Cimino&Ghiselin-tmpZXYZ:Template Proceedings_1.qxd.qxd

PROCEEDINGS OF THE CALIFORNIA ACADEMY OF SCIENCES 

Volume 60, No. 10, pp. 175–422, 1 fig., 16 pls., 1 table, Appendices September 25, 2009 

Chemical Defense and the Evolution 

of Opisthobranch Gastropods 

Guido Cimino 1 and Michael T. Ghiselin 2 

(With photographs by Terrence Gosliner, Ernesto Mollo and Guido Villani) 

1 Istituto di Chimica Biomolecolare, CNR, Via Campi Fegrei 34, 80078, Pozzuoli, Naples, Italy; 

Email: guido.cimino@icb.cnr.it; 2 Department of Invertebrate Zoology & Geology, California Academy of 

Sciences, 55 Music Concourse Drive, San Francisco, California 94118; Email: mghiselin@calacademy.org 

Opisthobranch gastropods and their marine pulmonate relatives have tended to lose 

their shells as a consequence of being protected by chemical defense. Metabolites 

obtained from food have been modified and deployed adaptively. The animals have 

sometimes evolved the capacity to synthesize metabolites that were originally 

obtained from food. Some evidence suggests that this capacity has evolved beginning 

with an initial stage in which only the end product is synthesized, followed by a series 

of later innovations in which precursors of that end product are added working 

backward. There is a complex history of changes in what the animals eat and how 

they utilize metabolites defensively. When a change in feeding habits has deprived 

the animals of their original defensive metabolites, other compounds are often 

pressed into service. Among these are polypropionates, which are not biosynthesized 

by any other eukaryotes. The polypropionates probably exist at low concentration 

and have some other function in animals that do not use them defensively. There is 

rigorous and compelling experimental support for the biosynthesis of metabolites by 

the opisthobranchs themselves. An herbivorous common ancestor has given rise to 

many herbivorous lineages and to a wide variety of carnivores. Diversification has to 

some extent corresponded to the taxonomy of the food source, but the animals have 

often come to exploit unrelated food organisms that share the same metabolites or 

have a similar texture. The remarkable adaptive radiation of these animals can be 

explained as a result of their capacity to innovate in how they utilize their food 

sources and deal with secondary metabolites. 

KEYWORDS: Adaptive radiation; Aposematism; Biosynthesis; Coevolution; Chemical 

defense; Funktionswechsel; De novo synthesis; Gastropoda; Marine; Natural products; 

Nudibranchia; Opisthobranchia; Phylogenetics; Polypropionates; Pulmonata; 

Repugnatorial glands; Review 

175

176 PROCEEDINGS OF THE CALIFORNIA ACADEMY OF SCIENCES 

Series 4, Volume 60, No. 10 

TABLE OF CONTENTS 

Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 175 

Table of Contents. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 176 

Dedication . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 178 

Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179 

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179 

CHAPTER I. Biosynthesis and Biotransformation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188 

Part 1: Biosynthesis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188 

Part 2: Biotransformation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 194 

Part 3: Deployment of Metabolites . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 195 

CHAPTER II. Comparisons and Experiments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196 

Part 1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196 

Part 2. Systematics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196 

Part 3. Metabolite Chemistry and Physiology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 202 

Part 4. Metabolite Ecology and Adaptive Significance . . . . . . . . . . . . . . . . . . . . . . . . . . . . 204 

CHAPTER III. Producers and Transformers of Secondary Metabolites . . . . . . . . . . . . . . . . . . . . 208 

Part 1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 208 

Part 2. Prokaryotes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 210 

Part 3. Plants and Fungi. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 211 

Part 4. Animals . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 211 

Part 5. Animals: Porifera . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 213 

Part 6. Animals: Cnidaria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 214 

Part 7. Animals: Deuterostomia (Echinodermata, Hemichordata, and Chordata) . . . . . . . . 215 

Part 8. Animals: Ecdysozoa, Platyhelminthes, Nemertea, Annelida. . . . . . . . . . . . . . . . . . . 215 

Part 9. Animals: Ectoprocta and Mollusca . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 216 

CHAPTER IV. Introduction to Gastropod Diversity and Systematics . . . . . . . . . . . . . . . . . . . . . . 216 

