Linnaeus was right all along: Ulva and Enteromorpha are not distinct ...

Eur. J. Phycol. (August 2003), 38: 277 – 294. 

Linnaeus was right all along: Ulva and Enteromorpha are not 

distinct genera 

HILLARY S. HAYDEN 1 , JAANIKA BLOMSTER 2 *, CHRISTINE A. MAGGS 2 , 

PAUL C. SILVA 3 , MICHAEL J. STANHOPE 2# AND J. ROBERT WAALAND 1 

1Department of Botany, Box 355325, University of Washington, Seattle, Washington 98195-5325, USA 

2School of Biology and Biochemistry, Queen’s University, Medical Biology Centre, 97 Lisburn Road, Belfast, BT9 7BL, 

Northern Ireland, UK 

3University Herbarium, University of California, Berkeley, CA 94720-2465, USA 

(Received 25 June 2002; accepted 16 May 2003) 

Ulva, one of the first Linnaean genera, was later circumscribed to consist of green seaweeds with distromatic blades, and 

Enteromorpha Link was established for tubular forms. Although several lines of evidence suggest that these generic 

constructs are artificial, Ulva and Enteromorpha have been maintained as separate genera. Our aims were to determine 

phylogenetic relationships among taxa currently attributed to Ulva, Enteromorpha, Umbraulva Bae et I.K. Lee and the 

monotypic genus Chloropelta C.E. Tanner, and to make any nomenclatural changes justified by our findings. Analyses of 

nuclear ribosomal internal transcribed spacer DNA (ITS nrDNA) (29 ingroup taxa including the type species of Ulva and 

Enteromorpha), the chloroplast-encoded rbcL gene (for a subset of taxa) and a combined data set were carried out. All trees 

had a strongly supported clade consisting of all Ulva, Enteromorpha and Chloropelta species, but Ulva and Enteromorpha 

were not monophyletic. The recent removal of Umbraulva olivascens (P.J.L. Dangeard) Bae et I.K. Lee from Ulva is 

supported, although the relationship of the segregate genus Umbraulva to Ulvaria requires further investigation. These 

results, combined with earlier molecular and culture data, provide strong evidence that Ulva, Enteromorpha and Chloropelta 

are not distinct evolutionary entities and should not be recognized as separate genera. A comparison of traits for surveyed 

species revealed few synapomorphies. Because Ulva is the oldest name, Enteromorpha and Chloropelta are here reduced to 

synonymy with Ulva, and new combinations are made where necessary. 

Key words: Chloropelta, Enteromorpha, nuclear ribosomal internal transcribed spacer DNA (ITS nrDNA), rbcL, Ulva, 

Umbraulva 

Introduction 

‘Ulva is distinguished from Enteromorpha on the 

basis of its distromatic blade, which in certain 

species (e.g. Ulva linza) may become tubular at 

the margins and thus approach the situation in 

Enteromorpha wherein at least the adult thalli are 

markedly tubular and hence monostromatic. 

This criterion is sometimes difficult to apply, 

and opinion is divided as to whether such species 

as U. linza should be referred to Ulva or 

Enteromorpha. There is perhaps something to 

be said in favor of those early workers who 

treated Enteromorpha as a section of Ulva.’ 

(Silva, 1952) 

Correspondence to: H. Hayden. e-mail: hhayden@u.washington.edu 

*Present address: Division of Systematic Biology, PO Box 7, 

University of Helsinki, 00014 Helsinki, Finland. 

# Present address: Bioinformatics, GlaxoSmithKline, 1250 

S. Collegeville Road, Collegeville, PA 19426, USA. 

ISSN 0967-0262 print/ISSN 1469-4433 online # 2003 British Phycological Society 

DOI: 10.1080/1364253031000136321 

‘A given swarmer population [of U. lactuca] may 

produce all Enteromorpha-like plants, all distromatic 

Ulva plants, a mixture of both types, or 

plants displaying both morphologies on the same 

plant.’ 

(Bonneau, 1977) 

‘The similarity of the abnormal filamentous 

uniseriate growth of Ulva and Enteromorpha 

and the fact that even with bacterial reinfection 

the Ulva-58 [isolate] produces at best thalli 

similar to Enteromorpha support the conclusion 

of Bonneau (1977) that there are at present no 

valid criteria for the maintenance of Ulva and 

Enteromorpha as separate genera.’ 

(Provasoli & Pintner, 1980) 

Despite evidence to the contrary, the cosmopolitan 

algal genera Ulva L. and Enteromorpha Link have 

been maintained to the present day (e.g. Gabrielson 

et al., 2000; Graham & Wilcox, 2000). The

H. S. Hayden et al. 

separation is convenient, because the majority of 

currently recognized species can be readily assigned 

to one genus or the other on the basis of 

morphology. The genus Ulva was one of the first 

named by Linnaeus (1753) and initially included a 

variety of unrelated algae. In the nineteenth 

century its members were split into several genera. 

Green seaweeds with distromatic blades were 

maintained in Ulva, and tubular green seaweeds 

were moved to Enteromorpha (Link, 1820). Papenfuss 

(1960) argued that Linnaeus based his 

diagnosis of Ulva on Enteromorpha intestinalis 

(the type species of Enteromorpha) so that the 

names Ulva and Enteromorpha should both be 

typified by E. intestinalis, but the type of Ulva is 

now conserved with Ulva lactuca L. (Greuter et al., 

2000). Of the more than 140 Ulva and 135 

Enteromorpha species described worldwide (Index 

Nominum Algarum, 2002), approximately 50 Ulva 

and 35 Enteromorpha species are currently recognized 

(Guiry & NicDonncha, 2002). 

Several lines of evidence suggest that these 

generic constructs are artificial. Species exist in 

nature that have intermediate forms, such as E. 

linza with an Enteromorpha-like tubular base and 

Ulva-like distromatic blade distally, and several 

culture studies have revealed flexibility between 

tubular and blade morphologies. Gayral (1959, 

1967) reported the development of tubular, or 

partially tubular, thalli in cultures of some Ulva 

species. Bonneau (1977) observed clonal progeny of 

U. lactuca with distromatic, partially distromatic or 

completely tubular blades, as well as individuals 

that were completely distromatic in one area of the 

blade and tubular in another. Føyn (1960, 1961) 

produced stable phenotypic mutants of U. mutabilis 

with tubular fronds that were capable of 

successful mating with wild-type individuals. Additionally, 

axenic culture experiments have revealed 

similarities that span generic boundaries. In the 

absence of native bacteria, Ulva and Enteromorpha 

cultures displayed similar abnormal morphologies 

(Provasoli, 1965; Berglund, 1969; Kapraun, 1970; 

Fries, 1975; Provasoli & Pintner, 1980). 

Most molecular phylogenies corroborate results 

from culture experiments. Four studies that include 

more than one or two representatives of each genus 

have been published (Blomster et al., 1999; Tan et 

al., 1999; Woolcott & King, 1999; Malta et al., 

1999). Among these, Tan et al. (1999) is the most 

extensive with 21 Ulva and Enteromorpha species 

sampled primarily from Europe. Based on nuclear 

ribosomal internal transcribed spacer DNA (ITS 

nrDNA) trees, the authors proposed that Enteromorpha 

be collapsed into Ulva. Other ITS nrDNA 

studies of European taxa (Blomster et al., 1999; 

Malta et al., 1999) supported their findings. 

However, preliminary results for taxa from eastern 

Australia based on the more conserved plastidencoded 

RUBISCO large subunit gene (rbcL) 

supported separation of the two genera (Woolcott 

& King, 1999). 

The aims of the present study were to determine 

the phylogenetic relationships of taxa currently 

attributed to Ulva and Enteromorpha and to make 

any nomenclatural changes justified by our findings. 

To do this, we included the type species of 

Ulva and Enteromorpha, and sampled from a broad 

geographical area. We also sampled two species 

formerly included in Ulva – Umbraulva olivascens 

(P.J.L. Dangeard) Bae et I.K. Lee and Chloropelta 

caespitosa C.E. Tanner – to investigate their 

relationship to Ulva and Enteromorpha taxa. We 

obtained sequences of ITS nrDNA for all 29 

ingroup taxa; the chloroplast-encoded rbcL gene 

was sequenced for a subset of taxa, for which 

combined analyses were also carried out. 

Materials and methods 

278 

Northeast Pacific collections (Table 1) were isolated into 

culture when possible. Unialgal cultures were grown in 

Guillard’s f/2 enriched seawater at 158C in glass culture 

vessels under 30 – 50 mmol m 72 s 71 in a 16 h light:8 h 

dark photoregime. Ulva collections from Australia, 

Chile, Hawaii, Spain and Japan were received as silicagel-preserved 

specimens. Vouchers for collections were 

deposited in the University of Washington Herbarium 

(WTU). Herbarium studies of type and other relevant 

material were carried out in the Natural History 

Museum London (BM) and the Dillenian Herbarium, 

Oxford University (OXF). All herbarium abbreviations 

are as listed in the Index Herbariorum (http://www.nybg.org/bsci/ih/ih.html). 

One Chloropelta, one Umbraulva, 17 Ulva and 10 

Enteromorpha accessions were included in ITS nrDNA 

analyses. rbcL sequences were available only from algal 

samples collected by the present authors, with the 

exception of Ulva rigida for which amplification difficulties 

were experienced. Thus, a subset of one Chloropelta, 

one Umbraulva, 12 Ulva and seven Enteromorpha 

samples were included in rbcL analyses (Table 1). Taxa 

were chosen for outgroup comparison on the basis of 

prior molecular analyses of generic relationships in the 

Ulvales (Hayden & Waaland, 2002). In each case the 

type species of the genus was studied, as follows (with 

approximate number of species in each genus noted in 

parentheses): Blidingia minima var. minima (5), Kornmannia 

leptoderma (1), Percursaria percursa (2) and 

Ulvaria obscura var. blyttii (2). All outgroups were used 

in the rbcL analysis, but B. minima var. minima and K. 

leptoderma were excluded from ITS nrDNA analyses 

because large sections of the spacers in these taxa were 

unalignable with ingroup taxa. 

DNA extraction from silica-gel-preserved specimens 

was preceded by a rehydration step in which 14 – 18 mg 

of material was rehydrated in 200 ml of double-distilled, 

UV-treated water at 48C for 10 min. Total DNA was 

extracted from fresh cultured or rehydrated material

Ulva and Enteromorpha are not distinct genera 

Table 1. Details of the sampled taxa 

Taxon Collection information or ITS rDNA sequence origin 

using a modified CTAB method (Doyle & Doyle, 1990; 

Hughey et al., 2001). rbcL sequences of eight European 

taxa were obtained from genomic DNA previously used 

for ITS nrDNA sequences published elsewhere (Table 1). 

Total genomic DNA (10 – 20 ng) was added to six 

25 ml PCR reactions each containing final concentrations 

of 1 6 PCR Buffer II (PE Applied Biosystems), 1.5 mM 

MgCl 2, 0.8 mM dNTPs (GibcoBRL), 0.3 U AmpliTaq 

DNA Polymerase (PE Applied Biosystems) and 0.8 mM 

of each primer. ITS nrDNA reactions also contained 5% 

DMSO (Sigma). Six reactions were performed in order 

to produce more product and to avoid sequence errors 

resulting from PCR amplification. PCR amplification 

ITS 

rDNA rbcL 

Chloropelta caespitosa C.E. Tanner Kobe, Hyogo Pref., Japan. 22 Mar 2000. Coll. H. 

