong>m extraction protocols.<br />

The extracted DNA was modified acc<strong>or</strong>ding to Herman<br />

et al [28] with min<strong>or</strong> modifications, to convert all unmethylated<br />

cytosines to uracils. Briefly, 1 μg <strong>of</strong> genomic DNA,<br />

<strong>or</strong> serum DNA extracted from 5 mL blood plus 1 μg <strong>of</strong><br />

salmon sperm carrier DNA (Sigma, St. Louis, MO, USA),<br />

in a total volume <strong>of</strong> 50 μL, were denatured by NaOH<br />

(0.3 mol/L final concentration) at 40℃ f<strong>or</strong> 15 min. After<br />

30 μL <strong>of</strong> freshly prepared 10 mmol/L hydroquinone<br />

(Sigma) and 520 μL <strong>of</strong> freshly prepared 3 mol/L sodium<br />

bisulfite (Sigma) at pH 5.0 were added, the samples were<br />

incubated under mineral oil at 55℃ in darkness f<strong>or</strong> 14 h.<br />

The modified DNA was purified using the Wizard DNA<br />

clean-up system (Promega, Madison, WI, USA), following<br />

its manufacturer’s protocol. Modification was completed<br />

www.wjgnet.com<br />

by NaOH (0.3 mol/L final concentration) treatment f<strong>or</strong><br />

10 min at room temperature, followed by ethanol precipitation.<br />

The modified DNA was resuspended in sterile<br />

deionized water (100 μL f<strong>or</strong> genomic DNA and 25 μL f<strong>or</strong><br />

serum DNA) and used immediately <strong>or</strong> st<strong>or</strong>ed at -80℃.<br />

MSPCR<br />

Two sets <strong>of</strong> primers, described elsewhere [29] , were used<br />

to discriminate between methylated and unmethylated alleles<br />

(Table 2). The PCR system has been described previously<br />

[30] . Briefly, the PCR mixture containing 2.5 μL <strong>of</strong><br />

10 × reaction buffer (100 mmol/L Tris-HCl (pH 8.3),<br />

500 mmol/L KCl, 15 mmol/L MgCl2), 10 μL <strong>of</strong> modified<br />

DNA, 15 pmol <strong>of</strong> each primer (Shenery Biocol<strong>or</strong>,<br />

Shanghai, China), 2 μL <strong>of</strong> deoxynucleotide triphosphates<br />

(200 μmol/L each, final concentration), and 1 U TaKaRa<br />

Taq polymerase (Hot Start Version, TaKaRa, Shiga, Japan)<br />

was adjusted by H2O to a final volume <strong>of</strong> 25 μL. The<br />

cycling conditions consisted <strong>of</strong> an incubation period at<br />

95℃ f<strong>or</strong> 15 min, 40 cycles <strong>of</strong> denaturation at 94℃ f<strong>or</strong> 30 s,<br />

annealing at 64℃ <strong>or</strong> at 59℃ f<strong>or</strong> 50 s (Table 2), extension<br />

at 72℃ f<strong>or</strong> 30 s, and a final extension at 72℃ f<strong>or</strong> 10 min.<br />

PCR products were separated in 2% agarose gel and visualized<br />

under UV illumination.<br />

Lymphocyte DNA, <strong>or</strong>iginal <strong>or</strong> methylated in vitro by excessive<br />

CpG (Sss I) methylase (New England Biolabs, Beverly,<br />

MA, USA), was used as an unmethylated and methylated<br />

DNA positive control, respectively (Figure 1A). Water<br />

blank was used as a negative control.<br />

Statistical analysis<br />

We analyzed the c<strong>or</strong>relation between methylation status <strong>of</strong><br />

serum RASSF1A promoter and clinicopathologic parameters.<br />

Chi-square test <strong>or</strong> Fisher’s exact test was conducted<br />

to examine the association <strong>of</strong> two categ<strong>or</strong>ical variables using<br />

SAS s<strong>of</strong>tware (SAS Institute, Cary, NC, USA). All statistical<br />

tests were two-sided, and P < 0.05 was considered<br />

statistically significant.<br />

RESULTS<br />

Serum RASSF1A promoter hypermethylation pr<strong>of</strong>ile in<br />

gastric and col<strong>or</strong>ectal adenocarcinoma patients<br />

First we analyzed the methylation status <strong>of</strong> CpG islands<br />

within the RASSF1A promoter in serum DNA from 47<br />

gastric adenocarcinoma patients, 45 col<strong>or</strong>ectal adenocarcinoma<br />

patients, 60 benign gastrointestinal disease patients<br />

(30 with benign gastric disease and 30 with benign col<strong>or</strong>ectal<br />

disease), and 30 healthy don<strong>or</strong>s. Hypermethylation <strong>of</strong><br />

the RASSF1A promoter was detected in 16 gastric adeno-

---

3078 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

role in human cancer development. It was rep<strong>or</strong>ted that<br />

RASSF1A is inactivated by promoter hypermethylation in<br />

gastric and col<strong>or</strong>ectal cancer, but the frequencies <strong>of</strong> aberrant<br />

RASSF1A methylation vary widely [8,9,14-16,40,41] . In addition,<br />

serum promoter methylation <strong>of</strong> RASSF1A in gastric<br />

and col<strong>or</strong>ectal cancer has not been extensively studied,<br />

and few comparative studies using both primary tum<strong>or</strong><br />

and serum samples are available. To our knowledge, there<br />

is only one related study with a limited sample size [10] . In<br />

the present study, we identified the RASSF1A promoter<br />

methylation status both in serum DNA and in available<br />

paired tum<strong>or</strong> genomic DNA from patients with gastric and<br />

col<strong>or</strong>ectal adenocarcinoma, showing that serum RASSF1A<br />

promoter hypermethylation is a potential biomarker f<strong>or</strong><br />

gastric and col<strong>or</strong>ectal cancer diagnosis.<br />

In the present study, serum RASSF1A promoter hypermethylation<br />

was detected in 34.0% <strong>of</strong> patients with gastric<br />

adenocarcinoma and in 28.9% <strong>of</strong> those with col<strong>or</strong>ectal<br />

adenocarcinoma. The frequencies were slightly higher<br />

than those rep<strong>or</strong>ted by Tan et al [10] (25% in gastric cancer<br />

and 24% in col<strong>or</strong>ectal cancer, respectively). The serum<br />

RASSF1A promoter hypermethylation frequencies in<br />

gastric and col<strong>or</strong>ectal adenocarcinoma patients were significantly<br />

higher than those in patients with benign gastric<br />

<strong>or</strong> col<strong>or</strong>ectal disease <strong>or</strong> in healthy don<strong>or</strong>s (P < 0.01). The<br />

sensitivity <strong>of</strong> serum RASSF1A promoter hypermethylation<br />

in detecting gastric and col<strong>or</strong>ectal cancer is relatively low.<br />

Perhaps a simultaneous analysis <strong>of</strong> the methylation status <strong>of</strong><br />

a panel <strong>of</strong> TSGs would be m<strong>or</strong>e sensitive in detecting gastric<br />

and col<strong>or</strong>ectal cancer. On the other hand, the specificity<br />

<strong>of</strong> serum RASSF1A promoter hypermethylation was very<br />

high (approximate 98.3%). Since clinical tests with a high<br />

specificity are usually useful in confirming the diagnosis,<br />

serum RASSF1A promoter methylation status is a potential<br />

marker f<strong>or</strong> the diagnosis <strong>of</strong> gastric and col<strong>or</strong>ectal cancer.<br />

We also compared the RASSF1A promoter methylation<br />

status in paired tissue and serum samples from 25<br />

gastric and col<strong>or</strong>ectal adenocarcinoma patients. F<strong>or</strong> the<br />

seven patients with hypermethylated RASSF1A promoter<br />

detected in their serum samples, RASSF1A promoter<br />

hypermethylation was also present in the primary tum<strong>or</strong>,<br />

which supp<strong>or</strong>ts the presumption that circulating DNA in<br />

peripheral blood <strong>of</strong> cancer patients reflects the epigenetic<br />

change in the primary tum<strong>or</strong>. In two patients, however,<br />

hypermethylated RASSF1A promoter could be detected<br />

in the primary tum<strong>or</strong> samples but not in the paired serum<br />

samples, suggesting that not all cancer patients have detectable<br />

tum<strong>or</strong>-<strong>or</strong>iginating DNA in their peripheral blood.<br />

RASSF1A promoter hypermethylation was detected<br />

in adjacent n<strong>or</strong>mal tissue from 2 patients, which can be explained<br />

by the invisible invasion <strong>of</strong> the primary tum<strong>or</strong> to the<br />

adjacent tissue. Another possible reason is the presence <strong>of</strong><br />

aberrant promoter methylation <strong>of</strong> TSGs in precancerous lesions<br />

adjacent to the primary tum<strong>or</strong>. Lee et al [9] rep<strong>or</strong>ted that<br />

RASSF1A promoter hypermethylation occurs in 2.1% <strong>of</strong><br />

col<strong>or</strong>ectal adenomas, and Derks et al [42] found that aberrant<br />

RASSF1A promoter methylation is present in 19.1% <strong>of</strong> nonprogressed<br />

adenomas and in 24.4% <strong>of</strong> progressive adenomas.<br />

In our study, we also detected methylated RASSF1A promoter<br />

in the serum from one patient with chronic fundal gastritis<br />

and two patients with colon adenoma, believed to be precan-<br />

www.wjgnet.com<br />

cerous lesions in gastric and colon cancer, respectively. These<br />

findings suggest that aberrant promoter hypermethylation<br />

<strong>of</strong> RASSF1A might be an early event in the development <strong>of</strong><br />

gastric and col<strong>or</strong>ectal cancer. Theref<strong>or</strong>e, identification <strong>of</strong> serum<br />

RASSF1A promoter methylation status may contribute<br />

to the early diagnosis <strong>of</strong> gastric and col<strong>or</strong>ectal cancer.<br />

In the present study, no association was observed<br />

between RASSF1A promoter methylation status and<br />

patients’ sex, age, tum<strong>or</strong> differentiation grade, distal<br />

metastasis, <strong>or</strong> surgical therapy. We also compared the<br />

methylation status <strong>of</strong> RASSF1A promoter in preoperative<br />

and postoperative serum samples from patients who<br />

were underwent to surgical therapy in our hospital, and<br />

the status remained unchanged in all patients. The<strong>or</strong>etically,<br />

when the primary tum<strong>or</strong> is resected, tum<strong>or</strong>-specific<br />

methylated DNA would decrease considerably in peripheral<br />

blood. However, this does not seem to be the case.<br />

Fiegl et al [43] monit<strong>or</strong>ed the serum RASSF1A promoter<br />

methylation status in 148 breast cancer patients f<strong>or</strong> up to<br />

1 year after surgery, and only 21 patients showed positive to<br />

negative transition in MSPCR analysis <strong>of</strong> serum RASSF1A<br />

promoter. A possible source <strong>of</strong> persistently present methylated<br />

copy after surgery is the micrometastases that may<br />

present bef<strong>or</strong>e surgery.<br />

We investigated whether serum RASSF1A promoter<br />

hypermethylation is c<strong>or</strong>related with elevated serum CEA<br />

levels and found that there is no c<strong>or</strong>relation between them.<br />

Koike et al [44] rep<strong>or</strong>ted that the detection rate <strong>of</strong> TSG (p16,<br />

E-cadherin, and RARβ ) hypermethylation is higher than<br />

that <strong>of</strong> conventional tum<strong>or</strong> marker (CEA and CA19-9)<br />

abn<strong>or</strong>malities in the serum from gastric cancer patients,<br />

and that there is no c<strong>or</strong>relation between them. Since serum<br />

CEA and TSG hypermethylation are not c<strong>or</strong>related,<br />

a combinational analysis <strong>of</strong> serum RASSF1A promoter<br />

methylation status and serum CEA level may be useful in<br />

the diagnosis <strong>of</strong> gastric and col<strong>or</strong>ectal cancer.<br />

In conclusion, serum RASSF1A promoter hypermethylation<br />

is common in gastric and col<strong>or</strong>ectal adenocarcinoma<br />

and aberrant CpG island methylation within the<br />

promoter region <strong>of</strong> RASSF1A is a promising biomarker<br />

f<strong>or</strong> such cancers.<br />

ACKNOWLEDGMENTS<br />

The auth<strong>or</strong>s thank Drs. Ya-Ping Wang and Long Yi, Medical<br />

School <strong>of</strong> Nanjing University and Dr. Jian-Dong Wang,<br />

Department <strong>of</strong> Pathology, Jinling Hospital, f<strong>or</strong> their technical<br />

assistance.<br />

COMMENTS<br />

Background<br />

RASSF1A inactivation by promoter hypermethylation in gastric and col<strong>or</strong>ectal<br />

cancer has been rep<strong>or</strong>ted. However, serum promoter methylation <strong>of</strong> RASSF1A<br />

in gastric and col<strong>or</strong>ectal cancer has not been extensively studied. Particularly,<br />

comparative studies using both primary tum<strong>or</strong> and serum samples are indicated<br />

can evaluate the diagnostic role <strong>of</strong> serum RASSF1A promoter hypermethylation in<br />

gastric and col<strong>or</strong>ectal cancer.<br />

Research frontiers<br />

Circulating nucleotide acid is a hotspot in the early diagnosis <strong>of</strong> cancer.<br />

Characterization <strong>of</strong> molecular changes in serum DNA reflecting the genetic and

---

Wang YC et al . Serum RASSF1A hypermethylation 3079<br />

epigenetic alterations in primary tum<strong>or</strong> would provide an alternative approach to<br />

the early detection <strong>of</strong> cancer.<br />

Innovations and breakthroughs<br />

This is the first comprehensive study on RASSF1A promoter hypermethylation<br />

status both in tum<strong>or</strong> and n<strong>or</strong>mal tissue samples and in pre- and post serum<br />

samples from gastric and col<strong>or</strong>ectal cancer patients. Our results indicate that<br />

aberrant hypermethylation <strong>of</strong> RASSF1A promoter is a promising serum biomarker<br />

f<strong>or</strong> gastric and col<strong>or</strong>ectal cancer diagnosis.<br />

Applications<br />

A combined study on promoter hypermethylation <strong>of</strong> a panel <strong>of</strong> relevant tum<strong>or</strong><br />

suppress<strong>or</strong> genes in serum samples may have a bright future in the early diagnosis<br />

<strong>of</strong> gastric and col<strong>or</strong>ectal cancer.<br />

Terminology<br />

In DNA, methylation is the addition <strong>of</strong> a methyl group to a cytosine residue to<br />

convert it to 5-methylcytosine. DNA methylation is the main epigenetic modification<br />

in humans, and changes in methylation patterns play an imp<strong>or</strong>tant role in<br />

tum<strong>or</strong>igenesis. In particular, hypermethylation <strong>of</strong> n<strong>or</strong>mally unmethylated CpG<br />

islands in the promoter region <strong>of</strong> tum<strong>or</strong> suppress<strong>or</strong> genes c<strong>or</strong>relates with their loss<br />

<strong>of</strong> expression and may confer growth advantages to those cells that fav<strong>or</strong> cancer<br />

development.<br />

Peer review<br />

This paper is very interesting. The study is well designed. The auth<strong>or</strong>s evaluated<br />

the role <strong>of</strong> serum RASSF1A promoter hypermethylation in diagnosing gastric<br />

and col<strong>or</strong>ectal adenocarcinoma, showing that aberrant CpG island methylation<br />

within the promoter region <strong>of</strong> RASSF1A is a promising biomarker f<strong>or</strong> gastric and<br />

col<strong>or</strong>ectal cancer.<br />

REFERENCES<br />

1 Macdonald JS. Carcinoembryonic antigen screening: pros and<br />

cons. Semin Oncol 1999; 26: 556-560<br />

2 Jones PA, Baylin SB. The fundamental role <strong>of</strong> epigenetic events<br />

in cancer. Nat Rev Genet 2002; 3: 415-428<br />

3 Baylin SB, Herman JG, Graff JR, Vertino PM, Issa JP.<br />

Alterations in DNA methylation: a fundamental aspect <strong>of</strong><br />

neoplasia. Adv Cancer Res 1998; 72: 141-196<br />

4 Lee TL, Leung WK, Chan MW, Ng EK, Tong JH, Lo KW,<br />

Chung SC, Sung JJ, To KF. Detection <strong>of</strong> gene promoter<br />

hypermethylation in the tum<strong>or</strong> and serum <strong>of</strong> patients with<br />

gastric carcinoma. Clin Cancer Res 2002; 8: 1761-1766<br />

5 Kim H, Kim YH, Kim SE, Kim NG, Noh SH, Kim H. Concerted<br />

promoter hypermethylation <strong>of</strong> hMLH1, p16INK4A, and<br />

E-cadherin in gastric carcinomas with microsatellite instability.<br />

J Pathol 2003; 200: 23-31<br />

6 Tamura G. Alterations <strong>of</strong> tum<strong>or</strong> suppress<strong>or</strong> and tum<strong>or</strong>-related<br />

genes in the development and progression <strong>of</strong> gastric cancer.<br />

W<strong>or</strong>ld J Gastroenterol 2006; 12: 192-198<br />

7 Zhao YF, Zhang YG, Tian XX, Juan Du, Jie Zheng. Aberrant<br />

methylation <strong>of</strong> multiple genes in gastric carcinomas. Int J Surg<br />

Pathol 2007; 15: 242-251<br />

8 Xu XL, Yu J, Zhang HY, Sun MH, Gu J, Du X, Shi DR, Wang<br />

P, Yang ZH, Zhu JD. Methylation pr<strong>of</strong>ile <strong>of</strong> the promoter<br />

CpG islands <strong>of</strong> 31 genes that may contribute to col<strong>or</strong>ectal<br />

carcinogenesis. W<strong>or</strong>ld J Gastroenterol 2004; 10: 3441-3454<br />

9 Lee S, Hwang KS, Lee HJ, Kim JS, Kang GH. Aberrant CpG<br />

island hypermethylation <strong>of</strong> multiple genes in col<strong>or</strong>ectal<br />

neoplasia. Lab Invest 2004; 84: 884-893<br />

10 Tan SH, Ida H, Lau QC, Goh BC, Chieng WS, Loh M, Ito Y.<br />

Detection <strong>of</strong> promoter hypermethylation in serum samples<br />

<strong>of</strong> cancer patients by methylation-specific polymerase chain<br />

reaction f<strong>or</strong> tumour suppress<strong>or</strong> genes including RUNX3. Oncol<br />

Rep 2007; 18: 1225-1230<br />

11 Dammann R, Li C, Yoon JH, Chin PL, Bates S, Pfeifer GP.<br />

Epigenetic inactivation <strong>of</strong> a RAS association domain family<br />

protein from the lung tumour suppress<strong>or</strong> locus 3p21.3. Nat<br />

Genet 2000; 25: 315-319<br />

12 Pfeifer GP, Dammann R. Methylation <strong>of</strong> the tum<strong>or</strong> suppress<strong>or</strong><br />

gene RASSF1A in human tum<strong>or</strong>s. Biochemistry (Mosc) 2005; 70:<br />

576-583<br />

13 Dammann R, Schagdarsurengin U, Seidel C, Strunnikova<br />

M, Rastetter M, Baier K, Pfeifer GP. The tum<strong>or</strong> suppress<strong>or</strong><br />

RASSF1A in human carcinogenesis: an update. Histol<br />

Histopathol 2005; 20: 645-663<br />

14 Byun DS, Lee MG, Chae KS, Ryu BG, Chi SG. Frequent<br />

epigenetic inactivation <strong>of</strong> RASSF1A by aberrant promoter<br />

hypermethylation in human gastric adenocarcinoma. Cancer<br />

Res 2001; 61: 7034-7038<br />

15 Wagner KJ, Cooper WN, Grundy RG, Caldwell G, Jones C,<br />

Wadey RB, M<strong>or</strong>ton D, Sch<strong>of</strong>ield PN, Reik W, Latif F, Maher<br />

ER. Frequent RASSF1A tumour suppress<strong>or</strong> gene promoter<br />

methylation in Wilms' tumour and col<strong>or</strong>ectal cancer. Oncogene<br />

2002; 21: 7277-7282<br />

16 van Engeland M, Roemen GM, Brink M, Pachen MM,<br />

Weijenberg MP, de Bruine AP, Arends JW, van den Brandt<br />

PA, de Goeij AF, Herman JG. K-ras mutations and RASSF1A<br />

promoter methylation in col<strong>or</strong>ectal cancer. Oncogene 2002; 21:<br />

3792-3795<br />

17 Oliveira C, Velho S, Domingo E, Preto A, H<strong>of</strong>stra RM, Hamelin<br />

R, Yamamoto H, Seruca R, Schwartz S Jr. Concomitant<br />

RASSF1A hypermethylation and KRAS/BRAF mutations occur<br />

preferentially in MSI sp<strong>or</strong>adic col<strong>or</strong>ectal cancer. Oncogene 2005;<br />

24: 7630-7634<br />

18 Leon SA, Shapiro B, Sklar<strong>of</strong>f DM, Yaros MJ. Free DNA in the<br />

serum <strong>of</strong> cancer patients and the effect <strong>of</strong> therapy. Cancer Res<br />

1977; 37: 646-650<br />

19 Stroun M, Anker P, Maurice P, Lyautey J, Lederrey C, Beljanski<br />

M. Neoplastic characteristics <strong>of</strong> the DNA found in the plasma<br />

<strong>of</strong> cancer patients. Oncology 1989; 46: 318-322<br />

20 Camps C, Sirera R, Bremnes R, Blasco A, Sancho E, Bayo P,<br />

Safont MJ, Sanchez JJ, Taron M, Rosell R. Is there a prognostic<br />

role <strong>of</strong> K-ras point mutations in the serum <strong>of</strong> patients with<br />

advanced non-small cell lung cancer? Lung Cancer 2005; 50:<br />

339-346<br />

21 Gotoh T, Hosoi H, Iehara T, Kuwahara Y, Osone S, Tsuchiya K,<br />

Ohira M, Nakagawara A, Kuroda H, Sugimoto T. Prediction <strong>of</strong><br />

MYCN amplification in neuroblastoma using serum DNA and<br />

real-time quantitative polymerase chain reaction. J Clin Oncol<br />

2005; 23: 5205-5210<br />

22 Cuda G, Gallelli A, Nistico A, Tassone P, Barbieri V,<br />

Tagliaferri PS, Costanzo FS, Tranfa CM, Venuta S. Detection <strong>of</strong><br />

microsatellite instability and loss <strong>of</strong> heterozygosity in serum<br />

DNA <strong>of</strong> small and non-small cell lung cancer patients: a tool<br />

f<strong>or</strong> early diagnosis? Lung Cancer 2000; 30: 211-214<br />

23 Nawroz-Danish H, Eisenberger CF, Yoo GH, Wu L, Koch<br />

W, Black C, Ensley JF, Wei WZ, Sidransky D. Microsatellite<br />

analysis <strong>of</strong> serum DNA in patients with head and neck cancer.<br />

Int J Cancer 2004; 111: 96-100<br />

24 Fujiwara K, Fujimoto N, Tabata M, Nishii K, Matsuo K,<br />

Hotta K, Kozuki T, Aoe M, Kiura K, Ueoka H, Tanimoto M.<br />

Identification <strong>of</strong> epigenetic aberrant promoter methylation in<br />

serum DNA is useful f<strong>or</strong> early detection <strong>of</strong> lung cancer. Clin<br />

Cancer Res 2005; 11: 1219-1225<br />

25 Ramirez JL, Sarries C, de Castro PL, Roig B, Queralt C, Escuin D,<br />

de Aguirre I, Sanchez JM, Manzano JL, Margeli M, Sanchez JJ,<br />

Astudillo J, Taron M, Rosell R. Methylation patterns and K-ras<br />

mutations in tum<strong>or</strong> and paired serum <strong>of</strong> resected non-smallcell<br />

lung cancer patients. Cancer Lett 2003; 193: 207-216<br />

26 Yamaguchi S, Asao T, Nakamura J, Ide M, Kuwano H. High<br />

frequency <strong>of</strong> DAP-kinase gene promoter methylation in<br />

col<strong>or</strong>ectal cancer specimens and its identification in serum.<br />

Cancer Lett 2003; 194: 99-105<br />

27 Sobin LH, Wittekind C. TNM Classification <strong>of</strong> Malignant Tumours,<br />

6th Edition. New Y<strong>or</strong>k: Wiley-Liss, 2002<br />

28 Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific<br />

PCR: a novel PCR assay f<strong>or</strong> methylation status<br />

<strong>of</strong> CpG islands. Proc Natl Acad Sci USA 1996; 93: 9821-9826<br />

29 Burbee DG, F<strong>or</strong>gacs E, Zochbauer-Muller S, Shivakumar L,<br />

Fong K, Gao B, Randle D, Kondo M, Virmani A, Bader S, Sekido<br />

Y, Latif F, Milchgrub S, Toyooka S, Gazdar AF, Lerman MI,<br />

Zabarovsky E, White M, Minna JD. Epigenetic inactivation <strong>of</strong><br />

www.wjgnet.com

---

3080 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

RASSF1A in lung and breast cancers and malignant phenotype<br />

suppression. J Natl Cancer Inst 2001; 93: 691-699<br />

30 Wang Y, Yu Z, Wang T, Zhang J, Hong L, Chen L. Identification<br />

<strong>of</strong> epigenetic aberrant promoter methylation <strong>of</strong> RASSF1A<br />

in serum DNA and its clinicopathological significance in lung<br />

cancer. Lung Cancer 2007; 56: 289-294<br />

31 Donninger H, Vos MD, Clark GJ. The RASSF1A tum<strong>or</strong> suppress<strong>or</strong>.<br />

J Cell Sci 2007; 120: 3163-3172<br />

32 Liu L, Tommasi S, Lee DH, Dammann R, Pfeifer GP. Control <strong>of</strong><br />

microtubule stability by the RASSF1A tum<strong>or</strong> suppress<strong>or</strong>. Oncogene<br />

2003; 22: 8125-8136<br />

33 Vos MD, Martinez A, Elam C, Dallol A, Tayl<strong>or</strong> BJ, Latif F,<br />

Clark GJ. A role f<strong>or</strong> the RASSF1A tum<strong>or</strong> suppress<strong>or</strong> in the regulation<br />

<strong>of</strong> tubulin polymerization and genomic stability. Cancer<br />

Res 2004; 64: 4244-4250<br />

34 Shivakumar L, Minna J, Sakamaki T, Pestell R, White MA. The<br />

RASSF1A tum<strong>or</strong> suppress<strong>or</strong> blocks cell cycle progression and<br />

inhibits cyclin D1 accumulation. Mol Cell Biol 2002; 22: 4309-4318<br />

35 Whang YM, Kim YH, Kim JS, Yoo YD. RASSF1A suppresses<br />

the c-Jun-NH2-kinase pathway and inhibits cell cycle progression.<br />

Cancer Res 2005; 65: 3682-3690<br />

36 Vos MD, Ellis CA, Bell A, Birrer MJ, Clark GJ. Ras uses the<br />

novel tum<strong>or</strong> suppress<strong>or</strong> RASSF1 as an effect<strong>or</strong> to mediate<br />

apoptosis. J Biol Chem 2000; 275: 35669-35672<br />

37 Vos MD, Dallol A, Eckfeld K, Allen NP, Donninger H, Hesson<br />

LB, Calvisi D, Latif F, Clark GJ. The RASSF1A tum<strong>or</strong> suppress<strong>or</strong><br />

activates Bax via MOAP-1. J Biol Chem 2006; 281: 4557-4563<br />

38 Matallanas D, Romano D, Yee K, Meissl K, Kucerova L, Piazzolla<br />

D, Baccarini M, Vass JK, Kolch W, O'neill E. RASSF1A<br />

www.wjgnet.com<br />

elicits apoptosis through an MST2 pathway directing proapoptotic<br />

transcription by the p73 tum<strong>or</strong> suppress<strong>or</strong> protein. Mol<br />

Cell 2007; 27: 962-975<br />

39 Dallol A, Agathanggelou A, Tommasi S, Pfeifer GP, Maher ER,<br />

Latif F. Involvement <strong>of</strong> the RASSF1A tum<strong>or</strong> suppress<strong>or</strong> gene in<br />

controlling cell migration. Cancer Res 2005; 65: 7653-7659<br />

40 To KF, Leung WK, Lee TL, Yu J, Tong JH, Chan MW, Ng EK,<br />

Chung SC, Sung JJ. Promoter hypermethylation <strong>of</strong> tum<strong>or</strong>related<br />

genes in gastric intestinal metaplasia <strong>of</strong> patients with<br />

and without gastric cancer. Int J Cancer 2002; 102: 623-628<br />

41 Ye M, Xia B, Guo Q, Zhou F, Zhang X. Association <strong>of</strong> diminished<br />

expression <strong>of</strong> RASSF1A with promoter methylation in<br />

primary gastric cancer from patients <strong>of</strong> central China. BMC<br />

Cancer 2007; 7: 120<br />

42 Derks S, Postma C, Moerkerk PT, van den Bosch SM, Carvalho<br />

B, Hermsen MA, Giaretti W, Herman JG, Weijenberg MP, de<br />

Bruine AP, Meijer GA, van Engeland M. Promoter methylation<br />

precedes chromosomal alterations in col<strong>or</strong>ectal cancer development.<br />

Cell Oncol 2006; 28: 247-257<br />

43 Fiegl H, Millinger S, Mueller-Holzner E, Marth C, Ensinger<br />

C, Berger A, Klocker H, Goebel G, Widschwendter M. Circulating<br />

tum<strong>or</strong>-specific DNA: a marker f<strong>or</strong> monit<strong>or</strong>ing efficacy<br />

<strong>of</strong> adjuvant therapy in cancer patients. Cancer Res 2005; 65:<br />

1141-1145<br />

44 Koike H, Ichikawa D, Ikoma H, Tani N, Ikoma D, Otsuji E,<br />

Okamoto K, Ueda Y, Kitamura K, Yamagishi H. Comparison<br />

<strong>of</strong> serum aberrant methylation and conventional tum<strong>or</strong> markers<br />

in gastric cancer patients. Hepatogastroenterology 2005; 52:<br />

1293-1296<br />

S- Edit<strong>or</strong> Li DL L- Edit<strong>or</strong> Wang XL E- Edit<strong>or</strong> Liu Y

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3081-3084<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

Reoperation <strong>of</strong> biliary tract by laparoscopy: Experiences with<br />

39 cases<br />

Li-Bo Li, Xiu-Jun Cai, Yi-Ping Mou, Qi Wei<br />

Li-Bo Li, Xiu-Jun Cai, Yi-Ping Mou, Qi Wei, Department<br />

<strong>of</strong> General Surgery, Sir Run Run Shaw Hospital, Institute <strong>of</strong><br />

Microinvasive Surgery, Medical College <strong>of</strong> Zhejiang University,<br />

Hangzhou, No. 3 East Qingchun Road, Hangzhou 310016,<br />

Zhejiang Province, China<br />

Auth<strong>or</strong> contributions: Li LB designed the research; Li LB, Cai<br />

XJ, Mou YP, Wei Q perf<strong>or</strong>med the research and contributed to<br />

reagents, materials and analytic w<strong>or</strong>k; Li LB and Cai XJ analyzed<br />

the data; Li LB wrote the paper.<br />

C<strong>or</strong>respondence to: Li-Bo Li, MD, Department <strong>of</strong> General<br />

Surgery, Sir Run Run Shaw Hospital, Medical college <strong>of</strong> Zhejiang<br />

University, No. 3 East Qingchun Road, Hangzhou 310016,<br />

Zhejiang Province, China. lilb@srrsh.com<br />

Telephone: +86-571-86995056 Fax: +86-571-86044822<br />

Received: February 12, 2008 Revised: April 12, 2008<br />

Abstract<br />

AIM: To evaluate the safety and feasibility <strong>of</strong> biliary<br />

tract reoperation by laparoscopy f<strong>or</strong> the patients with<br />

retained <strong>or</strong> recurrent stones who failed in endoscopic<br />

sphincterotomy.<br />

METHODS: A retrospective analysis <strong>of</strong> data obtained<br />

from attempted laparoscopic reoperation f<strong>or</strong> 39 patients<br />

in a single institution was perf<strong>or</strong>med, examining open<br />

conversion rates, operative times, complications, and<br />

hospital stay.<br />

RESULTS: Out <strong>of</strong> the 39 cases, 38 (97%) completed<br />

laparoscopy, 1 required conversion to open operation<br />

because <strong>of</strong> difficulty in exposing the common bile<br />

duct. The mean operative time was 135 min. The<br />

mean post-operative hospital stay was 4 d. Procedures<br />

included laparoscopic residual gallbladder resection in<br />

3 cases, laparoscopic common bile duct expl<strong>or</strong>ation<br />

and primary duct closure at choledochotomy in 13<br />

cases, and laparoscopic common bile duct expl<strong>or</strong>ation<br />

and choledochotomy with T tube drainage in 22 cases.<br />

Duodenal perf<strong>or</strong>ation occurred in 1 case during dissection<br />

and was repaired laparoscopically. Retained stones<br />

were found in 2 cases. Postoperative asymptomatic<br />

hyperamylasemia occurred in 3 cases. There were no<br />

complications due to p<strong>or</strong>t placement, postoperative<br />

bleeding, bile <strong>or</strong> bowel leakage and m<strong>or</strong>tality. No<br />

recurrence <strong>or</strong> f<strong>or</strong>mation <strong>of</strong> duct stricture was observed<br />

during a mean follow-up period <strong>of</strong> 18 mo.<br />

CONCLUSION: Laparoscopic biliary tract reoperation<br />

is safe and feasible if it is perf<strong>or</strong>med by experienced<br />

RAPID COMMUNICATION<br />

laparoscopic surgeons, and is an alternative choice f<strong>or</strong><br />

patients with choledocholithiasis who fail in endoscopic<br />

sphincterectomy.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Minimally invasive surgery; Reoperation;<br />