CHAPTER V. Opisthobranch Systematics and Phylogeny . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 221 

CHAPTER VI. Cephalaspidea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225 

CHAPTER VII. Anaspidea and Pteropods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 230 

CHAPTER VIII. Sacoglossa. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 275 

CHAPTER IX. Notaspidea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 282 

CHAPTER X. Nudibranchia: Doridacea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 285 

CHAPTER XI. Other Nudibranchs. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 306 

Part 1. Dendronotacea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 307 

Part 2. Arminacea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 308 

Part 3. Aeolidiacea. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 309 

CHAPTER XII. Macroevolution and Macroeconomics. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 310 

REFERENCES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 318 

APPENDIX I. An Atlas of Secondary Metabolite Structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 357 

Polyacetates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 358 

Fatty acids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 358 

Polyacetylenes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 358 

Prostaglandin lactones. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 358 

Cyclic acetogenins. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 359

CIMINO & GHISELIN: CHEMICAL DEFENSE AND EVOLUTION OF GASTROPODS 177 

Macrocyclic fatty acid lactones. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 361 

Polyethers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 362 

Aromatic polyketides . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 363 

Polypropionates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 364 

Phenols and Quinones . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 370 

Monoterpenoids. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 372 

Sesquiterpenoids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 373 

Halogenated sesquiterpenoids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 377 

Isocyanosesquiterpenoids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 378 

Furanosesquiterpenoids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 380 

Diterpenoids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 382 

Sesterterpenoids. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 390 

Degraded furanosesterterpenoids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 390 

Furanosesterterpenoids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 390 

Cyclic sesterterpenoids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 391 

Triterpenoids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 394 

Glyceride esters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 395 

Fatty acid esters. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 395 

Sesquiterpenoid esters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 395 

Diterpenoid esters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 396 

Steroids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 398 

Nitrogenous compounds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 400 

Peptides . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 404 

Macrolides . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 411 

APPENDIX II. Index to metabolite structures shown in Appendix I. . . . . . . . . . . . . . . . . . . . . . . 413 

PHOTO GALLERY OF ANIMALS DISCUSSED IN TEXT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 239



Dedication 

To the memory of 

D. John Faulkner 

10 June 1942 – 23 November 2002


Chemical Defense and the Evolution of 

Opisthobranch Gastropods 

PREFACE 

This volume presents the results of many years of collaborative work. A great deal of the planning 

and writing was done during visits to the Istituto di Chimica Biomolecolare of the Consiglio 

Nazionale delle Ricerche in Pozzuoli (Napoli). Much of the original research herein discussed was 

done there and at its predecessor the Istituto per la Chimica di Molecole di Interesse Biologico in 

nearby Arco Felice (Trincone, 2002). We wish to express our deepest gratitude to our many colleagues, 

collaborators and employees, too numerous to enumerate here, though many of them are 

cited in the references. We would like, however, to give special thanks to those who have been particularly 

helpful in the preparation of the manuscript. Margherita Gavagnin, Angelo Fontana, and 

Ernesto Mollo read drafts of the manuscript and provided advice and assistance in the course of its 

preparation. Raffaele Turco did an outstanding job preparing illustrations and the atlas of metabolites. 

Ernesto Mollo and Guido Villani provided many of the illustrations. 

At the California Academy of Sciences we have had the assistance and support of other colleagues, 

especially Terrence M. Gosliner and his students. He read drafts of the manuscript and provided 

expert advice on all aspects of the biology of opisthobranchs, especially their taxonomy. He 

also provided many of the photographs that we have used. Rebecca Johnson read a draft of the 

manuscript and made unpublished results available. William J. Bennetta’s meticulous reading of 

the manuscript provided numerous improvements, Alan E. Leviton encouraged this project, 

advised us on the manuscript, and did most of the work of getting it set up in print and published. 

We are particularly grateful to the Academy, which has a long history of research and publication 

on opisthobranchs as well as the best collections of them in the world, for publishing the work. 

It is our pleasant duty to acknowledge an International Short-Term Mobility Grant from the 

Consiglio Nazionale delle Ricerche in support of a visit to Pozzuoli. 