Kawai 

AY260556 AY255858 

Enteromorpha clathrata (Roth) Greville Blomster et al. 1999 (as E. muscoides) AF127170 AY255862 

E. compressa (L.) Nees Blomster et al. 1998 AF035350 AY255859 

E. flexuosa (Wulfen) J. Agardh Leskinen & Pamilo 1997 AJ234306 na 

E. intestinalis (L.) Nees Blomster et al. 1998 AF035342 AY255860 

E. intestinaloides Koeman et van den Hoek Tan et al. 1999 AJ234303 na 

E. linza (L.) J. Agardh Humboldt Bay, CA USA, 19 Jun 2000. Coll. H.S. 

Hayden & F. Shaunessey 

AY260557 AY255861 

E. procera Ahlner Coll. J. Blomster AY260558 AY255863 

E. prolifera (O.F. Mu¨ ller.) J. Agardh Tan et al. 1999 AJ234304 AY255864 

Enteromorpha sp. I Bodega Bay, CA, USA. 17 Jun 2000. Coll. H.S. Hayden AY260559 AY255865 

Enteromorpha sp. II Tan et al. 1999 AJ234308 na 

Ulva armoricana Dion, de Reviers et Coat Coat et al. 1998 na na 

U. australis Areschoug Woolcott & King 1999 AF099726 na 

U. californica Wille in Collins, Holden et Setchell La Jolla, CA, USA. 14 Jun 1999. Coll. H.S. Hayden AY260560 AY255866 

U. fasciata Delile Kihei, Maui, USA. 6 Feb 2000. Coll. L. Hodgson AY260561 AY255867 

U. fenestrata Postels et Ruprecht San Juan Is., WA, USA. 15 Jun 1998. Coll. H.S. 

Hayden & D.J. Garbary, MA715 

AY260562 AF499668 

U. lactuca L. Tan et al. 1999 AJ234310 AF499669 

U. lobata (Kützing) Setchell et Gardner Newport, OR, USA. 16 May 1999. Coll. H.S. Hayden 

& A. Whitmer, MA716 a 

AY260563 AY255868 

U. pertusa Kjellman Tan et al. 1999 AJ234321 na 

U. pseudocurvata Koeman et van den Hoek Tan et al. 1999 AJ234312 AY255869 

U. rigida C. Agardh Cádiz, Spain. Coll. J. Berges AY260565 na 

U. rotundata Bliding Coat et al. 1998 na na 

U. scandinavica Bliding Tan et al. 1999 AJ234317 AY255870 

Ulva sp. I Coihuin, Puerto Montt, Chile. 17 Oct 2000. Coll. J.R. 

Waaland 

AY260566 AY255871 

Ulva sp. II Tamarama, Sydney, NSW. 9 Aug 1999. Coll. G. 

Zuccarello 

AY260567 AY255872 

Ulva sp. III Newport Beach, CA, USA. 15 Jun 1999. Coll. H.S. 

Hayden & S. Murray 

AY260568 AY255873 

U. stenophylla Setchell et Gardner Seattle, WA, USA. 2 Jun 2000. Coll. H.S. Hayden, 

MA721 a 

AY260569 AY255874 

U. taeniata (Setchell in Collins, Holden et Setchell) Monterey, CA, USA. 17 Jun 1999. Coll. H.S. Hayden, 

Setchell et Gardner 

MA722 a 

AY262335 AY255875 

Umbraulva olivascens (P.J.L Dangeard) Bae et I.K. Lee 

Outgroups 

Portaferry, Strangford Lough, N. Ireland. 5 May 2000. 

Coll. C.A. Maggs 

AY260564 AY255876 

Blidingia minima (Nägeli ex Ku¨ tzing) Kylin var. minima Bolinas, CA, USA. 16 Jun 2000. Coll. H.S. Hayden na AF499675 

Kornmannia leptoderma (Kjellman) Bliding Vancouver Is., B.C., Canada. 29 Jun 1999. Coll. H.S. 

Hayden 

na AF499661 

Percursaria percursa (C. Agardh) Rosenvinge MA230 a 

AY260570 AF499658 

Ulvaria obscura var. blyttii (Areschoug) Bliding Padilla Bay, WA, USA. 25 Apr 1997. Coll. H.S. 

Hayden 

AY260571 AF499657 

a Cultures are in the University of Washington Culture Collection (UWCC). 

279 

was carried out in a PTC-100 Programmable Thermal 

Controller (MJ Research, NJ, USA). Primers used to 

amplify and sequence ITS nrDNA and the rbcL gene are 

listed in Table 2. A fragment containing ITS1, ITS2 and 

the 5.8S ribosomal subunit was amplified using primers 

18S1505 and ENT26S, which anneal to the 18S and 26S 

ribosomal subunits, respectively. The reaction profile 

included an initial denaturation at 948C for 5 min, 

followed by 1 min at 948C and 3 min at 608C for 30 

cycles, and a final 10 min extension at 608C (Blomster et 

al., 1998). The rbcL gene was amplified using primers 

from Manhart (1994). These primers amplified the first 

1357 bp of the rbcL gene excluding primers. This


Table 2. Primers used in this study for PCR amplification and sequencing 

Primer Sequence Target 

18S1505 a 

18S1763 b 

5.8S30 a 

5.8S142 a 

ENT26S c 

RH1 d 

rbc571 a 

rbc590 a 

1385r d 

fragment excludes the variable 3’ terminus and represents 

95% of the gene. The reaction profile included an 

initial denaturation at 948C for 3 min, followed by 35 

cycles of 1 min at 948C, 2 min at 458C and 3 min at 

658C. PCR products were run on 1.5% agarose gels 

(SeaKem LE, FMC Bioproducts), stained in a solution 

of 0.5 mg ml –1 ethidium bromide (Gibco BRL) and 

visualized under UV light. Products were pooled then 

purified using a polyethylene glycol (PEG) precipitation 

(Sigma). Briefly, an equal volume of a 20% PEG – 8000/ 

2.5M NaCl stock solution was added to pooled PCR 

product. Following mixing, solutions were incubated at 

378C for 15 min and microcentrifuged for 15 min. The 

supernatant was removed and the DNA pellet was 

washed twice in 80% cold ethanol, dried down and 

resuspended in double-distilled, UV-treated water for 

sequencing. Purified PCR products were sequenced 

using a dideoxy chain termination protocol with the 

ABI Prism BigDye Terminator Cycle Sequencing Ready 

Reaction Kit (PE Applied Biosystems). Both strands of 

PCR products were sequenced on an automated DNA 

sequencer (ABI 377). 

Sequences for the rbcL gene were aligned using 

Clustal X (Thompson et al., 1997) and edited by eye. 

ITS nrDNA regions were aligned manually using Se-Al 

version 1.0a1. All positions of ITS1 and ITS2 that 

could not be aligned with confidence were removed 

prior to analyses. Sequence divergence values were 

calculated using uncorrected ‘p’ distances. Maximum 

parsimony (MP) and maximum likelihood (ML) 

analyses were performed for each data set using 

PAUP* version 4.0b8 (Swofford, 1999). A MP analysis 

was also conducted for a combined data set; however, a 

ML analysis of the combined data was not performed 

due to computational limitations. Prior to analysis of 

the combined data, the incongruence length difference 

test (ILD) of Farris et al. (1994), implemented in 

PAUP* as the partition homogeneity test, was 

performed. This test assesses heterogeneity among 

user-designated partitions, e.g. genes or codon positions. 

A non-significant result indicates that userdesignated 

data partitions are not significantly different 

from random partitions of the combined data set. 

Congruent data partitions may then be combined in a 

5’ TCTTTGAAACCGTATCGTGA 3’ ITS1 

5’ GGTGAACCTGCGGAGGGATCATT 3’ ITS1 

5’ GCAACGATGAAGAACGCAGC 3’ ITS2 

5’ TATTCCGACGCTGAGGCAG 3’ ITS1 

5’ GCTTATTGATATGCTTAAGTTCAGCGGGT 3’ ITS2 

5’ ATGTCACCACAAACAGAAACTAAAGC 3’ rbcL 

5’ TGTTTACGAGGTGGTCTTGA 3’ rbcL 

5’ TCAAGACCACCTCGTAAACA 3’ rbcL 

5’ AATTCAAATTTAATTTCTTTCC 3’ rbcL 

a Primer name includes gene abbreviation and approximate position to which primer anneals in Ulva. 

b Modified from Blomster et al. (1998). 

c Blomster et al. (1998). 

d Manhart (1994). 

280 

single phylogenetic analysis (de Queiroz et al., 1995; 

Huelsenbeck et al., 1996). In MP analyses, all 

characters and character state changes were weighted 

equally and gaps were coded as missing data. Heuristic 

searches were performed with tree bisection-reconnection 

(TBR), MulTrees and steepest descent options in 

effect. Ten replicate searches with randomized taxon 

input were conducted to avoid local optima of most 

parsimonious trees. To compare relative support for 

branches, 1000 bootstrap replications (Felsenstein, 

1985) were performed using heuristic searches with 

simple taxon addition, TBR and MulTrees options in 

effect. 

Prior to likelihood searches, several parameters were 

estimated using PAUP*. Base frequencies, transition to 

transversion ratio, proportion of invariable sites and siteto-site 

rate heterogeneity were estimated under maximum 

likelihood criteria from an optimal parsimony topology 

(Swofford et al., 1996). These parameters were then set to 

estimated values in ensuing ML searches. Based on these 

estimations, substitution bias was modelled by the 

general time-reversible model (Yang, 1994a) with invariable 

sites (Hasegawa et al., 1985), and rate heterogeneity 

was modelled using the gamma distribution method 

(Yang, 1994b) with four discrete rate categories and a 

single shape parameter (alpha) (model GTR + I + G). A 

heuristic search was conducted using an optimal starting 

tree from MP analyses with TBR, MulTrees and steepest 

descent options in effect. 

Results 

MP and ML analyses were conducted using 471 

aligned characters from the spacers and the 5.8S 

gene. Boundaries for the 5.8S gene were defined 

according to Thompson & Herrin (1994). The 5’ 

end of ITS1 and the 3’ end of ITS2 were determined 

according to van de Peer et al. (2000) and Wuyts et 

al. (2001), respectively. The ITS1 spacer ranged in 

length from 154 to 218 bp and the ITS2 from 162 

to 184 bp among the surveyed taxa. A total of 141


characters were excluded from the spacers prior to 

analyses because positional homology could not be 

confidently determined. In contrast, the 5.8S 

nrDNA gene was 158 bp in all surveyed taxa and 

had only 14 variable sites. The lengths of the 

spacers and the 5.8S gene are comparable to those 

of other taxa in the Ulvophyceae (Bakker et al., 

1995a, b; van Oppen, 1995; Friedl, 1996). 