Choledocholithiasis; Laparoscopic common bile duct<br />

expl<strong>or</strong>ation<br />

Peer reviewer: Kalpesh Jani, Dr. SIGMA, 102, Abhishek House,<br />

Vadodara 390011, India<br />

Li LB, Cai XJ, Mou YP, Wei Q. Reoperation <strong>of</strong> biliary tract by<br />

laparoscopy: Experiences with 39 cases. W<strong>or</strong>ld J Gastroenterol<br />

2008; 14(19): 3081-3084 Available from: URL: http://www.wjgnet.com/1007-9327/14/3081.asp<br />

DOI: http://dx.doi.<strong>or</strong>g/10.3748/<br />

wjg.14.3081<br />

INTRODUCTION<br />

In the past, laparoscopic surgery was contraindicated f<strong>or</strong><br />

patients undergone any pri<strong>or</strong> abdominal surgery. With<br />

the advances in laparoscopic instrumentation and skills,<br />

increasingly complex procedures can be perf<strong>or</strong>med f<strong>or</strong><br />

patients with <strong>or</strong> without pri<strong>or</strong> operations [1-5] . Pri<strong>or</strong> open<br />

biliary surgery in particular is associated with difficulty in<br />

placing the initial trocar and obtaining adequate exposure<br />

<strong>of</strong> the biliary tract. Two maj<strong>or</strong> concerns that have<br />

prevented surgeons from using a laparoscopic approach<br />

when perf<strong>or</strong>ming a repeated biliary tract surgery include<br />

the risk <strong>of</strong> injury to <strong>or</strong>gans adherent to the abdominal<br />

wall when Veress needle <strong>or</strong> trocar is inserted, and the<br />

complications associated with adhesiolysis. With the<br />

increased experience in our institution, we have attempted<br />

laparoscopic surgery f<strong>or</strong> patients with retained <strong>or</strong> recurrent<br />

stones who failed in endoscopic sphincterotomy. We<br />

reviewed the data collected from our cases to study the<br />

effect <strong>of</strong> pri<strong>or</strong> biliary surgery on biliary tract reoperation<br />

using laparoscopy.<br />

MATERIALS AND METHODS<br />

Patients<br />

Laparoscopic cholecystectomy was introduced in our<br />

institution in 1993. Based on the experiences with<br />

16 605 laparoscopic cholecystectomies, 658 laparoscopic<br />

common bile duct expl<strong>or</strong>ations, and 851 laparoscopic<br />

www.wjgnet.com

---

3082 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

Table 1 Diagnosis and pri<strong>or</strong> surgery <strong>of</strong> 39 patients<br />

Diagnosis Pri<strong>or</strong> surgery<br />

LC OC OC+<br />

CBDE<br />

OC+CBDE+left<br />

lateral lobectomy<br />

Stones in residual gallbladder 1 2<br />

Stones in CBD 22 11 3<br />

LC: Laparoscopic cholecystectomy; OC: Open cholecystectomy; CBDE:<br />

Common bile duct expl<strong>or</strong>ation; CBD: Common bile duct.<br />

cholecystectomies f<strong>or</strong> patients with pri<strong>or</strong> upper <strong>or</strong> lower<br />

abdominal surgery, we attempted laparoscopic biliary tract<br />

reoperation f<strong>or</strong> patients with retained <strong>or</strong> recurrent stones<br />

who failed in endoscopic sphincterotomy.<br />

A total <strong>of</strong> 39 patients including 26 females and 13<br />

males, with a mean age <strong>of</strong> 46.4 years (ranging 13-76 years)<br />

were underwent to laparoscopic biliary tract reoperations<br />

by two surgical teams between January 2001 and June<br />

2007. Retained <strong>or</strong> recurrent stones were found at a pri<strong>or</strong><br />

biliary surgery f<strong>or</strong> biliary stones. None <strong>of</strong> them had any<br />

other previous abdominal surgery. A pri<strong>or</strong> surgery was<br />

perf<strong>or</strong>med at other hospitals f<strong>or</strong> 36 <strong>of</strong> them. The time<br />

between pri<strong>or</strong> surgery and reoperation ranged from 7 d<br />

to 28 years, with a mean time <strong>of</strong> 2 years. Right subcostal<br />

scars were present in 18 cases, while midline <strong>or</strong> right paramidline<br />

scars were present in 21 cases. The diagnosis and<br />

pri<strong>or</strong> surgery hist<strong>or</strong>y <strong>of</strong> the 39 cases are listed in Table 1.<br />

Diagnosis <strong>of</strong> retained stones <strong>or</strong> recurrent stones was<br />

made by pre-operative ultrasonography, CT, and MRCP.<br />

Endoscopic sphincterotomy failed <strong>or</strong> was contraindicated<br />

in the 39 cases. As the study was begun at a time when our<br />

experience with endoscopic sphincterotomy was limited,<br />

endoscopic sphincterotomy was either contraindicated<br />

<strong>or</strong> failed due to stones greater than 1.5 cm in diameter<br />

in 16 cases, the presence <strong>of</strong> m<strong>or</strong>e than four stones in<br />

12 cases, t<strong>or</strong>tuous ducts in 4 cases, and periampullary<br />

duodenal diverticula in 7 cases, respectively. There were no<br />

contraindications f<strong>or</strong> general anesthesia. The diameter <strong>of</strong><br />

the common bile duct ranged from 1 cm to 2.2 cm in 36<br />

cases <strong>of</strong> choledocholithiasis. Biliary stricture <strong>or</strong> neoplasms<br />

were ruled out by radiological examination and serological<br />

tum<strong>or</strong> markers.<br />

Operative procedure<br />

General endotracheal anesthesia was used. The abdominal<br />

cavity was accessed near the umbilicus. If the previous<br />

scar was m<strong>or</strong>e than 3 cm from the umbilicus, the blind<br />

technique was used to insert the Veress needle. If the scar<br />

was less than 3 cm from the umbilicus, the open (Hasson)<br />

technique was used. Adhesions under the umbilical<br />

incision were dissected using blunt finger dissection.<br />

After pneumoperitoneum was established, intraperitoneal<br />

adhesions were evaluated by a 30-degree angled<br />

laparoscopy. A 5 mm p<strong>or</strong>t was placed under direct<br />

vision into the right <strong>or</strong> left lower abdomen, 5 cm from<br />

the adhesions, allowing dissection <strong>of</strong> the pri<strong>or</strong> surgical<br />

adhesions located below the scar using sciss<strong>or</strong>s, a harmonic<br />

scalpel. One 10 mm operative p<strong>or</strong>t and two 5 mm<br />

access<strong>or</strong>y p<strong>or</strong>ts were placed as a standard four-trocar<br />

www.wjgnet.com<br />

Table 2 Results <strong>of</strong> laparoscopic biliary tract reoperation f<strong>or</strong> 39<br />

cases<br />

technique <strong>of</strong> laparoscopic cholecystectomy.<br />

To approach the hepatic-duodenal ligament, we freed<br />

the lateral parietes and then began dissection on the right<br />

side along the lateral inferi<strong>or</strong> b<strong>or</strong>der <strong>of</strong> the liver, dissecting<br />

the adhesions on the right side <strong>of</strong> hepatic round ligament<br />

down to the hepatic-duodenal ligament. The common<br />

bile duct was identified by touching the stones, needle<br />

aspiration <strong>of</strong> bile from the duct, <strong>or</strong> by laparoscopic<br />

ultrasound.<br />

After identification <strong>of</strong> the common bile duct,<br />

choledochotomy was perf<strong>or</strong>med. Stones in the common<br />

bile duct were retrieved by spontaneous evacuation at the<br />

incision <strong>of</strong> the duct, instrumental expl<strong>or</strong>ation with f<strong>or</strong>ceps,<br />

flushing <strong>of</strong> the common bile duct with saline, <strong>or</strong> Fogarty<br />

balloon catheter. Next, a fifth p<strong>or</strong>t (10 mm) was placed<br />

at the right subcostal margin, just above the gallbladder,<br />

through which a 5.0 mm fiberoptic choledochoscope<br />

(Olympus) was inserted to check the biliary duct and<br />

remove the stones.<br />

As long as choledochoscopy certified a patent common<br />

bile duct and absence <strong>of</strong> stones, the incision was closed<br />

using abs<strong>or</strong>bable 4/0 sutures with a running suture and<br />

intrac<strong>or</strong>p<strong>or</strong>eal knotting, otherwise a T-tube was placed<br />

f<strong>or</strong> drainage, and intraoperative cholangiography was<br />

perf<strong>or</strong>med through the T tube. A No. 10 Jackson-Pratt<br />

drain tube was placed in the subhepatic space f<strong>or</strong> all<br />

patients.<br />

RESULTS<br />

Laparoscopic biliary tract<br />

reoperation (n = 39)<br />

Mean operating time (min) 135 (45-185)<br />

Conversion rate 1 (2.5%)<br />

Postoperative hospital stay (d) 4 (1-6)<br />

Intra-operative complication rate 2.5% (1/39)<br />

Post-operative complication rate 5.1% (2/39)<br />

Of the 39 cases, 38 were underwent to laparoscopic<br />

operation and 1 was converted to an open operation<br />

because <strong>of</strong> difficulty in exposing the common bile duct.<br />

The mean operative time was 135 min (range, 45-185 min)<br />

and the mean postoperative hospital stay was 4 d (ranging<br />

1-6 d, Table 2). Procedures included laparoscopic<br />

residual gallbladder resection in 3 cases, laparoscopic<br />

common bile duct expl<strong>or</strong>ation and primary duct closure<br />

at choledochotomy in 13 cases and laparoscopic common<br />

bile duct expl<strong>or</strong>ation and choledochotomy with T tube<br />

drainage in 22 cases. The mean number <strong>of</strong> removed stones<br />

was 3 (ranging 1-15) and the mean diameter <strong>of</strong> removed<br />

stones was 1 cm (ranging 1-2.6 cm). The mean time <strong>of</strong> T<br />

tube drainage was 38 d (ranging 28-47 d).<br />

There were no complications due to p<strong>or</strong>t placement.<br />

In one patient with a hist<strong>or</strong>y <strong>of</strong> open cholecystectomy and<br />

common bile duct expl<strong>or</strong>ation, the duodenum perf<strong>or</strong>ation<br />

occurred during dissection was repaired laparoscopically.<br />

There were no m<strong>or</strong>tality, postoperative bleeding, bile

---

Li LB et al . Laparoscopic biliary tract reoperation 3083<br />

<strong>or</strong> bowel leakage in any <strong>of</strong> the 38 cases. Asymptomatic<br />

hyperamylasemia present in 3 cases postoperatively was<br />

treated with conservative therapy. Retained stones found<br />

in 2 cases were removed by choledochoscopy through<br />

the sinus tract <strong>of</strong> the T tube. No recurrent stones <strong>or</strong> duct<br />

stricture f<strong>or</strong>mation was found during a mean follow-up<br />

period <strong>of</strong> 18 mo.<br />

DISCUSSION<br />

Most patients with common bile duct stones are cured by<br />

minimally invasive endoscopic sphincterotomy [6-10] . In the<br />

absence <strong>of</strong> a remaining T-tube from a pri<strong>or</strong> operation,<br />

endoscopic sphincterotomy is considered the procedure<br />

<strong>of</strong> choice f<strong>or</strong> patients with retained <strong>or</strong> recurrent stones,<br />

and should be attempted bef<strong>or</strong>e pursuing biliary tract<br />

reoperation. However, endoscopic sphincterotomy cannot<br />

be perf<strong>or</strong>med, and is itself associated with a significant<br />

m<strong>or</strong>bidity [11-15] . Contraindications f<strong>or</strong> endoscopic<br />

sphincterotomy, as mentioned above, include size <strong>of</strong><br />

stones, number <strong>of</strong> stones, presence <strong>of</strong> t<strong>or</strong>tuous ducts <strong>or</strong><br />

presence <strong>of</strong> periampullary duodenal diverticula, etc and<br />

vary depending on institutional and individual techniques<br />

and experiences. With the advances in laparoscopic<br />

skills and instrumentation, laparoscopic common bile<br />

duct expl<strong>or</strong>ation [16-20] and other laparoscopic procedures<br />

have become an increasingly popular option f<strong>or</strong> patients<br />

undergone any pri<strong>or</strong> abdominal surgery [21-25] , making<br />

laparoscopic reoperation <strong>of</strong> the biliary tract a reasonable<br />

choice f<strong>or</strong> patients with a hist<strong>or</strong>y <strong>of</strong> pri<strong>or</strong> biliary surgery<br />

who have failed in endoscopic sphincterotomy. The<br />

results <strong>of</strong> our study indicate that laparoscopic surgery was<br />

not only minimally invasive, but also safe and feasible in<br />

cases <strong>of</strong> biliary tract reoperation, suggesting that it is the<br />

best method f<strong>or</strong> patients who have failed in endoscopic<br />

sphincterotomy.<br />

A primary concern when considering laparoscopic<br />

reoperation is the f<strong>or</strong>mation <strong>of</strong> adhesions after abdominal<br />

surgery, particularly after open biliary surgery. Adhesions<br />

from pri<strong>or</strong> surgery are associated with difficulty in<br />

establishing pneumoperitoneum, placing the initial trocar,<br />

and obtaining adequate exposure <strong>of</strong> the biliary tract. To<br />

avoid the potential risk <strong>of</strong> injury to <strong>or</strong>gans adherent to<br />

either the abdominal wall <strong>or</strong> the previous operative field,<br />

certain techniques and principles should be followed<br />

during Veress needle and trocar insertion as well as<br />

adhesiolysis.<br />

Safe establishment <strong>of</strong> pneumoperitoneum and<br />

placement <strong>of</strong> an initial trocar are the prerequisite to any<br />

laparoscopic biliary tract reoperation and related with half<br />

<strong>of</strong> the complications <strong>of</strong> laparoscopic surgery [26-29] . In our<br />

study, blind Veress needle and initial trocar insertion m<strong>or</strong>e<br />

than 3 cm from the previous scar were safe f<strong>or</strong> patients<br />

with previous biliary surgery. The open Hasson procedure<br />

perf<strong>or</strong>med in a previously unoperated field can avoid<br />

potential underlying adhesions <strong>or</strong> injury. In our study,<br />

no complications were related to the entrance into the<br />

peritoneum, indicating that previous biliary surgery is not a<br />

contraindication f<strong>or</strong> minimally invasive procedures.<br />

After access has been achieved, sufficient adhesiolysis<br />

should be perf<strong>or</strong>med to allow the insertion <strong>of</strong> a second<br />

p<strong>or</strong>t to aid in visualization, retraction and dissection, and<br />

to allow f<strong>or</strong> additional p<strong>or</strong>ts as needed. The laparoscope<br />

can be moved to different p<strong>or</strong>t sites without the need to<br />

perf<strong>or</strong>m total adhesiolysis <strong>of</strong> all visible adhesions. Only<br />

the adhesions interfering with adequate access to the<br />

operative field <strong>or</strong> the perf<strong>or</strong>mance <strong>of</strong> the procedure need<br />

to be lysed. Adhesions close to the abdominal wall should<br />

be dissected to avoid injury to the intestine. By using a<br />

harmonic scalpel to dissect adhesions, the operative time<br />

can be reduced, thus decreasing blood loss [30] .<br />

Once the gallbladder has been removed <strong>or</strong> the<br />

common bile duct has been expl<strong>or</strong>ed, dense adhesions<br />

are usually found during reoperation in the healed fossa<br />

and near the common duct. In many instances, the upper<br />

edge <strong>of</strong> the duodenum is tented sharply cephalad into<br />

the gallbladder fossa. At times, because it is difficult to<br />

recognize the anatomy <strong>or</strong> identify the common bile duct,<br />

one should approach to the hepatic hilum by freeing the<br />

lateral parietes, and then begin dissection on the right side<br />

along the lateral inferi<strong>or</strong> b<strong>or</strong>der <strong>of</strong> the liver. This gives<br />

a better mobility <strong>of</strong> structures so the hepatic flexure <strong>of</strong><br />

the colon and the lateral edge <strong>of</strong> the second part <strong>of</strong> the<br />

duodenum can be identified bef<strong>or</strong>e beginning dissection<br />

in the area <strong>of</strong> dense adhesions. The adhesions on the right<br />

side <strong>of</strong> the hepatic round ligament should be dissected<br />

from Glisson’s capsule down to the hepatic-duodenal<br />

ligament. When adhesions are dissected from Glisson’s<br />

capsule, attempts at blunt dissection with heavy retraction<br />

can easily avulse the capsule and expose the bleeding liver<br />

parenchyma. Consequently, careful sharp dissection is<br />

a m<strong>or</strong>e expedient technique. To prevent thermal injury<br />

<strong>of</strong> the gastrointestinal tract, electrical cautery should be<br />

avoided. After exposure <strong>of</strong> the hepatic-duodenal ligament,<br />

the common bile duct can be identified by touching the<br />

stones and needle aspiration <strong>of</strong> bile <strong>or</strong> by laparoscopic<br />

ultrasound.<br />

In summary, laparoscopic biliary tract reoperation<br />

has a reasonable operating time, low conversion rate, low<br />

intra-operative and postoperative complication rate, and<br />

sh<strong>or</strong>t postoperative hospital stay. Given these results, a<br />

laparoscopic approach to biliary tract reoperation appears<br />

to be a minimally invasive, safe, feasible, and effective<br />

procedure when done by expert laparoscopic surgeons,<br />

and is a first choice <strong>of</strong> treatment f<strong>or</strong> patients who have<br />

failed in endoscopic sphincterotomy.<br />

COMMENTS<br />

Background<br />

In the past, a hist<strong>or</strong>y <strong>of</strong> pri<strong>or</strong> biliary tract surgery was considered a contraindication<br />

f<strong>or</strong> perf<strong>or</strong>ming a repeat biliary operation. In the absence <strong>of</strong> a remaining T-tube<br />

from a pri<strong>or</strong> operation, endoscopic sphincterotomy is considered the procedure<br />

<strong>of</strong> choice f<strong>or</strong> patients with retained <strong>or</strong> recurrent stones, and should be attempted<br />

bef<strong>or</strong>e pursuing biliary tract reoperation. However, endoscopic sphincterotomy<br />

cannot be perf<strong>or</strong>med on everyone, and is itself associated with a significant<br />

m<strong>or</strong>bidity. With the advances in laparoscopic skills and instrumentation,<br />

increasingly complex procedures have been perf<strong>or</strong>med in patients with <strong>or</strong> without<br />

pri<strong>or</strong> operations.<br />

Research frontiers<br />

It has previously been rep<strong>or</strong>ted that laparoscopic common bile duct (CBD)<br />

www.wjgnet.com

---

3084 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

expl<strong>or</strong>ation is a common method f<strong>or</strong> the management <strong>of</strong> choledocholithiae, and<br />

laparoscopic procedures are safe f<strong>or</strong> patients undergone pri<strong>or</strong> abdominal surgery.<br />

Few studies are available on the safety and feasibility <strong>of</strong> reoperation <strong>of</strong> biliary tract<br />

by laparoscopy f<strong>or</strong> the patients with retained <strong>or</strong> recurrent stones who have failed in<br />

whom endoscopic sphincterotomy.<br />

Innovations and breakthroughs<br />

This study showed laparoscopic biliary tract reoperation appears to be a minimally<br />

invasive, safe, feasible, and effective method when done by expert laparoscopic<br />

surgeons.<br />

Applications<br />

Laparoscopic biliary tract reoperation is an alternative method f<strong>or</strong> patients with<br />

choledocholithiasis who have failed in endoscopic sphincterectomy.<br />

Peer review<br />

The auth<strong>or</strong>s describe, in this paper, their experience in laparoscopic biliary tract<br />

reoperation, which is <strong>of</strong> a certain clinical value.<br />

REFERENCES<br />

1 Cai XJ, Yu H, Liang X, Wang YF, Zheng XY, Huang DY, Peng<br />

SY. Laparoscopic hepatectomy by curettage and aspiration.<br />

Experiences <strong>of</strong> 62 cases. Surg Endosc 2006; 20: 1531-1535<br />

2 Karayiannakis AJ, Polychronidis A, Perente S, Botaitis S,<br />

Simopoulos C. Laparoscopic cholecystectomy in patients with<br />

previous upper <strong>or</strong> lower abdominal surgery. Surg Endosc 2004;<br />

18: 97-101<br />

3 Palanivelu C, Jani K, Senthilnathan P, Parthasarathi R,<br />

Rajapandian S, Madhankumar MV. Laparoscopic pancreaticoduodenectomy:<br />

technique and outcomes. J Am Coll Surg 2007;<br />

205: 222-230<br />

4 Hur H, Jeon HM, Kim W. Laparoscopic pancreas- and spleenpreserving<br />

D2 lymph node dissection in advanced (cT2)<br />

upper-third gastric cancer. J Surg Oncol 2008; 97: 169-172<br />

5 Donati M, Memming M, Donati A, Calò PG, Nicolosi<br />

A. [Indications and limits <strong>of</strong> laparoscopic treatment f<strong>or</strong><br />

diverticular disease <strong>of</strong> the colon: personal experience] Chir Ital<br />

2008; 60: 63-73<br />

6 Escourrou J, C<strong>or</strong>dova JA, Laz<strong>or</strong>thes F, Frexinos J, Ribet A.<br />

Early and late complications after endoscopic sphincterotomy<br />

f<strong>or</strong> biliary lithiasis with and without the gall bladder 'in situ'.<br />

Gut 1984; 25: 598-602<br />

7 Leese T, Neoptolemos JP, Carr-Locke DL. Successes, failures,<br />

early complications and their management following<br />

endoscopic sphincterotomy: results in 394 consecutive patients<br />

from a single centre. Br J Surg 1985; 72: 215-219<br />

8 Heo JH, Kang DH, Jung HJ, Kwon DS, An JK, Kim BS, Suh<br />

KD, Lee SY, Lee JH, Kim GH, Kim TO, Heo J, Song GA, Cho M.<br />

Endoscopic sphincterotomy plus large-balloon dilation versus<br />

endoscopic sphincterotomy f<strong>or</strong> removal <strong>of</strong> bile-duct stones.<br />

Gastrointest Endosc 2007; 66: 720-726; quiz 768, 771<br />

9 Teoh AY, Poon MC, Leong HT. Role <strong>of</strong> prophylactic<br />

endoscopic sphincterotomy in patients with acute biliary<br />

pancreatitis due to transient common bile duct obstruction. J<br />

Gastroenterol Hepatol 2007; 22: 1415-1418<br />

10 Wojtun S, Gil J, Gietka W, Gil M. Endoscopic sphincterotomy<br />

f<strong>or</strong> choledocholithiasis: a prospective single-center study on<br />

the sh<strong>or</strong>t-term and long-term treatment results in 483 patients.<br />

Endoscopy 1997; 29: 258-265<br />

11 Tranter SE, Thompson MH. Comparison <strong>of</strong> endoscopic<br />

sphincterotomy and laparoscopic expl<strong>or</strong>ation <strong>of</strong> the common<br />

bile duct. Br J Surg 2002; 89: 1495-1504<br />

12 Kim HJ, Choi HS, Park JH, Park DI, Cho YK, Sohn CI, Jeon<br />

WK, Kim BI, Choi SH. Fact<strong>or</strong>s influencing the technical<br />

www.wjgnet.com<br />

difficulty <strong>of</strong> endoscopic clearance <strong>of</strong> bile duct stones.<br />

Gastrointest Endosc 2007; 66: 1154-1160<br />

13 Szyca R, Tomaszewski S, Jasiński A, Leksowski K. [Late<br />

complication <strong>of</strong> endoscopic sphincterotomy] Pol Merkur<br />

Lekarski 2007; 22: 414-415<br />

14 Cheon YK, Lehman GA. Identification <strong>of</strong> risk fact<strong>or</strong>s f<strong>or</strong> stone<br />

recurrence after endoscopic treatment <strong>of</strong> bile duct stones. Eur J<br />

Gastroenterol Hepatol 2006; 18: 461-464<br />

15 Lai KH, Peng NJ, Lo GH, Cheng JS, Huang RL, Lin CK,<br />

Huang JS, Chiang HT, Ger LP. Prediction <strong>of</strong> recurrent<br />

choledocholithiasis by quantitative cholescintigraphy in<br />

patients after endoscopic sphincterotomy. Gut 1997; 41:<br />

399-403<br />

16 Decker G, B<strong>or</strong>ie F, Millat B, Berthou JC, Deleuze A, Drouard F,<br />

Guillon F, Rodier JG, Fingerhut A. One hundred laparoscopic<br />

choledochotomies with primary closure <strong>of</strong> the common bile<br />

duct. Surg Endosc 2003; 17: 12-18<br />

17 Petelin JB. Laparoscopic common bile duct expl<strong>or</strong>ation. Surg<br />

Endosc 2003; 17: 1705-1715<br />

18 Paganini AM, Feliciotti F, Guerrieri M, Tamburini A,<br />

Campagnacci R, Lezoche E. Laparoscopic cholecystectomy<br />

and common bile duct expl<strong>or</strong>ation are safe f<strong>or</strong> older patients.<br />

Surg Endosc 2002; 16: 1302-1308<br />

19 Topal B, Aerts R, Penninckx F. Laparoscopic common bile<br />

duct stone clearance with flexible choledochoscopy. Surg<br />

Endosc 2007; 21: 2317-2321<br />

20 Gholipour C, Shalchi RA, Abassi M. Efficacy and safety <strong>of</strong><br />

early laparoscopic common bile duct expl<strong>or</strong>ation as primary<br />

procedure in acute cholangitis caused by common bile duct<br />

stones. J Laparoendosc Adv Surg Tech A 2007; 17: 634-638<br />

21 Chen B, Hu SY, Wang L, Wang KX, Zhang GY, Zhang HF.<br />

Reoperation <strong>of</strong> biliary tract by laparoscopy: a consecutive<br />

series <strong>of</strong> 26 cases. Acta Chir Belg 2007; 107: 292-296<br />

22 Dexter SP, Miller GV, Davides D, Martin IG, Sue Ling HM,<br />

Sagar PM, Larvin M, McMahon MJ. Relaparoscopy f<strong>or</strong> the<br />

detection and treatment <strong>of</strong> complications <strong>of</strong> laparoscopic<br />

cholecystectomy. Am J Surg 2000; 179: 316-319<br />

23 Kwon AH, Inui H, Imamura A, Kaib<strong>or</strong>i M, Kamiyama Y.<br />

Laparoscopic cholecystectomy and choledocholithotomy in<br />

patients with a previous gastrectomy. J Am Coll Surg 2001; 193:<br />

614-619<br />

24 Ballesta Lopez C, Ruggiero R, Poves I, Bettonica C, Procaccini<br />

E, C<strong>or</strong>sale I, Mandato M, De Luca L. Laparoscopic procedures<br />

in patients who have previously undergone laparotomic<br />

operations. Minerva Chir 2003; 58: 53-56<br />

25 Leister I, Becker H. [Relaparoscopy as an alternative to<br />

laparotomy f<strong>or</strong> laparoscopic complications] Chirurg 2006; 77:<br />

986-997<br />

26 Chandler JG, C<strong>or</strong>son SL, Way LW. Three spectra <strong>of</strong><br />

laparoscopic entry access injuries. J Am Coll Surg 2001; 192:<br />

478-490; discussion 490-491<br />

27 Johnston K, Rosen D, Cario G, Chou D, Carlton M, Cooper<br />

M, Reid G. Maj<strong>or</strong> complications arising from 1265 operative<br />

laparoscopic cases: a prospective review from a single center. J<br />

Minim Invasive Gynecol 2007; 14: 339-344<br />

28 Altun H, Banli O, Kavlakoglu B, Kavlakoglu B, Kelesoglu C,<br />

Erez N. Comparison between direct trocar and Veress needle<br />

insertion in laparoscopic cholecystectomy. J Laparoendosc Adv<br />

Surg Tech A 2007; 17: 709-712<br />

29 Marakis GN, Pavlidis TE, Ballas K, Aimoniotou E, Psarras K,<br />

Karvounaris D, Rafailidis S, Demertzidis H, Sakantamis AK.<br />

Maj<strong>or</strong> complications during laparoscopic cholecystectomy. Int<br />

Surg 2007; 92: 142-146<br />

30 Langer C, Markus P, Liersch T, Füzesi L, Becker H. UltraCision<br />

<strong>or</strong> high-frequency knife in transanal endoscopic microsurgery<br />

(TEM)? Advantages <strong>of</strong> a new procedure. Surg Endosc 2001; 15:<br />

513-517<br />

S- Edit<strong>or</strong> Zhong XY L- Edit<strong>or</strong> Wang XL E- Edit<strong>or</strong> Yin DH

---

3086 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

Table 1 IBD medications during pregnancy<br />

Low risk Limited data Not<br />

recommended<br />

(Prometheus Lab<strong>or</strong>at<strong>or</strong>ies, San Diego, CA) with an<br />

enzyme-linked immunos<strong>or</strong>bent assay. A spike and recovery<br />

study was perf<strong>or</strong>med to investigate whether any nonspecific<br />

binding by breast milk components was interfering<br />

with the assay. A sample <strong>of</strong> breast milk was spiked with<br />

40 ng/mL solution <strong>of</strong> infliximab, a concentration<br />

comparable to the mother’s serum concentration. A<br />

dilutional analysis (1:2, 1:4, and 1:8) was also perf<strong>or</strong>med<br />

and the infliximab was detected by the lab<strong>or</strong>at<strong>or</strong>y in all<br />

the spiked breast milk samples, but was not identified<br />

in her regular breast milk. The patient then received her<br />

regularly scheduled infliximab infusion (10 mg/kg) and<br />

her breast milk was collected daily f<strong>or</strong> 30 d. No infliximab<br />

was identified in any <strong>of</strong> the breast milk samples, even<br />

with dilutional analysis. At 27 mo, no developmental<br />

abn<strong>or</strong>malities were noted in the child.<br />

DISCUSSION<br />

Contraindicated<br />

Oral mesalamine Olsalazine Tetracycline Methotrexate<br />

Topical mesalamine Azathioprine Sulfonamides<br />

Sulfasalazine 6-Mercaptopurine<br />

Ampicillin Metronidazole<br />

Cephalosp<strong>or</strong>ins Cipr<strong>of</strong>loxacin<br />

C<strong>or</strong>ticosteroids Infliximab<br />

Cyclosp<strong>or</strong>ine Adalimumab<br />

Loperamide<br />

New medications and aggressive treatment approaches<br />

to medical management have put m<strong>or</strong>e women with<br />

IBD in the position <strong>of</strong> being healthy enough to consider<br />

pregnancy. In women with IBD, the key to a healthy<br />

pregnancy is adequate control <strong>of</strong> disease activity<br />

throughout pregnancy [1] . Biologic agents are increasingly<br />

becoming a mainstay in the treatment regimens <strong>of</strong> both<br />

CD and ulcerative colitis (UC). Unf<strong>or</strong>tunately, little<br />

inf<strong>or</strong>mation is available about the sh<strong>or</strong>t-term and the longterm<br />

consequences <strong>of</strong> treatment with target monoclonal<br />

antibodies on the maturing fetus [2,3] . The safety <strong>of</strong> IBD<br />

medications during pregnancy and nursing are summarized<br />

in Tables 1 and 2.<br />

Infliximab (Remicade; Centoc<strong>or</strong> Inc, Malvern, PA) is<br />

a chimeric monoclonal antibody to tum<strong>or</strong> necrosis fact<strong>or</strong>alpha<br />

(TNF-α) [4] . It is indicated f<strong>or</strong> inducing and maintaining<br />

clinical remission in moderately to severely active CD<br />

and UC patients that have had an inadequate response<br />

to conventional therapy and maintenance <strong>of</strong> remission [5] .<br />

Infliximab is increasingly used to treat pregnant women and<br />

data on its safety during pregnancy are scarce. Infliximab is<br />

listed as a pregnancy categ<strong>or</strong>y B medication and the product<br />

label states that “It is not known whether infliximab can<br />

cause fetal harm when administered to a pregnant woman [4] ”.<br />

Most clinicians believe that the chimeric structure <strong>of</strong> the<br />

infliximab molecule containing a human IgG1 constant<br />

region, limits placental transfer during the first trimester [6] .<br />

However, the safety <strong>of</strong> infliximab beyond the first trimester<br />

www.wjgnet.com<br />

Table 2 IBD medications during nursing<br />

Low risk Limited data Not recommended Contraindicated<br />

Oral mesalamine Olsalazine Tetracycline Methotrexate<br />

Topical mesalamine Infliximab Sulfonamides Cyclosp<strong>or</strong>ine<br />

Sulfasalazine Adalimumab Azathioprine<br />

C<strong>or</strong>ticosteroids 6-Mercaptopurine<br />

Loperamide<br />

Metronidazole<br />

Cipr<strong>of</strong>loxacin<br />

is unknown because IgG subclasses are readily passed into<br />

the fetus during the second and third trimesters [7] . Until<br />

recently, the medical literature contained no <strong>evidence</strong> that<br />

engineered therapeutic antibodies could cross the placenta<br />

when administered to expectant mothers. A recent case<br />

rep<strong>or</strong>t documents clinically significant fetal exposure to<br />

infliximab via placental transfer and a prolonged half-life <strong>of</strong><br />

the medication in newb<strong>or</strong>ns [2] . The presumed mechanism<br />

<strong>of</strong> fetal exposure to infliximab is transplacental maternal<br />