INTRODUCTION 

A slug, by definition, is a modified snail — one in which a shell is lacking or at least inconspicuous. 

The change from snail to slug can be seen in the animal’s embryological development. 

The young slug can generally withdraw into a shell, but as the animal gets older the soft parts of 

the body become relatively larger and the shell relatively smaller. Often the shell is cast off when 

the animal is still quite young, but sometimes it remains as a kind of vestigial organ, no longer providing 

protection but perhaps providing some skeletal support. It tends to be grown over by tissue 

and may become completely internal. The reduction of the shell can be followed through geological 

time. Intermediate stages in the transition between snail and slug are also preserved in extant 

representatives of several distinct lineages. Therefore it has happened repeatedly, in separate lines 

of descent. 

But why should something like that happen? After all, gastropods, whether they are snails or 

slugs, are slow-moving creatures that cannot easily outrun predators. Shells help to keep them from 

getting eaten. But that is not the only advantage to having a shell. It is a kind of skeleton, supporting 

the snail’s body and providing sites for the attachment of muscles. It also helps to keep terrestrial 

snails from drying out. On the other hand, it gets in the way, slowing the animal down and hin-



dering its movements. And it costs something to make a shell as well as to haul it from place to 

place. It would seem that either the advantages of getting rid of the shell outweigh the disadvantages, 

or the slugs have found some way to compensate. 

So far as avoiding predators goes, there is a fairly straightforward answer. Slugs have an 

unpleasant taste. As a general rule, the gastropods that are eaten by human beings have relatively 

well developed shells, whereas those without shells are left alone. This is true even of the airbreathing 

terrestrial snails and slugs (pulmonates). Not everybody likes escargot, but their shellless 

relatives are repugnant even to gourmets. The recipe contest for “banana slugs” that is held 

annually in Sonoma County, California was always intended as a joke. As to marine gastropods, 

quite a variety are eaten by man, including abalone (Haliotis) and various limpets. Rumor has it 

that one species of seaslug is eaten in China and another in Alaska. Anecdotes about tropical seahares 

(see Anaspidea) are better documented. However, occasional references to seaslug fisheries 

in the popular press are uninformed with respect to elementary zoology. The animals in question 

are not gastropods at all. They are not even mollusks. Rather, they are sea-cucumbers, or holothurians, 

and, like sea-stars and sea-urchins, they are echinoderms, more closely related to chickens and 

cows than to snails. 

Marine slugs, unlike their terrestrial relatives, are often very colorful. They may be strikingly 

beautiful, as one can readily see from the illustrations in this volume. Because they have no shells, 

their beauty is only apparent while they are still alive. Pickled specimens soon fade into colorless 

blobs. Consequently they are popular with photographers but not with amateur collectors, so that 

there is less of a conservation problem than there is with snails. Color patterns have a variety of 

functions in nature. Many birds have colorful sexual ornaments that are displayed during courtship. 

The color patterns of snails are not used that way, for the animals cannot perceive them. Many seem 

to be examples of warning coloration. The brilliant colors advertise the fact that the slug is not good 

to eat. Generally speaking, the slugs are not good to eat because of chemicals that are contained in 

their tissues. These chemicals are often obtained from food but sometimes the slugs make the 

chemicals themselves. We will go into such matters in considerable detail later, but for the moment 

let us dwell upon an exemplary scientific problem. Namely, did snails turn into slugs and then, 

because they were undefended, become distasteful? Or was it the other way round? In other words, 

did snails become distasteful and then, the shell being redundant, evolve into slugs? 

That sounds like the problem of “Which came first, the chicken or the egg?” Fortunately, an 

evolutionary biologist can easily solve that kind of problem. There were eggs a billion years (plus 

or minus a few hundred million) before there were chickens. And in fact it was precisely this problem 

— which came first, chemical defense or the absence of a shell — that inspired much of the 

research that went into the present volume. Faulkner and Ghiselin (1983) showed that in several 

lineages of gastropods there are both shelled and shell-less forms with defensive chemicals. 

Consequently the chemical defense must have originated while the sea slugs’ ancestors were still 

defended by shells. That kind of reasoning can be applied to quite a variety of similar problems. 