Alignment of rbcL sequences required the addition 

of a single gap of three nucleotides in all 

sequences relative to the outgroup Kornmannia 

leptoderma. The additional amino acid in K. 

leptoderma is present in other green algae sequenced 

to date (e.g. Yang et al., 1986; Kono et 

al., 1991; Manhart, 1994; Sherwood et al., 2000), 

with the exception of other Ulvales (Sherwood et 

al., 2000; Hayden & Waaland, 2002). The final 

rbcL alignment included 1357 characters. 

The ILD test using partitions for rbcL versus ITS 

nrDNA was non-significant (p = 0.99); thus, data 

sets were combined in a single analysis. The 

alignment of combined data included all taxa, and 

rbcL positions were coded as missing data for the 

taxa in which this gene was not sequenced (Table 1). 

MP analysis of ITS nrDNA data resulted in 90 

optimal trees of 347 steps. There were 147 variable 

sites in the analysed data set, and 108 sites were 

parsimony-informative. The strict consensus of 

most-parsimonious trees is shown in Fig. 1a. The 

ML analysis resulted in a single tree (Fig. 2) which 

is similar to the strict consensus tree based on ITS 

nrDNA sequences (Fig. 1a). Minor differences 

between trees can be seen in the clades comprising 

U. lactuca, U. australis, etc., and U. stenophylla, E. 

prolifera, etc. and the positions of E. flexuosa and 

Enteromorpha sp. II. 

Fig. 1. Comparison of strict consensus trees derived from (a) nuclear ribosomal ITS sequence data and (b) the chloroplastencoded 

rbcL gene. Bootstrap percentages (1000 replicates samples) are shown above branches. Nodes with bootstrap values of 

less than 50% are not labelled. 

281


Fig. 2. Phylogram of sampled taxa based on ML analysis of ITS nrDNA sequences ( – lnL = 2424.316). Bootstrap percentages 

(1000 replicates samples) are shown above branches. Nodes with bootstrap values of less than 50% are not labelled. 

MP analysis of the rbcL data set resulted in 

six optimal trees of 473 steps. The strict 

consensus tree is shown in Fig. 1b. There were 

291 variable sites in the data set, and 138 sites 

were parsimony-informative. Clades with bootstrap 

values of 50% or greater in the consensus 

282 

tree (Fig. 1b) were also resolved in the ML tree 

(Fig. 3) with one exception. In the ML tree 

Umbraulva olivascens rather than Ulvaria obscura 

var. blyttii is basal in the clade that is 

sister to the remaining Ulva and Enteromorpha 

species.


Fig. 3. Phylogram of a subset of sampled taxa based on ML analysis of rbcL sequences ( – lnL = 4435.492). Bootstrap 

percentages (1000 replicates samples) are shown above branches. Nodes with bootstrap values of less than 50% are not labelled. 

MP analysis of the combined data resulted in 117 

trees of 824 steps (Fig. 4). A total of 1828 

characters were included in the analysis, of which 

246 were parsimony-informative. Clades resolved 

in the combined data consensus tree (Fig. 4) are 

similar to those in the ITS nrDNA and rbcL 

283 

consensus trees (Fig. 1) but they have higher 

bootstrap values. In all trees a clade consisting of 

all Ulva and Enteromorpha species is strongly 

supported. The topology of the deepest branches 

within this clade varies among trees; however, in all 

analyses there are well-supported clades which


Fig. 4. Strict consensus of 117 most parsimonious trees of 824 steps from the analysis of combined ITS nrDNA and rbcL 

sequences. Bootstrap percentages (1000 replicate samples are shown above branches. Nodes with bootstrap values of less than 

50% are not labelled. 

contain both Ulva and Enteromorpha species. 

Examples of such clades include: (1) E. compressa 

and U. pseudocurvata; (2) these taxa plus E. 

intestinalis and E. intestinaloides; (3) U. californica 

and Enteromorpha sp. I; (4) these taxa plus 

284 

Chloropelta caespitosa; and (5) E. clathrata plus 

several species of Ulva. Several additional clades 

that have moderate to strong bootstrap values in 

all consensus trees contain either Ulva or Enteromorpha 

species.


Sequence divergence among the ITS nrDNA 

sequences ranged from 0 between U. fasciata and 

Ulva sp. II to nearly 18% between Percursaria 

percursa and some species of Ulva and Enteromorpha. 

The Umbraulva olivascens sequence was 

approximately 7% divergent from Ulvaria obscura 

var. blyttii and P. percursa and more than 13% 

divergent from Ulva and Enteromorpha sequences. 

The greatest divergence among ingroup taxa 

(minus U. olivascens) was 13.3% between U. 

taeniata and E. compressa. Divergence among 

species found in mixed Ulva and Enteromorpha 

clades varied. There was 0.2% divergence between 

E. compressa and U. pseudocurvata and approximately 

6% between these taxa and E. intestinalis. 

Sequence divergence was 1.3% between U. californica 

and Enteromorpha sp. I, approximately 3% 

between these taxa and C. caespitosa, and 5.0 – 

6.5% between E. clathrata and closely related Ulva 

taxa. 

Sequence divergence values in the rbcL data set 

were generally lower than those observed in the ITS 

nrDNA data set. They ranged from 0.1% between 

two pairs of taxa, U. lactuca /U. fenestrata and E. 

compressa/U. pseudocurvata, to nearly 14% between 

ingroup taxa and the two outgroups, K. 

leptoderma and B. minima var. minima. Umbraulva 

olivascens was less than 3% divergent from Ulvaria 

obscura var. blyttii and P. percursa and 3.7 – 4.4% 

divergent from Ulva and Enteromorpha taxa. In 

mixed clades, there was 1.9% sequence divergence 

between E. intestinalis and either E. compressa or 

U. pseudocurvata. Divergence was 0.5% between U. 

californica and Enteromorpha sp. I, 0.7 – 0.8% 

between C. caespitosa and these taxa, and 0.9 – 

1.6% between E. clathrata and related Ulva species. 

The greatest sequence divergence among ingroup 

taxa (minus U. olivascens) was 3.6%. 

Discussion 

Ulva and Enteromorpha together form a strongly 

supported clade in all analyses, but they are not 

monophyletic. These results, combined with earlier 

findings from molecular (Blomster et al., 1999; Tan 

et al., 1999) and culture studies (Gayral, 1959, 

1967; Føyn, 1960, 1961; Løvlie, 1964; Provasoli, 

1965; Berglund, 1969; Kapraun, 1970; Fries, 1975; 

Bonneau, 1977; Provasoli & Pintner, 1980), provide 

strong evidence that Ulva and Enteromorpha are 

not distinct evolutionary entities and should not be 

recognized as separate genera. 

Additionally, Chloropelta caespitosa is nested 

among Ulva and Enteromorpha taxa. Tanner (1979, 

1980) described C. caespitosa on the basis of its 

unique developmental pattern. Early in development, 

cells in the tubular germling undergo one 

285 

division producing a distromatic tubular germling 

not seen in other Ulvaceae. Rupture of the apical 

end of the germling and continued growth eventually 

result in a peltate distromatic blade (Tanner, 

1980). Despite its unique development, which is 

very distinctive in culture (Hayden, personal 

observation), C. caespitosa groups with U. californica 

and Enteromorpha sp. I from California in all 

trees, and bootstrap support for this grouping is 

strong (Fig. 4). Thus, the type and only species of 

Chloropelta should also be transferred to Ulva. 

However, because the resulting binomial would be 

a later homonym of Ulva caespitosa Withering 

(Bot. Arr. Veg. Gt. Brit.: 735. 1776), the basionym 

of Catenella caespitosa (Withering) L. Irvine (J. 

Mar. Biol. Assoc. UK, 56: 590. 1976), the following 

substitute name is proposed: 

Ulva tanneri H.S. Hayden & J.R. Waaland, nom. 

nov. 

Replaced name: Chloropelta caespitosa C.E. 

Tanner (J. Phycol., 16: 130, figs 2 – 49. 1980). 

In the ensuing discussion, the clade comprising 

Ulva, Enteromorpha and Chloropelta taxa will be 

referred to as the Ulva clade. Umbraulva olivascens 

is discussed further below. 

Mixed clades of Ulva and Enteromorpha 

Within the Ulva clade several subclades consisting 

of both distromatic and tubular species received 

strong support. E. compressa and U. pseudocurvata 

are allied with 100% bootstrap support in trees 

from all analyses. E. compressa is common in the 

British Isles and is morphologically similar to the 

type species of Enteromorpha, E. intestinalis; 

however, these two species have been shown to be 

distinct evolutionary entities using crossing experiments 

(Larsen, 1981) and phylogenetic analysis of 

ITS nrDNA sequences (Blomster et al., 1998). Ulva 

pseudocurvata is a typical Ulva species with a 

distromatic, medium to light green membranaceous 

blade (Koeman & van den Hoek, 1981). ITS 

nrDNA sequence divergence among isolates of 

these two species was similar to levels of divergence 

within clearly monospecific groupings, such as 

geographically distinct collections of E. intestinalis 

and E. compressa (up to 2.3%) (Blomster et al., 

1998). Distances between rbcL sequences among 

conspecifics range from 0.0 to 0.4% (Hayden, 

2001). Thus, divergence between E. compressa and 

U. pseudocurvata in the rbcL gene ( 5 0.1%) is also 

within the range of conspecifics. 

Another mixed Ulva and Enteromorpha pair that 

is well supported in trees is U. californica and 

Enteromorpha sp. I from California. U. californica 

is a distromatic species found along the Pacific


coast of North America from the Alaska Peninsula 

to Baja California. Morphological and culture 

studies have revealed that while this species has a 

wide range of environmentally influenced blade 

forms, it shows a distinctive developmental pattern 

which clearly separates it from other species of 

Ulva (Tanner, 1979, 1986). These developmental 

characteristics are the presence of a germination 

tube and the early development of an extensive 

basal system of rhizoids (Tanner, 1986). Enteromorpha 

sp. I, a tubular alga with a branched 

morphology similar to E. prolifera, has a similar 

distribution to that of U. californica (Hayden, 

2001). Divergence between these taxa is 1.3% and 

0.5% for ITS nrDNA and rbcL sequences, 

respectively – values not much greater than those 

for E. compressa and U. pseudocurvata. 

One explanation for these observations is that 

these paired taxa represent two phases in the life 

history of a single species. However, an isomorphic 

life history has been observed in E. compressa 

(Bliding, 1968), U. pseudocurvata (Koeman & van 

den Hoek, 1981) and U. californica (Tanner, 1979, 

1986). Further, the type of sexual life history is 

used to delimit the Ulvales (isomorphic) from the 

Ulotrichales (heteromorphic) (Kornmann, 1965), 

and its use at this taxonomic level is supported by 

molecular and ultrastructural data (Floyd & 

O’Kelly, 1984; Hayden & Waaland, 2002). Thus, 

an alternation of heteromorphic generations in this 

clade is unlikely. An alternative explanation is that 

these pairs represent separate species and that 

observed low sequence divergences are due either to 

recent speciation, i.e. they are in the early stages of 

diverging from one another, or to other factors, 

such as convergent evolution. Data supporting 

their status as individual species exist. In Tan et al. 