IgG antibody transfer beginning in the second trimester<br />

and peaking at term. No fetal abn<strong>or</strong>malities were apparent<br />

in this case, but the long-term implications <strong>of</strong> infliximab<br />

exposure during early childhood development are unknown.<br />

These findings suggest that pregnant patients should avoid<br />

therapeutic antibody treatments after thirty weeks’ gestation<br />

and if necessary, the expectant mother can be bridged with<br />

steroids to control the disease activity until delivery [2,8] .<br />

Limited clinical data are available on the safety <strong>of</strong><br />

infliximab in pregnancy, because no controlled study is<br />

available in pregnant women. The manufacturer’s safety<br />

database contains inf<strong>or</strong>mation on the outcomes <strong>of</strong> 131<br />

pregnant women who received infliximab f<strong>or</strong> rheumatoid<br />

arthritis <strong>or</strong> IBD [9] . An analysis perf<strong>or</strong>med on this safety<br />

database suggests no significant difference in pregnancy<br />

outcomes in women with infliximab exposure [7] . A<br />

published retrospective review <strong>of</strong> 10 pregnancies in CD<br />

patients in which infliximab was continued throughout<br />

the course <strong>of</strong> the pregnancy rep<strong>or</strong>ted fav<strong>or</strong>able fetal and<br />

maternal outcomes [7] . The limited clinical results available<br />

suggest that the benefits <strong>of</strong> infliximab in attaining response<br />

and maintaining remission in pregnant IBD patients might<br />

outweigh the risks <strong>of</strong> drug exposure to the fetus [10] .<br />

The primary concern <strong>of</strong> the case we rep<strong>or</strong>t is the<br />

safety <strong>of</strong> infliximab while breastfeeding, because many<br />

drugs and immunoglobulins are excreted in human milk.<br />

The infliximab product label states that “It is not known<br />

whether infliximab is excreted in human milk <strong>or</strong> abs<strong>or</strong>bed<br />

systemically after ingestion [4] ”. A commercially available<br />

infliximab assay was used to measure drug levels in breast<br />

milk taken daily from our patient over a 30 d time period.<br />

No infliximab was detected in our patient’s breast milk.<br />

Other published rep<strong>or</strong>ts only tested breast-feeding mothers<br />

f<strong>or</strong> one <strong>or</strong> two days but the results were consistent with<br />

our data [2] . We believe the daily testing perf<strong>or</strong>med on our<br />

patient’s breast milk bef<strong>or</strong>e and immediately after receiving<br />

an infliximab infusion clearly demonstrates that infliximab<br />

is not excreted in breast milk in any clinically significant<br />

amount.<br />

Several case rep<strong>or</strong>ts have recently emerged describing

---

Stengel JZ et al . Safety <strong>of</strong> infliximab while breastfeeding 3087<br />

the <strong>of</strong>f-label usage <strong>of</strong> other biologics during pregnancy.<br />

A pregnant woman with treatment-refract<strong>or</strong>y CD who<br />

failed treatment with infliximab was successfully treated<br />

with adalimumab (Humira; Abbott Lab<strong>or</strong>at<strong>or</strong>ies, Chicago,<br />

IL), a recombinant human IgG1 monoclonal anti-TNF<br />

antibody [11,12] . The pregnancy was uncomplicated and at<br />

6 mo, the infant showed n<strong>or</strong>mal growth and development<br />

[13] . Another case rep<strong>or</strong>ted the use <strong>of</strong> etanercept<br />

(Enbrel; Amgen, Thousand Oaks, CA), a soluble TNF<br />

recept<strong>or</strong> fusion protein that binds to and inactivates TNF,<br />

in an uneventful pregnancy <strong>of</strong> a patient with refract<strong>or</strong>y<br />

rheumatoid arthritis [14] . Etanercept has been shown to be<br />

excreted in breast milk, but it is not known whether the drug<br />

can be abs<strong>or</strong>bed <strong>or</strong>ally because it is such a large protein [15] .<br />

In conclusion, therapeutic monoclonal antibodies and<br />

other biologic agents are used to a greater extent to treat<br />

immune-mediated dis<strong>or</strong>ders in pregnant patients. The<br />

limited clinical data currently available show no significant<br />

difference in pregnancy outcomes <strong>of</strong> patients exposed<br />

to infliximab during pregnancy compared to a healthy<br />

population. Physicians should be aware that the fetus<br />

may be exposed to therapeutic monoclonal antibodies<br />

when administered to pregnant patients and the long term<br />

implications on the child’s developing immune system<br />

are unknown at this time. While physicians must remain<br />

cautious about matern<strong>of</strong>etal exposure to medications<br />

like therapeutic monoclonal antibodies, additions to<br />

the literature from rep<strong>or</strong>ts like this one will hopefully<br />

assuage some <strong>of</strong> the fears faced by gastroenterologists,<br />

obstetricians, and patients, alike.<br />

REFERENCES<br />

1 Jospe ES, Pepperc<strong>or</strong>n MA. Inflammat<strong>or</strong>y bowel disease and<br />

pregnancy: a review. Dig Dis 1999; 17: 201-207<br />

2 Vasiliauskas EA, Church JA, Silverman N, Barry M, Targan<br />

SR, Dubinsky MC. Case rep<strong>or</strong>t: <strong>evidence</strong> f<strong>or</strong> transplacental<br />

transfer <strong>of</strong> maternally administered infliximab to the newb<strong>or</strong>n.<br />

Clin Gastroenterol Hepatol 2006; 4: 1255-1258<br />

3 Srinivasan R. Infliximab treatment and pregnancy outcome in<br />

active Crohn's disease. Am J Gastroenterol 2001; 96: 2274-2275<br />

4 Remicade product inf<strong>or</strong>mation. In: Physicians desk reference.<br />

58th ed. Montvale, NJ: Medical Economics Company, Inc,<br />

2004: 1145-1148<br />

5 Reddy JG, L<strong>of</strong>tus EV Jr. Safety <strong>of</strong> infliximab and other biologic<br />

agents in the inflammat<strong>or</strong>y bowel diseases. Gastroenterol Clin<br />

N<strong>or</strong>th Am 2006; 35: 837-855<br />

6 Simister NE. Placental transp<strong>or</strong>t <strong>of</strong> immunoglobulin G.<br />

Vaccine 2003; 21: 3365-3369<br />

7 Mahadevan U, Kane S, Sandb<strong>or</strong>n WJ, Cohen RD, Hanson K,<br />

Terdiman JP, Binion DG. Intentional infliximab use during<br />

pregnancy f<strong>or</strong> induction <strong>or</strong> maintenance <strong>of</strong> remission in<br />

Crohn's disease. Aliment Pharmacol Ther 2005; 21: 733-738<br />

8 Friedman S, Regueiro MD. Pregnancy and nursing in<br />

inflammat<strong>or</strong>y bowel disease. Gastroenterol Clin N<strong>or</strong>th Am 2002;<br />

31: 265-73, xii<br />

9 Katz JA, Antoni C, Keenan GF, Smith DE, Jacobs SJ,<br />

Lichtenstein GR. Outcome <strong>of</strong> pregnancy in women receiving<br />

infliximab f<strong>or</strong> the treatment <strong>of</strong> Crohn's disease and rheumatoid<br />

arthritis. Am J Gastroenterol 2004; 99: 2385-2392<br />

10 Tursi A. Effect <strong>of</strong> intentional infliximab use throughout<br />

pregnancy in inducing and maintaining remission in Crohn's<br />

disease. Dig Liver Dis 2006; 38: 439-440<br />

11 Humira (adalimumab) [prescribing inf<strong>or</strong>mation]. N<strong>or</strong>th<br />

Chicago, IL: Abbott Lab<strong>or</strong>at<strong>or</strong>ies, 2005<br />

12 Sanchez Munoz D, Hoyas Pablos E, Ramirez Martin Del<br />

Campo M, Nunez Hospital D, Guerrero Jimenez P. [Term<br />

pregnancy in a patient with Crohn's disease under treatment<br />

with adalimumab] Gastroenterol Hepatol 2005; 28: 435<br />

13 Vesga L, Terdiman JP, Mahadevan U. Adalimumab use in<br />

pregnancy. Gut 2005; 54: 890<br />

14 Sills ES, Perloe M, Tucker MJ, Kaplan CR, Palermo GD.<br />

Successful ovulation induction, conception, and n<strong>or</strong>mal<br />

delivery after chronic therapy with etanercept: a recombinant<br />

fusion anti-cytokine treatment f<strong>or</strong> rheumatoid arthritis. Am J<br />

Reprod Immunol 2001; 46: 366-368<br />

15 Ostensen M, Eigenmann GO. Etanercept in breast milk. J<br />

Rheumatol 2004; 31: 1017-1018<br />

S- Edit<strong>or</strong> Li DL L- Edit<strong>or</strong> Wang XL E- Edit<strong>or</strong> Yin DH<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3088-3091<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

CASE REPORT<br />

Abscesses <strong>of</strong> the spleen: Rep<strong>or</strong>t <strong>of</strong> three cases<br />

Constantin Fotiadis, Giagkos Lavranos, Pavlos Patapis, Gabriel Karatzas<br />

Constantin Fotiadis, Giagkos Lavranos, Pavlos Patapis,<br />

Gabriel Karatzas, 3rd Department <strong>of</strong> Surgery, Attikon University<br />

Hospital, Chaidari 12462, Greece<br />

Auth<strong>or</strong> contributions: Fotiadis C and Lavranos G contributed<br />

equally to this w<strong>or</strong>k and wrote the paper; Patapis P and Karatzas<br />

G analyzed the data.<br />

C<strong>or</strong>respondence to: Giagkos Lavranos, Medical Doct<strong>or</strong>, 3rd<br />

Department <strong>of</strong> Surgery, Attikon University Hospital, 34 Falireos<br />

Street, 18547 Neo Faliro, Piraeus 18538,<br />

Greece. glavran@med.uoa.gr<br />

Telephone: +30-210-7462350 Fax: +30-210-7462105<br />

Received: November 19, 2007 Revised: March 11, 2008<br />

Abstract<br />

Abscess <strong>of</strong> the spleen is a rare discovery, with about 600<br />

cases in the international literature so far. Although it<br />

may have various causes, it is most usually associated<br />

with trauma and infections <strong>of</strong> the spleen. The latter are<br />

m<strong>or</strong>e common in the presence <strong>of</strong> a different primary<br />

site <strong>of</strong> infection, especially endocarditis <strong>or</strong> in cases<br />

<strong>of</strong> ischemic infarcts that are secondarily infected.<br />

M<strong>or</strong>eover, immunosuppression is a maj<strong>or</strong> risk fact<strong>or</strong>.<br />

Clinical examination usually reveals a combination <strong>of</strong><br />

fever, left-upper-quadrant abdominal pain and vomiting.<br />

Lab<strong>or</strong>at<strong>or</strong>y findings are not constant. Imaging is a<br />

necessary tool f<strong>or</strong> establishing the diagnosis, with a<br />

choice between ultrasound and computed tomography.<br />

Treatment includes conservative measures, and surgical<br />

intervention. In children and in cases <strong>of</strong> solitary<br />

abscesses with a thick wall, percutaneous catheter<br />

drainage may be attempted. Otherwise, splenectomy<br />

is the preferred approach in most centers. Here, we<br />

present three cases <strong>of</strong> splenic abscess. In all three,<br />

splenectomy was perf<strong>or</strong>med, followed by rapid clinical<br />

improvement. These cases emphasize that current<br />

understanding <strong>of</strong> spleen abscess etiology is still limited,<br />

and a study f<strong>or</strong> additional risk fact<strong>or</strong>s may be necessary.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Spleen; Abscess; Splenectomy; Infections;<br />

Trauma<br />

Peer reviewer: Ronan A Cahill, Dr, Department <strong>of</strong> General<br />

Surgery, Waterf<strong>or</strong>d Regional Hospital, Waterf<strong>or</strong>d, C<strong>or</strong>k, Ireland<br />

Fotiadis C, Lavranos G, Patapis P, Karatzas G. Abscesses <strong>of</strong><br />

the spleen: Rep<strong>or</strong>t <strong>of</strong> three cases. W<strong>or</strong>ld J Gastroenterol 2008;<br />

14(19): 3088-3091 Available from: URL: http://www.wjgnet.<br />

com/1007-9327/14/3088.asp DOI: http://dx.doi.<strong>or</strong>g/10.3748/<br />

wjg.14.3088<br />

www.wjgnet.com<br />

INTRODUCTION<br />

Abscess <strong>of</strong> the spleen is a rather rare clinical entity. About<br />

600 cases have been described so far in the international<br />

literature [1] . Most <strong>of</strong> these refer to patients with recognized<br />

risk fact<strong>or</strong>s. These include the synchronous presence<br />

<strong>of</strong> conditions that compromise the immune system,<br />

such as endocarditis, diabetes mellitus, congenital <strong>or</strong><br />

acquired immunodeficiency and the administration <strong>of</strong><br />

immunosuppressive medication (e.g. post-transplantation <strong>or</strong><br />

as part <strong>of</strong> the treatment <strong>of</strong> connective tissue dis<strong>or</strong>ders) [2-5] .<br />

Trauma is an additional predisposing fact<strong>or</strong> f<strong>or</strong> splenic<br />

abscesses [6] . Instances <strong>of</strong> splenic abscesses are relatively<br />

increased among intravenous drug addicts. On the other<br />

hand, splenic abscesses are most uncommon in the general<br />

population. From an epidemiological point <strong>of</strong> view, they<br />

are m<strong>or</strong>e frequently detected in middle-aged and older<br />

individuals, with no obvious preference f<strong>or</strong> either sex [1-3] .<br />

The clinical manifestations <strong>of</strong> splenic abscesses<br />

usually include abdominal pain, exclusively located <strong>or</strong>, at<br />

least, m<strong>or</strong>e intensely described in the upper-left-quadrant<br />

area. Fever, nausea, vomiting and an<strong>or</strong>exia may be also<br />

present in various combinations [7-9] . Lab<strong>or</strong>at<strong>or</strong>y findings<br />

are consistent with the acute phase <strong>of</strong> infection, but<br />

their exact nature is determined by the pathogen isolated<br />

from the abscess [10,11] . The most common pathogens<br />

detected include Staphylococcus and Streptococcus [2,12] . Imaging<br />

by common abdominal X-ray <strong>or</strong> ultrasound may be<br />

suggestive, but the lesion is usually revealed via computed<br />

tomography (CT). Due to the seriousness <strong>of</strong> the potential<br />

implications, including a threat to life itself, the most<br />

usual treatment currently applied is splenectomy, which is<br />

followed by rapid clinical improvement [13-15] .<br />

CASE REPORTS<br />

Case 1<br />

A 45-year-old man presented to our hospital’s outpatient<br />

clinic with persistent pain in the upper-left-quadrant area <strong>of</strong><br />

the abdomen. He was w<strong>or</strong>king as a clerk, having previously<br />

spent 10 years as a member <strong>of</strong> embassy personnel in Africa.<br />

The referred pain had initiated about 1 mo previously,<br />

with periods <strong>of</strong> temp<strong>or</strong>ary improvement and relapse. The<br />

pain was not altered after food intake <strong>or</strong> sleep. The patient<br />

recognized no other maj<strong>or</strong> symptoms, such as vomiting,<br />

nausea <strong>or</strong> fever. M<strong>or</strong>eover, the patient was not treated f<strong>or</strong><br />

any other disease at the time (including recent infection <strong>or</strong><br />

operation), n<strong>or</strong> had he ever been admitted to the hospital<br />

in the past. Clinical examination reproduced localized<br />

sensitivity in the area <strong>of</strong> the spleen, with no other significant<br />

findings. Lab<strong>or</strong>at<strong>or</strong>y testing (standard hematological and

---

Fotiadis C et al. Abscesses <strong>of</strong> the spleen 3089<br />

Figure 1 Abdominal<br />

CT scan <strong>of</strong> a 45-yearold<br />

man. The spleen<br />

contained a large<br />

single abscess <strong>of</strong> 8<br />

cm × 4 cm.<br />

Figure 2 Macroscopic image <strong>of</strong> the dissected spleen. Notice the extent <strong>of</strong> the<br />

pathological tissue.<br />

biochemical controls) revealed a mild increase in the<br />

number <strong>of</strong> leukocytes, which was otherwise within the<br />

n<strong>or</strong>mal range. Blood and urine cultures failed to reveal any<br />

pathogens. Imaging included chest and abdominal X-ray,<br />

followed by a CT scan <strong>of</strong> the upper abdomen. The latter<br />

detected a large abscess <strong>of</strong> the spleen, <strong>of</strong> an average size<br />

<strong>of</strong> 8 cm × 4 cm (Figure 1). Aspiration <strong>of</strong> the abscess was<br />

perf<strong>or</strong>med under CT guidance and the material obtained<br />

was cultured, which led to the development <strong>of</strong> several<br />

colonies identified as Streptococcus spp. No other pathogen <strong>of</strong><br />

any kind was detected in the cultures. Owing to the abscess<br />

being symptomatic and <strong>of</strong> considerable size, the decision<br />

to perf<strong>or</strong>m splenectomy was made. The operation was<br />

completed successfully (Figure 2). Follow-up 1 year later has<br />

revealed a completely asymptomatic postoperative period.<br />

Case 2<br />

A 50-year-old woman visited the outpatient clinic <strong>of</strong> our<br />

hospital with referred acute abdominal pain, which was not<br />

related to dietary habits and/<strong>or</strong> sleep. She also rep<strong>or</strong>ted mild<br />

fever f<strong>or</strong> about 1 wk (up to 38.5℃). Pri<strong>or</strong> to surgery, she<br />

had been evaluated by a physician at the internal medicine<br />

clinic, who rep<strong>or</strong>ted no clinical findings other than localized<br />

pain in the left-upper-quadrant area <strong>of</strong> the abdomen. Our<br />

clinical examination verified this finding. The patient had<br />

no hist<strong>or</strong>y <strong>of</strong> recent infection <strong>or</strong> surgery, n<strong>or</strong> had she<br />

received medication <strong>of</strong> any kind. M<strong>or</strong>eover, she did not<br />

suffer from diabetes, human immunodeficiency virus (HIV)<br />

infection, <strong>or</strong> any other condition that would justify a degree<br />

A<br />

B<br />

Figure 3 A: CT scan <strong>of</strong> a<br />

50-year-old woman. The<br />

spleen contained a single<br />

abscess <strong>of</strong> 3 cm × 3 cm;<br />

B: CT scan <strong>of</strong> a 40-yearold<br />

male sail<strong>or</strong>, which<br />

featured multiple splenic<br />

abscesses.<br />

<strong>of</strong> immunosuppression/immunocompromise. Lab<strong>or</strong>at<strong>or</strong>y<br />

testing was perf<strong>or</strong>med, which showed signs <strong>of</strong> on-going<br />

bacterial infection (leukocytosis, increased C-reactive<br />

protein and fibrinogen, and a mild decrease in blood<br />

albumin). Blood and urine cultures failed to reveal microbial<br />

infection. Imaging was also perf<strong>or</strong>med, including th<strong>or</strong>acic<br />

and abdominal X-ray, followed by CT <strong>of</strong> the upper and<br />

lower abdomen. The latter detected a single, small abscess<br />

<strong>of</strong> the spleen <strong>of</strong> 3 cm × 3 cm (Figure 3A). Subsequently,<br />

percutaneous aspiration <strong>of</strong> the lesion was perf<strong>or</strong>med and<br />

the material was sent f<strong>or</strong> culture. The microbiological rep<strong>or</strong>t<br />

referred to the presence <strong>of</strong> Staphylococci, a rather common<br />

finding in splenic abscesses. Due to the symptomatic nature<br />

<strong>of</strong> the lesion, the patient was advised to undergo surgical<br />

treatment, which she accepted. She was operated a week<br />

later and total splenectomy was perf<strong>or</strong>med under general<br />

anesthesia. A follow-up session took place 1 year after<br />

the operation, which revealed complete resolution <strong>of</strong> all<br />

symptoms. The patient has remained asymptomatic ever<br />

since.<br />

Case 3<br />

A 40-year-old male sail<strong>or</strong> visited our hospital as part <strong>of</strong><br />

a yearly check-up, as instructed by his employers. During<br />

a brief review <strong>of</strong> his medical hist<strong>or</strong>y, he mentioned a<br />

persistent chronic pain in the upper-left quadrant <strong>of</strong><br />

the abdomen. The pain was not directly related to food<br />

intake <strong>or</strong> sleep, although it was occasionally combined<br />

with mild episodes <strong>of</strong> nausea and an<strong>or</strong>exia. M<strong>or</strong>eover, the<br />

patient referred to moderate fever (up to 38.8℃) that had<br />

occurred 3-4 times in the past 3 mo, each time lasting f<strong>or</strong><br />

about 3 d, and retreated after the use <strong>of</strong> non-steroidal antiinflammat<strong>or</strong>y<br />

drugs, administered every 6 h. The patient<br />

also had a long hist<strong>or</strong>y <strong>of</strong> infections <strong>of</strong> the respirat<strong>or</strong>y<br />

www.wjgnet.com

---

3090 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

Figure 4 Macroscopic postoperative image <strong>of</strong> the dissected spleen. Abscess<br />

areas are easily recognized.<br />

and gastrointestinal tracts, although he rep<strong>or</strong>ted that all<br />

<strong>of</strong> these had been treated successfully, leaving no remnant<br />

disease. Clinical examination revealed nothing significant,<br />

other than sensitivity in the abdomen, which was m<strong>or</strong>e<br />

intense in the upper-left quadrant. Lab<strong>or</strong>at<strong>or</strong>y findings<br />

were consistent with acute-phase reaction (leukocytosis,<br />

and increased acute-phase proteins). Imaging included<br />

th<strong>or</strong>acic and abdominal X-ray, abdominal ultrasound,<br />

and finally, CT. The latter revealed multiple abscesses in<br />

the spleen (Figure 3B). No abscesses were detected via<br />

imaging in any other <strong>or</strong>gan examined, including the liver.<br />

Cultures from blood and urine samples were negative,<br />

but the sample obtained from the abscesses themselves<br />

developed numerous colonies <strong>of</strong> bacteria identified as<br />

Streptococcus spp. Evaluation <strong>of</strong> the clinical condition,<br />

lab<strong>or</strong>at<strong>or</strong>y and imaging data, as well as pr<strong>of</strong>essional danger<br />

(minimal access to immediate medical referral in case <strong>of</strong><br />

an emergency), led to the decision to perf<strong>or</strong>m splenectomy<br />

(Figure 4). The surgery was completed without any<br />

complications and the patient has been found healthy and<br />

free from all referred symptoms to this date.<br />

DISCUSSION<br />

Abscesses <strong>of</strong> the spleen are rather rare, especially in<br />

developed countries in which the frequency <strong>of</strong> parasitic<br />

infections is low [2,13-17] . From this point <strong>of</strong> view, the random<br />

discovery <strong>of</strong> three such cases in a single Greek hospital<br />

in the course <strong>of</strong> two years may at first appear to signify<br />

an increased incidence. However, this may be misleading,<br />

since our hospital is a tertiary medical referral center<br />

f<strong>or</strong> a densely populated area <strong>of</strong> about 4 million citizens.<br />

M<strong>or</strong>eover, it is closely located to the central p<strong>or</strong>t <strong>of</strong> the<br />

country, Pireaus, which makes access f<strong>or</strong> f<strong>or</strong>eign visit<strong>or</strong>s,<br />

immigrants and Greeks returning from high-prevalence<br />

countries particularly easy [18] . Indeed, in case 3, the subject<br />

was a sail<strong>or</strong> and in case 1, there was a hist<strong>or</strong>y <strong>of</strong> residence<br />

in Africa.<br />

The age <strong>of</strong> the individuals in our small series is 40-50<br />

years, which is consistent with the peak age group f<strong>or</strong><br />

initial diagnosis <strong>of</strong> splenic abscesses described in the<br />

literature [3,4,9,19,20] . However, it should be noted that in all<br />

three cases, medical care was only infrequently demanded<br />

pri<strong>or</strong> to consultation by our department and theref<strong>or</strong>e,<br />

www.wjgnet.com<br />

it might be suggested that the disease evolved over a<br />

considerable time pri<strong>or</strong> to our diagnosis. The personal<br />

hist<strong>or</strong>y <strong>of</strong> long-term presence abroad strengthens this<br />

assumption.<br />

The clinical manifestations, and lab<strong>or</strong>at<strong>or</strong>y and imaging<br />

findings in all three individuals were similar, although<br />

some variety was definitely observed (e.g. presence, height<br />

and duration <strong>of</strong> fever, abdominal pain characteristics<br />

and blood leukocyte count). In fact, all the symptoms<br />

described by the patients are included in the most frequent<br />

clinical findings lists provided by other rep<strong>or</strong>ted studies,<br />

which proves that the current general understanding <strong>of</strong><br />

the disease’s pathophysiology is reasonably accurate [1,10,21] .<br />

Perhaps the most interesting parameter in our three<br />

cases <strong>of</strong> splenic abscess, however, is the lack <strong>of</strong> any<br />

obvious risk fact<strong>or</strong>s in any <strong>of</strong> the individuals [22,23] . Indeed,<br />

a detailed medical hist<strong>or</strong>y and clinical examination were<br />

perf<strong>or</strong>med initially and post-diagnosis, in an attempt to<br />

reveal any <strong>of</strong> the fact<strong>or</strong>s known to be associated with<br />

the development <strong>of</strong> abscesses in the spleen and other<br />

<strong>or</strong>gans. However, no such findings occurred, with the<br />

only exception <strong>of</strong> potential occupational risk in cases<br />

1 and 3. This discovery, along with the detection <strong>of</strong><br />

common pathogens in the abscess itself (Streptococcus<br />

and Staphylococcus spp., respectively), may imply that<br />

further fact<strong>or</strong>s, apart from those already described, must<br />

contribute to the etiology <strong>of</strong> the disease [6,10,24] . Their exact<br />

nature and involvement in immunity modification and<br />

regulation <strong>of</strong> the reaction to infectious agents remains to<br />

be determined in future [20] .<br />

As far as treatment is concerned, our department<br />

proceeded to classic total splenectomy in all three cases<br />

discussed. This led to rapid and complete relief from<br />

all disease-associated symptoms, without any maj<strong>or</strong><br />

complications. This policy is still considered the standard<br />

<strong>of</strong> care f<strong>or</strong> splenic abscesses [1,6] . However, m<strong>or</strong>e recent<br />

studies have also referred to alternative options, including<br />

laparoscopic splenectomy and spleen-preserving protocols,<br />

such as percutaneous imaging-guided drainage [1,15,25,26] .<br />

These methods are minimally invasive and are expected<br />

to result in smaller operative risk and overall treatment<br />

period, although <strong>of</strong> course this may differ acc<strong>or</strong>ding to<br />

the exact cause <strong>of</strong> the abscess [27-31] . Although initial results<br />

from the application <strong>of</strong> these novel methods are most<br />

promising and the potential advantages most welcome,<br />

current experience is still rather limited to justify their<br />

place in splenic abscess treatment. Theref<strong>or</strong>e, the current<br />

policy is to limit their use in centers with adequately trained<br />

surgeons and only f<strong>or</strong> a selected subgroup <strong>of</strong> patients.<br />

REFERENCES<br />

1 Carbonell AM, Kercher KW, Matthews BD, Joels CS, Sing RF,<br />

Henif<strong>or</strong>d BT. Laparoscopic splenectomy f<strong>or</strong> splenic abscess.<br />

Surg Laparosc Endosc Percutan Tech 2004; 14: 289-291<br />

2 Chang KC, Chuah SK, Changchien CS, Tsai TL, Lu SN, Chiu<br />

YC, Chen YS, Wang CC, Lin JW, Lee CM, Hu TH. Clinical<br />

characteristics and prognostic fact<strong>or</strong>s <strong>of</strong> splenic abscess: a<br />

review <strong>of</strong> 67 cases in a single medical center <strong>of</strong> Taiwan. W<strong>or</strong>ld<br />

J Gastroenterol 2006; 12: 460-464<br />

3 Chiang IS, Lin TJ, Chiang IC, Tsai MS. Splenic abscesses:<br />

review <strong>of</strong> 29 cases. Kaohsiung J Med Sci 2003; 19: 510-515

---

Fotiadis C et al. Abscesses <strong>of</strong> the spleen 3091<br />

4 Chulay JD, Lankerani MR. Splenic abscess. Rep<strong>or</strong>t <strong>of</strong> 10 cases<br />

and review <strong>of</strong> the literature. Am J Med 1976; 61: 513-522<br />

5 Kim HS, Cho MS, Hwang SH, Ma SK, Kim SW, Kim NH, Choi<br />

KC. Splenic abscess associated with endocarditis in a patient<br />

on hemodialysis: a case rep<strong>or</strong>t. J K<strong>or</strong>ean Med Sci 2005; 20:<br />

313-315<br />

6 Ulhaci N, Meteoglu I, Kacar F, Ozbas S. Abscess <strong>of</strong> the spleen.<br />

Pathol Oncol Res 2004; 10: 234-236<br />

7 Gadacz T, Way LW, Dunphy JE. Changing clinical spectrum<br />

<strong>of</strong> splenic abscess. Am J Surg 1974; 128: 182-187<br />

8 Green BT. Splenic abscess: rep<strong>or</strong>t <strong>of</strong> six cases and review <strong>of</strong><br />

the literature. Am Surg 2001; 67: 80-85<br />

9 Nelken N, Ignatius J, Skinner M, Christensen N. Changing<br />

clinical spectrum <strong>of</strong> splenic abscess. A multicenter study and<br />

review <strong>of</strong> the literature. Am J Surg 1987; 154: 27-34<br />

10 Cavuoti D, Fogli M, Quinton R, Gander RM, Southern PM.<br />

Splenic abscess with Vibrio cholerae masking pancreatic<br />

cancer. Diagn Microbiol Infect Dis 2002; 43: 311-313<br />

11 Farnsw<strong>or</strong>th TA. Enterococcus avium splenic abscess: a rare<br />

bird. Lancet Infect Dis 2002; 2: 765<br />

12 Zacharoulis D, Katsogridakis E, Hatzithe<strong>of</strong>ilou C. A case<br />

<strong>of</strong> splenic abscess after radi<strong>of</strong>requency ablation. W<strong>or</strong>ld J<br />

Gastroenterol 2006; 12: 4256-4258<br />

13 Smyrniotis V, Kehagias D, V<strong>or</strong>os D, Fotopoulos A, Lambrou<br />

A, Kostopanagiotou G, Kostopanagiotou E, Papadimitriou J.<br />

Splenic abscess. An old disease with new interest. Dig Surg<br />

2000; 17: 354-357<br />

14 Westh H, Reines E, Skibsted L. Splenic abscesses: a review <strong>of</strong><br />

20 cases. Scand J Infect Dis 1990; 22: 569-573<br />

15 Zerem E, Bergsland J. Ultrasound guided percutaneous<br />

treatment f<strong>or</strong> splenic abscesses: The significance in treatment<br />

<strong>of</strong> critically ill patients. W<strong>or</strong>ld J Gastroenterol 2006; 12: 7341-7345<br />

16 Ghidirim G, Rojnoveanu G, Misin I, Gagauz I, Gurghis R.<br />

[Splenic abscess--etiologic, clinical and diagnostic features].<br />

Chirurgia (Bucur) 2007; 102: 309-314<br />

17 Krzyszt<strong>of</strong> L, Krysiak R, Basiak M, Kalina M, Mykala-Ciesla<br />

J, Kolodziej-Jaskula A, Okopien B. [Diagnostic difficulties in<br />

diagnosis <strong>of</strong> splenic abscesses]. Wiad Lek 2007; 60: 83-86<br />

18 Tappe D, Muller A, Langen HJ, Frosch M, Stich A. Isolation <strong>of</strong><br />

Salmonella enterica serotype newp<strong>or</strong>t from a partly ruptured<br />

splenic abscess in a traveler returning from Zanzibar. J Clin<br />

Microbiol 2007; 45: 3115-3117<br />

19 Andre MF, Piette JC, Kemeny JL, Ninet J, Jego P, Delevaux<br />

I, Wechsler B, Weiller PJ, Frances C, Bletry O, Wismans PJ,<br />

Rousset H, Colombel JF, Aumaitre O. Aseptic abscesses: a<br />

study <strong>of</strong> 30 patients with <strong>or</strong> without inflammat<strong>or</strong>y bowel<br />

disease and review <strong>of</strong> the literature. Medicine (Baltim<strong>or</strong>e) 2007;<br />