Natural products chemists and systematic zoologists are able to put their respective expertise 

together and thereby give new meaning to both disciplines. It is a kind of synergism, or, as bioeconomists 

put it, combination of labor. 

One of our goals — indeed, one might even say the ultimate goal for all science — is to place 

the data of natural history within the context of an explanatory historical narrative. Such a view of 

what scientists ought to do is out of line with an old tradition in the philosophy of science. 

According to that view, science deals with the laws of nature and nothing whatsoever else; anything 

that refers to individuals in the broad, philosophical sense of particular material bodies or 

events is, by definition, something other than science. An historical science would be a contradic-


tion in terms. Defining “science” that way may seem rather odd, for it would mean that although 

physics is a science, astronomy is not. So too with geology, paleontology, anatomy, embryology, 

genomics, zoology, botany, bacteriology and anything else that might by any stretch of the imagination 

be considered a natural history discipline. That definition is arbitrary, subjective, and inappropriate 

to an understanding of science as it is pursued by real scientists in real laboratories. It 

seems far more realistic to define science in terms of the goals and methods that actually guide 

research. Science is about both the laws of nature and the particular things to which those laws 

apply. Although some sciences (the nomothetic ones) emphasize the laws, others (the idiographic 

ones) emphasize the particular things. For example, Physics is nomothetic, astronomy idiographic. 

But the distinction is misleading. Although some sciences emphasize the nomothetic aspect and 

others the idiographic aspect, the two are investigated together, often in the context of the same 

research program. An explanatory narrative puts the two aspects together by describing what has 

happened and explaining it in terms of laws of nature. 

Toward the end of the eighteenth century such sciences as mineralogy, botany, and zoology 

were statically descriptive. Natural history was not conceived of as history in the sense of describing 

and explaining the natural order in terms of what has happened and why. But with the rise of 

geology and the introduction of evolutionary thinking (or something like it) there was a gradual 

shift from natural history to the history of nature (Lepenies, 1976). The real breakthrough came 

with Darwin’s accomplishment. On the one hand, in The Origin of Species, he said: “Our classifications 

will come to be, so far as they can be so made, genealogies….” (Darwin, 1859:486). 

Groups of organisms are branches of phylogenetic trees, and much of natural order is the product 

of historical accident and circumstance. On the other hand, Darwin proposed the theory of natural 

selection, which provides the law-like basis for explaining diversity, replacing the assumptions 

about a supernatural order that had so long been presupposed. Evolutionary theory could now provide 

the basis for explanatory narratives in biology. The transformation of biology into an historical 

science occurred gradually, however, and its integration with natural products chemistry is a 

particularly enlightening example. 

Chemistry is generally thought of as one of the nomothetic disciplines, but natural products 

chemistry is somewhat of an exception. It has traditionally been associated with botany and materia 

medica. As is common knowledge, not just medicines, but also poisons, flavorings, perfumes 

and many other chemicals that are in daily use are derived from plants, fungi, and microorganisms, 

and occasionally from animals. People began to use herbal remedies long before the rise of civilization, 

and the folk medicine of primitive tribes continues to yield valuable contributions to science. 

The roles that such materials play in the lives of the organisms that produce them, however, 

are not so widely appreciated. Not everybody who smokes, for example, realizes that nicotine is a 

natural insecticide. Even scientists were slow to understand such matters. 

The chemicals to be discussed later on in this work have been investigated largely in the hope 

that they would provide “drugs from the sea,” as can be seen from three books devoted to that subject 

(Freudenthal, ed., 1968; Fautin, ed., 1988; Fusetani, ed., 2000). In the first of these books the 

emphasis was largely on plants. The mollusks covered were mainly venomous ones, such as cone 

shells and Octopus, and bivalves with toxins taken up from small plants filtered out of the water. 

The opisthobranchs were scarcely mentioned, and although the sponges were beginning to receive 

attention, the nudibranchs as a source of sponge-derived metabolites were as yet unknown. The 

first metabolites of marine organisms to receive attention from medical researchers were alkaloids, 

as one might expect since some of them, such as the tetrodotoxin that occurs in the flesh of some 

fishes and in the tissues of bivalves, are exceedingly toxic and often fatal to human beings who 

ingest them. Tetrodotoxin and related alkaloids are the main exceptions to a general rule noted by



Daly (2004): bioreactive natural products that are found in the sea rarely occur in non-marine habitats 

and, conversely those from non-marine sources are rarely found in the sea. 