(1999) the monophyly of E. compressa accessions is 

strongly supported by ITS nrDNA analyses. 

Similarly, geographically distinct isolates of U. 

californica form a clade, as do isolates of Enteromorpha 

sp. I in ITS nrDNA and rbcL trees 

(Hayden, 2001). Thus, these taxa are considered 

separate species. 

Tan et al. (1999) hypothesized that a reversible 

morphogenetic switch (or switches) controls gross 

morphology in these algae: the switch from a blade 

to a tube morphology (or vice versa) is activated 

infrequently in nature perhaps by various environmental 

cues, and it is more frequent in culture due 

to stresses unique to artificial systems. It is clear 

from the position of Ulva and Enteromorpha taxa 

in the present trees and those of Tan et al. (1999) 

that gross morphology has been fixed in certain 

lineages. It is unclear whether the same mechanism(s) 

is involved in culture experiments. Culture 

studies citing flexibility of form show Ulva taxa 

with tubular or globular morphologies (Løvlie, 

286 

1964; Gayral, 1959, 1967; Bonneau, 1977; Føyn, 

1960, 1961), but although monostromatic sheets 

are formed under green tide conditions (Blomster 

et al., 2002) there are no culture studies which show 

Enteromorpha with distromatic morphologies. 

Further, observations of cultures suggest that 

altered morphologies in cultures of Ulva are not 

uncommon (Hayden, personal observation). With 

the exception of Percursaria, all ulvacean taxa pass 

through a tubular stage in development. Distromatic 

species growing without exposure to wave 

action, desiccation or other environmental factors 

may not develop normally beyond the tubular 

stage. Some culture studies of Ulva species have not 

reported altered morphology (e.g. Bliding, 1963, 

1968; Kapraun, 1970; Tanner, 1979). It is possible 

that certain culture conditions foster normal 

development, or that some species are capable of 

normal development in culture while others are 

not. Further research, including field outplanting 

of culture material, may help to resolve these issues 

and lead to a better understanding of the mechanism(s) 

underlying morphology in these algae. 

Morphological synapomorphies 

A comparison of traits for surveyed species 

revealed few synapomorphies. Given that clades 

are not defined on the basis of distromatic versus 

tubular morphology, it is not surprising that they 

are also not defined by the type of blade (e.g. 

expanded versus linear) or tube (e.g. branched 

versus unbranched). Other characters are too 

conserved, e.g. mode of reproduction (Floyd & 

O’Kelly, 1984) or too variable, e.g. cell size, 

number of pyrenoids (Tanner, 1979; Phillips, 

1988). The difficulty in identifying morphological 

synapomorphies for clades in molecular-based trees 

is not unique to this group of seaweeds (e.g. Stiller 

& Waaland, 1993). These results reinforce the need 

for great caution when using morphological 

characters in comparative, taxonomic or systematic 

studies in this and other groups of morphologically 

simple algae. Characters commonly used to distinguish 

species are listed in Table 3. Of these 

characters, only two potential synapomorphies 

were identified. E. compressa, U. pseudocurvata, 

E. intestinalis and E. intestinaloides are all described 

as having ‘hood’- or ‘cup’-shaped chloroplasts 

which are predominantly oriented apically 

in cells of the middle and apical regions (Blomster 

et al., 1998; Koeman & van den Hoek, 1981, 1982). 

Some taxa, such as U. lactuca and U. rigida, have 

been observed to have similarly shaped chloroplasts 

in these thallus regions, but their chloroplasts 

are variously oriented rather than apically 

oriented (Koeman & van den Hoek, 1981). Other 

taxa have chloroplasts which completely fill cells in


Table 3. Characters used to delimit species of Ulva and 

Enteromorpha based on Koeman and van den Hoek (1981) 

and Bliding (1963, 1968). Characters noted with (E) and (U) 

are used only in Enteromorpha and Ulva, respectively. 

Character 

Gross morphology, including colour and texture of mature plant 

Structure of plant base 

Arrangement and shape of cells in surface view 

Structure of branch tips (E) 

Number of pyrenoids per cell 

Shape of chloroplast in surface view 

Cell size at base, middle and apex of thallus 

Height-to-width ratio of cells in cross section (U) 

Thallus thickness (U) 

Morphology of young germling 

Mode of reproduction 

Ecology 

surface view. Neither of the latter chloroplast 

positions appears to delimit clades. Studies by 

Britz & Briggs (1976, 1983) and Mishkind et al. 

(1979) showed that chloroplasts in some Ulva 

species migrate within the cells according to a 

circadian rhythm. Such movement was not detected 

in certain Ulvales, including an alga 

identified as E. intestinalis (Britz & Briggs, 1976). 

These studies may suggest that chloroplast position 

is too variable for use in systematic studies. 

Conversely, the presence of diurnal changes in 

chloroplast position may prove to be a synapomorphy, 

but at present this phenomenon has been 

studied in only a limited number of taxa. 

Ulva species in the clade with E. clathrata (Fig. 4) 

share the presence of microscopic teeth along the 

blade margin. E. clathrata has a tubular morphology 

and therefore lacks a blade margin; however, 

one of the diagnostic characters for this species is 

the presence of ‘spine-like’ short branchlets 

throughout the thallus (Bliding, 1963; Blomster et 

al., 1999, as E. muscoides). These branchlets have a 

broad base composed of several cells and a narrow 

tip which typically ends in a single cell. Their 

appearance is reminiscent of marginal teeth observed 

in Ulva species (Dion et al., 1998); however, 

marginal dentition has been described in two other 

surveyed taxa – U. rotundata (Bliding, 1968) and U. 

australis (Phillips, 1988; Woolcott & King, 1999) – 

which were not placed in the same clade as E. 

clathrata, suggesting that this trait has evolved 

more than once in these algae. 

Comparison with other molecular studies 

Relationships of taxa in the present trees are 

generally congruent with those in Tan et al. 

(1999) and Blomster et al. (1999), although the 

latter study included a relatively small number of 

287 

Ulva and Enteromorpha species. Differences in the 

positions of three taxa between the present study 

and that of Tan et al. (1999) are noteworthy. In the 

present study, Umbraulva olivascens is allied with 

the designated outgroups, Ulvaria and Percursaria, 

and these three taxa comprise the sister group to 

the Ulva clade in the rbcL trees. In Tan et al. (1999) 

U. olivascens (as Ulva olivascens) occupied a basal 

position among the sampled Ulva and Enteromorpha 

leading to the conclusion that all Ulva and 

Enteromorpha species form a clade. However, 

Ulvaria and Percursaria were not included in their 

study, rather Blidingia (Ulvales) and Gloeotilopsis 

(Ulotrichales) served as the sole outgroups and 

introduced a relatively long branch into the ITS 

nrDNA-based trees. 

Umbraulva olivascens, found in the northeast 

Atlantic and Mediterranean, was named for its 

characteristic olive-green thallus (Dangeard, 1951, 

1961, as Ulva olivascens). Other traits which 

distinguish this taxon from Ulva species include 

the presence of (1) relatively large cells in the 

mature plant, (2) characteristically rounded cells in 

apical regions, and (3) a marginal region of sterile 

cells distal to zoosporangia that detaches in 

‘threadlike masses’ following reproductive cell 

release (Bliding, 1968; Burrows, 1991). At present, 

there are no clear morphological traits that would 

suggest affinities of U. olivascens to Ulvaria or 

Percursaria other than its early development, which 

is typically ulvacean (Bliding, 1968), and the 

relationship between these three taxa requires 

further investigation. 

The positions of two additional Ulva species, U. 

fenestrata and U. californica, differ in the present 

trees compared with those in Tan et al. (1999). Tan 

et al. (1999) found that U. fenestrata was allied 

with U. armoricana, and their collection of U. 

californica appeared in a clade of multiple geographically 

distinct collections of U. lactuca, the 

type species of Ulva. In the present trees the close 

relationship of U. fenestrata and U. lactuca is 

strongly supported. Sequence divergence values 

between these taxa are within the range of 

conspecifics: 0.5% and 0.1% for ITS nrDNA and 

rbcL, respectively (Blomster, 1998, 1999; Hayden, 

2001). A study of Ulva and Enteromorpha from the 

northeast Pacific including collections of U. californica 

and U. fenestrata from throughout their 

distribution ranges found similar relationships of 

these species to others (Hayden, 2001). This 

suggests that the U. californica and U. fenestrata 

collections in Tan et al. (1999) were misidentified. 

Given the morphological plasticity exhibited by 

these taxa, and overlapping distribution ranges and 

ecology (Tanner, 1979, 1986; Gabrielson et al., 

2000), it is not unreasonable that an individual of 

U. californica would be misidentified as U.

Table 4. Valid Enteromorpha binomials with authorities, in current usage (Wynne, 1998; Guiry & NicDonncha, 2002) or otherwise of interest as indicated, with existing binomials in Ulva, new 

combinations in Ulva, or explanations why binomials in Ulva are blocked (Index Nominum Algarum, 2002). Infraspecific taxa are omitted 

Binomial in Enteromorpha 

Basionym (if different) 

Binomial in Ulva 

Enteromorpha acanthophora Ku¨ tzing (1849) Sp. Alg.: 479 

Ulva acanthophora (Ku¨ tzing) comb. nov. 

Enteromorpha atroviridis (‘atro-viridis’) 

(Levring) M.J. Wynne (1986) 

Nova Hedwigia 43: 324 

Ulva atroviridis Levring (1938) Lunds Univ. A˚ rsskr. N.F. Avd. 2, 

34(9): 4, fig. 2; pl. 1: fig. 1 

Enteromorpha bulbosa (Suhr) Montagne (1846) Voy. Bonite, Crypt. 

Cell.: 33 

Solenia bulbosa Suhr (1839) Flora 22: 72, pl. IV: fig. 46 

Solenia bulbosa Suhr was transferred to Ulva by Trevisan (Fl. 

Eugan.: 51. 1842), but Ulva bulbosa (Suhr) Trevisan is a later 

homonym of Ulva bulbosa Palisot de Beauvois (Fl. Oware 1: 20, pl. 

XIII: fig. 1. 1805) from Ghana, of uncertain identity 

Enteromorpha chaetomorphoides Børgesen (1911) Bot. Tidsskr. 31: 

149, fig. 12 

Ulva chaetomorphoides (Børgesen) comb. nov. 

Enteromorpha clathrata (Roth) Greville 

Conferva clathrata Roth (1806) Cat. bot. III: 175 – 8 

Type locality; collector 

Type material (with relevant reference if any) 

Type or other authentic material examined 

Bay of Islands, New Zealand; J.D. Hooker 

Type: L 938.19.134 (Womersley, 1956) 

Hotel Rocks, Port Nolloth, Cape Province, South Africa 

Type: GB (Wynne, 1986) 

Peru 

Type: L 1391 sheet 40 (Ricker, 1987) 

Material examined: BM, Peru, ex herb. Montagne 

Bovoni Lagoon, St Thomas, Virgin Islands 

Holotype: C (Bliding, 1963) 

Type locality: Fehmarn, SW Baltic (original material missing) 

Neotype: LD 137737 from Landskoma, Baltic Oresund, 1829 

(Blomster et al., 1999; illustrated in Bliding 1963, figs 69a, b) 

Taxonomic notes (non-type material examined) 

Currently placed in synonymy with E. clathrata but we concur with 

Adams (1994) that New Zealand material might be distinct (E. 

acanthophora, BM, Chatham Islands, H.E. Maltby xi 1905) 

South African endemic resembling E. linza (Wynne, 1986; Stegenga 

et al., 1997) 

Highly morphologically variable, from tubular to cornucopia-like 

(Ricker, 1987). Many putative synonyms. As the Ulva binomial 

cannot be used, a synonym is chosen here. The most appropriate 

geographically is E. hookeriana Kützing (see below) 

Very finely branched material, often growing with Rhizoclonium. 