86: 145-161<br />

20 Rudiger T, Hartmann M, Muller-Hermelink HK, Marx A.<br />

[Inflammat<strong>or</strong>y reactions <strong>of</strong> the spleen]. Pathologe 2008; 29:<br />

121-128<br />

21 Thapa R, Mukherjee K, Chakrabartty S. Splenic abscess as a<br />

complication <strong>of</strong> enteric fever. Indian Pediatr 2007; 44: 438-440<br />

22 Al-Tawfiq JA. Bacteroides (Parabacteroides) distasonis splenic<br />

abscess in a sickle cell patient. Intern Med 2008; 47: 69-72<br />

23 Pisanu A, Ravarino A, Nieddu R, Uccheddu A. Synchronous<br />

isolated splenic metastasis from colon carcinoma and<br />

concomitant splenic abscess: a case rep<strong>or</strong>t and review <strong>of</strong> the<br />

literature. W<strong>or</strong>ld J Gastroenterol 2007; 13: 5516-5520<br />

24 Matsubayashi T, Matsubayashi R, Saito I, Tobayama<br />

S, Machida H. Splenic abscess in an infant caused by<br />

Streptococcus intermedius. J Infect Chemother 2007; 13: 423-425<br />

25 Martinez DG, Sanchez AW, Garcia AP. Splenic abscess after<br />

laparoscopic nissen fundoplication: a consequence <strong>of</strong> sh<strong>or</strong>t<br />

gastric vessel division. Surg Laparosc Endosc Percutan Tech 2008;<br />

18: 82-85<br />

26 Kogo H, Yoshida H, Mamada Y, Taniai N, Bando K,<br />

Mizuguchi Y, Ishikawa Y, Yokomuro S, Akimaru K, Tajiri<br />

T. Successful percutaneous ultrasound-guided drainage f<strong>or</strong><br />

treatment <strong>of</strong> a splenic abscess. J Nippon Med Sch 2007; 74:<br />

257-260<br />

27 Hasan M, Sarwar JM, Bhuiyan JH, Islam SM. Tubercular<br />

splenic abscess. Mymensingh Med J 2008; 17: 67-69<br />

28 Agarwal N, Dewan P. Isolated tubercular splenic abscess in an<br />

immunocompetent child. Trop Gastroenterol 2007; 28: 83-84<br />

29 Sharma SK, Smith-Rohrberg D, Tahir M, Mohan A, Seith<br />

A. Radiological manifestations <strong>of</strong> splenic tuberculosis: a<br />

23-patient case series from India. Indian J Med Res 2007; 125:<br />

669-678<br />

30 Rechner J, Nowak L, Hess F, Mebold A, De L<strong>or</strong>enzi D. [A rare<br />

splenic involvement by Echinococcus multilocularis - case<br />

rep<strong>or</strong>t]. Zentralbl Chir 2007; 132: 158-160<br />

31 Jabr FI, Skeik N. Splenic abscess caused by actinomycosis.<br />

Intern Med 2007; 46: 1943-1944<br />

S- Edit<strong>or</strong> Zhong XY L- Edit<strong>or</strong> Kerr C E- Edit<strong>or</strong> Ma WH<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3092-3094<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

CASE REPORT<br />

Hepatic cyst misdiagnosed as a gastric submucosal tum<strong>or</strong>: A<br />

case rep<strong>or</strong>t<br />

Joong-Min Park, Jin Kim, Ho-Il Kim, Chong-Suk Kim<br />

Joong-Min Park, Jin Kim, Ho-Il Kim, Chong-Suk Kim,<br />

Department <strong>of</strong> Surgery, K<strong>or</strong>ea University College <strong>of</strong> Medicine,<br />

K<strong>or</strong>ea University Anam Hospital, 126-1 Anam-dong 5ga,<br />

Sungbuk-gu, Seoul 136-705, South K<strong>or</strong>ea<br />

Auth<strong>or</strong> contributions: Park JM, Kim J, Kim HI and Kim CS<br />

contributed equally to this w<strong>or</strong>k.<br />

C<strong>or</strong>respondence to: Chong-Suk Kim, Department <strong>of</strong> Surgery,<br />

K<strong>or</strong>ea University Anam Hospital, 126-1 Anam-dong 5ga,<br />

Sungbuk-gu, Seoul 136-705, South K<strong>or</strong>ea. chongsuk@k<strong>or</strong>ea.ac.kr<br />

Telephone: +82-2-9205866 Fax: +82-2-9281631<br />

Received: February 17, 2008 Revised: April 17, 2008<br />

Abstract<br />

We describe here a case <strong>of</strong> 51-year-old woman with<br />

a symptomatic hepatic cyst that was misdiagnosed as<br />

a gastric submucosal tum<strong>or</strong> (SMT) with endoscopic<br />

ultrasound (EUS) and CT scan. The patient presented<br />

with an epigastric pain f<strong>or</strong> two months. On endoscopy,<br />

a submucosal tum<strong>or</strong> was found on the cardia <strong>of</strong> the<br />

stomach. Based on EUS and abdominal CT scan, the<br />

lesion was diagnosed as a gastric duplication cyst <strong>or</strong> a<br />

gastrointestinal stromal tum<strong>or</strong> (GIST). The operative<br />

plan was laparoscopic wedge resection f<strong>or</strong> the GIST <strong>of</strong><br />

the gastric cardia. A cystic mass arising from the left<br />

lateral segment <strong>of</strong> the liver was found at the laparoscopic<br />

examination. There was no abn<strong>or</strong>mal finding at the<br />

gastric cardia. She was treated by laparoscopic hepatic<br />

wedge resection including the hepatic cyst using an<br />

endoscopic linear stapler.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Hepatic cyst; Submucosal tum<strong>or</strong>; Stomach<br />

Peer reviewer: Filip Braet, Associate Pr<strong>of</strong>ess<strong>or</strong>, Australian Key<br />

Centre f<strong>or</strong> Microscopy and Microanalysis, Madsen Building (F09),<br />

The University <strong>of</strong> Sydney, Sydney NSW 2006, Australia<br />

Park JM, Kim J, Kim HI, Kim CS. Hepatic cyst misdiagnosed as<br />

a gastric submucosal tum<strong>or</strong>: A case rep<strong>or</strong>t. W<strong>or</strong>ld J Gastroenterol<br />

2008; 14(19): 3092-3094 Available from: URL: http://www.wjgnet.com/1007-9327/14/3092.asp<br />

DOI: http://dx.doi.<strong>or</strong>g/10.3748/<br />

wjg.14.3092<br />

INTRODUCTION<br />

Although submucosal tum<strong>or</strong> (SMT) is benign and<br />

www.wjgnet.com<br />

asymptomatic, it should be evaluated by follow-up<br />

examinations. Certain gastric SMTs that are considered to<br />

be gastrointestinal stromal tum<strong>or</strong> (GIST) <strong>or</strong> symptomatic<br />

SMT require operative intervention because it is very<br />

difficult to confirm its malignant potential with endoscopic<br />

biopsy [1] .<br />

SMT is usually asymptomatic and most <strong>of</strong>ten<br />

discovered accidentally at surgery and autopsy <strong>or</strong> at<br />

perf<strong>or</strong>ming diagnostic procedures. Unspecific symptoms,<br />

such as abdominal pain, obstruction, hem<strong>or</strong>rhage and<br />

intussusception, may occur. Two advanced tools have<br />

been generally accepted f<strong>or</strong> the diagnosis and treatment <strong>of</strong><br />

gastric SMTs. Endoscopic ultrasound (EUS) is one useful<br />

accurate diagnostic method, and the other is a laparoscopic<br />

procedure that allows minimally invasive treatment f<strong>or</strong><br />

SMTs.<br />

Extragastric compression may mimic the symptoms<br />

and endoscopic findings <strong>of</strong> gastric SMTs. EUS and CT<br />

scan can accurately differentiate extragastric compression<br />

from true SMTs. However, cases may arise that cannot<br />

be differentiated even after various methods are used. We<br />

rep<strong>or</strong>t here a case <strong>of</strong> hepatic cyst which was misdiagnosed<br />

as a gastric submucosal tum<strong>or</strong> in a patient undergone<br />

various diagnostic modalities, including endoscopy, EUS<br />

and abdominal CT scan.<br />

Case RepORT<br />

A 51-year-old woman presented with epigastric pain f<strong>or</strong><br />

two months. Initial examination showed that she had<br />

tenderness in the epigastrium. The patient was taking no<br />

medications. Her past medical hist<strong>or</strong>y and familial hist<strong>or</strong>y<br />

were unremarkable. Routine lab<strong>or</strong>at<strong>or</strong>y data on admission<br />

did not show any abn<strong>or</strong>mal findings.<br />

Gastrointestinal endoscopy revealed a submucosal<br />

tum<strong>or</strong> in the cardia <strong>of</strong> the stomach (Figure 1). On EUS,<br />

the lesion was a hypoechoic mass (3.6 cm in diameter)<br />

suggestive <strong>of</strong> a gastric duplication cyst <strong>or</strong> a GIST<br />

(Figure 2). Abdominal CT scan showed a cystic lesion<br />

at the submucosal layer <strong>of</strong> the gastric cardia, and the<br />

impression <strong>of</strong> the radiologist was a gastric duplication cyst<br />

<strong>or</strong> a GIST with necrosis (Figure 3). The operative plan was<br />

laparoscopic wedge resection f<strong>or</strong> the GIST <strong>of</strong> the gastric<br />

cardia. Laparoscopic expl<strong>or</strong>ation was perf<strong>or</strong>med f<strong>or</strong> the<br />

patient under general anesthesia. On the laparoscopic<br />

examination, a cystic mass arising from the left lateral<br />

segment <strong>of</strong> the liver was found (Figure 4A). There<br />

was no abn<strong>or</strong>mal finding at the gastric cardia. After the

---

Park JM et al . Hepatic cyst misdiagnosed as a gastric SMT 3093<br />

Figure 1 Endoscopic photograph demonstrating a protruding mass on the<br />

cardia <strong>of</strong> stomach.<br />

triangular ligament was divided with electrocautery<br />

(Figure 4B), wedge resection <strong>of</strong> the left lateral segment <strong>of</strong><br />

the liver, including the hepatic cyst, was perf<strong>or</strong>med using<br />

an endoscopic linear stapler (Figure 4C and D). There was<br />

no specific complication during the procedure. An <strong>or</strong>al<br />

diet was permitted on the 1st postoperative day. She was<br />

discharged from the hospital on the 3rd postoperative day.<br />

The mass was diagnosed as a simple hepatic cyst.<br />

DIsCUssION<br />

Figure 2 EUS showing<br />

a hypoechoic mass<br />

(3.6 cm in diameter)<br />

which was suspicious<br />

<strong>of</strong> a gastric duplication<br />

cyst <strong>or</strong> a GIST.<br />

Hepatic cysts are usually asymptomatic and not associated<br />

with defective hepatic function. They are incidentally<br />

found at laparotomy <strong>or</strong> laparoscopy, and even at routine<br />

ultrasound <strong>or</strong> CT scan. However, they may become<br />

symptomatic if they grow. The symptoms depend on<br />

the size and location <strong>of</strong> the cyst. The patients may have<br />

a vague upper abdominal pain, a right upper quadrant<br />

abdominal mass, postprandial fullness, dyspnea and<br />

vomiting [2] . In our case, the hepatic cyst was located at the<br />

edge <strong>of</strong> the left lateral segment <strong>of</strong> the liver and caused<br />

epigastric pain by compressing the gastric cardia.<br />

A left hepatic cyst may rarely mimic a SMT arising<br />

from the gastric cardia <strong>or</strong> fundus [3] . Various conditions can<br />

mimic gastric SMT due to extragastric compression. The<br />

most common source <strong>of</strong> extraluminal compression in the<br />

stomach is from the spleen and splenic vessels [4,5] . Other<br />

sources <strong>of</strong> extraluminal compression include n<strong>or</strong>mal<br />

abdominal <strong>or</strong>gan structures such as liver and gallbladder,<br />

Figure 3 Abdominal CT scan showing a low density lesion in the submucosal<br />

layer <strong>of</strong> the gastric cardia (arrow).<br />

A<br />

Lv<br />

C<br />

Cs<br />

St<br />

Figure 4 Operative procedures f<strong>or</strong> the hepatic cyst in the left lateral segment<br />

<strong>of</strong> liver (A), after dissection <strong>of</strong> the triangular ligament (B), liver wedge resection<br />

using an endoscopic linear stapler (C, D). Lv: Liver, Cs: Hepatic cyst, St:<br />

Stomach.<br />

and pathologic lesions such as tum<strong>or</strong>s, abscesses,<br />

pancreatic pseudocysts and enlarged lymph nodes.<br />

Whether the lesion is due to intramural <strong>or</strong> extrinsic<br />

compression can be distinguished by changing the<br />

patient’s position to see if the location and appearance<br />

<strong>of</strong> the mass change. Also, a change in appearance <strong>of</strong> the<br />

mass with either air insufflation <strong>or</strong> deflation is helpful in<br />

determining if the lesion is due to extrinsic compression,<br />

yet it can be difficult to differentiate. It was rep<strong>or</strong>ted that<br />

the sensitivity and specificity <strong>of</strong> endoscopy are 87% and<br />

29%, respectively f<strong>or</strong> distinguishing intramural lesion<br />

from extramural compression [6] . On the other hand,<br />

EUS is 100% accurate f<strong>or</strong> differentiating extragastric<br />

compression from submucosal tum<strong>or</strong> and f<strong>or</strong> identifying<br />

the compressing <strong>or</strong>gan [7] .<br />

In our case, however, the hepatic cyst was misdiagnosed<br />

as a GIST although various diagnostic methods such as<br />

EUS and CT scan were used.<br />

In the best <strong>of</strong> our knowledge, this is the first rep<strong>or</strong>t<br />

<strong>of</strong> a patient with asymptomatic left hepatic cyst that was<br />

misdiagnosed as a GIST and treated by laparoscopic<br />

resection <strong>of</strong> the hepatic cyst.<br />

Surgical treatment f<strong>or</strong> hepatic cyst is indicated when<br />

the cyst causes complaints and the diameter is at least 5 cm<br />

B<br />

D<br />

Lv<br />

www.wjgnet.com

---

3094 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

<strong>or</strong> rapid growth is observed. Possible surgical treatments<br />

<strong>of</strong> the cyst include unro<strong>of</strong>ing, extirpation <strong>or</strong> resection <strong>of</strong><br />

the cyst. Conservative treatment (aspiration, sclerotherapy<br />

and percutaneous drainage) is not <strong>of</strong>ten recommended<br />

because <strong>of</strong> frequent relapse <strong>of</strong> the disease [2,8] .<br />

With the advances in minimally invasive surgery,<br />

laparoscopic unro<strong>of</strong>ing is generally recommended f<strong>or</strong> the<br />

treatment <strong>of</strong> hepatic cyst [8] . In our case, since the cyst was<br />

located at the left edge <strong>of</strong> the liver and relatively small,<br />

laparoscopic wedge resection <strong>of</strong> the hepatic cyst was easily<br />

perf<strong>or</strong>med by using an endoscopic linear stapler.<br />

In conclusion, a left hepatic cyst may mimic a SMT arising<br />

from the gastric cardia and cause nonspecific abdominal<br />

symptoms. F<strong>or</strong> such a case, laparoscopic procedure is a useful<br />

option f<strong>or</strong> making the accurate diagnosis, and laparoscopic<br />

resection <strong>of</strong> the hepatic cyst is a minimally invasive treatment.<br />

RefeReNCes<br />

1 Ponsaing LG, Hansen MB. Therapeutic procedures f<strong>or</strong><br />

submucosal tum<strong>or</strong>s in the gastrointestinal tract. W<strong>or</strong>ld J<br />

www.wjgnet.com<br />

Gastroenterol 2007; 13: 3316-3322<br />

2 Caetano-Juni<strong>or</strong> EM, Linhares MM, Matos D, Schraibman V,<br />

Matone J, Saad SS. Laparoscopic management <strong>of</strong> hepatic cysts.<br />

Surg Laparosc Endosc Percutan Tech 2006; 16: 68-72<br />

3 Park SS, Ryu WS, Kwak JM, Lee SI, Kim WB, Mok YJ, Choi<br />

JW, Park JJ, Bak YT. Gastric fundus impression caused by a<br />

hepatic cyst mimicking gastric submucosal tum<strong>or</strong>. South Med J<br />

2006; 99: 902-903<br />

4 Hwang JH, Kimmey MB. The incidental upper gastrointestinal<br />

subepithelial mass. Gastroenterology 2004; 126: 301-307<br />

5 Rosch T, L<strong>or</strong>enz R, von Wichert A, Classen M. Gastric fundus<br />

impression caused by splenic vessels: detection by endoscopic<br />

ultrasound. Endoscopy 1991; 23: 85-87<br />

6 Rosch T, Kapfer B, Will U, Baronius W, Strobel M, L<strong>or</strong>enz R,<br />

Ulm K. Accuracy <strong>of</strong> endoscopic ultrasonography in upper<br />

gastrointestinal submucosal lesions: a prospective multicenter<br />

study. Scand J Gastroenterol 2002; 37: 856-862<br />

7 Motoo Y, Okai T, Ohta H, Satomura Y, Watanabe H,<br />

Yamakawa O, Yamaguchi Y, Mouri I, Sawabu N. Endoscopic<br />

ultrasonography in the diagnosis <strong>of</strong> extraluminal compressions<br />

mimicking gastric submucosal tum<strong>or</strong>s. Endoscopy 1994; 26:<br />

239-242<br />

8 Szabo LS, Takacs I, Arkosy P, Sapy P, Szentkereszty Z.<br />

Laparoscopic treatment <strong>of</strong> nonparasitic hepatic cysts. Surg<br />

Endosc 2006; 20: 595-597<br />

S- Edit<strong>or</strong> Zhong XY L- Edit<strong>or</strong> Wang XL E- Edit<strong>or</strong> Lu W

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3095-3097<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

A<strong>or</strong>toduodenal fistula and a<strong>or</strong>tic aneurysm secondary to<br />

biliary stent-induced retroperitoneal perf<strong>or</strong>ation<br />

Tae Hoon Lee, Do Hyun Park, Ji-Young Park, Suck-Ho Lee, Il-Kwun Chung, Hong Soo Kim, Sang-Heum Park,<br />

Sun-Joo Kim<br />

Tae Hoon Lee, Ji-Young Park, Suck-Ho Lee, Il-Kwun<br />

Chung, Hong Soo Kim, Sang-Heum Park, Sun-Joo Kim,<br />

Division <strong>of</strong> Gastroenterology, Department <strong>of</strong> Internal Medicine,<br />

Soonchunhyang University College <strong>of</strong> Medicine, Cheonan<br />

Hospital, 23-20 Bongmyung-dong, Cheonan, Choongnam<br />

330-721, South K<strong>or</strong>ea<br />

Do Hyun Park, Division <strong>of</strong> Gastroenterology, Department <strong>of</strong><br />

Internal Medicine, University <strong>of</strong> Ulsan College <strong>of</strong> Medicine, Asan<br />

Medical Center, 388-1 Pungnap-2dong, Songpagu, Seoul 138-736,<br />

South K<strong>or</strong>ea<br />

Auth<strong>or</strong> contributions: Lee TH and Park DH contributed equally<br />

to this w<strong>or</strong>k; Park JY, Lee SH, Chung IK and Kim HS provided<br />

the clinical advice; Park DH, Park SH and Kim SJ designed the<br />

case rep<strong>or</strong>t; Lee TH and Park DH wrote the paper.<br />

C<strong>or</strong>respondence to: Do Hyun Park, Division <strong>of</strong> Gastroenterology,<br />

Department <strong>of</strong> Internal Medicine, University <strong>of</strong> Ulsan<br />

College <strong>of</strong> Medicine, Asan Medical Center, 388-1 Pungnap-<br />

2dong, Songpagu, Seoul 138-736,<br />

South K<strong>or</strong>ea. dhpark@amc.seoul.kr<br />

Telephone: +82-2-30103180 Fax: +82-2-4855782<br />

Received: February 14, 2008 Revised: April 8, 2008<br />

Abstract<br />

Duodenal perf<strong>or</strong>ations caused by biliary prostheses are<br />

not uncommon, and they are potentially life threatening<br />

and require immediate treatment. We describe an<br />

unusual case <strong>of</strong> a<strong>or</strong>tic aneurysm and rupture which<br />

occurred after retroperitoneal a<strong>or</strong>toduodenal fistula<br />

f<strong>or</strong>mation as a rare complication caused by biliary<br />

metallic stent-related duodenal perf<strong>or</strong>ation. To our<br />

knowledge, this is the first rep<strong>or</strong>t describing a lethal<br />

complication <strong>of</strong> a bleeding, a<strong>or</strong>toduodenal fistula and<br />

caused by biliary metallic stent-induced perf<strong>or</strong>ation.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Stents; Retroperitoneal perf<strong>or</strong>ation; A<strong>or</strong>tic<br />

aneurysm; Fistula<br />

Peer reviewer: Giovanni D De Palma, Pr<strong>of</strong>ess<strong>or</strong>, Department<br />

<strong>of</strong> Surgery and Advanced Technologies, University <strong>of</strong> Naples<br />

Federico II, School <strong>of</strong> Medicine, Naples 80131, Italy<br />

Lee TH, Park DH, Park JY, Lee SH, Chung IK, Kim HS, Park<br />

SH, Kim SJ. A<strong>or</strong>toduodenal fistula and a<strong>or</strong>tic aneurysm secondary<br />

to biliary stent-induced retroperitoneal perf<strong>or</strong>ation. W<strong>or</strong>ld J<br />

Gastroenterol 2008; 14(19): 3095-3097 Available from: URL:<br />

http://www.wjgnet.com/1007-9327/14/3095.asp DOI: http://<br />

dx.doi.<strong>or</strong>g/10.3748/wjg.14.3095<br />

INTRODUCTION<br />

CASE REPORT<br />

Endoscopic <strong>or</strong> percutaneous biliary stenting is the preferred<br />

method <strong>of</strong> palliative treatment f<strong>or</strong> malignant biliary<br />

strictures [1-4] . As the stents are used frequently and f<strong>or</strong> long<br />

periods <strong>of</strong> time, biliary stent-related duodenal perf<strong>or</strong>ation<br />

is not an uncommon complication, which is potentially life<br />

threatening [5-9] . Biliary metallic stent-induced retroperitoneal<br />

perf<strong>or</strong>ation resulting in a<strong>or</strong>toduodenal fistula has not<br />

been rep<strong>or</strong>ted as yet. To our knowledge, this is the first rep<strong>or</strong>t<br />

describing the lethal complication <strong>of</strong> a bleeding a<strong>or</strong>toduodenal<br />

fistula following biliary metallic stent-related<br />

duodenal perf<strong>or</strong>ation.<br />

CASE REPORT<br />

A 69-year-old woman presented herself with symptoms<br />

<strong>of</strong> abdominal pain and melena that started to w<strong>or</strong>sen 2 d<br />

<strong>or</strong> 3 d bef<strong>or</strong>e. An uncovered biliary wall stent (Boston<br />

Scientific, Marlb<strong>or</strong>o, MA), 5 cm in length, was inserted two<br />

years bef<strong>or</strong>e when the patient was diagnosed with a locally<br />

advanced pancreatic cancer. One year later, endoscopic removal<br />

<strong>of</strong> the uncovered wall stent was attempted because<br />

<strong>of</strong> stent clogging and tum<strong>or</strong> ingrowth. However, the attempt<br />

was unsuccessful, and resulted in a partial def<strong>or</strong>mity<br />

<strong>of</strong> the distal end <strong>of</strong> the stent. A covered biliary wall stent,<br />

6 cm in length, was reinserted into the stent. The patient<br />

received gemcitabine chemotherapy f<strong>or</strong> 2 mo and recently<br />

took analgesics. She also frequently received folk remedies,<br />

such as massage <strong>of</strong> the epigastrium with downward palmpressure.<br />

Upon presentation, clinical examination revealed mild<br />

epigastric tenderness and abdominal distension without rebound<br />

tenderness. Lab<strong>or</strong>at<strong>or</strong>y tests showed 21.88 × 10 9 /L<br />

(4.0-10.8 × 10 9 /L) white blood cells, 8.5 g/dL (13-18 g/dL)<br />

hemoglobin, 36 IU/L (60-160 IU/L) amylase, 10 IU/L<br />

(0-60 IU/L) lipase, and 152 IU/L (39-117 IU/L) alkaline<br />

phosphatase. Comparisons <strong>of</strong> two simple abdominal<br />

X-rays, one taken recently and the other 2 mo bef<strong>or</strong>e,<br />

found that the stents were slightly migrated distally and<br />

the outer stent’s distal tip was compressed, shooting out<br />

radially in all directions (Figure 1). Abdominal computer<br />

tomography (CT) scan demonstrated a biliary stent with<br />

lesions arising from the head <strong>of</strong> the pancreas, compressing<br />

the second part <strong>of</strong> the duodenum. Air bubble densities<br />

were traced from the pancreatic head to the lower paraa<strong>or</strong>tic<br />

lesions (Figure 2).<br />

An endoscopy demonstrated that the bare metal<br />

www.wjgnet.com

---

Figure 1 Simple abdomen examination demonstrating compression <strong>of</strong><br />

def<strong>or</strong>med distal tip <strong>of</strong> the outer biliary metallic stent shooting out radially in all<br />

directions.<br />

A<br />

3096 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

barbs def<strong>or</strong>med in the stent were seen to have impacted<br />

and penetrated the neighb<strong>or</strong>ing wall <strong>of</strong> the duodenum.<br />

Following removal <strong>of</strong> the stents with a rat-tooth f<strong>or</strong>ceps<br />

without any additional injury, a circular hole with<br />

bleeding c<strong>or</strong>responding to the perf<strong>or</strong>ation was evident<br />

(Figure 3). We then planned to place a covered self-expandable<br />

metal stent into the duodenum, instead <strong>of</strong> placing a<br />

nasobiliary drainage f<strong>or</strong> a sh<strong>or</strong>t time due to desaturation<br />

and instability <strong>of</strong> the patient. After removal <strong>of</strong> the stent<br />

and treatment with parenteral nutrition and intravenous<br />

antibiotics, the patient felt well with no abdominal pain.<br />

However, 3 d later, she complained again <strong>of</strong> abdominal<br />

B<br />

Figure 2 Abdominal CT scan showing biliary metallic stents with a lesion arising<br />

from the pancreatic head and the traject<strong>or</strong>y <strong>of</strong> air bubble densities traced from the<br />

pancreatic head to the lower paraa<strong>or</strong>tic lesions.<br />

Figure 3 EGD. A: On previous admission (one year ago), placement <strong>of</strong> a stent into a stent due to clogging; B: On the present admission, a circular hole with bleeding (arrow)<br />

caused by stent-induced perf<strong>or</strong>ation following removal <strong>of</strong> stents; C: Retrieved biliary metallic stents showing def<strong>or</strong>med barbs <strong>of</strong> the uncovered wall stent tip on the distal<br />

p<strong>or</strong>tion <strong>of</strong> the covered wall stent.<br />

A B<br />

www.wjgnet.com<br />

C<br />

pain and melena. So a follow-up abdominal CT was perf<strong>or</strong>med,<br />

which showed decreased air densities in the same<br />

area. However, a newly developed circular contrast collecting<br />

a<strong>or</strong>tic aneurysm was found in the adjacent para-a<strong>or</strong>tic<br />

lesion (Figure 4). On the following day, unexpected and<br />

massive hematemesis and hematochezia occurred, and the<br />

patient died due to bleeding.<br />

DISCUSSION<br />

F i g u r e 4 A b d o m i n a l C T s c a n<br />

showing decreased air densities in the<br />

pancreatic head to the paraa<strong>or</strong>tic area<br />

(A) and a circular contrast collecting<br />

aneurysm <strong>of</strong> a<strong>or</strong>ta (B).<br />

Early occurrence <strong>of</strong> iatrogenic duodenal perf<strong>or</strong>ations is<br />

generally apparent during papillotomy and stent placement.

---

Lee TH et al . Biliary stent-induced retroperitoneal perf<strong>or</strong>ation 3097<br />

Late presentations <strong>of</strong> duodenal perf<strong>or</strong>ations caused by biliary<br />

prosthesis are much rarer, but they are potentially life<br />

threatening and require immediate management [10-12] .<br />

Although the uncovered wall stent is easily embedded<br />

in the bile duct epithelium [13,14] , the prolonged in situ uncovered<br />

wall stent may lose its framew<strong>or</strong>k, causing the stent<br />

to become weak because <strong>of</strong> its woven structures. In the<br />

present case, the stent’s distal end was partially destroyed<br />

by repeated tries to remove it and it might have migrated<br />

distally during the follow-up. Under these circumstances,<br />

with repeated external abdominal pressure, the inner covered<br />

stent might have acted on the distal tip <strong>of</strong> the outer<br />

uncovered wall stent as a vehicle with a straining and compressing<br />

f<strong>or</strong>ce. These fact<strong>or</strong>s are believed to have increased<br />

the intensity <strong>of</strong> trauma to the adjacent duodenal wall. Consequently,<br />

the def<strong>or</strong>med wire barbs <strong>of</strong> the outer wall stent’s<br />

distal tip caused stent-induced retroperitoneal perf<strong>or</strong>ation<br />

and fistula.<br />

The mainstays <strong>of</strong> treatment f<strong>or</strong> early perf<strong>or</strong>ations without<br />

systemic upset are nasogastric suction, antibiotics,<br />

bowel rest and parenteral nutrition [15] . Our patient received<br />

conservative treatment and improved after stent removal.<br />

However, the patient suddenly bled to death due to the onset<br />

<strong>of</strong> an a<strong>or</strong>tic aneurysm, the a<strong>or</strong>tic wall might have been<br />

eroded as a result <strong>of</strong> retroperitoneal para-a<strong>or</strong>tic irritation<br />

<strong>or</strong> inflammation through the fistula.<br />

In summary, we can learn some lessons from this case.<br />

One is that stent-induced late perf<strong>or</strong>ation and related lethal<br />

complications may develop as a result <strong>of</strong> a distally migrated<br />

uncovered stent with sharp distal barbs and def<strong>or</strong>mity<br />

caused by repeated stent removal trials and external abdominal<br />

pressure. The other is that early diagnosis and management<br />

are essential to prevent significant complications.<br />

REFERENCES<br />

1 Saranga Bharathi R, Rao P, Ghosh K. Iatrogenic duodenal<br />

perf<strong>or</strong>ations caused by endoscopic biliary stenting and stent<br />

migration: an update. Endoscopy 2006; 38: 1271-1274<br />

2 Maire F, Hammel P, Ponsot P, Aubert A, O'Toole D, Hentic<br />

O, Levy P, Ruszniewski P. Long-term outcome <strong>of</strong> biliary<br />

and duodenal stents in palliative treatment <strong>of</strong> patients with<br />

unresectable adenocarcinoma <strong>of</strong> the head <strong>of</strong> pancreas. Am J<br />

Gastroenterol 2006; 101: 735-742<br />

3 Mutignani M, Tringali A, Costamagna G. Therapeutic biliary<br />

endoscopy. Endoscopy 2004; 36: 147-159<br />

4 Fogel EL, McHenry L, Sherman S, Watkins JL, Lehman GA.<br />

Therapeutic biliary endoscopy. Endoscopy 2005; 37: 139-145<br />

5 Humar A, Barron PT, Sekar AS, Lum A. Pancreatitis and<br />

duodenal perf<strong>or</strong>ation as complications <strong>of</strong> an endoscopically<br />

placed biliary stent. Gastrointest Endosc 1994; 40: 365-366<br />

6 Sanchez-Tembleque MD, Naranjo Rodriguez A, Ruiz M<strong>or</strong>ales<br />

R, Hervas Molina AJ, Calero Ayala B, de Dios Vega JF.<br />

[Duodenal perf<strong>or</strong>ation due to an endoscopic biliary prosthesis]<br />

Gastroenterol Hepatol 2005; 28: 225-227<br />

7 Novacek G, H<strong>or</strong>mann M, Puig S, Herbst F, Puspok A,<br />

Schöfl R. Duodenal perf<strong>or</strong>ation secondary to placement <strong>of</strong><br />

a biliary endoprosthesis diagnosed by multislice computed<br />

tomography. Endoscopy 2002; 34: 351<br />

8 Roses LL, Ramirez AG, Seco AL, Blanco ES, Alonso DI, Avila S,<br />

Lopez BU. Clip closure <strong>of</strong> a duodenal perf<strong>or</strong>ation secondary to<br />

a biliary stent. Gastrointest Endosc 2000; 51: 487-489<br />

9 Fi<strong>or</strong>i E, Mazzoni G, Galati G, Lutzu SE, Cesare A, Bononi M,<br />

Bolognese A, Tocchi A. Unusual breakage <strong>of</strong> a plastic biliary<br />

endoprosthesis causing an enterocutaneous fistula. Surg<br />

Endosc 2002; 16: 870<br />

10 Martin DF, Tweedle DE. Retroperitoneal perf<strong>or</strong>ation during<br />

ERCP and endoscopic sphincterotomy: causes, clinical features<br />

and management. Endoscopy 1990; 22: 174-175<br />

11 Enns R, Eloubeidi MA, Mergener K, Jowell PS, Branch MS,<br />

Pappas TM, Baillie J. ERCP-related perf<strong>or</strong>ations: risk fact<strong>or</strong>s<br />

and management. Endoscopy 2002; 34: 293-298<br />

12 Paikos D, Gatopoulou A, Moschos J, Soufleris K, Tarpagos A,<br />

Katsos I. Migrated biliary stent predisposing to fatal ERCPrelated<br />

perf<strong>or</strong>ation <strong>of</strong> the duodenum. J Gastrointestin Liver Dis<br />