Although classes of similar chemicals occur in both habitats, the structures are usually quite 

different. This rule may seem a bit less odd when we consider the taxonomic groups that are numerically 

dominant in the sea, in fresh water, and on land. The dominant terrestrial organisms that have 

been rich sources of bioactive chemicals, namely, vascular plants and insects, occur around the 

periphery of the sea, where they are replaced by algae and crustaceans. The main groups of marine 

animals that are sources of such compounds are ones that are restricted to the sea or have just a few 

representatives in fresh water: sponges, soft corals, tunicates, echinoderms, and opisthobranch gastropods. 

Tetrodotoxin and related compounds are largely associated with tropical to semitropical 

aquatic or semiaquatic vertebrates. 

The great attention that was devoted to marine drugs began in the 1960s, and was well funded 

thanks in large measure to lavish spending by United States governmental agencies and also by 

Canada, Europe, and Japan. After several decades of concentrated effort only a few such drugs 

have become commercially successful. A synthetic peptide identical to one that occurs in snails of 

the genus Conus is now available as ziconotide (Prialt®) and used as a pain-killer. Quite a number 

of compounds, such as kahalalide F (Atlas 652), have been found to be active against tumors, but 

they are still undergoing clinical tests (Faircloth & Cuevas, 2006). The sophisticated approach now 

being applied involves synthesizing variants upon molecules that have been found to have promising 

biological activity and also understanding the chemical control of the relevant biological 

processes. The interested reader may wish to consult some of the following recent review articles: 

Newman and Cragg (2004); Newman, Cragg and Snader (2000, 2003); Paterson and Anderson 

(2005); Li and Vederas (2009); Molinski, Dalisay, Lievens and Saludes (2009). 

Before he died at the age of sixty, D. John Faulkner published splendid annual reviews summarizing 

research on marine natural products chemistry in the journal Natural Product Reports 

(Faulkner, 1984a, 1984b, 1986, 1987, 1988, 1990, 1991, 1992, 1993, 1994, 1995, 1996, 1997, 

1998, 1999, 2000a, 2001b, 2002). These reviews are still exceedingly useful. The series has been 

continued by other authors (Blunt, Copp, Munro, Northcote & Prinsep, 2004, 2005, 2006; Blunt, 

Copp, Hu, Munro, Northcote & Prinsep, 2007, 2008, 2009). Other valuable review articles have 

also been published in the same journal and we refer to some of these in the text. A massive 

Dictionary of Marine Natural Products has been edited by Blunt and Munro (2008). The chemical 

literature presents something of a bibliographical barrier to the outsider because of such practices 

as the incomplete citation of references, leaving out titles and providing only the initial page. 

Herein the references are more nearly complete. 

Early in the nineteenth century two unfortunate terms were introduced into the scientific literature: 

“organic chemistry” and “invertebrate zoology.” Organic chemistry, introduced early in the 

nineteenth century by the Swedish chemist Jöns Jakob Berzelius, reflected the ancient doctrine of 

vitalism, according to which living organisms possessed a “vital force” that endowed them with 

capacities that transcended the laws of inert matter and could not be synthesized in the laboratory. 

The refutation of vitalism began with Friedrich Wöhler’s synthesis of urea, performed in 1824 and 

made public in 1828. Subsequently the term “organic chemistry” was redefined so as to make it the 

chemistry of carbon compounds and the vitalism has become a dead metaphor. Yet as Hendrickson 

(1965) points out, during the early part of the nineteenth century organic chemistry was almost 

entirely concerned with the chemistry of natural products. Organic chemists continued to study 

them, but as a specialized branch of a larger discipline. The chemicals of interest to natural products 

chemists are mainly what are called “secondary metabolites” to distinguish them from the 

“primary metabolites,” which are involved in the major biochemical pathways of the organism.


Secondary metabolites are secondary in the sense that they are made from the primary metabolites. 

Although secondary in that sense, they may be of crucial significance in the lives of the organisms 

in which they occur. 