(BM, Puerto Rico, various collections) 

Heterotypic synonyms include: 

E. crinita Nees (1820) Hor. Phys. Berol.: Index [2] 

E. muscoides (Clemente) J. Cremades in J. Cremades & J.L. Pe´ rez- 

Cirera (1990) Anales Jard. Bot. Madrid 47: 489, based on Ulva 

muscoides Clemente (1807) Ensayo sobre las Variedades de la Vid: 

320 (erroneously regarded as the oldest valid name by Blomster et 

al., 1999) 

E. ramulosa (J.E. Smith) Carmichael 

Enteromorpha welwitschii J. Agardh (1883) Alg. Syst. 3: 143. Tagus 

R. near Aldea, Portugal; Welwitsch, Phyc. Lusitan. 289. Syntypes: 

BM 

Enteromorpha gelatinosa Kützing (1849) Sp. Alg.: 482. Canary 

Islands, Despreaux 

non Ulva gelatinosa Ku¨ tzing (1856) Tab. Phyc. VI, Tab. 32 

(continued ) 


288

Table 4. (continued ) 




Enteromorpha compressa (Linnaeus) Nees (1820) Hor. Phys. Berol.: 

Index [2] 

Ulva compressa Linnaeus (1753) Sp. Pl. 2: 1163 

Enteromorpha crassimembrana V.J. Chapman (1956) J. Linn. Soc. 

London, Bot. 55: 424, fig. 74 

Ulva crassimembrana (V.J. Chapman) comb. nov. 

Enteromorpha flexuosa (Wulfen) J. Agardh (1883) Alg. Syst. 3: 126 

Ulva flexuosa Wulfen (1803) Crypt. Aquat.: 1., new name for 

Conferva flexuosa Roth 1800 (nom. illeg.; see Silva et al., 1996, 

p. 732) 

Enteromorpha hookeriana Ku¨ tzing (1849) Sp. Alg.: 480 

Ulva hookeriana (Ku¨ tzing) comb. nov. 

Enteromorpha intestinalis (Linnaeus) Nees (1820) Hor. Phys. Berol.: 

Index [2] 

Ulva intestinalis Linnaeus (1753) Sp. Pl. 2: 1163 

Enteromorpha intestinaloides R.P.T. Koeman & C. van den Hoek 

(1982) Arch. Hydrobiol. Suppl. 63 [Algol. Stud. 32]: 321, figs. 115 – 

129 

Ulva intestinaloides (R.P.T. Koeman & C. van den Hoek) comb. nov. 

Enteromorpha kylinii Bliding 1948: 199 – 204, figs 1 – 3 

Ulva kylinii (Bliding) comb. nov. 

Enteromorpha lingulata J. Agardh (1883) Alg. Syst. 3: 143 

Cannot be transferred to Ulva because of the prior existence of Ulva 

lingulata A.P. de Candolle (in Lamarck & de Candolle, 1805, Fl. 

Franc. ed. 3, 2: 14), of uncertain identity but most likely referable to 

Hypoglossum hypoglossoides 

Enteromorpha linza (Linnaeus) J. Agardh (1883) Alg. Syst. 3: 134. 

Ulva linza Linnaeus (1753) Sp. Pl. 2: 1163. 




Bognor, Sussex, England? 

Typotype (= epitype): OXF. Lectotype: Dillenius (1742: pl. 9, fig. 8; 

Blomster et al., 1998) 

Cape Maria van Diemen, New Zealand 

Type: AKU (Chapman, 1956) 

Duino, near Trieste, Italy 

Holotype: W, Wulfen no. 23 (Bliding, 1963) 

Berkeley Sound, Falkland Islands; J.D. Hooker 

Type: L? Isotype: BM, iv 1842 

Woolwich, London, England? 

Typotype (= epitype): OXF. Lectotype: Dillenius (1742: pl. 9, fig. 7; 

Blomster et al., 1998) 

Westkapelle, Netherlands; R.P.T. Koeman (iv.1976) 

Holotype: L; Isotype: GRO (Koeman & van den Hoek, 1982) 

Kristineberg, Swedish west coast 

Holotype: LD (Bliding, 1963) 

North Atlantic; Gulf of Mexico; Tasmania; New Zealand 

Syntypes: L 13522 to 13576 (some European, mostly from Australia; 

Bliding, 1963) 

Sheerness, Kent, England 

Epitype: OXF. Lectotype: Dillenius (1742: pl. 9, fig. 6), Tremella 

marina fasciata (L.M. Irvine, note dated xii 1966, in Herb. OXF) 


Heterotypic synonyms: Enteromorpha usneoides J. Agardh (1883) 

Alg. Syst. 3: 159 [misnumbered 157] (Blomster et al., 1998) 

Enteromorpha complanata Ku¨ tzing 1845: 248; see Silva et al. (1996) 

Known only from northern North I., New Zealand (Adams, 1994) 

Heterotypic synonym: Enteromorpha tubulosa (Ku¨ tzing) Ku¨ tzing, 

based on Enteromorpha intestinalis var. tubulosa Ku¨ tzing (1845) 

Phycol. Germ.: 247 (Bliding, 1963) 

Currently treated as a synonym of Enteromorpha bulbosa (Suhr) 

Montagne, which cannot be transferred to Ulva due to a prior 

homonym (see above) 

Type species of Enteromorpha Link (1820) 

Algae in Nees, Hor. Phys. Berol.: 5 

nom. cons. vs. Splaknon Adanson 1763, nom. rej. 

Differs morphologically and ecologically from E. intestinalis (Koeman 

& C. van den Hoek, 1982) 

Recorded widely from NE Atlantic and elsewhere (e.g. Coppejans, 

1995; Silva et al., 1996; Furnari et al., 1999) 

Recorded widely in Atlantic and Pacific Oceans (e.g. Silva et al., 

1996; Wynne, 1998) 

Type material investigated by Bliding (1963) was conspecific with or 

closely related to Enteromorpha flexuosa (Wulfen) J. Agardh so a 

new name is not proposed here 

(continued ) 


289

Table 4. (continued ) 




Enteromorpha muscoides (Clemente) J. Cremades in J. Cremades & 

J.L. Pérez-Cirera (1990) Anales Jard. Bot. Madrid 47: 489. 

Ulva muscoides Clemente (1807) Ensayo sobre las Variedades de la 

Vid: 320. 

Enteromorpha paradoxa (C. Agardh) Ku¨ tzing (1845) Phycol. Germ.: 

247. 

Ulva paradoxa C. Agardh (1817), new name, Syn. Alg. Scand.: XXII. 

Conferva paradoxa Dillwyn 1809 (illeg.) 

Enteromorpha procera Ahlner (1877) Bidr. Enteromorpha: 40, fig. 5. 

Ulva procera (Ahlner) comb. nov. 

Enteromorpha prolifera (O.F. Mu¨ ller) J. Agardh (1883) Alg. Syst. 3: 

129. 

Ulva prolifera O.F. Mu¨ ller (1778) Fl. Dan. 5(13): 7, pl. DCCLXIII(1) 

Enteromorpha pseudolinza R.P.T. Koeman & C. van den Hoek 

(1982) Arch. Hydrobiol. Suppl. 63 [Algol. Stud. 32]: 302, figs. 50 – 69 

Ulva pseudolinza (R.P.T. Koeman & C. van den Hoek) comb. nov. 

Enteromorpha radiata J. Agardh 1883: 156 

Ulva radiata (J. Agardh) comb. nov. 

Enteromorpha ralfsii Harvey (1851) Phycol. Brit. 3: pl. CCLXXXII 

Ulva ralfsii (Harvey) Le Jolis (1863) Me´ m. Soc. Imp. Sci. Nat. 

Cherbourg 10: 54 

Enteromorpha simplex (K.L. Vinogradova) R.P.T. Koeman & C. van 

den Hoek (1982, p. 42) 

E. prolifera f. simplex K.L. Vinogradova 1974, Ul’vovye Vodorosli 

SSSR: 99, pl. XXXIII: 5 – 12 

Ulva simplex (K.L. Vinogradova) comb. nov. 




Cádiz, Algeciras, Spain; Clemente 

Lectotype: MA-Algae 1713 (Blomster et al., 1999). 

Bangor, Wales 

Lectotype: LD 13702 (Bliding, 1960, fig. 43a – d; Womersley, 1984) 

Typified by the type of Conferva paradoxa Dillwyn (1809) Conf. Syn. 

70, suppl. pl. F. 

Sweden 

Type: S. Should be typified with material of E. procera f. denudata 

Ahlner Bidr. Enteromorpha: 42 (Bliding’s ‘E. ahlneriana Typus III’; 

Bliding, 1963) 

Nebbelund, Lolland Island, Denmark 

Type lost (Womersley, 1984). In the absence of material, we hereby 

designate by Fl. Dan. pl. DCCLXIII(1) as lectotype. 

Den Helder, Netherlands; R.P.T. Koeman (vi.1975) 

Holotype: L 

Arctic Norway, Berggren 

Lectotype: LD 14233 (Bliding, 1963) 

Bangor, North Wales; J. Ralfs 

No types in TCD (Bliding, 1963) nor in BM. Lectotype: Harvey 

(1851) Phycol. Brit. 3: pl. CCLXXXII 

Kandalakshski Zaliv, Beloye More, Murmansk Oblast, Russia; K.L. 

Vinogradova (8.viii.1967) 

Holotype: LE 


Heterotypic synonyms include: 

E. clathrata (Roth) Greville; E. crinita Nees; E. ramulosa (J.E. Smith) 

Carmichael (see Blomster et al., 1999) 

Enteromorpha welwitschii J. Agardh (1883) Alg. Syst. 3: 143. Tagus 

R. near Aldea, Portugal; Welwitsch, Phyc. Lusitan. 289. Syntypes: 

BM. 

Enteromorpha gelatinosa Ku¨ tzing (1849) Sp. Alg.: 482. Canary 

Islands, Despreaux. non Ulva gelatinosa Ku¨ tzing (1856) Tab. Phyc. 

VI, Tab. 32 

Enteromorpha flexuosa subsp. paradoxa (C. Agardh) Bliding (1963); 

recognized at species level by Womersley (1984) 

Heterotypic synonym: 

E. plumosa Ku¨ tzing (Bliding, 1963) 

Enteromorpha ahlneriana Bliding (1944) 

Bot. Not. 1944: 338, 355 is an illegitimate new name for E. procera 

Ahlner 

Heterotypic synonyms: 

Enteromorpha salina Ku¨ tzing 1845: 247 (Guiry & NicDonncha, 2002) 

Enteromorpha torta (Mertens) Reinbold (Burrows, 1991) 

Enteromorpha prolifera subsp. radiata (J. Agardh) Bliding (1963, p. 