2006; 15: 387-388<br />

13 Park do H, Kim MH, Choi JS, Lee SS, Seo DW, Kim JH,<br />

Han J, Kim JC, Choi EK, Lee SK. Covered versus uncovered<br />

wallstent f<strong>or</strong> malignant extrahepatic biliary obstruction: a<br />

coh<strong>or</strong>t comparative analysis. Clin Gastroenterol Hepatol 2006; 4:<br />

790-796<br />

14 Yoon WJ, Lee JK, Lee KH, Lee WJ, Ryu JK, Kim YT, Yoon<br />

YB. A comparison <strong>of</strong> covered and uncovered Wallstents<br />

f<strong>or</strong> the management <strong>of</strong> distal malignant biliary obstruction.<br />

Gastrointest Endosc 2006; 63: 996-1000<br />

15 Putcha RV, Burdick JS. Management <strong>of</strong> iatrogenic perf<strong>or</strong>ation.<br />

Gastroenterol Clin N<strong>or</strong>th Am 2003; 32: 1289-1309<br />

S- Edit<strong>or</strong> Zhong XY L- Edit<strong>or</strong> Wang XL E- Edit<strong>or</strong> Lu W<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3098-3100<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

CASE REPORT<br />

Tuberculous lymphadenitis as a cause <strong>of</strong> obstructive jaundice:<br />

A case rep<strong>or</strong>t and literature review<br />

Radoje Colovic, Nikica Grub<strong>or</strong>, Rada Jesic, Marjan Micev, Tanja Jovanovic, Natasa Colovic, Henry Dushan Atkinson<br />

Radoje Colovic, Nikica Grub<strong>or</strong>, Rada Jesic, Marjan Micev,<br />

Natasa Colovic, Institute f<strong>or</strong> Digestive Diseases, First Surgical<br />

Clinic, Clinical Center <strong>of</strong> Serbia, Belgrade 11000, Serbia<br />

Tanja Jovanovic, Institute <strong>of</strong> Microbiology, Belgrade School <strong>of</strong><br />

Medicine, Belgrade 11000, Serbia<br />

Henry Dushan Atkinson, Imperial College School <strong>of</strong> Medicine,<br />

St Mary’s Hospital, Praed Street, London W2 1NY, United Kingdom<br />

Auth<strong>or</strong> contributions: Colovic R, Grub<strong>or</strong> N, Jesic R and Colovic<br />

N undertook the surgery and clinical care <strong>of</strong> the patient; Jovanovic<br />

T made PCR analysis; Micev M perf<strong>or</strong>med histopathological<br />

analysis; Colovic R, Atkinson HD, Grub<strong>or</strong> N and Colovic N wrote<br />

the paper.<br />

C<strong>or</strong>respondence to: Nikica Grub<strong>or</strong>, MD, Institute f<strong>or</strong> Digestive<br />

Diseases, First Surgical Clinic, Clinical Center <strong>of</strong> Serbia, Koste<br />

Tod<strong>or</strong>ovica 6, Belgrade 11000, Serbia. ngrub<strong>or</strong>@eunet.yu<br />

Telephone: +381-11-3610715 Fax: +381-11-3615569<br />

Received: January 3, 2008 Revised: March 24, 2008<br />

Abstract<br />

Obstructive jaundice secondary to tuberculosis (TB) is<br />

extremely rare. It can be caused by TB enlargement <strong>of</strong><br />

the head <strong>of</strong> the pancreas, TB lymphadenitis, TB stricture<br />

<strong>of</strong> the biliary tree, <strong>or</strong> a TB mass <strong>of</strong> the retroperitoneum.<br />

A 29-year-old man with no previous hist<strong>or</strong>y <strong>of</strong> TB<br />

presented with abdominal pain, obstructive jaundice,<br />

malaise and weight loss. Ultrasonography (US), computer<br />

tomography (CT) scan and endoscopic retrograde<br />

cholangiopancreatography (ERCP) were suggestive <strong>of</strong><br />

a stenosis <strong>of</strong> the distal common bile duct (CBD) caused<br />

by a mass in the posteri<strong>or</strong> head <strong>of</strong> the pancreas. Tum<strong>or</strong><br />

markers, CEA and CA19-9 were within n<strong>or</strong>mal limits.<br />

At operation, an enlarged, centrally caseous lymph<br />

node <strong>of</strong> the posteri<strong>or</strong> head <strong>of</strong> the pancreas was found,<br />

causing inflammat<strong>or</strong>y stenosis and a fistula with the<br />

distal CBD. The lymph node was removed and the bile<br />

duct resected and anastomosed with the Roux-en Y<br />

jejunal limb. Histology and PCR <strong>based</strong>-assay confirmed<br />

tuberculous lymphadenitis. After an uneventful<br />

postoperative recovery, the patient was treated with<br />

anti-tuberculous medication and remained well 2.5<br />

years later. Though obstructive jaundice secondary<br />

to tuberculous lymphadenitis is rare, abdominal TB<br />

should be considered as a differential diagnosis in<br />

immunocompromised patients and in TB endemic areas.<br />

Any stenosis <strong>or</strong> fistulation into the CBD should also be<br />

taken into consideration, and biliary bypass surgery be<br />

perf<strong>or</strong>med to both relieve jaundice and prevent further<br />

stricture.<br />

© 2008 WJG . All rights reserved.<br />

www.wjgnet.com<br />

Key w<strong>or</strong>ds: Obstructive jaundice; Common bile duct stricture;<br />

Tuberculous lymphadenitis; Surgical excision; Roux en Y<br />

Peer reviewers: William Dickey, Altnagelvin Hospital,<br />

Londonderry, N<strong>or</strong>thern Ireland BT47 6SB, United Kingdom;<br />

Serdar Karakose, Department <strong>of</strong> Radiology, Meram Medical<br />

Faculty, Selcuk University, Konya 42080, Turkey; Qin Su,<br />

Department <strong>of</strong> Pathology, Cancer Hospital and Cancer Institute,<br />

Chinese Academy <strong>of</strong> Medical Sciences and Peking Medical<br />

College, PO Box 2258, Beijing 100021, China<br />

Colovic R, Grub<strong>or</strong> N, Jesic R, Micev M, Jovanovic T, Colovic<br />

N, Atkinson HD. Tuberculous lymphadenitis as a cause <strong>of</strong><br />

obstructive jaundice: A case rep<strong>or</strong>t and literature review. W<strong>or</strong>ld<br />

J Gastroenterol 2008; 14(19): 3098-3100 Available from: URL:<br />

http://www.wjgnet.com/1007-9327/14/3098.asp DOI: http://<br />

dx.doi.<strong>or</strong>g/10.3748/wjg.14.3098<br />

INTRODUCTION<br />

Abdominal tuberculosis (ATB) is rare and obstructive<br />

jaundice caused by tuberculosis (TB) is extremely rare.<br />

ATB can mimic m<strong>or</strong>e common noninfectious abdominal<br />

syndromes and is <strong>of</strong>ten overlooked because <strong>of</strong> its low<br />

incidence. The mechanisms by which ATB causes bile duct<br />

obstruction are varied. We describe a patient with biliary<br />

obstruction caused by enlarged tuberculous lymph nodes.<br />

CASE REPORT<br />

A 29-year-old man presented to our unit with epigastric<br />

pain and tenderness on examination, and jaundice,<br />

steat<strong>or</strong>rhea, malaise and weight loss <strong>of</strong> 7 kg over the<br />

preceding 6 mo. Total bilirubin was 163 µmol/L and<br />

direct bilirubin 88 µmol/L; SGOT, SGPT, gamma GT<br />

and alkaline phosphatase were moderately elevated. Other<br />

lab<strong>or</strong>at<strong>or</strong>y tests including the tum<strong>or</strong> markers CEA and<br />

CA19-9 were all within n<strong>or</strong>mal limits. HBsAg and HCV<br />

were negative. Abdominal ultrasonography (US) revealed a<br />

semi-solid hypoechogenic lesion 39 mm × 40 mm in size<br />

around the head <strong>of</strong> the pancreas, with two enlarged lymph<br />

nodes lying above this, and a common bile duct measuring<br />

10 mm in diameter. Computer tomography (CT) scan<br />

showed a low density mass on the posteri<strong>or</strong> aspect <strong>of</strong> the<br />

head <strong>of</strong> the pancreas with a contrast enhancing solid-rim<br />

(Figure 1). Pancreatography was n<strong>or</strong>mal, however severe<br />

narrowing <strong>of</strong> the distal common bile duct (CBD) was<br />

seen on endoscopic retrograde cholangiopancreatography<br />

(ERCP) (Figure 2A and B).

---

Colovic RB et al . TBC lymphadenitis causing obstructive jaundice 3099<br />

Figure 1 Abdominal CT-scan showing a low density mass on the posteri<strong>or</strong> aspect<br />

<strong>of</strong> the head <strong>of</strong> the pancreas with contrast enhancing solid rim (arrow).<br />

A<br />

Figure 2 A: ERCP with a n<strong>or</strong>mal pancreatogram; B: A smooth long severe<br />

narrowing <strong>of</strong> the distal common bile duct.<br />

The patient underwent open surgery, and at operation<br />

the liver was found to be slightly firm, gallbladder<br />

moderately dilated, Lund’s lymph node enlarged (about<br />

1.5 cm), common bile duct moderately dilated and two<br />

lymph nodes close to the common hepatic artery also<br />

enlarged (2 cm and 3 cm). After mobilizing the duodenum<br />

and the head <strong>of</strong> the pancreas, an enlarged (4 cm) s<strong>of</strong>t<br />

lymph node adherent to the distal CBD, was removed. The<br />

lymph node had a solid surface with a s<strong>of</strong>t and caseous<br />

centre, and had a fistulous connection with the posteri<strong>or</strong><br />

aspect <strong>of</strong> the CBD. Frozen section histology <strong>of</strong> the lymph<br />

node revealed chronic granulomatous inflammation. The<br />

gallbladder, Lund’s lymph node, the two other enlarged<br />

lymph nodes lying close to the common hepatic artery, and<br />

a specimen <strong>of</strong> liver was removed and sent f<strong>or</strong> histology.<br />

The narrowed distal CBD was resected, the distal end over<br />

sewn, and the proximal end anastomosed with a Roux-en-Y<br />

jejunal limb. The resected specimen included the fistulous<br />

opening on the posteri<strong>or</strong> wall <strong>of</strong> the CBD (Figure 3).<br />

The patient had an uneventful postoperative recovery,<br />

and bilirubin levels n<strong>or</strong>malised within two weeks.<br />

Histology <strong>of</strong> the liver and gallbladder was n<strong>or</strong>mal.<br />

The resected CBD showed epithelial ulceration and<br />

inflammation with a number <strong>of</strong> necrotizing granulomata.<br />

The lymph nodes had a chronic granulomatous appearance<br />

with large merged necrotic areas, and smaller epitheloidtype<br />

granulomata with occasional multinuclear giant cells<br />

(Figure 4A and B) suggestive <strong>of</strong> tuberculous lymphadenitis.<br />

The diagnosis was confirmed with a polymerase chain<br />

B<br />

A<br />

B<br />

reaction (PCR) using automated analyzer Cobas/Roche/,<br />

with the Amplic<strong>or</strong> Mycobacterium tuberculosis assay. No<br />

previous specific risk f<strong>or</strong> TB was found in the patient. He<br />

was treated with anti-tuberculous quadruple therapy and<br />

achieved gradual clinical improvement, with resolution <strong>of</strong><br />

pain and malaise, and a weight gain <strong>of</strong> 10 kg over the next<br />

6 mo. He remained well at 2.5 years postoperatively.<br />

DISCUSSION<br />

Figure 3 The resected part <strong>of</strong> the<br />

common bile duct with fistula on the<br />

posteri<strong>or</strong> wall (arrow).<br />

Figure 4 A: Extensive chronic granulomatous lymphadenitis (HE, × 13); B: Focal<br />

tuberculoid granuloma f<strong>or</strong>mation (HE, × 64).<br />

Obstructive jaundice secondary to abdominal TB is<br />

extremely rare. Four mechanisms have been described:<br />

TB <strong>of</strong> the pancreas itself may cause pseudoneoplastic<br />

obstructive jaundice [1-10] ; it may be secondary to TB<br />

lymphadenitis causing compression and inflammation<br />

<strong>of</strong> the lymph nodes and the CBD [6,11-19] , as in our case,<br />

with caseation <strong>of</strong> the lymph node causing fistulation into<br />

the CBD; biliary TB itself may lead to single <strong>or</strong> multiple<br />

www.wjgnet.com

---

3100 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

strictures, mimicking cholangiocarcinoma [20-25] ; and TB<br />

can create a retroperitoneal mass leading to biliary tree<br />

obstruction [26] .<br />

The diagnosis <strong>of</strong> abdominal TB should be considered<br />

in the context <strong>of</strong> a mass in the head <strong>of</strong> the pancreas in<br />

the immunocompromised patients and in countries with<br />

endemic TB [7] , after the exclusion <strong>of</strong> malignancy and other<br />

biliary inflammation. TB lymphadenitis can be suspected<br />

when a contrast-enhanced CT scan demonstrates low<br />

density masses surrounded by an enhancing solid rim [14] ,<br />

<strong>or</strong> when ERCP demonstrates a n<strong>or</strong>mal pancreatogram<br />

with a smooth narrowing <strong>of</strong> the CBD [18] , as were seen in<br />

our patient. FDG-PET scanning has not been shown to<br />

be useful in distinguishing TB from pancreatic malignancy,<br />

as both conditions have an increased uptake <strong>of</strong> the<br />

FDG metabolite [18] . US <strong>or</strong> CT-guided percutaneous fine<br />

needle aspiration (FNA) <strong>of</strong> the enlarged lymph nodes<br />

may be useful [7] , but is <strong>of</strong>ten not definitive [21] . Cytology<br />

<strong>of</strong> CBD aspirate, however, obtained by ERCP, may be<br />

confirmat<strong>or</strong>y in the presence <strong>of</strong> the acid-fast bacillus<br />

(Mycobacterium tuberculosis); alternatively PCR <strong>of</strong> the<br />

aspirate may be diagnostic [19] . However, in the case <strong>of</strong> a<br />

perip<strong>or</strong>tal lymphadenopathy causing obstructive jaundice,<br />

as in our patient, these FNA tests are only positive if a<br />

fistula exists between the TB lymph node and the CBD,<br />

allowing bacilli to pass into the CBD [19] . Other potential<br />

diagnostic methods include obtaining tissue specimens<br />

by laparoscopy [17] <strong>or</strong> endoscopic ultrasound with FNA [27] .<br />

Though in <strong>practice</strong>, the diagnosis is <strong>of</strong>ten established at<br />

operation [6,7,18,26] <strong>or</strong> even after surgery by histology [4] <strong>or</strong><br />

PCR-<strong>based</strong> assay [2,4,6,8,10] , as was the case in our patient.<br />

The great benefit <strong>of</strong> a preoperative diagnosis <strong>of</strong> TB<br />

causing the obstruction is that a m<strong>or</strong>e conservative path<br />

could be followed, involving removal <strong>of</strong> the obstructing<br />

lymph node alone, followed by anti-TB medications [18] .<br />

In our case m<strong>or</strong>e elab<strong>or</strong>ate CBD resective surgery was<br />

undertaken f<strong>or</strong> presumed malignancy.<br />

However, even though TB lymphadenitis was suspected<br />

in our patient after intraoperative frozen section, resection<br />

<strong>of</strong> the involved part <strong>of</strong> the CBD was necessary as the<br />

bile duct was already strictured, and eventual closure <strong>of</strong><br />

the fistula would probably result in additional stenosis <strong>or</strong><br />

even complete obstruction <strong>of</strong> the CBD. Thus inexplicable<br />

stenosis <strong>of</strong> the CBD should be taken into consideration in<br />

the context <strong>of</strong> pancreatic <strong>or</strong> TB lymphadenitis associated<br />

with obstructive jaundice and be treated by biliary bypass<br />

surgery [7] in addition to anti-TB medication.<br />

REFERENCES<br />

1 Crowson MC, Perry M, Burden E. Tuberculosis <strong>of</strong> the<br />

pancreas: a rare cause <strong>of</strong> obstructive jaundice. Br J Surg 1984;<br />

71: 239<br />

2 Chen CH, Yang CC, Yeh YH, Yang JC, Chou DA. Pancreatic<br />

tuberculosis with obstructive jaundice--a case rep<strong>or</strong>t. Am J<br />

Gastroenterol 1999; 94: 2534-2536<br />

3 Shan YS, Sy ED, Lin PW. Surgical resection <strong>of</strong> isolated<br />

pancreatic tuberculosis presenting as obstructive jaundice.<br />

Pancreas 2000; 21: 100-101<br />

4 Kouraklis G, Glinavou A, Karayiannakis A, Karatzas G.<br />

Primary tuberculosis <strong>of</strong> the pancreas mimicking a pancreatic<br />

tum<strong>or</strong>. Int J Pancreatol 2001; 29: 151-153<br />

www.wjgnet.com<br />

5 Singh B, Moodley J, Batitang S, Chetty R. Isolated pancreatic<br />

tuberculosis and obstructive jaundice. S Afr Med J 2002; 92:<br />

357-359<br />

6 Xia F, Poon RT, Wang SG, Bie P, Huang XQ, Dong JH.<br />

Tuberculosis <strong>of</strong> pancreas and peripancreatic lymph nodes in<br />

immunocompetent patients: experience from China. W<strong>or</strong>ld J<br />

Gastroenterol 2003; 9: 1361-1364<br />

7 El Mansari O, Tajdine MT, Mikou I, Janati MI. [Pancreatic<br />

tuberculosis. Rep<strong>or</strong>t <strong>of</strong> two cases] Gastroenterol Clin Biol 2003;<br />

27: 548-550<br />

8 Panzuto F, D'Amato A, Laghi A, Cadau G, D'Ambra G,<br />

Aguzzi D, Iannaccone R, Montesani C, Caprilli R, Delle Fave G.<br />

Abdominal tuberculosis with pancreatic involvement: a case<br />

rep<strong>or</strong>t. Dig Liver Dis 2003; 35: 283-287<br />

9 Kumar R, Kapo<strong>or</strong> D, Singh J, Kumar N. Isolated tuberculosis<br />

<strong>of</strong> the pancreas: a rep<strong>or</strong>t <strong>of</strong> two cases and review <strong>of</strong> the<br />

literature. Trop Gastroenterol 2003; 24: 76-78<br />

10 Beaulieu S, Chouillard E, Petit-Jean B, Vitte RL, Eugene C.<br />

[Pancreatic tuberculosis: a rare cause <strong>of</strong> pseudoneoplastic<br />

obstructive jaundice] Gastroenterol Clin Biol 2004; 28: 295-298<br />

11 Kohen MD, Altman KA. Jaundice due to a rare cause:<br />

tuberculous lymphadenitis. Am J Gastroenterol 1973; 59: 48-53<br />

12 Murphy TF, Gray GF. Biliary tract obstruction due to<br />

tuberculous adenitis. Am J Med 1980; 68: 452-454<br />

13 Stanley JH, Yantis PL, Marsh WH. Perip<strong>or</strong>tal tuberculous<br />

adenitis: a rare cause <strong>of</strong> obstructive jaundice. Gastrointest<br />

Radiol 1984; 9: 227-229<br />

14 Mathieu D, Ladeb MF, Guigui B, Rousseau M, Vasile N.<br />

Perip<strong>or</strong>tal tuberculous adenitis: CT features. Radiology 1986;<br />

161: 713-715<br />

15 Alvarez SZ, Sollano JD Jr. ERCP in hepatobiliary tuberculosis.<br />

Gastrointest Endosc 1998; 47: 100-104<br />

16 Queralt CB, Cruz JM, Comet V Jr, Almajano C, Val-Carreres<br />

C. [Obstructive jaundice due to peripancreatic tuberculous<br />

adenitis] Rev Esp Enferm Dig 1992; 82: 201-202<br />

17 Poon RT, Lo CM, Fan ST. Diagnosis and management <strong>of</strong><br />

biliary obstruction due to perip<strong>or</strong>tal tuberculous adenitis.<br />

Hepatogastroenterology 2001; 48: 1585-1587<br />

18 Obama K, Kanai M, Taki Y, Nakamoto Y, Takabayashi A.<br />

Tuberculous lymphadenitis as a cause <strong>of</strong> obstructive jaundice:<br />

rep<strong>or</strong>t <strong>of</strong> a case. Surg Today 2003; 33: 229-231<br />

19 Probst A, Schmidbaur W, Jechart G, Hammond A, Zentner<br />

J, Niculescu E, Messmann H. Obstructive jaundice in AIDS:<br />

diagnosis <strong>of</strong> biliary tuberculosis by ERCP. Gastrointest Endosc<br />

2004; 60: 145-148<br />

20 Fan ST, Ng IO, Choi TK, Lai EC. Tuberculosis <strong>of</strong> the bile duct:<br />

a rare cause <strong>of</strong> biliary stricture. Am J Gastroenterol 1989; 84:<br />

413-414<br />

21 Behera A, Kochhar R, Dhavan S, Aggarwal S, Singh K.<br />

Isolated common bile duct tuberculosis mimicking malignant<br />

obstruction. Am J Gastroenterol 1997; 92: 2122-2123<br />

22 Yeh TS, Chen NH, Jan YY, Hwang TL, Jeng LB, Chen MF.<br />

Obstructive jaundice caused by biliary tuberculosis: spectrum<br />

<strong>of</strong> the diagnosis and management. Gastrointest Endosc 1999; 50:<br />

105-108<br />

23 Kok KY, Yapp SK. Tuberculosis <strong>of</strong> the bile duct: a rare cause<br />

<strong>of</strong> obstructive jaundice. J Clin Gastroenterol 1999; 29: 161-164<br />

24 Inal M, Aksungur E, Akgul E, Demirbas O, Oguz M, Erkocak E.<br />

Biliary tuberculosis mimicking cholangiocarcinoma: treatment<br />

with metallic biliary endoprothesis. Am J Gastroenterol 2000;<br />

95: 1069-1071<br />

25 Prasad A, Pandey KK. Tuberculous biliary strictures:<br />

uncommon cause <strong>of</strong> obstructive jaundice. Australas Radiol<br />

2001; 45: 365-368<br />

26 Jazet IM, Perk L, De Roos A, Bolk JH, Arend SM. Obstructive<br />

jaundice and hematemesis: two cases with unusual<br />

presentations <strong>of</strong> intra-abdominal tuberculosis. Eur J Intern Med<br />

2004; 15: 259-261<br />

27 Woodfield JC, Winds<strong>or</strong> JA, Godfrey CC, Orr DA, Officer NM.<br />

Diagnosis and management <strong>of</strong> isolated pancreatic tuberculosis:<br />

recent experience and literature review. ANZ J Surg 2004; 74:<br />

368-371<br />

S- Edit<strong>or</strong> Li DL L- Edit<strong>or</strong> Ma JY E- Edit<strong>or</strong> Lu W

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3101-3104<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

Primary lymphoblastic B-cell lymphoma <strong>of</strong> the stomach:<br />

A case rep<strong>or</strong>t<br />

Miao-Xia He, Ming-Hua Zhu, Wei-Qiang Liu, Li-Li Wu, Xiong-Zeng Zhu<br />

Miao-Xia He, Ming-Hua Zhu, Wei-Qiang Liu, Li-Li Wu,<br />

Department <strong>of</strong> Pathology, Changhai Hospital, Second Military<br />

Medical University, Shanghai 200433, China<br />

Xiong-Zeng Zhu, Department <strong>of</strong> Pathology, Tum<strong>or</strong> Hospital,<br />

Fudan University, Shanghai 200032, China<br />

Auth<strong>or</strong> contributions: He MX wrote the paper and <strong>or</strong>ganized the<br />

figures and patient data; The diagnosis and differential diagnosis<br />

were carried out by Zhu XZ, Zhu MH, Liu WQ and Wu LL; Zhu<br />

XZ helped <strong>or</strong>ganize and c<strong>or</strong>rect the paper; Zhu MH supervised the<br />

writing and <strong>or</strong>ganization process.<br />

C<strong>or</strong>respondence to: Miao-Xia He, Department <strong>of</strong> Pathology,<br />

Changhai Hospital, Second Military Medical University, Shanghai<br />

200433, China. hmm26@163.com<br />

Telephone: +86-21-25074851 Fax: +86-21-25074604<br />

Received: July 31, 2007 Revised: April 10, 2008<br />

Abstract<br />

Primary stomach lymphoblastic B-cell lymphoma<br />

(B-LBL) is a rare tum<strong>or</strong>. We describe a primary stomach<br />

B-LBL in a 38 years old female who presented with<br />

nonspecific complaints <strong>of</strong> fatigue and vomiting f<strong>or</strong> 2 mo.<br />

Gastr<strong>of</strong>iberscopy revealed a large gastric ulcer, which was<br />

successfully resected. Pathology showed a lymphoblastic<br />

cell lymphoma arising from the stomach, and there<br />

was no <strong>evidence</strong> <strong>of</strong> disease at any extrastomach site.<br />

Immunohistochemical staining and gene rearrangement<br />

studies supp<strong>or</strong>ted that the stomach tum<strong>or</strong> was a clonal<br />

B-cell lymphoma. Theref<strong>or</strong>e, the diagnosis <strong>of</strong> B-LBL was<br />

made <strong>based</strong> on the stomach specimen.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Primary stomach lymphoma; Lymphoblastic<br />

lymphoma; B-cell<br />

Peer reviewer: Ibrahim A Al M<strong>of</strong>leh, Pr<strong>of</strong>ess<strong>or</strong>, Department <strong>of</strong><br />

Medicine, College <strong>of</strong> Medicine, King Saud University, PO Box<br />

2925, Riyadh 11461, Saudi Arabia<br />

He MX, Zhu MH, Liu WQ, Wu LL, Zhu XZ. Primary<br />

lymphoblastic B-cell lymphoma <strong>of</strong> the stomach: A case rep<strong>or</strong>t.<br />

W<strong>or</strong>ld J Gastroenterol 2008; 14(19): 3101-3104 Available from:<br />

URL: http://www.wjgnet.com/1007-9327/14/3101.asp DOI:<br />

http://dx.doi.<strong>or</strong>g/10.3748/wjg.14.3101<br />

INTRODUCTION<br />

Precurs<strong>or</strong> B-cell lymphoblastic lymphoma (B-LBL) is a<br />

neoplasm <strong>of</strong> lymphoblasts committed to the B-cell lineage,<br />

which is an uncommon type <strong>of</strong> lymphoma and accounts<br />

f<strong>or</strong> less than 10% <strong>of</strong> the total cases <strong>of</strong> lymphoblastic<br />

lymphoma. It usually affects people at a younger age.<br />

Most cases rep<strong>or</strong>ted in a literature review are less than<br />

18 years <strong>of</strong> age, some patients are under 35 years <strong>of</strong> age<br />

and the median age is 20 years [1] . Unlike precurs<strong>or</strong> T-cell<br />

lymphoblastic lymphoma, precurs<strong>or</strong> B-cell lymphoblastic<br />

lymphoma commonly involves lymph nodes <strong>or</strong> extranodal<br />

sites, mediastinal masses are infrequent. The most frequent<br />

sites <strong>of</strong> B-LBL lesions are the skin, bone, s<strong>of</strong>t tissue, and<br />

lymph nodes [1-3] .<br />

Primary stomach lymphoma is defined as an extranodal<br />

non-Hodgkin’s lymphoma <strong>of</strong> any cell type, with no <strong>evidence</strong><br />

<strong>of</strong> extrastomach dissemination. The maj<strong>or</strong>ity <strong>of</strong> stomach<br />

cases rep<strong>or</strong>ted in the English literature are extranodal<br />

marginal zone B cell lymphoma <strong>of</strong> mucosa-associated<br />

lymphoid tissue (MALToma), diffuse large B cell lymphoma<br />

(DLBCL), nasal type NK/T cell lymphoma, etc [3-5] . Primary<br />

stomach B-LBL is rare. Here we present a case <strong>of</strong> primary<br />

B-LBL involving the stomach.<br />

CASE REPORT<br />

CASE REPORT<br />

The patient was a 38 years old female who had an<br />

unremarkable past medical hist<strong>or</strong>y. She presented with<br />

nonspecific complaints <strong>of</strong> fatigue and vomiting f<strong>or</strong> 2 mo.<br />

Gastr<strong>of</strong>iberscopy revealed a large gastric ulcer. During<br />

surgery, a large neoplastic ulcer was found in the stomach<br />

and gastric wall was diffusely thickened. The tum<strong>or</strong><br />

was successfully resected with adjacent p<strong>or</strong>tions <strong>of</strong> the<br />

stomach. Good macroscopic margins were obtained.<br />

No other masses <strong>or</strong> enlarged lymph nodes were present.<br />

Examination <strong>of</strong> the bone marrow showed 13% immature<br />

lymphoid cells, the leukocyte count <strong>of</strong> peripheral blood<br />

was 12 × 10 9 /L, and the percentage <strong>of</strong> peripheral blood<br />

lymphocytes was 35%.<br />

Grossly, the greater and lesser curvatures <strong>of</strong> the<br />

resected stomach measured 22 cm and 11 cm, respectively.<br />

There was a well circumscribed neoplastic ulcer measuring<br />

10 cm × 8 cm × 2.5 cm in antro-pyl<strong>or</strong>ic region <strong>of</strong> the<br />

stomach (Figure 1). A small necrosis was found on surface<br />

<strong>of</strong> the neoplastic ulcer. The cut surface <strong>of</strong> the tum<strong>or</strong><br />

was grey and firm. Tum<strong>or</strong> tissue was found in the gastric<br />

serosa. P<strong>or</strong>tions <strong>of</strong> tum<strong>or</strong> tissue were fixed in f<strong>or</strong>malin<br />

and embedded in paraffin and cut into sections which<br />

were stained with HE f<strong>or</strong> routine histom<strong>or</strong>phology.<br />

Additional sections <strong>of</strong> paraffin-embedded tissue were used<br />

www.wjgnet.com

---

3102 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

Figure 1 A large neoplastic ulcer in the stomach involving the whole gastric wall.<br />

f<strong>or</strong> immunohistochemical staining and gene rearrangement<br />

analysis.<br />

Microscopically, the tum<strong>or</strong> cells were unif<strong>or</strong>m,<br />

medium-sized immature lymphoid cells, their nuclei<br />

contained evenly dispersed nuclear chromatin with a<br />

high nuclear/cytoplasmic ratio. The nuclei were round <strong>or</strong><br />

oval <strong>or</strong> convoluted in shape. A large number <strong>of</strong> mitotic<br />

figures were appreciated. The tum<strong>or</strong> cells were diffusely<br />

distributed in the gastric glands, and found in all layers<br />

<strong>of</strong> the gastric wall. There were tum<strong>or</strong> emboli within the<br />

gastric wall lymphatic vessels. Lymphoepithlial lesions were<br />

not found (Figure 2).<br />

Immunohistochemistry analysis revealed immature<br />

lymphoid cells positive f<strong>or</strong> cytoplasmic CD10 and CD79a,<br />

nuclear TdT and CD99 antigens, and negative f<strong>or</strong> CD20<br />

antigen. About 50%-70% <strong>of</strong> the tum<strong>or</strong> cells were reactive<br />

f<strong>or</strong> Ki-67 (Figure 3). Gene rearrangement analysis showed<br />

monoclonal immunoglubin high chain gene rearrangement<br />

(Figure 4).<br />

The m<strong>or</strong>phology, immunophenotype, and gene<br />

rearrangement <strong>of</strong> the neoplastic cells supp<strong>or</strong>ted the<br />

diagnosis <strong>of</strong> stomach precurs<strong>or</strong> B-LBL. There was no<br />

<strong>evidence</strong> that supp<strong>or</strong>ted the diagnosis <strong>of</strong> precurs<strong>or</strong> B<br />

lymphoblastic leukemia in the bone marrow and peripheral<br />

blood.<br />

DISCUSSION<br />

Primary stomach lymphomas are in the min<strong>or</strong>ity, most<br />

<strong>of</strong> which are mucosa- associated lymphoid tissue B cell<br />

lymphoma, diffuse large B cell lymphoma, extranodal nasal<br />

type NK/T cell lymphoma, etc. Primary stomach B-LBL is<br />

rare [1-5] .<br />

Ninety percent <strong>of</strong> lymphoblastic lymphomas are <strong>of</strong><br />

precurs<strong>or</strong> T cell lineage and only 10% are <strong>of</strong> precurs<strong>or</strong><br />

B cell lineage [1,2] . Precurs<strong>or</strong> B lymphoblastic lymphoma<br />

(B-LBL)/leukemia (B-ALL) are <strong>or</strong>iginated from B<br />

cell lineage. ALL and LBL represent different clinical<br />

presentations <strong>of</strong> the same neoplasm and are grouped in<br />

the categ<strong>or</strong>y <strong>of</strong> precurs<strong>or</strong> B-cell lymphoblastic leukemia/<br />

lymphoma by the revised W<strong>or</strong>ld Health Organization<br />

classification <strong>of</strong> lymphoid neoplasms [1] . Because <strong>of</strong> the<br />

biologic unity <strong>of</strong> B-ALL and B-LBL, the criteria f<strong>or</strong><br />

distinguishing B-LBL from B-ALL are also arbitrary<br />

and applied inconsistently. In some studies [2,6,7] , patients<br />

www.wjgnet.com<br />

A<br />

B<br />

C<br />

D<br />

Figure 2 Diffuse proliferation <strong>of</strong> lymphoblastic cells between gastric glands <strong>of</strong><br />

stomach B-LBL. A: HE, × 100; B: HE, × 200; C: HE, × 200; D: Tum<strong>or</strong> emboli within<br />

lymphatic vessels <strong>of</strong> the gastric wall (HE, × 100).<br />

with B-LBL and acute leukemia are included, but in<br />

other studies [3,4,6] , patients with leukemic involvement are<br />

excluded. Acc<strong>or</strong>ding to the new WHO classification <strong>of</strong><br />

lymphoid neoplasms, when the process is confined to a<br />

mass lesion without any <strong>or</strong> minimal <strong>evidence</strong> <strong>of</strong> blood and<br />

marrow involvement, the diagnosis is lymphoma; when<br />

extensive marrow and blood are involved, lymphoblastic

---

3104 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

lymphoid tissues. International agency f<strong>or</strong> reseach on cancer.<br />

Lyon, France: IARC Press, 2001: 109-117<br />

2 Soslow RA, Baergen RN, Warnke RA. B-lineage lymphoblastic<br />

lymphoma is a clinicopathologic entity distinct from other<br />

histologically similar aggressive lymphomas with blastic<br />

m<strong>or</strong>phology. Cancer 1999; 85: 2648-2654<br />

3 Lin P, Jones D, D<strong>or</strong>fman DM, Medeiros LJ. Precurs<strong>or</strong> B-cell<br />

lymphoblastic lymphoma: a predominantly extranodal tum<strong>or</strong><br />

with low propensity f<strong>or</strong> leukemic involvement. Am J Surg<br />

Pathol 2000; 24: 1480-1490<br />

4 Maitra A, McKenna RW, Weinberg AG, Schneider NR, Kr<strong>of</strong>t<br />

SH. Precurs<strong>or</strong> B-cell lymphoblastic lymphoma. A study <strong>of</strong><br />

nine cases lacking blood and bone marrow involvement and<br />

review <strong>of</strong> the literature. Am J Clin Pathol 2001; 115: 868-875<br />

5 Burkhardt B, Zimmermann M, Oschlies I, Niggli F, Mann G,<br />

Parwaresch R, Riehm H, Schrappe M, Reiter A. The impact<br />

<strong>of</strong> age and gender on biology, clinical features and treatment<br />

outcome <strong>of</strong> non-Hodgkin lymphoma in childhood and<br />

adolescence. Br J Haematol 2005; 131: 39-49<br />

6 Bassi D, Lentzner BJ, Mosca RS, Alobeid B. Primary cardiac<br />

precurs<strong>or</strong> B lymphoblastic lymphoma in a child: a case rep<strong>or</strong>t<br />

and review <strong>of</strong> the literature. Cardiovasc Pathol 2004; 13: 116-119<br />

7 Zinzani PL, Bendandi M, Visani G, Gherlinzoni F, Frezza G,<br />

Merla E, Manfroi S, Gozzetti A, Tura S. Adult lymphoblastic<br />

www.wjgnet.com<br />

lymphoma: clinical features and prognostic fact<strong>or</strong>s in 53<br />

patients. Leuk Lymphoma 1996; 23: 577-582<br />

8 Kim JY, Kim YC, Lee ES. Precurs<strong>or</strong> B-cell lymphoblastic<br />

lymphoma involving the skin. J Cutan Pathol 2006; 33: 649-653<br />

9 Medeiros LJ, Carr J. Overview <strong>of</strong> the role <strong>of</strong> molecular<br />

methods in the diagnosis <strong>of</strong> malignant lymphomas. Arch<br />

Pathol Lab Med 1999; 123: 1189-1207<br />

10 Hojo H, Sasaki Y, Nakamura N, Abe M. Absence <strong>of</strong> somatic<br />

hypermutation <strong>of</strong> immunoglobulin heavy chain variable<br />

region genes in precurs<strong>or</strong> B-lymphoblastic lymphoma: a study<br />

<strong>of</strong> four cases in childhood and adolescence. Am J Clin Pathol<br />

2001; 116: 673-682<br />

11 Le Gouill S, Lepretre S, Briere J, M<strong>or</strong>el P, Bouabdallah R,<br />

Raffoux E, Sebban C, Lepage E, Brice P. Adult lymphoblastic<br />

lymphoma: a retrospective analysis <strong>of</strong> 92 patients under 61<br />

years included in the LNH87/93 trials. Leukemia 2003; 17:<br />

2220-2224<br />

12 Kantarjian HM, O’Brien S, Smith TL, C<strong>or</strong>tes J, Giles FJ, Beran<br />

M, Pierce S, Huh Y, Andreeff M, Koller C, Ha CS, Keating<br />

MJ, Murphy S, Freireich EJ. Results <strong>of</strong> treatment with hyper-<br />

CVAD, a dose-intensive regimen, in adult acute lymphocytic<br />

leukemia. J Clin Oncol 2000; 18: 547-561<br />

13 Pui CH, Robison LL, Look AT. Acute lymphoblastic<br />

leukaemia. Lancet 2008; 371: 1030-1043<br />

S- Edit<strong>or</strong> Sun YL L- Edit<strong>or</strong> Wang XL E- Edit<strong>or</strong> Ma WH

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3105<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

Perivascular epithelioid cell tumour <strong>of</strong> the liver<br />

Unne Stenram<br />

Unne Stenram, Department <strong>of</strong> Pathology, Lund University, Lund<br />

SE-22185, Sweden<br />

Auth<strong>or</strong> contribution: Stenram U contributed all to this paper.<br />

C<strong>or</strong>respondence to: Unne Stenram, Department <strong>of</strong> Pathology,<br />

University Hospital, Lund SE-22185,<br />

Sweden. unne.stenram@med.lu.se<br />

Telephone: +46-46-173407 Fax: +46-46-143307<br />

Received: October 8, 2007 Revised: April 5, 2008<br />

Abstract<br />

Perivascular epithelioid cell tumour is not uncommon in<br />

the liver but seldom malignant.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Perivascular epithelioid cell tumour; Liver<br />

Peer reviewer: David Adams, Pr<strong>of</strong>ess<strong>or</strong>, Liver Research<br />

Lab<strong>or</strong>at<strong>or</strong>ies, Institute f<strong>or</strong> Biomedical Research, Queen Elizabeth<br />

Hospital, University <strong>of</strong> Birmingham, Birmingham B15 2TT,<br />

United Kingdom<br />

Stenram U. Perivascular epithelioid cell tumour <strong>of</strong> the liver. W<strong>or</strong>ld<br />

J Gastroenterol 2008; 14(19): 3105 Available from: URL: http://<br />

www.wjgnet.com/1007-9327/14/3105.asp DOI: http://dx.doi.<br />

<strong>or</strong>g/10.3748/wjg.14.3105<br />

TO THE EDITOR<br />

LETTERS TO THE EDITOR<br />

I read with great interest the w<strong>or</strong>k by Fang, Zhou, Jin<br />

and Hu, dealing with perivascular epithelioid cell tumour<br />

(angiomyolipoma) <strong>of</strong> the liver [1] . It is right that, in<br />

mesenchymal tissues, the tumour is common in the uterus.<br />

The most frequent localization generally is, however, in the<br />

kidney [2,3] . In the liver, 110 cases had been described by 1999 [3] .<br />

It is true that the malignant cases are much fewer.<br />

Our interest in this entity was arisen, when we scrutinized<br />

a hepatic tumour, described from our department as an<br />

oncocytic adenoma [4] . However, the tumour later turned<br />

out to be positive f<strong>or</strong> the melanocytic marker HMB-45 and<br />

is in fact a perivascular epithelioid cell tumour. The journal<br />

refused to publish the revised diagnosis!<br />

REFERENCES<br />

1 Fang SH, Zhou LN, Jin M, Hu JB. Perivascular epithelioid<br />

cell tum<strong>or</strong> <strong>of</strong> the liver: a rep<strong>or</strong>t <strong>of</strong> two cases and review <strong>of</strong> the<br />

literature. W<strong>or</strong>ld J Gastroenterol 2007; 13: 5537-5539<br />

2 H<strong>or</strong>nick JL, Fletcher CD. PEComa: what do we know so far?<br />

Histopathology 2006; 48: 75-82<br />

3 Tryggvason G, Blondal S, Goldin R, Albrechtsen J, Bj<strong>or</strong>nsson<br />

J, Jonasson J. Epithelioid angiomyolipoma <strong>of</strong> the liver: case<br />

rep<strong>or</strong>t and review <strong>of</strong> the literature. APMIS 2004; 112: 612-616<br />

4 el Hag IA, Ekberg H, Tranberg KG, Lundstedt C, Johansson S,<br />

Sassner P, Hagerstrand I. Oncocytic liver tumours and arterial<br />

dilatation. Case rep<strong>or</strong>t. Eur J Surg 1994; 160: 55-59<br />

S- Edit<strong>or</strong> Li DL L- Edit<strong>or</strong> Wang XL E- Edit<strong>or</strong> Lu W<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3106-3107<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

LETTERS TO THE EDITOR<br />

Role <strong>of</strong> silis in esophageal cancer<br />

Ali Jabbari, Sima Besharat, Shahryar Semnani<br />

Ali Jabbari, Sima Besharat, Shahryar Semnani, Golestan<br />

University <strong>of</strong> Medical Sciences, Golestan Research Center <strong>of</strong><br />

Gastroenterology and Hepatology, G<strong>or</strong>gan City 49177-44563,<br />

Golestan Province, Iran<br />

Auth<strong>or</strong> contributions: Jabbari A and Besharat S contributed<br />

equally to this w<strong>or</strong>k, designed and perf<strong>or</strong>med the research and<br />

wrote the paper; Semnani S designed the first idea <strong>of</strong> the w<strong>or</strong>k.<br />

C<strong>or</strong>respondence to: Sima Besharat, MD, Researcher,<br />

Golestan University <strong>of</strong> Medical Sciences, Golestan Research<br />

Center <strong>of</strong> Gastroenterology and Hepatology, 21st Edalat,<br />

Vali_e_asr Ave, G<strong>or</strong>gan City 49177-44563, Golestan Province,<br />

Iran. s_besharat_gp@yahoo.com<br />

Telephone: +98-171-2240835 Fax: +98-171-2269210<br />

Received: January 16, 2008 Revised: March 6, 2008<br />

Abstract<br />

Association <strong>of</strong> silica with diseases like cancers has<br />

been determined previously. This study was designed<br />

to determine the quantity <strong>of</strong> silis in flour produced in<br />

Golestan Province, and its relation to esophageal cancer<br />

(EC). We took flour samples from all flour millings in<br />

Golestan Province. Base-melting method in nickel cruise<br />

was used at 550℃. The extract was reduced with<br />

acids. Different silis concentrations in various regions<br />

were compared. P < 0.05 was considered statistically<br />

significant. The median silis concentration was 0.0030 g,<br />

the mean silis concentration was 0.008760 ± 0.004265<br />

g in each 100 g flour. The difference <strong>of</strong> mean silis<br />

concentrations in various regions was not significant.<br />

No high level <strong>of</strong> silica was found in the flour <strong>of</strong> Golestan<br />

Province. We could not find any significant difference<br />

in various areas between silica contaminations. Studies<br />

on the consumed bread and rice in various regions <strong>of</strong><br />

Golestan Province can be helpful.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Silis; Esophageal cancer; Flour; Miling; Iran<br />

Peer reviewer: Satoshi Osawa, MD, First Department <strong>of</strong><br />

Medicine, Hamamatsu University School <strong>of</strong> Medicine, 1-20-1<br />

Handayama, Hamamatsu 431-3192, Japan<br />

Jabbari A, Besharat S, Semnani S. Role <strong>of</strong> silis in esophageal<br />

cancer. W<strong>or</strong>ld J Gastroenterol 2008; 14(19): 3106-3107 Available<br />

from: URL: http://www.wjgnet.com/1007-9327/14/3106.asp<br />

DOI: http://dx.doi.<strong>or</strong>g/10.3748/wjg.14.3106<br />

LETTER TO THE EDITOR<br />

Silica (SiO2) is an oxide <strong>of</strong> silicon. Its existence in food<br />

www.wjgnet.com<br />

products is a presentation <strong>of</strong> contamination. Some studies<br />

revealed that silica exposure may play a role in diseases like<br />

cancer [1] , although its definite effect has not been confirmed in<br />

some cancers like esophageal caner. The International Agency<br />

f<strong>or</strong> Research on Cancer (IARC) has classified crystalline silica<br />

as a known human carcinogen in lung cancer [2] . The excess<br />

risk <strong>of</strong> esophageal cancer (EC) m<strong>or</strong>tality among caisson<br />

w<strong>or</strong>kers with silicosis explains best by the very heavy exposure<br />

to free silica dust in their w<strong>or</strong>king environment [3-8] and their<br />

silicosis as an underlining disease.<br />

A case-control study <strong>of</strong> the relationships among silica<br />

exposure, gastric cancer, and EC in Japan, suggested that<br />

gastric cancer and EC are related to silica exposure and<br />

silicosis in that area, although they did not reach a statistically<br />

significant level [9] .<br />

O’Neill et al [9] rep<strong>or</strong>ted that the contamination with<br />

fibrous silica contaminant is high in the diet <strong>of</strong> n<strong>or</strong>theast<br />

<strong>of</strong> Iran. Low quality <strong>of</strong> wheat and its contamination<br />

with weed and sand are considered imp<strong>or</strong>tant [10] . The<br />

n<strong>or</strong>theastern part <strong>of</strong> Iran in Golestan Province (Turkmen<br />

Sahra) is known to have the highest incidence <strong>of</strong> EC in the<br />

country and to be one <strong>of</strong> the highest areas in the w<strong>or</strong>ld [11] .<br />

Golestan Province is located on the hot spots that are<br />

along a presumptive belt starting from n<strong>or</strong>thern China,<br />

extending along the southern parts <strong>of</strong> the f<strong>or</strong>mer Soviet<br />

Union and ending in the Caspian litt<strong>or</strong>al in n<strong>or</strong>thern Iran.<br />

In 1982, O'Neill et al [9] rep<strong>or</strong>ted an association <strong>of</strong> silica<br />

fibers in the millet bran and esophageal tum<strong>or</strong>s in another<br />

study. In 1986, Newman [1] found that certain plants contain<br />

structures consisting <strong>of</strong> biogenic silica, which has been<br />

supposed as a causative agent in the high cancer areas <strong>of</strong><br />

Southern Africa, N<strong>or</strong>theast Iran and N<strong>or</strong>th <strong>of</strong> China. It is<br />

hypothesized that these plant mineral fibers are involved<br />

in the etiology <strong>of</strong> EC in Iran and in other high incidence<br />

areas. Phalaris min<strong>or</strong> is a known common weed in the<br />

Mediterranean area, but it is not considered a region with a<br />

high incidence and prevalence <strong>of</strong> EC.<br />

Some findings suggest that silica particles might be<br />

involved in the etiology <strong>of</strong> EC. In fact, different results<br />

are available about the significant relationship between silis<br />

exposure and EC, some are in agreement and suppose that<br />

silis plays a role in the etiology <strong>of</strong> EC, and others are in<br />

disagreement.<br />

In our study, silis but not its compound <strong>or</strong> its biologic<br />

derivatives was considered a carcinogen. Flour samples from<br />

all flour millings in Golestan Province were taken. Basemelting<br />

method in nickel cruise was used at 550℃ and the<br />

extract was reduced with acids. The complex was evaluated<br />

with a spectrophotometer (820 nanometer wavelength).<br />

Five control samples <strong>of</strong> wheat seeds and pedicles were<br />

examined, too. The different silis median concentrations in

---

Jabbari A et al . Silis and EC 3107<br />

wheat seeds, pedicles and flour were statistically significant.<br />

However, the total silis in the flour was in the n<strong>or</strong>mal<br />

range because a great deal <strong>of</strong> silis was omitted from the<br />

flour during the preparing process. The modern and new<br />

purification technologies may be effective in producing<br />

these results, so the previous contaminants can be supposed<br />

less imp<strong>or</strong>tant.<br />

The mean silis concentration was 0.012, 0.01 and 0.003<br />

in the central, western and eastern parts <strong>of</strong> G<strong>or</strong>gan City,<br />

respectively. The differences were not statistically significant.<br />

The Golestan province was divided into 3 areas acc<strong>or</strong>ding<br />

to the incidence <strong>of</strong> EC and we matched the data with the<br />

location <strong>of</strong> flour millings on the map.<br />

Our findings suggest that there are no significant<br />

differences in flours <strong>of</strong> various areas, revealing a less<br />

imp<strong>or</strong>tant role <strong>of</strong> silis in EC. However, from a medical<br />

point <strong>of</strong> view it is imp<strong>or</strong>tant. There is a great variation in<br />

the incidence <strong>of</strong> EC between countries and regions. The<br />

distribution <strong>of</strong> EC in Golestan Province is not conc<strong>or</strong>dant<br />

with the amount <strong>of</strong> silis rep<strong>or</strong>ted in this study. Silis concentration<br />

is higher in the west part but EC is higher in the east.<br />

Despite the high incidence <strong>of</strong> EC in N<strong>or</strong>theast Iran, no<br />

significant differences were seen between silis in wheat flour<br />

<strong>of</strong> this area and standard measures. It seems that silis could<br />

not play a maj<strong>or</strong> role in the etiology <strong>of</strong> EC <strong>or</strong> is considered a<br />

predisposing fact<strong>or</strong> when we eat it. Perhaps, <strong>or</strong>al <strong>or</strong> inhalation<br />

abs<strong>or</strong>ption <strong>of</strong> silis has an effect on its carcinogenicity. This<br />

hypothesis becomes acceptable when we pay m<strong>or</strong>e attention<br />

to the main component <strong>of</strong> earth crust. Silis, an abundant<br />

mineral in rock, sand, and soil, is in contact with our skin, but<br />

it is not supposed as a carcinogen <strong>or</strong> a predisposing fact<strong>or</strong>.<br />

Previous studies have rep<strong>or</strong>ted a considerable concentration<br />

<strong>of</strong> silica in the flour produced in this area and<br />

suggested a relationship between EC and silis. In this study,<br />

no high level <strong>of</strong> silica was found in the flour <strong>of</strong> Golestan<br />

Province. Thus, on the one hand, we could not confirm the<br />

hypothesis <strong>of</strong> high contamination <strong>of</strong> the flour in this area,<br />

which is considered a high risk <strong>of</strong> EC in Golestan Province.<br />

On the other hand, we could not rule out the probable<br />

role <strong>of</strong> this element in the etiology <strong>of</strong> EC. Studies on the<br />

consumed bread and rice in various regions <strong>of</strong> the province<br />

can be helpful.<br />

ACKNOWLEDGMENTS<br />

The auth<strong>or</strong>s thank all colleagues in "Food and Drug<br />

Committee" <strong>of</strong> Golestan Province f<strong>or</strong> their help in data<br />

collection, especially Dr. Hamidreza Yazdi (head <strong>of</strong> the<br />

deputy), Dr. Abbas-ali Keshtkar (MD, PhD) f<strong>or</strong> their kind<br />

help in analyzing the data and Mr.Naderi f<strong>or</strong> his cooperation<br />

in chemical analysis.<br />

REFERENCES<br />

1 Newman R. Association <strong>of</strong> biogenic silica with disease. Nutr<br />

Cancer 1986; 8: 217-821<br />

2 Yassin A, Yebesi F, Tingle R. Occupational exposure to<br />

crystalline silica dust in the United States, 1988-2003. Environ<br />

Health Perspect 2005; 113: 255-260<br />

3 Yu IT, Tse LA, Wong TW, Leung CC, Tam CM, Chan AC.<br />

Further <strong>evidence</strong> f<strong>or</strong> a link between silica dust and esophageal<br />

cancer. Int J Cancer 2005; 114: 479-483<br />

4 Tsuda T, Mino Y, Babazono A, Shigemi J, Otsu T, Yamamoto E.<br />

A case-control study <strong>of</strong> the relationships among silica exposure,<br />

gastric cancer, and esophageal cancer. Am J Ind Med 2001; 39:<br />

52-57<br />

5 Siemiatycki J, Germ M, Dewar R, Lakhani R, Begin D,<br />

Richardson L. Silica and cancer associations from a multicenter<br />

occupational case-referent study. IARC Sci Publ, 1990;<br />

97: 129-142<br />

6 Pan G, Takahashi K, Feng Y, Liu L, Liu T, Zhang S, Liu<br />

N, Okubo T, Goldsmith DF. Nested case-control study <strong>of</strong><br />

esophageal cancer in relation to occupational exposure to silica<br />

and other dusts. Am J Ind Med 1999; 35: 272-280<br />

7 Soutar CA, Robertson A, Miller BG, Searl A, Bignon J.<br />

Epidemiological <strong>evidence</strong> on the carcinogenicity <strong>of</strong> silica:<br />

fact<strong>or</strong>s in scientific judgement. Ann Occup Hyg 2000; 44: 3-14<br />

8 Johnson WM, Busnardo MS. Silicosis following employment<br />

in the manufacture <strong>of</strong> silica flour and industrial sand. J Occup<br />

Med 1993; 35: 716-719<br />

9 O'Neill C, Pan Q, Clarke G, Liu F, Hodges G, Ge M, J<strong>or</strong>dan P,<br />

Chang U, Newman R, Toulson E. Silica fragments from millet<br />

bran in mucosa surrounding oesophageal tumours in patients<br />

in n<strong>or</strong>thern China. Lancet 1982; 1: 1202-1206<br />

10 O'Neill CH, Hodges GM, Riddle PN, J<strong>or</strong>dan PW, Newman<br />

RH, Flood RJ, Toulson EC. A fine fibrous silica contaminant<br />

<strong>of</strong> flour in the high oesophageal cancer area <strong>of</strong> n<strong>or</strong>th-east Iran.<br />

Int J Cancer 1980; 26: 617-628<br />

11 Semnani SH, Besharat S, Abdolahi N, Kalavi KH, Fazeli SA,<br />

Davarian A, Danesh A, Malekzadeh R. Esophageal cancer in<br />

n<strong>or</strong>theastern Iran. Indian J Gastroenterol 2005; 24: 224<br />

S- Edit<strong>or</strong> Li DL L- Edit<strong>or</strong> Wang XL E- Edit<strong>or</strong> Liu Y<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3108-3111<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

SCIENTOMETRICS<br />

Variations <strong>of</strong> auth<strong>or</strong> <strong>or</strong>igins in W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong><br />

Gastroenterology during 2001-2007<br />

Hua Yang, Yue-Yang Zhao<br />

Hua Yang, Yue-Yang Zhao, Library <strong>of</strong> Shengjing Hospital, China<br />

Medical University, Shenyang 110004, Liaoning Province, China<br />

Auth<strong>or</strong> contributions: Yang H designed and perf<strong>or</strong>med the<br />

research; Zhao YY edited the manuscript.<br />

Supp<strong>or</strong>ted by The Education Department <strong>of</strong> Liaoning Province,<br />

No. 05W238<br />

C<strong>or</strong>respondence to: Hua Yang, Library <strong>of</strong> Shengjing Hospital,<br />

China Medical University, No. 36 Sanhao Street, Heping District,<br />

Shenyang 110004, Liaoning Province, China. yangh@cmu2h.<strong>or</strong>g<br />

Telephone: +86-24-83956534 Fax: +86-24-83955092<br />

Received: March 10, 2008 Revised: April 16, 2008<br />

Abstract<br />

AIM: To discuss the variations and distributions <strong>of</strong><br />

auth<strong>or</strong>s who published their papers in W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong><br />

Gastroenterology (WJG ) during 2001-2007 and evaluate<br />

the development <strong>of</strong> WJG and gastroenterology c<strong>or</strong>e<br />

journals in recent years by comparing the contributions<br />

<strong>of</strong> the auth<strong>or</strong>s.<br />

METHODS: WJG articles published in 2001-2007<br />

were searched from MEDLINE database (by ISI Web<br />

<strong>of</strong> Knowledge). The variations (cooperation degree,<br />

cooperation rate) and distributions <strong>of</strong> the first auth<strong>or</strong>s<br />

were analyzed with bibliometric methods. SCIE was<br />

used to collect articles published in Am J Gastroenterol ,<br />

Gastroenterology , Scand J Gastroenterol and WJG in<br />

2007, and comparison <strong>of</strong> the data was made. Comparison<br />

indicat<strong>or</strong>s included the article number <strong>of</strong> annual journals,<br />

cooperation degree <strong>of</strong> auth<strong>or</strong>s, cooperation rate, mean<br />

number <strong>of</strong> articles published in each WJG issue, number<br />

<strong>of</strong> countries <strong>of</strong> the first WJG auth<strong>or</strong>s, geographical<br />

distribution and article contribution ratio <strong>of</strong> all WJG<br />

auth<strong>or</strong>s and domestic auth<strong>or</strong>s.<br />

RESULTS: Of the 5851 articles covered in MEDLINE ,<br />

173, 236, 633, 826, 1496, 1382 and 1105 articles were<br />

cited from 2001 to 2007. The cooperation degree was<br />

5.11, 5.56, 5.75, 5.76, 6.31, 5.90 and 5.64 respectively.<br />

The cooperation rates was 94.80%, 99.15%, 98.89%,<br />

98.55%, 99.13%, 96.67% and 95.66%, respectively. The<br />

mean number <strong>of</strong> articles published in each WJG issue<br />

from 2001 to 2007 was 28, 39, 52, 34, 31, 28 and 23,<br />

respectively. The number <strong>of</strong> countries <strong>of</strong> the first WJG<br />

auth<strong>or</strong>s was 8, 8, 27, 32, 49, 61 and 56, respectively.<br />

The first auth<strong>or</strong>s <strong>of</strong> WJG came from 3 continents in 2001<br />

and covered 6 continents in 2006-2007. The number <strong>of</strong><br />

articles written by Asian auth<strong>or</strong>s was 136 (79.07%), 227<br />

(96.19%), 575 (90.98%), 713 (87.81%), 1111 (75.32%),<br />

www.wjgnet.com<br />

712 (53.98%) and 555 (53.21%), respectively in<br />

2001-2007. The number <strong>of</strong> articles written by European<br />

& American auth<strong>or</strong>s increased from 36 (20.93%)<br />

and 8 (3.39%) in 2001-2002 to 563 (42.68%) and<br />

452(43.34%) in 2006-2007. The number <strong>of</strong> countries<br />

except f<strong>or</strong> China contributing papers was increased.<br />

The number <strong>of</strong> articles written by first auth<strong>or</strong>s <strong>of</strong> Japan<br />

rose from 0 (0%) in 2001-2002 to 287 (12.15%) in<br />

2006-2007. The number <strong>of</strong> articles written by American<br />

auth<strong>or</strong>s increased from 6 (1.47%) in 2001-2002 to 158<br />

(6.69%) in 2006-2007. The number <strong>of</strong> articles written by<br />

Chinese auth<strong>or</strong>s was 136 (79.07%), 227 (96.19%), 548<br />

(86.71%), 669 (82.39%), 884 (59.93%), 380 (28.81%)<br />

and 320 (30.68%), respectively, in 2001 to 2007. The<br />

number <strong>of</strong> articles published in Am J Gastroenterol,<br />

Gastroenterology , Scand J Gastroenterol and WJG was<br />

565, 586, 238 and 1118, respectively in 2007. The<br />

cooperation degree was 4.77, 6.14, 5.95 and 5.64,<br />

respectively, in 2007. The cooperation rate was 95.40%,<br />

84.18%, 96.63% and 95.66%, respectively, in 2007. The<br />

number <strong>of</strong> countries <strong>of</strong> auth<strong>or</strong>s contributing papers was<br />

44, 35, 42 and 62, respectively, in 2007.<br />

CONCLUSION: The geographical distribution <strong>of</strong> WJG<br />

auth<strong>or</strong>s is wide f<strong>or</strong> the past 2 years. WJG has made a<br />

step onto international publishing, and drawn even m<strong>or</strong>e<br />

attentions from gastroenterology researchers. Its auth<strong>or</strong>s<br />

are distributed over 74 countries in 6 global continents,<br />

and the journal has become the main intermediary<br />

f<strong>or</strong> international gastroenterology researchers to<br />

demonstrate their research accomplishments.<br />

© 2008 WJG . All rights reserved.<br />

Key w<strong>or</strong>ds: Bibliometrics; W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology<br />

; Science citation index<br />

Peer reviewer: Sheng-Li Ren, PhD, Department <strong>of</strong> Publication,<br />

National Natural Science Foundation <strong>of</strong> China, Beijing 100085,<br />

China<br />

Yang H, Zhao YY. Variations <strong>of</strong> auth<strong>or</strong> <strong>or</strong>igins in W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong><br />

Gastroenterology during 2001-2007. W<strong>or</strong>ld J Gastroenterol 2008;<br />

14(19): 3108-3111 Available from: URL: http://www.wjgnet.<br />

com/1007-9327/14/3108.asp DOI: http://dx.doi.<strong>or</strong>g/10.3748/<br />

wjg.14.3108<br />

INTRODUCTION<br />

W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology (WJG) was first published

---

Yang H et al . WJG auth<strong>or</strong> variations 3109<br />

in 1995. This English journal is edited and published by<br />

The WJG Press and can be retrieved with the following<br />

citation tools: Current Contents ® /Clinical Medicine,<br />

Science Citation Index Expanded (also known as<br />

SciSearch ® ) and <strong>Journal</strong> Citation Rep<strong>or</strong>ts/Science Edition,<br />

Index Medicus, MEDLINE and PubMed, Chemical<br />

Abstracts, EMBASE/Excerpta Medica, Abstracts<br />

<strong>Journal</strong>s, Nature Clinical Practice Gastroenterology and<br />

Hepatology, CAB Abstracts and Global Health, etc. In<br />

recent years, Ma et al [1] has analyzed the articles covered<br />

in SCIE during 1998-2004, claiming that the self-citation<br />

rate is decreased. However, the citation rate by others<br />

is increased and the journal citation status is improved.<br />

The variations <strong>of</strong> WJG auth<strong>or</strong>s’ data in 2001 to 2007<br />

were comparatively analyzed. The cooperation degree,<br />

cooperation rate, number <strong>of</strong> countries and auth<strong>or</strong><br />

publishing ratios <strong>of</strong> domestic journal issues in American<br />

<strong>Journal</strong> <strong>of</strong> Gastroenterology, Gastroenterology, Scandinavian<br />

<strong>Journal</strong> <strong>of</strong> Gastroenterology, were also comparatively analyzed<br />

using the SCIE database.<br />

A bibliometric analysis <strong>of</strong> the variations in distributions<br />

<strong>of</strong> auth<strong>or</strong>s was made to show the improvements and<br />

sh<strong>or</strong>tcomings <strong>of</strong> WJG and speed up its development.<br />

MATERIALS AND METHODS<br />

WJG articles were searched from MEDLINE (by ISI Web<br />

<strong>of</strong> Knowledge) [2] in 2001-2007. Variations (cooperation<br />

degree, cooperation rate) and distributions <strong>of</strong> the first<br />

auth<strong>or</strong>s were analyzed with biliometric methods. Articles<br />

published in Am J Gastroenterol, Gastroenterology, Scand J<br />

Gastroenterol and WJG covered in SCIE [3] in 2007 were<br />

analyzed using Web <strong>of</strong> Science (meeting summaries were<br />

not covered). The auth<strong>or</strong>s, titles, addresses and other<br />

relevant data <strong>of</strong> the four journals in 2007 were processed<br />

through the SCIE’s ‘Refine Results’ function, and countries<br />

<strong>of</strong> auth<strong>or</strong>s, WJG auth<strong>or</strong>s, research institutions and their<br />

distribution were closely consistent with the current status<br />

and auth<strong>or</strong>s <strong>of</strong> articles published in WJG experienced<br />

difficulties.<br />

RESULTS<br />

WJG articles retrieval status with MEDLINE citation in<br />

2001-2007<br />

WJG was published bimonthly in 2001-2002, monthly in<br />

2003, semimonthly in 2004, and weekly from 2006. In 2001<br />

-2007, 173, 236, 633, 826, 1496, 1382 and 1105 articles<br />

published in WJG were covered in MEDLINE. The<br />

number <strong>of</strong> articles published in each issue <strong>of</strong> WJG was 28,<br />

39, 52, 34, 31, 28 and 23, respectively, in 2001-2007.<br />

Co-auth<strong>or</strong> articles published in WJG<br />

A total <strong>of</strong> 5851 articles published in WJG during<br />

2001-2007 were cited. The number <strong>of</strong> auth<strong>or</strong>s <strong>of</strong> these<br />

papers was 34415 and the cooperation degree was 5.11,<br />

5.56, 5.75, 5.76, 6.31, 5.90 and 5.64, respectively, with a<br />

mean cooperation degree <strong>of</strong> 5.88. The number <strong>of</strong> articles<br />

written by a single auth<strong>or</strong> was 137, accounting f<strong>or</strong> 2.34%<br />