56) 

Recognized in NE Atlantic: Coppejans (1995); Stegenga et al. (1997) 


290


Table 5. Enteromorpha binomials that are currently regarded as synonyms of other valid names, not in current usage, and/or not 

valid. Infraspecific taxa are omitted. Binomials indicated by an asterisk lack valid binomials in Ulva, so if they were to be 

recognized at the species level in this genus they would require transfer to Ulva. Binomials in parentheses are either not valid or 

not legitimate. Binomials in square brackets are currently placed in genera other than Enteromorpha. For taxa shown in bold, 

transfer to Ulva is blocked by pre-existing Ulva binomials (for details see Index Nominum Algarum) 

(E. adriatica Bliding) 

*E. africana Kützing 

(E. ahlneriana Bliding) 

E. angusta (Setchell & Gardner) M.S. Doty 

(E. aragoensis Bliding) 

*E. arctica J. Agardh 

E. attenuata (C. Agardh) Greville 

[E. aureola (C. Agardh) Kützing] a 

*E. basiramosa Fritsch 

*E. bayonnensis P.J.L. Dangeard 

(E. bertolonii Montagne) 

*E. biflagellata Bliding 

(E. byssoides Nees) 

*E. caerulescens Harvey 

*E. canaliculata Batters 

E. capillaris M. Noda 

[*E. chadefaudii J. Feldmann] b 

*E. chartacea Schiffner 

*E. chlorotica J. Agardh 

*E. clathrata (Roth) Greville (see Table 4) 

E. clavata Wollny 

[*E. coarctata Kjellman] b 

(E. comosa J. Agardh) 

*E. complanata Ku¨ tzing (see Table 4) 

*E. confervacea (Kützing) Kützing 

*E. confervicola DeNotaris 

(E. constricta (J. Agardh) S.M. Saifullah & M. Nizamuddin) 

*E. corniculata Ku¨ tzing 

E. cornucopiae (Lyngbye) Carmichael 

*E. coziana P.J.L. Dangeard 

*E. crinita Nees (see Table 4) 

E. crispa (Kützing) Kützing 

E. crispata (Bertoloni) Piccone 

*E. cruciata Collins 

(E. cylindracea J. Blomster) 

E. dangeardii H. Parriaud 

*E. denudata (Ahlner) Hylmö 

*E. echinata (Roth) Nees 

*E. ectocarpoidea Zanardini 

E. erecta (Lyngbye) Carmichael 

E. fascia Postels & Ruprecht (see Table 4) 

E. fasciculata P.J.L. Dangeard 

*E. firma Schiffner 

*E. flabellata P.J.L. Dangeard 

*E. fucicola (Meneghini) Kützing 

E. fulvescens (C. Agardh) Greville 

(Enteromorpha fulvescens Schiffner) 

(E. gayraliae P.J.L. Dangeard) 

E. gelatinosa Kützing (see Table 4) 

*E. gracillima G.S. West 

[E. grevillei Thuret] c 

[*E. groenlandica (J. Agardh) Setchell & Gardner] a 

*E. gujaratensis S.R. Kale 

[E. gunniana J. Agardh] b 

(E. hendayensis P.J.L. Dangeard & H. Parriaud) 

*E. hirsuta Kjellman 

*E. hookeriana Kützing (see Table 4) 

E. hopkirkii M’Calla ex Harvey 

*E. howensis Lucas 

a Species of Capsosiphon (Burrows, 1991). 

b Species of Blidingia (Womersley, 1956, 1964; Burrows, 1991; Benhissoune et al., 2001). 

c Species of Monostroma (Burrows, 1991). 

d Species of Percursaria (Bliding, 1963). 

e Species of Ulva (Silva et al., 1996). 

*E. intermedia Bliding 

(E. juergensii Kützing) 

(E. jugoslavica Bliding) 

E. lanceolata (Linnaeus) Rabenhorst 

*E. limosa A. Parriaud 

E. linkiana Greville 

(E. linziformis Bliding) 

*E. littorea Ku¨ tzing 

E. livida W.J. Hooker 

(E. longissima P.J.L. Dangeard) 

*E. maeotica Proshkina-Lavrenko 

*E. marchantiae Setchell & N.L. Gardner 

[E. marginata J. Agardh] b 

[E. micrococca Kützing] b 

*E. microphylla Foslie 

[*E. minima Na¨ geli ex Ku¨ tzing] b 

(E. multiramosa Bliding) 

E. muscoides (Clemente) J. Cremades (see Table 4) 

*E. musciformis P.J.L. Dangeard 

[*E. nana (Sommerfelt) Sjo¨ stedt] b 

*E. nizamuddinii K. Aisha & M. Shameel 

*E. novae-hollandiae (Kützing) Ku¨ tzing 

E. opposita J. Agardh 

*E. ovata F. Thivy & V. Visalakshmi ex H.V. Joshi & V. 

Krishnamurthy 

Enteromorpha pacifica Montagne 

*E. pallescens Schiffner 

[E. percursa (C. Agardh) Greville] d 

*E. perestenkoae K.L. Vinogradova 

*E. peruviana Montagne 

*E. pilifera Ku¨ tzing 

E. plumosa Kützing (see Table 4) 

*E. polyclados (Kützing) Ku¨ tzing 

(Enteromorpha pulcherrima Holmes & Batters) 

E. quaternaria Ahlner 

*E. ramellosa Ku¨ tzing 

E. ramulosa (J.E. Smith) Carmichael (see Table 4) 

[E. rhacodes Holmes] e 

(E. rivularis P.J.L. Dangeard) 

*E. roberti-lamii H. Parriaud 

(E. rugosa Nees) 

*E. saifullahii K. Aisha & M. Shameel 

*E. salina Ku¨ tzing (see Table 4) 

(E. sancti-joannis P.J.L. Dangeard) 

*E. saxicola Simmons 

(*E. scopulorum (P.J.L. Dangeard) J.P. Villot) 

*E. spermatoidea (Ku¨ tzing) Kützing 

*E. spinescens Ku¨ tzing 

(E. stipitata P.J.L. Dangeard) 

E. subulata (Wulfen) Nees 

*E. szegediensis Gyorffy & Kol 

E. torta (Mertens) Reinbold (see Table 4) 

[*E. tuberculosa P.J.L. Dangeard] b 

*E. tubulosa (Ku¨ tzing) Ku¨ tzing (see Table 4) 

E. utricularis (Roth) Nees 

E. vexata (Setchell & Gardner) M.S. Doty 

(E. vulgaris Edmondston) 

*E. welwitschii J. Agardh (see Table 4) 

291


fenestrata. The definitive characters which separate 

these species are developmental, yet there is no 

indication that these species were placed in culture 

prior to identification for the Tan et al. paper. The 

true identity of the U. fenestrata collection in Tan 

et al. (1999) is less certain, but it appears in a 

strongly supported clade with U. armoricana and 

U. scandinavica. In the present ITS nrDNA trees 

relationships among these taxa are not well 

resolved and sequence divergence values are low 

(5 0.4%). Relationships among these taxa warrant 

further investigation. 

Conclusions 

Within the Ulva clade, there are smaller clades 

consisting of all distromatic, all tubular, and both 

distromatic and tubular species; however, few 

morphological synapomorphies defining these 

clades can be identified, given the simple morphology 

and high degree of phenotypic plasticity in 

these algae. Certain clades contain distromatic and 

tubular species that exhibit sequence divergence 

values within the range of conspecifics. A possible 

explanation is that these taxa are in the early stages 

of diverging from one another. Although the 

controls for gross morphology (tubular versus 

distromatic blade) in these algae remain unclear, 

it is likely that the mechanism underlying relatively 

rare changes in nature is different from that for 

more frequent changes in culture. Given that all 

Ulvaceae, except Percursaria, pass through a 

tubular stage in development, it is reasonable to 

postulate that changes from blade to tube morphology 

observed in Ulva cultures are artefactual. 

In addressing the question of monophyly of Ulva 

and Enteromorpha, results from phylogenetic analyses 

of the rbcL gene are similar to those from ITS 

nrDNA in this and previous studies. Neither Ulva 

nor Enteromorpha is monophyletic; however, taxa 

from these genera together form a strongly 

supported clade. Since Ulva is the older genus, 

Enteromorpha is reduced to synonymy, as shown in 

Table 4. Despite its unique development, Chloropelta 

caespitosa is nested within this clade; thus, it 

also is transferred to Ulva. 

The nomenclatural changes are therefore proposed 

as shown in Table 4; binomials in Enteromorpha 

that are not currently recognized at the 

species level in Enteromorpha are listed in Table 5. 

Acknowledgements 

We would like to thank the following for collecting 

algae with or for us: John Berges, Deborah Dexter, 

David Garbary, Constance Gramllich, Lynn Hodgson, 

Hiroshi Kawai, Terrie Klinger, Louise Louis, 

Steven Murray, Tim Nelson, Frank Shaughnessy 

and Joe Zuccarello. We are grateful to Prof. M.D. 

Guiry (Galway) for drawing our attention to a 

nomenclatural problem. Technical support in 

Seattle was generously provided by Ellie Duffield, 

UW Culture Curator, and Sarah Gage, former UW 

Herbarium Manager. This material is based upon 

work supported by the National Science Foundation 

under Grant No. 0073169. JB thanks the 

Walter and Andrée de Nottbeck Foundation and 

Oskari Huttunen Foundation for their financial 

support. 

References 

292 

ADAMS, N.M. (1994). Seaweeds of New Zealand. An Illustrated 

Guide. Canterbury University Press, Christchurch, New Zealand. 

AGARDH, C.A. (1817). Synopsis algarum Scandinaviae. Lund. 

AGARDH, J.G. (1883). Till algernes systematik. Nya bidrag, 3. Lunds 

Univ.A˚rs-Skrift, Afd. Math. Naturvetensk., 19: 177 pp. 

AHLNER, K. (1877). Bidrag till ka¨nnedomen om de svenska formerna 

af algsla¨gtet Enteromorpha. Akademisk afhandling, Uppsala, 

Sweden. 

BAE, E.H. & LEE, I.K. (2001). Umbraulva, a new genus based on 

Ulva japonica (Holmes) Papenfuss (Ulvaceae, Chlorophyta). 

Algae, 16: 217 – 231. 

BAKKER, F.T., Olsen, J.L. & Stam, W.T. (1995a). Evolution of 

nuclear rDNA ITS sequences in the Cladophora albida/sericea 

clade (Chlorophyta). J. Mol. Evol., 40: 640 – 651. 

BAKKER, F.T., OLSEN, J.L. & STAM, W.T. (1995b). Global 

phylogeography in the cosmopolitan species Cladophora vagabunda 

(Chlorophyta) based on nuclear rDNA internal transcribed 

spacer sequences. J. Phycol., 30: 197 – 208. 