<strong>of</strong> all articles. The number <strong>of</strong> co-auth<strong>or</strong> articles published<br />

in 2001-2007 was 5714 and the cooperation rate was<br />

70<br />

60<br />

50<br />

40<br />

30<br />

20<br />

10<br />

0<br />

8<br />

8<br />

27<br />

2001 2002 2003 2004 2005 2006 2007<br />

Figure 1 Distribution <strong>of</strong> first auth<strong>or</strong>s and countries in 2001-2007.<br />

94.80%, 99.15%, 98.89%, 98.55%, 99.13%, 96.67% and<br />

95.66% respectively, with a mean cooperation rate <strong>of</strong><br />

97.66%. The cooperation degree was slightly increased<br />

from 2001 to 2005 (Table 1).<br />

Distribution <strong>of</strong> first auth<strong>or</strong>s in WJG<br />

Only addresses <strong>of</strong> the first auth<strong>or</strong>s were marked in<br />

MEDLINE, and 5851 articles published in WJG were<br />

retrieved in 2001-2007, in which only 5689 articles had<br />

available addresses. The number <strong>of</strong> countries with their<br />

articles covered in MEDLINE was 8, 8, 27, 32, 49, 61 and<br />

56, respectively (Figure 1). The geographical distribution<br />

<strong>of</strong> WJG auth<strong>or</strong>s was increasingly broadened, especially<br />

in 2006 and 2007 during which the number <strong>of</strong> countries<br />

increased multiple folds.<br />

The geographical distribution <strong>of</strong> the auth<strong>or</strong>s with<br />

addresses in 5689 articles was categ<strong>or</strong>ized into 6 continents<br />

(Table 2). During 2001-2005, the maj<strong>or</strong>ity auth<strong>or</strong>s were<br />

from Asia, accounting f<strong>or</strong>136 (79.07%), 227 (96.19%), 575<br />

(90.98%), 713 (87.81%) and 1111 (75.32%), respectively.<br />

During 2006-2007, the number <strong>of</strong> auth<strong>or</strong>s from Asia was<br />

712 (53.98%), 555 (53.21%) respectively, showing that the<br />

number <strong>of</strong> Asian auth<strong>or</strong>s is declining. During 2006-2007,<br />

the geographical distribution <strong>of</strong> WJG auth<strong>or</strong>s covered<br />

all the 6 continents and the number <strong>of</strong> European and<br />

N<strong>or</strong>th America auth<strong>or</strong>s increased from 36 (20.93%) and 8<br />

(3.39%) in 2001-2002 to 563 (42.68%) and 452 (43.34%) in<br />

2006-2007 respectively.<br />

Geographical distribution <strong>of</strong> the first auth<strong>or</strong>s<br />

In <strong>or</strong>der to reflect the geographical distributions <strong>of</strong><br />

auth<strong>or</strong>s, a comparison <strong>of</strong> the distribution <strong>of</strong> WJG auth<strong>or</strong>s<br />

was perf<strong>or</strong>med. The number <strong>of</strong> articles contributed to<br />

WJG by the top 15 countries (Table 3) was 5167 (90.82%),<br />

the number <strong>of</strong> articles contributed to WJG by Chinese<br />

auth<strong>or</strong>s was 136 (79.07%), 227 (96.19%), 548 (86.71%),<br />

669 (82.39%), 884 (59.93%), 380 (28.81%) and 320<br />

(30.68%), respectively, in 2001-2007. The number <strong>of</strong><br />

articles contributed by Japanese auth<strong>or</strong>s increased from<br />

0 (0%) in 2001-2002 to 287 (12.15%) in 2006-2007, the<br />

number <strong>of</strong> articles contributed by the American auth<strong>or</strong>s<br />

was also increased from 6 (1.47%) in 2001-2002 to 158<br />

(6.69%) in 2006-2007. All countries, except f<strong>or</strong> China<br />

showed an increased number <strong>of</strong> contributed articles.<br />

32<br />

49<br />

61<br />

56<br />

www.wjgnet.com

---

3110 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

Table 1 Co-auth<strong>or</strong> articles published in WJG during 2001-2007<br />

Yr Distribution <strong>of</strong> co-auth<strong>or</strong> articles Total<br />

1 2 3 4 5 6 7 8 9 10 > 11<br />

(articles)<br />

Among the top 15 countries, 7 are in Asia, 7 in Europe,<br />

and 1 in N<strong>or</strong>th America.<br />

Data comparisons <strong>of</strong> gastroenterology-related journals<br />

The articles <strong>of</strong> Am J Gastroenterol, Gastroenterology and Scand<br />

J Gastroenterol were selected to compare with those <strong>of</strong> WJG.<br />

Am J Gastroenterol is an <strong>of</strong>ficial publication <strong>of</strong> the American<br />

College <strong>of</strong> Gastroenterology, and its IF was 5.608 in 2006,<br />

ranking 5 th in <strong>Journal</strong> Citation Rep<strong>or</strong>t(JCR). Gastroenterology<br />

is the <strong>of</strong>ficial journal <strong>of</strong> the American Gastroenterology<br />

Association (AGA) and its IF was 12.457 in 2006, ranking<br />

1 st in JCR. Scand J Gastroenterol published by Tayl<strong>or</strong> & Francis<br />

Group is the membership journal <strong>of</strong> the Gastroenterologic<br />

Societies <strong>of</strong> Denmark, Finland, Iceland, N<strong>or</strong>way and<br />

Sweden, and its IF was 1.869 in 2006. These four journals<br />

are most typical <strong>of</strong> all journals related to the field <strong>of</strong><br />

gastroenterology. The number <strong>of</strong> articles published in Am<br />

J Gastroenterol, Gastroenterology, Scand J Gastroenterol and WJG<br />

covered in SCIE was 565, 586, 238 and 1118, respectively,<br />

in 2007. The cooperation degree <strong>of</strong> auth<strong>or</strong>s was 4.77, 6.14,<br />

5.95 and 5.64, respectively; the cooperation rate was 95.40%,<br />

84.18%, 96.63% and 95.66% respectively, in 2007. The<br />

geographical distribution <strong>of</strong> auth<strong>or</strong>s’ was 44, 35, 42 and 62,<br />

respectively (Table 4). In 2007, The number <strong>of</strong> American<br />

auth<strong>or</strong>s contributing to Am J Gastroenterol and Gastroenterology<br />

accounted f<strong>or</strong> 47.43% and 50.85% respectively, the number<br />

<strong>of</strong> Swedish auth<strong>or</strong>s contributing to Scand J Gastroenterol<br />

accounted f<strong>or</strong> 18.07%, the number <strong>of</strong> N<strong>or</strong>thern Europe<br />

auth<strong>or</strong>s contributing to Scand J Gastroenterol accounted f<strong>or</strong><br />

45.38%, the number <strong>of</strong> Chinese auth<strong>or</strong>s contributing to<br />

WJG accounted f<strong>or</strong> 30.4%.<br />

DISCUSSION<br />

In 2001-2007, the number <strong>of</strong> articles covered in<br />

Auth<strong>or</strong>s Cooperation<br />

degree<br />

Cooperation<br />

rate (%)<br />

2001 9 18 20 33 26 20 20 14 5 2 6 173 884 5.11 94.80<br />

2002 2 20 23 44 35 39 30 20 10 2 11 236 1313 5.56 99.15<br />

2003 7 30 65 88 131 110 79 55 25 22 21 633 3637 5.75 98.89<br />

2004 12 47 82 112 146 154 105 71 43 25 29 826 4755 5.76 98.55<br />

2005 13 59 113 188 243 273 202 154 86 56 109 1496 9434 6.31 99.13<br />

2006 46 111 149 169 210 191 150 119 74 57 106 1382 8160 5.90 96.67<br />

2007 48 107 129 148 158 139 120 83 48 59 66 1105 6232 5.64 95.66<br />

Total 137 392 581 782 949 926 706 516 291 223 348 5851 34415 5.88 97.66<br />

Table 2 Geographical distribution <strong>of</strong> the auth<strong>or</strong>s in WJG<br />

Yr Distribution <strong>of</strong> the auth<strong>or</strong>s in 6 continents<br />

Africa Asia Europe N<strong>or</strong>th Oceania South<br />

America<br />

America<br />

2001 0 136 32 4 0 0<br />

2002 0 227 6 2 1 0<br />

2003 1 575 45 6 2 3<br />

2004 3 713 85 6 0 5<br />

2005 7 1111 314 28 4 11<br />

2006 11 712 453 110 10 23<br />

2007 9 555 359 93 13 14<br />

www.wjgnet.com<br />

Table 3 Distribution <strong>of</strong> the top 15 countries in WJG during<br />

2001-2007<br />

Country name 2001 2002 2003 2004 2005 2006 2007 Total<br />

China 136 227 548 669 884 380 320 3164<br />

Japan 6 19 133 170 117 445<br />

Germany 10 2 4 10 68 92 66 252<br />

Italy 9 15 56 79 56 215<br />

United States 4 2 5 6 19 77 81 194<br />

Turkey 17 24 31 43 62 177<br />

South K<strong>or</strong>ea 5 9 37 53 38 142<br />

Greece 2 6 34 45 31 118<br />

United Kingdom 18 3 1 16 28 22 88<br />

India 5 2 7 35 30 79<br />

Spain 1 2 13 34 21 71<br />

Poland 1 2 6 31 17 4 61<br />

Hungary 2 12 20 20 5 59<br />

Iran 2 2 7 25 18 54<br />

Thailand 1 4 14 16 13 48<br />

MEDLINE was 173, 236, 633, 826, 1496, 1382 and 1105<br />

respectively, the mean number <strong>of</strong> articles published in each<br />

issue was 28, 39, 52, 34, 31, 28 and 23 respectively. The<br />

number <strong>of</strong> articles published increased by 932 (638.73%)<br />

in 2007 compared to 2001.<br />

In 2001-2007, the cooperation degree was 5.11, 5.56,<br />

5.75, 5.76, 6.31, 5.90 and 5.64 respectively (mean 5.88), the<br />

cooperation rate was 94.80%, 99.15%, 98.89%, 98.55%,<br />

99.13%, 96.67% and 95.66% respectively (mean 97.66%).<br />

The mean number <strong>of</strong> co-auth<strong>or</strong>s and single auth<strong>or</strong>s<br />

showed a tendency to increase from 2001 to 2005, while<br />

slightly decreased in 2006 to 2007.<br />

The geographical distributions <strong>of</strong> auth<strong>or</strong>s in WJG were<br />

expanded from 4 continents in 2001 to the 6 continents in<br />

2006-2007, the number <strong>of</strong> countries increased in multiple<br />

folds. The number <strong>of</strong> auth<strong>or</strong>s from Europe and N<strong>or</strong>th<br />

America increased while that from Asia decreased. The<br />

number <strong>of</strong> countries increased from 8, 8, 27, 32 and 49 in<br />

2001-2005 to 61 and 56 in 2006-2007.<br />

The number <strong>of</strong> Chinese auth<strong>or</strong>s accounted f<strong>or</strong><br />

79.07%, 96.19%, 86.71%, 82.39%, 59.93%, 28.81% and<br />

30.68% respectively, in 2001-2007, showing a maximum<br />

decrease <strong>of</strong> 67.38%. The number <strong>of</strong> Japanese, American,<br />

German and Italian auth<strong>or</strong>s increased greatly, showing an<br />

increasing trend <strong>of</strong> international auth<strong>or</strong>s contributing to<br />

WJG.<br />

When compared with Am J Gastroenterol, Gastroenterology,<br />

Scand J Gastroenterol, the geographical distribution <strong>of</strong>

---

Yang H et al . WJG auth<strong>or</strong> variations 3111<br />

Table 4 Data comparisons <strong>of</strong> the 4 representative gastroenterology journals in 2007<br />

<strong>Journal</strong> name Articles<br />

published in 2007<br />

Cooperation<br />

degree in 2007<br />

Cooperation<br />

rate in 2007<br />

auth<strong>or</strong>s in WJG was greatly expanded in the <strong>or</strong>der <strong>of</strong><br />

China, Asia and 6 continents. The mean number <strong>of</strong><br />

published articles in each issue showed a prominent<br />

decrease, which may improve the quality <strong>of</strong> articles<br />

published in WJG. The cooperation degree and rate were<br />

reasonable, and the number <strong>of</strong> Chinese auth<strong>or</strong>s was<br />

slightly increased in 2007.<br />

In conclusion, the geographical distribution <strong>of</strong><br />

WJG auth<strong>or</strong>s is w<strong>or</strong>ldwide. WJG has made a step onto<br />

international level, thus drawing m<strong>or</strong>e attentions from<br />

gastroenterology researchers. The journal has become<br />

the main intermediary f<strong>or</strong> international researchers in<br />

Geographical<br />

distribution <strong>of</strong> auth<strong>or</strong>s<br />

gastroenterology to demonstrate their research accomplishments.<br />

REFERENCES<br />

Ratio <strong>of</strong> articles contributed<br />

by domestic auth<strong>or</strong>s (%)<br />

Am J Gastroenterol 565 4.77 95.40 44 United States 47.43<br />

Gastroenterology 586 6.14 84.18 35 United States 50.85<br />

Scand J Gastroenterol 238 5.95 96.63 42 Sweden 18.07<br />

WJG 1118 5.64 95.66 62 China 30.4<br />

1 Ma LS, Pan BR, Li WZ, Guo SY. Improved citation status <strong>of</strong><br />

W<strong>or</strong>ld <strong>Journal</strong> Gastroenterology in 2004: Analysis <strong>of</strong> all reference<br />

citations by WJG and citations <strong>of</strong> WJG articles by other SCI<br />

journals during 1998-2004. W<strong>or</strong>ld J Gastroenterol 2005; 11: 1-6<br />

2 MEDLINE. Available from: URL: http://apps.isiknowledge.<br />

com/<br />

3 SCIE. Available from: URL: http://www.isinet.com/cgi-bin/<br />

jrnlst/jlsubcatg.cgi?PC=D<br />

L- Edit<strong>or</strong> Wang XL E- Edit<strong>or</strong> Yin DH<br />

www.wjgnet.com

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3112<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

ACKNOWLEDGMENTS<br />

Acknowledgments to Reviewers <strong>of</strong> W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong><br />

Gastroenterology<br />

Many reviewers have contributed their expertise and time<br />

to the peer review, a critical process to ensure the quality<br />

<strong>of</strong> W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology. The edit<strong>or</strong>s and auth<strong>or</strong>s<br />

<strong>of</strong> the articles submitted to the journal are grateful to the<br />

following reviewers f<strong>or</strong> evaluating the articles (including<br />

those published in this issue and those rejected f<strong>or</strong> this<br />

issue) during the last editing time period.<br />

Takafumi Ando, MD, PhD<br />

Department <strong>of</strong> Gastroenterology, Nagoya University Graduate School <strong>of</strong><br />

Medicine, Therapeutic Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550,<br />

Japan<br />

Taku Aoki, MD<br />

Division <strong>of</strong> Hepato-Biliary-Pancreatic and Transplantation Surgery, Department<br />

<strong>of</strong> Surgery, Graduate School <strong>of</strong> Medicine, University <strong>of</strong> Tokyo,7-3-1 Hongo,<br />

Bunkyo-ku, Tokyo, 113-8655, Japan<br />

Carla W Brady, MD, MHS<br />

Duke University Medical Center, Division <strong>of</strong> Gastroenterology, DUMC Box 3913,<br />

Durham, NC 27705, United States<br />

J<strong>or</strong>di Camps, PhD<br />

Centre de Recerca Biomèdica, Hospital Universitari de Sant Joan, C. Sant Joan<br />

s/n, 43201 Reus, Catalunya, Spain<br />

Ravi S Chari, MD, Associate Pr<strong>of</strong>ess<strong>or</strong><br />

Division <strong>of</strong> Hepatobiliary Surgery and Liver Transplantation, Departments <strong>of</strong><br />

Surgery and Cancer Biology,1313 21st Avenue South Suite 801 Oxf<strong>or</strong>d House,<br />

Vanderbilt University Medical Center, Nashville, TN 37232-4753, United States<br />

Wang-Xue Chen, Dr<br />

Institute f<strong>or</strong> Biological Sciences, National Research Concil Canada, 100 Sussex<br />

Drive, Room 3100, Ottawa, Ontario K1A 0R6, Canada<br />

John Y Chiang, MD, PhD, Pr<strong>of</strong>ess<strong>or</strong><br />

Department <strong>of</strong> Biochemistry and Molecular Pathology, N<strong>or</strong>theastern Ohio Univ.<br />

College <strong>of</strong> Medicine, 4209 State Route 44, P.O. Box 95, Rootstown, OH 44272,<br />

United States<br />

Vicente Felipo, Dr<br />

Vicente Felipo, Lab<strong>or</strong>at<strong>or</strong>y <strong>of</strong> Neurobiology, Fundación C.V. Centro de<br />

Investigacion Principe Felipe, Avda Autopista del Saler, 16, 46013 Valencia, Spain<br />

Zvi Fireman, MD, Associate Pr<strong>of</strong>ess<strong>or</strong> <strong>of</strong> Medicine<br />

Head, Gastroenterology Department, Hillel Yaffe Med Ctr, POB 169, 38100,<br />

Hadera, Israel<br />

Jean L Frossard, Dr<br />

Division <strong>of</strong> gastroenterology, Geneva University Hospital, Rue Micheli du Crest,<br />

1211 Geneva 14, Switzerland<br />

Diego Garcia-Compean, MD, Pr<strong>of</strong>ess<strong>or</strong><br />

Faculty <strong>of</strong> Medicine, University Hospital, Department <strong>of</strong> Gastroenterology,<br />

Autonomous University <strong>of</strong> Nuevo Leon, Ave Madero y Gonzalitos, 64700<br />

Monterrey, NL, México<br />

Subrata Ghosh, Pr<strong>of</strong>ess<strong>or</strong><br />

Department <strong>of</strong> Gastroenterology, Imperial College London, Hammersmith<br />

Hospital, 9 Lady Aylesf<strong>or</strong>d Avenue, Stanm<strong>or</strong>e, Middlesex, London HA7 4FG,<br />

United Kingdom<br />

Salvat<strong>or</strong>e Gruttadauria, MD, Assistant Pr<strong>of</strong>ess<strong>or</strong><br />

Abdominal Transplant Surgery, ISMETT, Via E. Tricomi, 190127 Palermo, Italy<br />

Kazuhiro Hanazaki, MD, Pr<strong>of</strong>ess<strong>or</strong> and Chairman<br />

Department <strong>of</strong> Surgery, Kochi Medical School, Kochi University, Kohasu,<br />

Okohcho, Nankoku, Kochi 783-8505, Japan<br />

Aydin Karabacakoglu, Dr, Assistant Pr<strong>of</strong>ess<strong>or</strong><br />

Department <strong>of</strong> Radiology, Meram Medical Faculty, Selcuk University, Konya<br />

42080, Turkey<br />

Paul Y Kwo, Pr<strong>of</strong>ess<strong>or</strong><br />

Gastroenterology and Hepatology Division, Indiana University School <strong>of</strong><br />

Medicine, 975 West Walnut, IB 327, Indianapolis, Indiana 46202-5121,<br />

United States<br />

Shou-Dong Lee, Pr<strong>of</strong>ess<strong>or</strong><br />

Department <strong>of</strong> Medicine, Taipei Veterans General Hospital, 201 Shih-Pai Road,<br />

Sec. 2. Taipei 112, Taiwan, China<br />

Anders E Lehmann, PhD, Associate Pr<strong>of</strong>ess<strong>or</strong><br />

Seni<strong>or</strong> Principal Scientist, Bioscience, AstraZeneca R&D Mölndal, Mölndal,<br />

Sweden<br />

Cynthia Levy, Dr<br />

Division <strong>of</strong> Gastroenterology, Hepatology and Nutrition, University <strong>of</strong> Fl<strong>or</strong>ida,<br />

MSB-Rm M 440, 1600 SW Archer Road, Gainesville, FL 32608, United States<br />

James D Luketich, MD, Pr<strong>of</strong>ess<strong>or</strong> and Chief<br />

Division <strong>of</strong> Th<strong>or</strong>acic and F<strong>or</strong>egut Surgery University <strong>of</strong> Pittsburgh Medical<br />

Center Pittsburgh, PA 15213,United States<br />

Peter J Mannon, MD<br />

Mucosal Immunity Section, Lab<strong>or</strong>at<strong>or</strong>y <strong>of</strong> Host Defense, National Institute <strong>of</strong><br />

Allergy, Lab<strong>or</strong>at<strong>or</strong>y <strong>of</strong> Clinical Investigation, Building 10/CRC, Room 6-3742,<br />

9000 Rockville Pike, Bethesda, Maryland 20892, United States<br />

Jose JG Marin, Pr<strong>of</strong>ess<strong>or</strong><br />

Head <strong>of</strong> the Departamento Physiology and Pharmacology, University <strong>of</strong><br />

Salamanca, CIBERehd, Campus Miguel de Unamuno, ED-S09, Salamanca 37007,<br />

Spain<br />

Didier Merlin, PhD, Associate Pr<strong>of</strong>ess<strong>or</strong><br />

Department <strong>of</strong> Medicine Division <strong>of</strong> Digestive Diseases, Em<strong>or</strong>y University, 615<br />

Michael Street, Atlanta, GA 30322, United States<br />

Fock Kwong Ming, Pr<strong>of</strong>ess<strong>or</strong>, Seni<strong>or</strong> Consultant<br />

Department <strong>of</strong> Medicine, Changi General Hospital, 2 Simei Street 3, Singap<strong>or</strong>e<br />

529889, Singap<strong>or</strong>e<br />

Sri P Misra, Pr<strong>of</strong>ess<strong>or</strong><br />

Gastroenterology, Moti Lal Nehru Medical College, Allahabad 211001, India<br />

Emiko Mizoguchi, MD, PhD<br />

Department <strong>of</strong> Medicine, Gastrointestinal Unit, GRJ 702, Massachusetts General<br />

Hospital, Boston, MA 02114, United States<br />

Justin H Nguyen, MD<br />

Division <strong>of</strong> Transplant Sugery, Mayo Clinic, 4205 Belf<strong>or</strong>t Road, Suite 1100,<br />

Jacksonville, Fl<strong>or</strong>ida 32256, United States<br />

Ramesh Roop Rai, MD, DM (Gastro.) Pr<strong>of</strong>ess<strong>or</strong> & Head<br />

Department <strong>of</strong> Gastroenterology & Hepatology, S.M.S. Medical College &<br />

Hospital, Jaipur 302019, (Rajasthan), India<br />

Markus Reiser, Pr<strong>of</strong>ess<strong>or</strong>, Dr<br />

Gastroenterology-Hepatology, Ruhr-Universit?t Bochum, Bürkle-de-la-Camp-<br />

Platz 1, Bochum 44789, Germany<br />

Ian C Roberts-Thomson, Pr<strong>of</strong>ess<strong>or</strong><br />

Department <strong>of</strong> Gastroenterology and Hepatology, The Queen Elizabeth Hospital,<br />

28 Woodville Road, Woodville South 5011, Australia<br />

Francis Seow-Choen, Pr<strong>of</strong>ess<strong>or</strong><br />

Seow-Choen Col<strong>or</strong>ectal Centre, Mt Elizabeth Medical Centre, Singap<strong>or</strong>e, 3 Mt<br />

Elizabeth Medical Centre #09-10, 228510, Singap<strong>or</strong>e<br />

Tadashi Shimoyama, MD<br />

Hirosaki University, 5 Zaifu-cho, Hirosaki 036-8562, Japan

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3113<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

Meetings<br />

Events Calendar 2008-2009<br />

FALK SYMPOSIA 2008<br />

January 24-25, Frankfurt, Germany<br />

Falk W<strong>or</strong>kshop: Perspectives in Liver<br />

Transplantation<br />

International Gastroenterological<br />

Congresses 2008<br />

February 14-16, Paris, France<br />

EASL-AASLD-APASL-ALEH-IASL<br />

Conference Hepatitis B and C virus<br />

resistance to antiviral therapies<br />

www.easl.ch/hepatitis-conference<br />

February 14-17, Berlin, Germany<br />

8 th International Conference on New<br />

Trends in Immunosuppression and<br />

Immunotherapy<br />

www.kenes.com/immuno<br />

February 28, Lyon, France<br />

3 rd Congress <strong>of</strong> ECCO - the European<br />

Crohn’s and Colitis Organisation<br />

Infl ammat<strong>or</strong>y Bowel Diseases 2008<br />

www.ecco-ibd.eu<br />

March 10-13, Birmingham, UK<br />

British Society <strong>of</strong> Gastroenterology<br />

Annual Meeting<br />

E-mail: BSG@mailbox.ulcc.ac.uk<br />

March 14-15, HangZhou, China<br />

Falk Symposium 163: Chronic<br />

Infl ammation <strong>of</strong> Liver and Gut<br />

March 23-26, Seoul, K<strong>or</strong>ea<br />

Asian Pacifi c Association f<strong>or</strong> the<br />

Study <strong>of</strong> the Liver<br />

18 th Conference <strong>of</strong> APASL: New<br />

H<strong>or</strong>izons in Hepatology<br />

www.apaslseoul2008.<strong>or</strong>g<br />

March 29-April 1, Shanghai, China<br />

Shanghai - Hong Kong International<br />

Liver Congress<br />

www.livercongress.<strong>or</strong>g<br />

April 05-09, Monte-Carlo (Grimaldi<br />

F<strong>or</strong>um), Monaco<br />

OESO 9 th W<strong>or</strong>ld Congress, The<br />

Gastro-esophageal Refl ux Disease:<br />

from Refl ux to Mucosal Infl ammation<br />

- Management <strong>of</strong> Adeno- carcinomas<br />

Email: robert.giuli@oeso.<strong>or</strong>g<br />

April 18-22, Buenos Aires, Argentina<br />

9 th W<strong>or</strong>ld Congress <strong>of</strong> the<br />

International Hepato-Pancreato<br />

Biliary Association<br />

Association f<strong>or</strong> the Study <strong>of</strong> the Liver<br />

www.ca-ihpba.com.ar<br />

April 23-27, Milan, Italy<br />

43 rd Annual Meeting <strong>of</strong> the European<br />

Association f<strong>or</strong> the Study <strong>of</strong> the Liver<br />

www.easl.ch<br />

May 2-3, Budapest, Hungary<br />

Falk Symposium 164: Intestinal<br />

Dis<strong>or</strong>ders<br />

May 18-21, San Diego, Calif<strong>or</strong>nia, USA<br />

Digestive Disease Week 2008<br />

June 4-7, Helsinki, Finland<br />

The 39 th N<strong>or</strong>dic Meeting <strong>of</strong><br />

Gastroenterology<br />

www.congrex.com/ngc2008<br />

June 6-8, Prague, Czech Republic<br />

3 rd Annual European Meeting:<br />

Perspectives in Inflammat<strong>or</strong>y Bowel<br />

Diseases<br />

Email: meetings@imedex.com<br />

June 13-14, Amsterdam, Netherlands<br />

Falk Symposium 165: XX<br />

International Bile Acid Meeting. B<br />

ile Acid Biology and Therapeutic<br />

Actions<br />

June 25-28, Barcelona, Spain<br />

10 th W<strong>or</strong>ld Congress on<br />

Gastrointestinal Cancer<br />

Imedex and ESMO<br />

Email: meetings@imedex.com<br />

June 25-28, Lodz, Poland<br />

Joint Meeting <strong>of</strong> the European<br />

Pancreatic Club (EPC)<br />

and the International Association <strong>of</strong><br />

Pancreatology (IAP)<br />

E-mail: <strong>of</strong>fi ce@epc-iap2008.<strong>or</strong>g<br />

www.e-p-c.<strong>or</strong>g<br />

www.pancreatology.<strong>or</strong>g<br />

June 26-28, Bratislava, Slovakia<br />

5 th Central European<br />

Gastroenterology Meeting<br />

www.ceurgem2008.cz<br />

September 10-13, Budapest, Hungary<br />

11 th W<strong>or</strong>ld Congress <strong>of</strong> the<br />

International Society f<strong>or</strong> Diseases <strong>of</strong><br />

the Esophagus<br />

Email: isde@isde.net<br />

September 13-16, New Delhi, India<br />

Asia Pacifi c Digestive Week<br />

E-mail: apdw@apdw2008.net<br />

III FALK GASTRO-CONFERENCE<br />

September 17, Mainz, Germany<br />

Falk W<strong>or</strong>kshop: Strategies <strong>of</strong> Cancer<br />

Prevention in Gastroenterology<br />

September 18-19, Mainz, Germany<br />

Falk Symposium 166:<br />

GI Endoscopy - Standards & Innovations<br />

September 18-20, Prague, Czech<br />

Republic<br />

Prague Hepatology Meeting 2008<br />

www.czech-hepatology.cz/phm2008<br />

September 20-21, Mainz, Germany<br />

Falk Symposium 167:<br />

Liver Under Constant Attack - From<br />

Fat to Viruses<br />

September 24-27, Nantes, France<br />

Third Annual Meeting<br />

European Society <strong>of</strong> Coloproctology<br />

www.escp.eu.com<br />

October 8-11, Istanbul, Turkey<br />

18 th W<strong>or</strong>ld Congress <strong>of</strong> the International<br />

Association <strong>of</strong> Surgeons,<br />

Gastroenterologists and Oncologists<br />

E-mail: <strong>or</strong>kun.sahin@serenas.com.tr<br />

October 18-22, Vienna, Austria<br />

16 th United European<br />

Gastroenterology Week<br />

www.negf.<strong>or</strong>g<br />

www.acv.at<br />

October 22-25, Brisbane, Australia<br />

Anstralian Gastroenterology Week 2008<br />

Email: gesa@gesa.<strong>or</strong>g.au<br />

October 31-November 4, Moscone<br />

West Convention Center, San<br />

Francisco, CA<br />

59 th AASLD Annual Meeting and<br />

Postgraduate Course<br />

The Liver Meeting<br />

Inf<strong>or</strong>mation: www.aasld.<strong>or</strong>g<br />

November 6-9, Lucerne, Switzerland<br />

Neurogastroenterology & Motility<br />

Joint International Meeting 2008<br />

Email: ngm2008@mci-group.com<br />

www.ngm2008.com<br />

November 12, Santiago de Chile, Chile<br />

Falk W<strong>or</strong>kshop: Digestive Diseases:<br />

State <strong>of</strong> the Art and Daily Practice<br />

December 7-9, Seoul, K<strong>or</strong>ea<br />

6 th International Meeting<br />

Hepatocellular Carcinoma: Eastern<br />

and Western Experiences<br />

E-mail: sglee@amc.seoul.kr<br />

INFORMATION FOR ALL<br />

FALK FOUNDATION e.V.<br />

Email: symposia@falkfoundation.de<br />

www.falkfoundation.de<br />

Advanced Courses - European<br />

Institute <strong>of</strong> Telesurgery EITS - 2008<br />

Strasbourg, France<br />

January 18-19, March 28-29, June 6-7,<br />

October 3-4<br />

N.O.T.E.S<br />

April 3-5, November 27-29<br />

Laparoscopic Digestive Surgery<br />

June 27-28, November 7-8<br />

Laparoscopic Col<strong>or</strong>ectal Surgery<br />

July 3-5<br />

Interventional GI Endoscopy<br />

Techniques<br />

Contact address f<strong>or</strong> all courses:<br />

info@eits.fr<br />

International Gastroenterological<br />

Congresses 2009<br />

March 23-26, Glasgow, Scotland<br />

Meeting <strong>of</strong> the British Society <strong>of</strong><br />

Gastroenterology (BSG)<br />

E-mail: bsg@mailbox.ulcc.ac.uk<br />

May 17-20, Denver, Col<strong>or</strong>ado, USA<br />

Digestive Disease Week 2009<br />

November 21-25, London, UK<br />

Gastro 2009 UEGW/W<strong>or</strong>ld Congress<br />

<strong>of</strong> Gastroenterology<br />

www.gastro2009.<strong>or</strong>g<br />

Global Collab<strong>or</strong>ation f<strong>or</strong><br />

Gastroenterology<br />

F<strong>or</strong> the first time in the hist<strong>or</strong>y <strong>of</strong><br />

gastroenterology, an international<br />

conference will take place which<br />

joins together the f<strong>or</strong>ces <strong>of</strong> four<br />

pre-eminent <strong>or</strong>ganisations: Gastro<br />

2009, UEGW/WCOG London. The<br />

United European Gastroenterology<br />

Federation (UEGF) and the W<strong>or</strong>ld<br />

Gastroenterology Organisation<br />

(WGO), together with the W<strong>or</strong>ld<br />

Organisation <strong>of</strong> Digestive Endoscopy<br />

(OMED) and the British Society <strong>of</strong><br />

Gastroenterology (BSG), are jointly<br />

<strong>or</strong>ganising a landmark meeting<br />

in London from November 21-25,<br />

2009. This collab<strong>or</strong>ation will ensure<br />

the perfect balance <strong>of</strong> basic science<br />

and clinical <strong>practice</strong>, will cover<br />

all disciplines in gastroenterology<br />

(endoscopy, digestive oncology,<br />

nutrition, digestive surgery,<br />

hepatology, gastroenterology) and<br />

ensure a truly global context; all<br />

presented in the exciting setting <strong>of</strong><br />

the city <strong>of</strong> London. Attendance is<br />

expected to reach rec<strong>or</strong>d heights<br />

as participants are provided with<br />

a compact “all-in-one” programme<br />

merging the best <strong>of</strong> several GI<br />

meetings. Faculty and participants<br />

from all c<strong>or</strong>ners <strong>of</strong> the earth will<br />

merge to provide a truly global<br />

environment conducive to the<br />

exchange <strong>of</strong> ideas and the f<strong>or</strong>ming <strong>of</strong><br />

friendships and collab<strong>or</strong>ations.