BENHISSOUNE, S., BOUDOURESQUE, C.-F. & VERLAQUE, M. (2001). A 

checklist of marine seaweeds of the Mediterranean and Atlantic 

coasts of Morocco. I. Chlorophyceae Wille s. l. Bot. Mar., 44: 

171 – 182. 

BERGLUND, H. (1969). On the cultivation of multicellular marine 

green algae in axenic culture. Svensk Bot. Tidskr., 63: 251 – 264. 

BLIDING, C. (1948). Enteromorpha kylini, eine neue Art aus der 

SchwedischenWestküste.Fys.Sa¨llsk.LundFo¨rhandl.,18:199 – 204. 

BLIDING, C. (1963). A critical survey of European taxa in Ulvales, 

Part I. Capsosiphon, Percursaria, Blidingia, Enteromorpha. Bot. 

Not. Suppl., 8: 1 – 160. 

BLIDING, C. (1968). A critical survey of European taxa in Ulvales, 

Part II. Ulva, Ulvaria, Monostroma, Kornmannia. Bot. Not., 121: 

534 – 629. 

BLOMSTER,J.,MAGGS, C.A., & STANHOPE, M.J. (1998). Molecular and 

morphological analysis of Enteromorpha intestinalis and E. compressa 

(Chlorophyta) in the British Isles. J. Phycol., 34: 319 – 340. 

BLOMSTER, J., MAGGS, C.A. & STANHOPE, M.J. (1999). Extensive 

intraspecific morphological variation in Enteromorpha muscoides 

(Chlorophyta) revealed by molecular analysis. J. Phycol., 35: 

575 – 586. 

BLOMSTER, J., BÄCK, S., FEWER, D.P., KIIRIKKI, M., LEHVO, A., 

MAGGS, C.A. & STANHOPE, M.J. (2002). Novel morphology in 

Enteromorpha (Ulvophyceae) forming green tides. Am. J. Bot., 89: 

1756 – 1763. 

BONNEAU, E.R. (1977). Polymorphic behavior of Ulva lactuca 

(Chlorophyta) in axenic culture. I. Occurence of Enteromorphalike 

plants in haploid clones. J. Phycol., 13: 133 – 140. 

BØRGESEN, F. (1911). Some Chlorophyceae from the Danish West 

Indies. Bot. Tidsskr., 31: 127 – 152. 

BRITZ, S.J. & BRIGGS, W.R. (1976). Circadian rhythms of 

chloroplast orientation and photosynthetic capacity in Ulva. 

Plant Physiol., 58: 22 – 27. 

BRITZ, S.J. & BRIGGS, W.R. (1983). Rhythmic chloroplast migration 

in the green alga Ulva: dissection of movement mechanism by 

differential inhibitor effects. J. Cell Biol., 31: 1–8.


BURROWS, E.M. (1991). Seaweeds of the British Isles, vol. 2. 

Chlorophyta. British Museum (Natural History), London. 

CHAPMAN, V.J. (1956). The marine algae of New Zealand. 1. 

Myxophyceae and Chlorophyceae. J. Linn. Soc. Bot., 55: 333 – 

501. 

CLEMENTE [Y RUBIO], S. DE ROJAS (1807). Ensayo sobre las 

variedades de la vid commun que vegetan en Andalucia. Madrid. 

COAT, G., DION, P., NOAILLES, M.-C., DE REVIERS, B., FONTIANE, J.- 

M., BERGER-PERROT, Y.&LOISEAUX-DE GOËR, S. (1998). Ulva 

armoricana (Ulvales, Chlorophyta) from the coasts of Brittany 

(France). II. Nuclear rDNA ITS sequence analysis. Eur. J. 

Phycol., 33: 81 – 86. 

COPPEJANS, E. (1995). Flore algologique des coˆtes du Nord de la 

France et de la Belgique. Jardin Botanique National de la 

Belgique, Meise. 

CREMADES, J.&PE´ REZ-CIRERA, J.L. (1990). Nuevas combinaciones 

de algas bento´ nicas marinas, como resultado del estudio del 

herbario de Simón de Rojas Clemente y Rubio (1777 – 1827). 

Anal. Jard. Bot. Madrid, 47: 489 – 492. 

DANGEARD, P. (1951). Sur une espe` ce d’Ulva des nos coˆ tes 

atlantiques (U. olivacea n. sp.). Le Botaniste, 35: 27 – 34. 

DANGEARD, P. (1958). Observations sur quelques Ulvacées du 

Maroc. Le Botaniste, 42: 5 – 63. 

DANGEARD, P. (1961). Le problème de l’espe` ce avec re´ férence au 

groupe des Ulvacées. Le Botaniste, 44: 21 – 36. 

DE QUEIROZ, A., DONOGHUE, M.J. & KIM, J. (1995). Separate versus 

combined analysis of phylogenetic evidence. Annu. Rev. Ecol. 

Syst., 28: 657 – 681. 

DILLWYN, L.W. (1802 – 9). British Confervae. London. 

DION, P., DE REVIERS, B.&COAT, G. (1998). Ulva armoricana sp. 

nov. (Ulvales, Chlorophyta) from the coasts of Brittany (France). 

I. Morphological identification. Eur. J. Phycol., 33: 73 – 80. 

DOYLE, J.J. & DOYLE, J.L. (1990). Isolation of plant DNA from 

fresh tissue. Focus, 12: 13 – 15. 

FARRIS, J.S., KALLERSJO, M., KLUGE, A.G. & BULT, C. (1994). 

Testing significance of incongruence. Cladistics, 10: 315 – 319. 

FELSENSTEIN, J. (1985). Confidence limits on phylogenies: an 

approach using the bootstrap. Evolution, 39: 137 – 195. 

FLOYD, G.L. & O’KELLY, C.J. (1984). Motile cell ultrastructure and 

the circumscription of the orders Ulotrichales and Ulvales 

(Ulvophyceae, Chlorophyta). Am. J. Bot., 71: 111 – 120. 

FØYN, B. (1960). Sex-linked inheritance in Ulva. Biol. Bull., 118: 

407 – 411. 

FØYN, B. (1961). Globose, a recessive mutant in Ulva mutabilis. Bot. 

Mar., 3: 60 – 64. 

FRIEDL, T. (1996). Evolution of the polyphyletic genus Pleurastrum 

(Chlorophyta): inferences from nuclear-encoded ribosomal 

DNA sequences and motile cell ultrastructure. Phycologia, 35: 

456 – 469. 

FRIES, L. (1975). Some observations of the morphology of 

Enteromorpha linza (L.) J. Ag. and Enteromorpha compressa (L.) 

Grev. in axenic culture. Bot. Mar., 18: 251 – 253. 

FURNARI, G., CORMACI, M.&SERIO, D. (1999). Catalogue of the 

benthic marine macroalgae of the Italian coast of the Adriatic Sea. 

Bocconea, 12: 1 – 214. 

GABRIELSON, P.W., WIDDOWSON, T.B., LINDSTROM, S.C., HAWKES, 

M.J. & SCAGEL, R.F. (2000). Keys to the Benthic Marine Algae and 

Seagrasses of British Columbia, southeast Alaska, Washington and 

Oregon. Department of Botany, University of British Columbia, 

Vancouver. 

GAYRAL, P. (1959). Premières observations et re´ flexions sur des 

Ulvacées en culture. Le Botaniste, 43: 85 – 100. 

GAYRAL, P. (1967). Mise au point sur les Ulvacées (Chlorophycées), 

particulièrement sur les résultats de leure e´ tude en laboratoire. Le 

Botaniste, 50: 205 – 251. 

GRAHAM, L.E. & WILCOX, L.W. (2000). Algae. Prentice-Hall, Upper 

Saddle River, NJ. 

GREUTER, W. et al., (2000). International Code of Botanical 

Nomenclature (Saint Louis Code). Koeltz Scientific Books, 

Ko¨ nigstein, Germany. 

GUIRY, M.D. & NICDONNCHA, E. (2002). AlgaeBase. World Wide 

Web electronic publication. www.algaebase.com (30 May 2002). 

293 

HARVEY, W.H. (1846 – 1851). Phycologia Britannica. Reeve, London. 

HASEGAWA, M., KISHINO, H. & YANO, T. (1985). Dating the 

human – ape split by a molecular clock of mitochondrial DNA. J. 

Mol. Evol., 22: 160 – 174. 

HAYDEN, H.S. (2001). Systematics of Ulvaceae (Ulvales, Ulvophyceae) 

and the genus Ulva L. based on nuclear and chloroplast 

sequence data. PhD dissertation, University of Washington, 

Seattle. 

HAYDEN, H.S. & WAALAND, J.R. (2002). Phylogenetic systematics of 

the Ulvaceae (Ulvales, Ulvophyceae) using chloroplast and 

nuclear sequences. J. Phycol., 38: 1200 – 1212. 

HUELSENBECK, J.P., BULL, J.J. & CUNNINGHAM, C.W. (1996). 

Combining data in phylogenetic analyses. Trends Evol. Ecol., 43: 

288 – 291. 

HUGHEY, J.R., SILVA, P.C. & HOMMERSAND, M.H. (2001). Solving 

taxonomic and nomenclatural problems in Pacific Gigartinaceae 

(Rhodophyta) using DNA from type material. J. Phycol., 37: 

1091 – 1109. 

INDEX NOMINUM ALGARUM (2002). University Herbarium, University 

of California, Berkeley. Compiled by Paul Silva. Available 

online at http://ucjeps.herb.berkeley.edu/INA.html 

KAPRAUN, D.F. (1970). Field and cultural studies of Ulva and 

Enteromorpha in the vicinity of Port Aransas, Texas. Contrib. 

Mar. Sci., 15: 205 – 285. 

KOEMAN, R.P.T. & VAN DEN HOEK, C. (1981). The taxonomy of Ulva 

(Chlorophyceae) in The Netherlands. Br. J. Phycol., 16: 9 – 53. 

KOEMAN, R.P.T. & VAN DEN HOEK, C. (1982). The taxonomy of 

Enteromorpha Link, 1820 (Chlorophyceae) in the Netherlands. I. 

The section Enteromorpha. Arch. Hydrobiol. Suppl., 63: 279 – 330. 

KONO, M., SATOH, H., OKABE, Y., ABE, Y., NAKAYAMA, K. & 

OKADA, M. (1991). Nucleotide sequence of the large subunit of 

ribulose-1,5-bisphosphate carboxylase/oxygenase from the green 

alga Bryopsis maxima. Plant Mol. Biol., 17: 505 – 508. 

KORNMANN, P. (1965). Ontogenie und Lebenszyklus der Ulotrichales 

in phylogenetischer sicht. Phycologia, 14: 163 – 172. 

KU¨ TZING, F.T. (1845). Phycologia Germanica. Nordhausen. 

KU¨ TZING, F.T. (1849). Species Algarum. Leipzig. 

KU¨ TZING, F.T. (1856). Tabulae Phycologicae . . . VI. Nordhausen. 

LAMARCK, J.B. DE &DE CANDOLLE, A.P. (1805). Flore française, 3rd 

edn. Paris. 

LARSEN, J. (1981). Crossing experiments with Enteromorpha 

intestinalis and E. compressa from different European localities. 

Nord. J. Bot., 1: 128 – 136. 