---

Online Submissions: wjg.wjgnet.com W<strong>or</strong>ld J Gastroenterol 2008 May 21; 14(19): 3114-3116<br />

www.wjgnet.com W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology ISSN 1007-9327<br />

wjg@wjgnet.com © 2008 WJG. All rights reserved.<br />

Instructions to auth<strong>or</strong>s<br />

GENERAL INFORMATION<br />

W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology (WJG, ISSN 1007-9327 CN 14-1219/R)<br />

is a weekly open access peer-reviewed journal supp<strong>or</strong>ted by an edit<strong>or</strong>ial<br />

board consisting <strong>of</strong> 1208 experts in gastroenterology and hepatology<br />

from 60 countries. The aim <strong>of</strong> the journal is to deliver the most<br />

clinically relevant <strong>or</strong>iginal and commentary articles to readers, and to<br />

make the full text publicly available to all clinicians, scientists, patients<br />

and biomedical students on an unrestricted platf<strong>or</strong>m, so that they<br />

can access and learn about the most recent key advances in the fi eld.<br />

In addition to the open access nature, another key characteristic<br />

<strong>of</strong> WJG is its reading guidance f<strong>or</strong> each article which includes<br />

background, research frontier, related rep<strong>or</strong>ts, breakthroughs,<br />

applications, terminology, and comments <strong>of</strong> peer reviewers f<strong>or</strong> the<br />

general readers.<br />

WJG publishes articles on esophageal, gastrointestinal,<br />

hepatobiliary and pancreatic tum<strong>or</strong>s, and other esophageal,<br />

gastrointestinal, hepatic-biliary and pancreatic diseases in relation<br />

to epidermiology, immunology, microbiology, motility & nerve-gut<br />

interaction, endocrinology, nutrition & obesity, endoscopy, imaging<br />

and advanced hi-technology.<br />

The main goal <strong>of</strong> WJG is to publish high quality commentary<br />

articles contributed by leading experts in gastroenterology and<br />

hepatology and <strong>or</strong>iginal articles that combine the clinical <strong>practice</strong><br />

and advanced basic research, to provide an interactive platf<strong>or</strong>m f<strong>or</strong><br />

clinicians and researchers in internal medicine, surgery, infectious<br />

diseases, traditional Chinese medicine, oncology, integrated Chinese<br />

and Western medicine, imaging, endoscopy, interventional therapy,<br />

pathology and other basic medical specialities, and thus eventually<br />

improving the clinical <strong>practice</strong> and healthcare f<strong>or</strong> patients.<br />

Indexed and abstracted in<br />

Current Contents®/Clinical Medicine, Science Citation Index<br />

Expanded (also known as SciSearch®) and <strong>Journal</strong> Citation Rep<strong>or</strong>ts/<br />

Science Edition, Index Medicus, MEDLINE and PubMed, Chemical<br />

Abstracts, EMBASE/Excerpta Medica, Abstracts <strong>Journal</strong>s, Nature<br />

Clinical Practice Gastroenterology and Hepatology, CAB Abstracts and<br />

Global Health. ISI JCR 2003-2000 IF: 3.318, 2.532, 1.445 and 0.993.<br />

Published by<br />

The WJG Press<br />

SUBMISSION OF MANUSCRIPTS<br />

Manuscripts should be typed double-spaced on A4 (297 mm × 210<br />

mm) white paper with outer margins <strong>of</strong> 2.5 cm. Number all pages<br />

consecutively, and start each <strong>of</strong> the following sections on a new page:<br />

Title Page, Abstract, Introduction, Materials and Methods, Results,<br />

Discussion, Acknowledgements, References, Tables, Figures, and<br />

Figure Legends. Neither the edit<strong>or</strong>s n<strong>or</strong> the publisher are responsible<br />

f<strong>or</strong> the opinions expressed by contribut<strong>or</strong>s. Manuscripts f<strong>or</strong>mally<br />

accepted f<strong>or</strong> publication become the permanent property <strong>of</strong> The<br />

WJG Press, and may not be reproduced by any means, in whole <strong>or</strong><br />

in part, without the written permission <strong>of</strong> both the auth<strong>or</strong>s and the<br />

publisher. We reserve the right to copy-edit and put onto our website<br />

accepted manuscripts. Auth<strong>or</strong>s should follow the relevant guidelines<br />

f<strong>or</strong> the care and use <strong>of</strong> lab<strong>or</strong>at<strong>or</strong>y animals <strong>of</strong> their institution <strong>or</strong><br />

national animal welfare committee. F<strong>or</strong> the sake <strong>of</strong> transparency in<br />

regard to the perf<strong>or</strong>mance and rep<strong>or</strong>ting <strong>of</strong> clinical trials, we end<strong>or</strong>se<br />

the policy <strong>of</strong> the International Committee <strong>of</strong> Medical <strong>Journal</strong> Edit<strong>or</strong>s<br />

to refuse to publish papers on clinical trial results if the trial was not<br />

rec<strong>or</strong>ded in a publicly-accessible registry at its outset. The only register<br />

now available, to our knowledge, is http://www. clinicaltrials.gov<br />

spons<strong>or</strong>ed by the United States National Library <strong>of</strong> Medicine and we<br />

encourage all potential contribut<strong>or</strong>s to register with it. However, in the<br />

case that other registers become available you will be duly notifi ed. A<br />

letter <strong>of</strong> recommendation from each auth<strong>or</strong>’s <strong>or</strong>ganization should be<br />

provided with the contributed article to ensure the privacy and secrecy<br />

<strong>of</strong> research is protected.<br />

Auth<strong>or</strong>s should retain one copy <strong>of</strong> the text, tables, photographs<br />

and illustrations because rejected manuscripts will not be returned<br />

to the auth<strong>or</strong>(s) and the edit<strong>or</strong>s will not be responsible f<strong>or</strong> loss <strong>or</strong><br />

www.wjgnet.com<br />

damage to photographs and illustrations sustained during mailing.<br />

Online submissions<br />

Manuscripts should be submitted through the Online Submission<br />

System at: http://wjg.wjgnet.com. Auth<strong>or</strong>s are highly recommended<br />

to consult the ONLINE INSTRUCTIONS TO AUTHORS (http://<br />

www.wjgnet.com/wjg/help/instructions.jsp) bef<strong>or</strong>e attempting to<br />

submit online. F<strong>or</strong> assistance, auth<strong>or</strong>s encountering problems with the<br />

Online Submission System may send an email describing the problem<br />

to submission@wjgnet.com, <strong>or</strong> by telephone: +86-10-85381892. If<br />

you submit your manuscript online, do not make a postal contribution.<br />

Repeated online submission f<strong>or</strong> the same manuscript is strictly<br />

prohibited.<br />

MANUSCRIPT PREPARATION<br />

All contributions should be written in English. All articles must be<br />

submitted using w<strong>or</strong>d-processing s<strong>of</strong>tware. All submissions must be<br />

typed in 1.5 line spacing and 12 pt. font with ample margins. The<br />

preferred font is Book Antiqua. Style should conf<strong>or</strong>m to our house<br />

f<strong>or</strong>mat. Required inf<strong>or</strong>mation f<strong>or</strong> each <strong>of</strong> the manuscript sections is<br />

as follows:<br />

Title page<br />

Full manuscript title, running title, all auth<strong>or</strong>(s) name(s), affi liations,<br />

institution(s) and/<strong>or</strong> department(s) where the w<strong>or</strong>k was carried out;<br />

auth<strong>or</strong> contributions; disclosure <strong>of</strong> any financial supp<strong>or</strong>t f<strong>or</strong> the<br />

research; and the name, full address, telephone and fax numbers<br />

and email address <strong>of</strong> the c<strong>or</strong>responding auth<strong>or</strong> should be included.<br />

Titles should be concise and inf<strong>or</strong>mative (remove all unnecessary<br />

w<strong>or</strong>ds), emphasize what is new, and avoid abbreviations. A sh<strong>or</strong>t<br />

running title <strong>of</strong> less than 40 letters should be provided. List the<br />

auth<strong>or</strong>(s)’ name(s) as follows: initial and/<strong>or</strong> fi rst name, middle name<br />

<strong>or</strong> initial(s), and full family name.<br />

Auth<strong>or</strong> controbutions: The f<strong>or</strong>mat <strong>of</strong> this section should be<br />

like this: Auth<strong>or</strong> contributions: Wang CL and Liang L contributed<br />

equally to this w<strong>or</strong>k; Wang CL, Liang L, Fu JF, Zou CC, Hong F and<br />

Wu XM designed research; Wang CL, Zou CC, Hong F and Wu XM<br />

perf<strong>or</strong>med research; Xue JZ and Lu JR contributed new reagents/<br />

analytic tools; Wang CL, Liang L and Fu JF analyzed data; and Wang<br />

CL, Liang L and Fu JF wrote the paper.<br />

Peer reviewers: All articles received are subject to peer review.<br />

N<strong>or</strong>mally, three experts are invited f<strong>or</strong> each article. Decision f<strong>or</strong><br />

acceptance is made only when at least two experts recommend<br />

an article f<strong>or</strong> publication. Reviewers f<strong>or</strong> accepted manuscripts are<br />

acknowledged in each manuscript, and reviewers <strong>of</strong> articles which<br />

were not accepted will be acknowledged at the end <strong>of</strong> each issue.<br />

To ensure the quality <strong>of</strong> the articles published in WJG, reviewers <strong>of</strong><br />

accepted manuscripts will be announced by publishing the name, title/<br />

position and institution <strong>of</strong> the reviewer in the footnote accompanying<br />

the printed article. F<strong>or</strong> example, reviewers: Pr<strong>of</strong>ess<strong>or</strong> Jing-Yuan Fang,<br />

Shanghai Institute <strong>of</strong> Digestive Disease, Shanghai, Affiliated Renji<br />

Hospital, Medical Faculty, Shanghai Jiaotong University, Shanghai,<br />

China; Pr<strong>of</strong>ess<strong>or</strong> Xin-Wei Han, Department <strong>of</strong> Radiology, The<br />

First Affi liated Hospital, Zhengzhou University, Zhengzhou, Henan<br />

Province, China; and Pr<strong>of</strong>ess<strong>or</strong> Anren Kuang, Department <strong>of</strong> Nuclear<br />

Medicine, Huaxi Hospital, Sichuan University, Chengdu, Sichuan<br />

Province, China.<br />

Abstract<br />

An inf<strong>or</strong>mative, structured abstract <strong>of</strong> no m<strong>or</strong>e than 350 w<strong>or</strong>ds should<br />

accompany each manuscript. Abstracts f<strong>or</strong> <strong>or</strong>iginal contributions<br />

should be structured into the following sections: AIM: Only the<br />

purpose should be included. METHODS: The materials, techniques,<br />

instruments and equipment, and the experimental procedures<br />

should be included. RESULTS: The observed and experimental<br />

results, including data, effects, outcome, etc. should be included.<br />

Auth<strong>or</strong>s should present P value where necessary, and also include any<br />

signifi cant data. CONCLUSION: Accurate view and the value <strong>of</strong> the<br />

results should be included.<br />

The f<strong>or</strong>mat f<strong>or</strong> structured abstracts can be found at: http://<br />

www.wjgnet.com/wjg/help/11.doc.

---

Instructions to auth<strong>or</strong>s 3115<br />

Key w<strong>or</strong>ds<br />

Please list 5-10 key w<strong>or</strong>ds, selected mainly from Index Medicus, which<br />

refl ect the content <strong>of</strong> the study.<br />

Text<br />

F<strong>or</strong> articles <strong>of</strong> these sections, <strong>or</strong>iginal articles, rapid communication<br />

and case rep<strong>or</strong>ts, the main text should be structured into the following<br />

sections: INTRODUCTION, MATERIALS AND METHODS,<br />

RESULTS and DISCUSSION, and should include appropriate Figures<br />

and Tables. Data should be presented in the body text <strong>or</strong> in Figures<br />

and Tables, but not in both. The main text f<strong>or</strong>mat <strong>of</strong> these sections,<br />

edit<strong>or</strong>ial, topic highlight, case rep<strong>or</strong>t, letters to the edit<strong>or</strong>s, should be<br />

found at: http://www.wjgnet.com/wjg/help/instructions.jsp.<br />

Illustrations<br />

Figures should be numbered as 1, 2, 3, etc., and mentioned clearly<br />

in the main text. Provide a brief title f<strong>or</strong> each fi gure on a separate<br />

page. Detailed legends should not be provided under the figures.<br />

This part should be added into the text where the figures are<br />

applicable. Figures should be either Photoshop <strong>or</strong> Illustrat<strong>or</strong><br />

files (in tiff, eps, jpeg f<strong>or</strong>mats) at high-resolution. Examples can<br />

be found at: http://www.wjgnet.com/1007-9327/13/4520.<br />

pdf; http://www.wjgnet.com/1007-9327/13/4554.pdf; http://<br />

www.wjgnet.com/1007-9327/13/4891.pdf; http://www.<br />

wjgnet.com/1007-9327/13/4986.pdf; http://www.wjgnet.<br />

com/1007-9327/13/4498.pdf. Keeping all elements compiled is<br />

necessary in line-art image. Scale bars should be used rather than<br />

magnifi cation fact<strong>or</strong>s, with the length <strong>of</strong> the bar defi ned in the legend<br />

rather than on the bar itself. File names should identify the fi gure and<br />

panel. Avoid layering type directly over shaded <strong>or</strong> textured areas. Please<br />

use unif<strong>or</strong>m legends f<strong>or</strong> the same subjects. F<strong>or</strong> example: Figure 1<br />

Pathological changes in atrophic gastritis after treatment. A: ...; B:<br />

...; C: ...; D: ...; E: ...; F: ...; G: …etc. It is our principle to publish high<br />

resolution-fi gures f<strong>or</strong> the printed and E-versions.<br />

Tables<br />

Three-line tables should be numbered 1, 2, 3, etc., and mentioned<br />

clearly in the main text. Provide a brief title f<strong>or</strong> each table. Detailed<br />

legends should not be included under tables, but rather added into<br />

the text where applicable. The inf<strong>or</strong>mation should complement<br />

but not duplicate the text. Use one h<strong>or</strong>izontal line under the title, a<br />

second under column heads, and a third below the Table, above any<br />

footnotes. Vertical and italic lines should be omitted.<br />

Notes in tables and illustrations<br />

Data that are not statistically signifi cant should not be noted. a P < 0.05,<br />

b P < 0.01 should be noted (P > 0.05 should not be noted). If there<br />

are other series <strong>of</strong> P values, c P < 0.05 and d P < 0.01 are used. A third<br />

series <strong>of</strong> P values can be expressed as e P < 0.05 and f P < 0.01. Other<br />

notes in tables <strong>or</strong> under illustrations should be expressed as 1 F, 2 F, 3 F;<br />

<strong>or</strong> sometimes as other symbols with a superscript (Arabic numerals) in<br />

the upper left c<strong>or</strong>ner. In a multi-curve illustration, each curve should<br />

be labeled with ●, ○, ■, □, ▲, △, etc., in a certain sequence.<br />

Acknowledgments<br />

Brief acknowledgments <strong>of</strong> persons who have made genuine<br />

contributions to the manuscripts and who end<strong>or</strong>se the data and<br />

conclusions should be included. Auth<strong>or</strong>s are responsible f<strong>or</strong> obtaining<br />

written permission to use any copyrighted text and/<strong>or</strong> illustrations.<br />

REFERENCES<br />

Coding system<br />

The auth<strong>or</strong> should number the references in Arabic numerals acc<strong>or</strong>ding<br />

to the citation <strong>or</strong>der in the text. Put reference numbers in square<br />

brackets in superscript at the end <strong>of</strong> citation content <strong>or</strong> after the cited<br />

auth<strong>or</strong>’s name. F<strong>or</strong> citation content which is part <strong>of</strong> the narration, the<br />

coding number and square brackets should be typeset n<strong>or</strong>mally. F<strong>or</strong><br />

example, “Crohn’s disease (CD) is associated with increased intestinal<br />

permeability [1,2] ”. If references are cited directly in the text, they should<br />

be put together within the text, f<strong>or</strong> example, “From references [19,22-24] , we<br />

know that...”<br />

When the auth<strong>or</strong>s write the references, please ensure that the<br />

<strong>or</strong>der in text is the same as in the references section, and also ensure<br />

the spelling accuracy <strong>of</strong> the fi rst auth<strong>or</strong>’s name. Do not list the same<br />

citation twice.<br />

PMID requirement<br />

PMID roots in the abstract serial number indexed by PubMed<br />

(http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed).<br />

The auth<strong>or</strong> should supply the PMID f<strong>or</strong> journal citation. F<strong>or</strong> those<br />

references that have not been indexed by PubMed, a printed copy <strong>of</strong><br />

the fi rst page <strong>of</strong> the full reference should be submitted.<br />

The accuracy <strong>of</strong> the inf<strong>or</strong>mation f<strong>or</strong> journal citations is very<br />

imp<strong>or</strong>tant. Using the reference testing system, the auth<strong>or</strong>s and edit<strong>or</strong><br />

should check the auth<strong>or</strong>s name, title, journal title, publication date,<br />

volume number, start page, and end page. We will interlink all references<br />

with PubMed in an ASP fi le so that the readers can immediately access<br />

the abstract <strong>of</strong> the citations online.<br />

DOI requirement<br />

A CrossRef DOI® (Digital Object Identifier) name is a unique<br />

string created to identify a piece <strong>of</strong> scholarly content in the online<br />

environment. The auth<strong>or</strong> should supply the DOIs f<strong>or</strong> journal<br />

citation(doi:10.3748/wjg.13.6458). This link (http://www.crossref.<strong>or</strong>g/<br />

SimpleTextQuery/) allows you to retrieve Digital Object Identifi ers<br />

(DOIs) f<strong>or</strong> journal articles, books, and chapters by simply cutting and<br />

pasting the reference list into the box. You may use the f<strong>or</strong>m with any<br />

reference style, although the tool w<strong>or</strong>ks most reliably if references<br />

are f<strong>or</strong>matted in a standard style such as shown in this example:<br />

Assimakopoulos SF, Scopa CD, Vagianos CE. Pathophysiology <strong>of</strong><br />

increased intestinal permeability in obstructive jaundice. W<strong>or</strong>ld J<br />

Gastroenterol 2007; 13(48): 6458-6464<br />

The accuracy <strong>of</strong> the inf<strong>or</strong>mation <strong>of</strong> journal citations is very<br />

imp<strong>or</strong>tant. We will interlink all references with DOI in ASP fi le so that<br />

readers can access the abstracts <strong>of</strong> cited articles online immediately.<br />

Style f<strong>or</strong> journal references<br />

Auth<strong>or</strong>s: the name <strong>of</strong> the fi rst auth<strong>or</strong> should be typed in bold-faced<br />

letters. The family name <strong>of</strong> all auth<strong>or</strong>s should be typed with the<br />

initial letter capitalized, followed by their abbreviated fi rst and middle<br />

initials. (F<strong>or</strong> example, Lian-Sheng Ma is abbreviated as Ma LS, Bo-<br />

Rong Pan as Pan BR). The title <strong>of</strong> the cited article and italicized<br />

journal title (journal title should be in its abbreviated f<strong>or</strong>m as shown<br />

in PubMed), publication date, volume number (in black), start page,<br />

and end page [PMID: 11819634 DOI: 10.3748/wjg.13.5396].<br />

Style f<strong>or</strong> book references<br />

Auth<strong>or</strong>s: the name <strong>of</strong> the fi rst auth<strong>or</strong> should be typed in bold-faced<br />

letters. The surname <strong>of</strong> all auth<strong>or</strong>s should be typed with the initial<br />

letter capitalized, followed by their abbreviated middle and fi rst initials.<br />

(F<strong>or</strong> example, Lian-Sheng Ma is abbreviated as Ma LS, Bo-Rong<br />

Pan as Pan BR) Book title. Publication number. Publication place:<br />

Publication press, Year: start page and end page.<br />

F<strong>or</strong>mat<br />

<strong>Journal</strong>s<br />

English journal article (list all auth<strong>or</strong>s and include the PMID where applicable)<br />

1 Jung EM, Clevert DA, Schreyer AG, Schmitt S, Rennert J,<br />

Kubale R, Feuerbach S, Jung F. Evaluation <strong>of</strong> quantitative<br />

contrast harmonic imaging to assess malignancy <strong>of</strong> liver<br />

tum<strong>or</strong>s: A prospective controlled two-center study. W<strong>or</strong>ld J<br />

Gastroenterol 2007; 13: 6356-6364 [PMID: 18081224 DOI:<br />

10.3748/wjg.13.6356]<br />

Chinese journal article (list all auth<strong>or</strong>s and include the PMID where applicable)<br />

2 Lin GZ, Wang XZ, Wang P, Lin J, Yang FD. Immunologic effect<br />

<strong>of</strong> Jianpi Yishen decoction in treatment <strong>of</strong> Pixu-diarrhoea.<br />

Shijie Huaren Xiaohua Zazhi 1999; 7: 285-287<br />

In press<br />

3 Tian D, Araki H, Stahl E, Bergelson J, Kreitman M. Signature<br />

<strong>of</strong> balancing selection in Arabidopsis. Proc Natl Acad Sci USA<br />

2006; In press<br />

Organization as auth<strong>or</strong><br />

4 Diabetes Prevention Program Research Group. Hypertension,<br />

insulin, and proinsulin in participants with impaired glucose<br />

tolerance. Hypertension 2002; 40: 679-686 [PMID: 12411462]<br />

Both personal auth<strong>or</strong>s and an <strong>or</strong>ganization as auth<strong>or</strong><br />

5 Vallancien G, Emberton M, Harving N, van Mo<strong>or</strong>selaar RJ; Alf-<br />

One Study Group. Sexual dysfunction in 1, 274 European men<br />

suffering from lower urinary tract symptoms. J Urol 2003; 169:<br />

2257-2261 [PMID: 12771764]<br />

No auth<strong>or</strong> given<br />

6 21st century heart solution may have a sting in the tail. BMJ

---

3116 ISSN 1007-9327 CN 14-1219/R W<strong>or</strong>ld J Gastroenterol May 21, 2008 Volume 14 Number 19<br />

2002; 325: 184 [PMID: 12142303]<br />

Volume with supplement<br />

7 Geraud G, Spierings EL, Keywood C. Tolerability and safety<br />

<strong>of</strong> frovatriptan with sh<strong>or</strong>t- and long-term use f<strong>or</strong> treatment <strong>of</strong><br />

migraine and in comparison with sumatriptan. Headache 2002;<br />

42 Suppl 2: S93-99 [PMID: 12028325]<br />

Issue with no volume<br />

8 Banit DM, Kaufer H, Hartf<strong>or</strong>d JM. Intraoperative frozen<br />

section analysis in revision total joint arthroplasty. Clin Orthop<br />

Relat Res 2002; (401): 230-238 [PMID: 12151900]<br />

No volume <strong>or</strong> issue<br />

9 Outreach: Bringing HIV-positive individuals into care. HRSA<br />

Careaction 2002; 1-6 [PMID: 12154804]<br />

Books<br />

Personal auth<strong>or</strong>(s)<br />

10 Sherlock S, Dooley J. Diseases <strong>of</strong> the liver and billiary system.<br />

9th ed. Oxf<strong>or</strong>d: Blackwell Sci Pub, 1993: 258-296<br />

Chapter in a book (list all auth<strong>or</strong>s)<br />

11 Lam SK. Academic investigat<strong>or</strong>’s perspectives <strong>of</strong> medical<br />

treatment f<strong>or</strong> peptic ulcer. In: Swabb EA, Azabo S. Ulcer disease:<br />

investigation and basis f<strong>or</strong> therapy. New Y<strong>or</strong>k: Marcel Dekker,<br />

1991: 431-450<br />

Auth<strong>or</strong>(s) and edit<strong>or</strong>(s)<br />

12 Breedlove GK, Sch<strong>or</strong>fheide AM. Adolescent pregnancy. 2nd<br />

ed. Wiecz<strong>or</strong>ek RR, edit<strong>or</strong>. White Plains (NY): March <strong>of</strong> Dimes<br />

Education Services, 2001: 20-34<br />

Conference proceedings<br />

13 Harnden P, J<strong>of</strong>fe JK, Jones WG, edit<strong>or</strong>s. Germ cell tumours V.<br />

Proceedings <strong>of</strong> the 5th Germ cell tumours Conference; 2001 Sep<br />

13-15; Leeds, UK. New Y<strong>or</strong>k: Springer, 2002: 30-56<br />

Conference paper<br />

14 Christensen S, Oppacher F. An analysis <strong>of</strong> Koza's computational<br />

eff<strong>or</strong>t statistic f<strong>or</strong> genetic programming. In: Foster JA, Lutton E,<br />

Miller J, Ryan C, Tettamanzi AG, edit<strong>or</strong>s. Genetic programming.<br />

EuroGP 2002: Proceedings <strong>of</strong> the 5th European Conference on<br />

Genetic Programming; 2002 Apr 3-5; Kinsdale, Ireland. Berlin:<br />

Springer, 2002: 182-191<br />

Electronic journal (list all auth<strong>or</strong>s)<br />

M<strong>or</strong>se SS. Fact<strong>or</strong>s in the emergence <strong>of</strong> infectious diseases. Emerg<br />

Infect Dis serial online, 1995-01-03, cited 1996-06-05; 1(1): 24<br />

screens. Available from: URL: http//www.cdc.gov/ncidod/<br />

EID/eid.htm<br />

Patent (list all auth<strong>or</strong>s)<br />

16 Pagedas AC, invent<strong>or</strong>; Ancel Surgical R&D Inc., assignee.<br />

Flexible endoscopic grasping and cutting device and positioning<br />

tool assembly. United States patent US 20020103498. 2002 Aug 1<br />

Inappropriate references<br />

Auth<strong>or</strong>s should always cite references that are relevant to their<br />

article, and avoid any inappropriate references. Inappropriate<br />

references include those linked with a hyphen when the difference<br />

between the two numbers is greater than fi ve. F<strong>or</strong> example, [1-6],<br />

[2-14] and [1, 3, 4-10, 22] are all considered inappropriate references.<br />

Auth<strong>or</strong>s should not cite their own unrelated published articles.<br />

Statistical data<br />

Write as mean ± SD <strong>or</strong> mean ± SE.<br />

Statistical expression<br />

Express t test as t (in italics), F test as F (in italics), chi square test as χ 2<br />

(in Greek), related coeffi cient as r (in italics), degree <strong>of</strong> freedom as υ (in<br />

Greek), sample number as n (in italics), and probability as P (in italics).<br />

Units<br />

Use SI units. F<strong>or</strong> example: body mass, m (B) = 78 kg; blood pressure,<br />

p (B) = 16.2/12.3 kPa; incubation time, t (incubation) = 96 h, blood<br />

glucose concentration, c (glucose) 6.4 ± 2.1 mmol/L; blood CEA<br />

mass concentration, p (CEA) = 8.6 24.5 μg/L; CO2 volume fraction,<br />

50 mL/L CO2, not 5% CO2; likewise f<strong>or</strong> 40 g/L f<strong>or</strong>maldehyde, not<br />

10% f<strong>or</strong>malin; and mass fraction, 8 ng/g, etc. Arabic numerals such as<br />

23, 243, 641 should be read 23 243 641.<br />

The f<strong>or</strong>mat f<strong>or</strong> how to accurately write common units and<br />

quantums can be found at: http://www.wjgnet.com/wjg/help/15.doc.<br />

Abbreviations<br />

Standard abbreviations should be defi ned in the abstract and on fi rst<br />

mention in the text. In general, terms should not be abbreviated unless<br />

they are used repeatedly and the abbreviation is helpful to the reader.<br />

Permissible abbreviations are listed in Units, Symbols and Abbreviations:<br />

A Guide f<strong>or</strong> Biological and Medical Edit<strong>or</strong>s and Auth<strong>or</strong>s (Ed. Baron<br />

DN, 1988) published by The Royal Society <strong>of</strong> Medicine, London.<br />

Certain commonly used abbreviations, such as DNA, RNA, HIV,<br />

LD50, PCR, HBV, ECG, WBC, RBC, CT, ESR, CSF, IgG, ELISA, PBS,<br />

ATP, EDTA, mAb, can be used directly without further explanation.<br />

Italics<br />

Quantities: t time <strong>or</strong> temperature, c concentration, A area, l length, m<br />

mass, V volume.<br />

Genotypes: gyrA, arg 1, c myc, c fos, etc.<br />

Restriction enzymes: EcoRI, HindI, BamHI, Kbo I, Kpn I, etc.<br />

Biology: H pyl<strong>or</strong>i, E coli, etc.<br />

SUBMISSION OF THE REVISED MANUSCRIPTS AFTER<br />

ACCEPTED<br />

Please revise your article acc<strong>or</strong>ding to the revision policies <strong>of</strong> WJG.<br />

The revised version including manuscript and high-resolution image<br />

fi gures (if any) should be copied on a fl oppy <strong>or</strong> compact disk. The<br />

auth<strong>or</strong> should send the revised manuscript, along with printed highresolution<br />

col<strong>or</strong> <strong>or</strong> black and white photos, copyright transfer letter,<br />

and responses to the reviewers by courier (such as EMS/DHL).<br />

Edit<strong>or</strong>ial Offi ce<br />

W<strong>or</strong>ld <strong>Journal</strong> <strong>of</strong> Gastroenterology<br />

Edit<strong>or</strong>ial Department: Room 903<br />

Ocean International Center, Building D<br />

No. 62 Dongsihuan Zhonglu<br />

Chaoyang District, Beijing 100025, China<br />

E-mail: wjg@wjgnet.com<br />

http://www.wjgnet.com<br />

Telephone: +86-10-59080039<br />

Fax: +86-10-85381893<br />

Language evaluation<br />

The language <strong>of</strong> a manuscript will be graded bef<strong>or</strong>e it is sent f<strong>or</strong><br />

revision. (1) Grade A: pri<strong>or</strong>ity publishing; (2) Grade B: min<strong>or</strong> language<br />

polishing; (3) Grade C: a great deal <strong>of</strong> language polishing needed; (4)<br />

Grade D: rejected. Revised articles should reach Grade A <strong>or</strong> B.<br />

Copyright assignment f<strong>or</strong>m<br />

Please download a Copyright assignment f<strong>or</strong>m from http://www.<br />

wjgnet.com/wjg/help/9.doc.<br />

Responses to reviewers<br />

Please revise your article acc<strong>or</strong>ding to the comments/suggestions<br />

provided by the reviewers. The f<strong>or</strong>mat f<strong>or</strong> responses to the reviewers’<br />

comments can be found at: http://www.wjgnet.com/wjg/help/10.doc.<br />

Pro<strong>of</strong> <strong>of</strong> fi nancial supp<strong>or</strong>t<br />

F<strong>or</strong> paper supp<strong>or</strong>ted by a foundation, auth<strong>or</strong>s should provide a copy<br />

<strong>of</strong> the document and serial number <strong>of</strong> the foundation.<br />

Links to documents related to the manuscript<br />

WJG will be initiating a platf<strong>or</strong>m to promote dynamic interactions<br />

between the edit<strong>or</strong>s, peer reviewers, readers and auth<strong>or</strong>s. After a<br />

manuscript is published online, links to the PDF version <strong>of</strong> the<br />

submitted manuscript, the peer-reviewers’ rep<strong>or</strong>t and the revised<br />

manuscript will be put on-line. Readers can make comments on the peer<br />

reviewer’s rep<strong>or</strong>t, auth<strong>or</strong>s’ responses to peer reviewers, and the revised<br />

manuscript. We hope that auth<strong>or</strong>s will benefi t from this feedback and be<br />

able to revise the manuscript acc<strong>or</strong>dingly in a timely manner.<br />

Science news releases<br />

Auth<strong>or</strong>s <strong>of</strong> accepted manuscripts are suggested to write a science<br />

news item to promote their articles. The news will be released<br />

rapidly at EurekAlert/AAAS (http://www.eurekalert.<strong>or</strong>g). The<br />

title f<strong>or</strong> news items should be less than 90 characters; the summary<br />

should be less than 75 w<strong>or</strong>ds; and main body less than 500 w<strong>or</strong>ds.<br />

Science news items should be lawful, ethical, and strictly <strong>based</strong> on<br />

your <strong>or</strong>iginal content with an attractive title and interesting pictures.<br />

Publication fee<br />

Auth<strong>or</strong>s <strong>of</strong> accepted articles must pay a publication fee.<br />

EDITORIAL, TOPIC HIGHLIGHTS, BOOK REVIEWS and<br />

LETTERS TO THE EDITOR are published free <strong>of</strong> charge.