LE JOLIS, A. (1863). Liste des Algue Marines de Cherbourg. Me´m. 

Soc. Imp. Sci. Nat. Cherbourg, 10: 6 – 168. 

LESKINEN,E.&PAMILO, P. (1997). Evolution of the ITS sequences of 

ribosomal DNA in Enteromorpha (Chlorophyceae). Hereditas, 

126: 17 – 23. 

LEVRING, T. (1938). Verzeichnis einiger Chlorophyceen und 

Phaeophyceen von Su¨ dafrika. Lunds Univ. A˚rsskr. N.F. Avd. 2, 

34(9): 25pp. 

LINK, H.F. (1820). Epistola de algis aquatics in genera disponendis. 

In Horae Physicae Berolinensis (Nees von Esenbeck, C.D., editor). 

Bonn, 1 – 8. 

LINNAEUS, C. (1753). Species planarum, exhibentes plantas rite 

cognitas, ad genera relatas, cum differentiis specificus, nominibus 

trivialibus, synonymis selectis, locis natalibus, secundum systema 

sexuale digestas. Ed. 1. Vols. 1 – 2, Salvii, Stockholm. Vol. 1, pp 

[i – xii] 1 – 560. Vol. 2, pp. [i], 561 – 1200, [1 – 30 index]. 

LØVLIE, A. (1964). Genetic control of division rate and morphogenesis 

in Ulva mutabilis Føyn. C. R. Trav. Lab. Carlsberg, 34: 77 – 

168. 

MALTA, E.-J., DRAISMA, S.G.A. & KAMERMANS, P. (1999). Freefloating 

Ulva in the southwest Netherlands: species or morphotypes? 

A morphological, molecular and ecological comparison. 

Eur. J. Phycol., 34: 443 – 454. 

MANHART, J.R. (1994). Phylogenetic analysis of green plant rbcL 

sequences. Mol. Phylogenet. Evol., 3: 114 – 127. 

MISHKIND, M., MAUZERALL, D. & BEALE, S.I. (1979). Diurnal 

variation in situ of photosynthetic capacity in Ulva is caused by a 

dark reaction. Plant Physiol., 64: 896 – 899.


MONTAGNE, J.F.C. (1846). Phyceae. In Voyage autour du monde 

exećute´ pendant les anneés 1836 et 1837 sur la corvette ‘La Bonite’ 

commandeé par M. Vaillant. Botanique. Vol. 1: Cryptogames 

cellulaires et vasculaires (Gaudichaud, C., editor), 1 – 112. Paris. 

MU¨ LLER, O.F. (1778). Flora Danica, pls 760 – 780. 

NEES, C.G. (1820). Horae physicae berolinenses. Bonn. 

PAPENFUSS, G.F. (1960). On the genera of the Ulvales and the status 

of the order. J. Linn. Soc. (Bot.), 56: 303 – 318. 

PHILLIPS, J.A. (1988). Field, anatomical and developmental studies 

on southern Australian species of Ulva (Ulvaceae, Chlorophyta). 

Aust. Syst. Bot., 1: 411 – 456. 

PROVASOLI, L. (1965). Nutritional aspects of seaweed growth. Proc. 

Can. Soc. Plant Physiol., 6: 26 – 27. 

PROVASOLI, L.&PINTNER, I.J. (1980). Bacteria induced polymorphism 

in an axenic laboratory strain of Ulva lactuca (Chlorophyceae). 

J. Phycol., 16: 196 – 201. 

RAMI´ REZ, M.E. & SANTELICES, B. (1991). Catalogo de las algas 

marinas bentońicas de la costa temperada del Pacı´fico de Sudame´rica. 

Monografías Biolo´ gicas no. 5, Pontificia Universidad Cato´ lico de 

Chile. Publicaciones Perio´ dicas, Vicerrectoría Académica. 

RICKER, R.W. (1987). Taxonomy and Biogeography of Macquarie 

Island Seaweeds. British Museum (Natural History), London. 

SHERWOOD, A.R., GARBARY,D.J.&SHEATH, R.G. (2000). Assessing 

the phylogenetic position of the Prasiolales (Chlorophyta) using 

rbcL and 18S rRNA gene sequence data. Phycologia, 39: 139 – 146. 

SILVA, P.C. (1952). A review of nomenclatural conservation in the 

algae from the point of view of the type method. Univ. Calif. Publ. 

Bot., 25: 241 – 324. 

SILVA, P.C., BASSON, P.W. & MOE, R.L. (1996). Catalogue of the 

benthic marine algae of the Indian Ocean. Univ. Calif. Publ. Bot., 

79: 1 – 1259. 

SOLTIS, D.E. & SOLTIS, P.S. (1998). Choosing an approach and an 

appropriate gene for phylogenetic analysis. In Molecular Systematics 

of Plants II, DNA Sequencing (Soltis, D.E., Soltis, P.S. & 

Doyle, J.J., editors). Kluwer Academic, Boston, MA. 

STEFFENSEN, D.A. (1976). Morphological variation in Ulva in the 

Avon-Heathcote Estuary, Christchurch. N. Z. J. Mar. Freshwater 

Res., 10: 329 – 341. 

STEGENGA, H., BOLTON, J.J. & ANDERSON, R.J. (1997). Seaweeds of 

the South African West Coast. Bolus Herbarium, University of 

Cape Town, Cape Town. 

STILLER, J.W.&WAALAND, J.R. (1993). Molecular analysis reveals 

cryptic diversity in Porphyra (Rhodophyta). J. Phycol., 29: 506 – 517. 

SUHR, J.N. VON (1839). Beiträge zur Algenkunde. Flora, Jena, 22: 

65 – 75. 

SWOFFORD, D.L. (1999). PAUP* Phylogenetic Analysis Using 

Parsimony (*and other methods), version 4. Sinauer Associates, 

Sunderland, Mass. 

SWOFFORD, D.L., OLSEN, G.J., WADDELL, P.J. & HILLIS, D.M. 

(1996). Phylogenetic inference. In Molecular Systematics (Hillis, 

D.M., Moritz, C. & Mable, B.K., editors), pp. 407 – 514. Sinauer 

Associates, Sunderland, Mass. 

TAN, I.H., BLOMSTER, J., HANSEN, G., LESKINEN, E., MAGGS, C.A., 

MANN, D.G., SLUIMAN, H.J. & STANHOPE, M.J. (1999). Molecular 

phylogenetic evidence for a reversible morphogenetic switch 

controlling the gross morphology of two common genera of 

green seaweeds, Ulva and Enteromorpha. Mol. Biol. Evol., 16: 

1011 – 1018. 

TANNER, C.E. (1979). The taxonomy and morphological variation 

of distromatic ulvaceous algae (Chlorophyta) from the northeast 

Pacific. PhD dissertation, Department of Botany, University of 

British Columbia, Vancouver. 

294 

TANNER, C.E. (1980). Chloropelta gen. nov., an ulvaceous green alga 

with a different type of development. J. Phycol., 16: 128 – 137. 

TANNER, C.E. (1986). Investigations of the taxonomy and morphological 

variation of Ulva (Chlorophyta): Ulva californica Wille. 

Phycologia, 25: 510 – 520. 

THOMPSON, A.J. & HERRIN, D.L. (1994). A chloroplast group I 

intron undergoes the first step of reverse splicing into host 

cytoplasmic 5.8 S rRNA. J. Mol. Biol., 236: 455 – 468. 

THOMPSON, J.D., GIBSON, T.J., PLEWNIAL, F., JEANMOUGIN, F.& 

HIGGONS, D.G. (1997). The ClustalX windows interface: flexible 

strategies for multiple sequence alignment aided by quality 

analysis tools. Nucleic Acids Res., 24: 4876 – 4882. 

TITLYANOV, E.A., GLEBOVA, N.T. & KOTLYAROVA, L.S. (1975). 

Seasonal changes in structure of the thalli of Ulva fenestrata P. et 

R. Ekologiya, 6: 320 – 324. 

TREVISAN, V.B.A. (1842). Prospetto della flora Euganea. Padua. 

VAN DE PEER, Y., DE RIJIK, P., WUYTS, J., WINKELMANS, T.&DE 

WACHTER, R. (2000). The European small subunit ribosomal 

RNA database. Nucleic Acids Res., 28: 175 – 176. 

VAN DEN HOEK, C., MANN, D.G. & JAHNS, H.M. (1995). Algae: An 

Introduction to Phycology. Cambridge University Press, Cambridge. 

VAN OPPEN, M.J.H. (1995). Tracking trails by cracking codes. PhD 

dissertation, University of Groningen, The Netherlands. 

VINOGRADOVA, K.L. (1974). Ul ’vovye vodorosli (Chlorophyta) morej 

SSSR. Nauka, Leningrad. 

WENDEL, J.F. & DOYLE, J.J. (1998). Phylogenetic incongruence: 

window into genome history and molecular evolution. In 

Molecular Systematics of Plants II, DNA Sequencing (Soltis, 

D.E., Soltis, P.S. & Doyle, J.J., editors). Kluwer Academic, 

Boston, Mass. 

WOMERSLEY, H.B.S. (1956). A critical survey of the marine algae of 

Southern Australia. I. Chlorophyta. Aust. J. Mar. Freshwater 

Res., 7: 343 – 383. 

WOMERSLEY, H.B.S. (1984). The Marine Benthic Flora of Southern 

Australia, part I. Government Printer, South Australia, Adelaide. 

WOOLCOTT, G.W. & KING, R.J. (1999). Ulva and Enteromorpha 

(Ulvales, Ulvophyceae, Chlorophyta) in eastern Australia: comparison 

of morphological features and analyses of nuclear rDNA 

sequence data. Aust. Syst. Bot., 12: 709 – 725. 

WULFEN, F.X. (1803) Cryptogama Aquatica. Arch. Bot. (Ro¨mer), 3: 

1 – 64. 

WUYTS, J., DE RIJIK, P., VAN DE PEER, Y., WINKELMANS, T.&DE 

WACHTER, R. (2001). The European large subunit ribosomal 

RNA database. Nucleic Acids Res., 29: 175 – 177. 

WYNNE, M.J. (1986). Report on a collection of benthic marine algae 

from the Namibian coast (southwestern Africa). Nova Hedwigia, 

43: 311 – 355. 

WYNNE, M.J. (1998). A checklist of benthic marine algae of the 

tropical and subtropical western Atlantic: first revision. Nova 

Hedwigia, 116: 1 – 155. 

YANG, R.C., DOVE, M., SELIGY, V.L., LEMIEUX, C., TURMEL, M.& 

NARANG, S.A. (1986). Complete nucleotide sequence and mRNAmapping 

of ribulose-1,5-bisphosphate carboxylase/oxygenase 

(RuBisCo) from Chlamydomonas moewusii. Plant Mol. Biol., 10: 

259 – 270. 

YANG, Z. (1994a). Estimating the pattern of nucleotide substitution. 

J. Mol. Evol., 39: 105 – 111. 

YANG, Z. (1994b). Maximum likelihood phylogenetic estimation 

from DNA sequences with variable rates over sites: approximate 

methods. J. Mol. Evol., 39: 306 – 314.

Linnaeus was right all along: Ulva and Enteromorpha are not distinct ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?