It was Jean-Baptiste Lamarck, the most influential pre-Darwinian evolutionist, who introduced 

the term “invertebrate” into the scientific literature. Invertebrates are animals without backbones. 

The sub-phylum of chordates to which we belong, Vertebrata, is a legitimate assemblage of animals 

all of which do in fact have backbones, and all of which are descended from a common ancestor. 

But invertebrates have nothing in common. They are just the animal kingdom minus one of its 

many branches. Dividing the animals in that way is like giving equal importance to British and 

non-British history. Lamarck believed that progress is a law, and thought that he could arrange all 

of the animals in a single series from lower to higher, culminating in Man. Simple animals, he 

thought, are continually being generated spontaneously and then giving rise to increasingly complex 

ones. He did suggest that adaptation to particular circumstances has led some animals to deviate 

somewhat from the general tendency for progressive change. But for him branching was unimportant. 

His classifications, because they arranged the materials in series, or “grades” proceeding 

from lower to higher, did not reflect the underlying pattern of diversification through time. 

Darwin, on the other hand, recognized the importance of common ancestry and evolutionary 

divergence. Arranging the materials in terms of recency of common ancestry meant that classification 

could be truly historical. The different groups of organisms could now be seen as diversifying, 

and adapting to ever-changing circumstances. The groups would come to occupy an increasing 

variety of ecological niches, or, as he put it, “places in the economy of nature.” The natural economy 

that he envisaged was a competitive one, in which the resources necessary for survival and 

reproduction were of crucial significance. The features of organisms could be explained as furthering 

the ability of their possessors to survive and reproduce—in other words, as adaptations in the 

sense of the products of an evolutionary process. 

Darwin’s theory of natural selection suggested that a much closer fit exists between organisms 

and their environments than had previously been realized. Impressive evidence for natural selection 

came in the form of discoveries about defensive adaptations that were made by three of 

Darwin’s followers. Camouflage, which conceals an insect from a predator, has an obvious advantage 

in the struggle for existence, but what about the insects that are conspicuously colored? 

Darwin put that question to the co-discoverer of natural selection, Alfred Russel Wallace, who 

came up with the answer: warning coloration. The conspicuous animal is in effect advertising the 

fact that it is distasteful or otherwise not appropriate as food. Henry Walter Bates, who accompanied 

Wallace to South America, discovered what is called “Batesian mimicry” in his honor. 

Distasteful butterflies often live together with butterflies of other species that are not distasteful but 

look like them (respectively the model and the mimic). Bates was able to show that often the mimic 

and the model are quite distantly related, and that a butterfly species may mimic different models 

in different parts of its geographical ranges. Another of Darwin’s early supporters, Fritz Müller, 

then a political refugee living in South America, discovered what is called “Müllerian mimicry,” in 

which butterflies of several different species, all of them distasteful, resemble one another. The 

predators, mainly birds, are more apt to leave a butterfly alone if all the distasteful ones look the 

same. 

Darwin (1862) himself wrote a book on orchids, in which he explained how these flowering 

plants reproduce with the aid of symbiotic insects. One of his points was that what might seem to 

be an unimportant structural detail often is of crucial importance in accomplishing fertilization. He 

also suggested that the structural arrangements are largely the result of historical accidents and are 

not the sort of thing that an intelligent creator would have produced. While he showed that natural



selection could account for even the most remarkable of adaptations, Darwin also reasoned that his 

theory would allow for a substantial amount of non-adaptive and even maladaptive change. 

Establishing the adaptive significance, or lack of it, of a feature may require a great deal of 

research. But adaptation has always been a contentious issue in evolutionary biology, and natural 

products chemistry has been a part of that discourse. Secondary metabolites have often been dismissed 

as useless byproducts that are excreted as waste. 

A strong reaction against Darwinism set in toward the end of the nineteenth century, and the 

difficulty of understanding evolution was exacerbated by the problems of reconciling the theory of 

natural selection with the primitive sort of genetics that emerged around 1900. Various alternative 

views about evolution were popular in the early part of the twentieth century, and these included 

efforts to explain the features of organisms in terms of physical and chemical forces rather than 

adaptation by natural selection. Assertions that various features are non-adaptive were commonplace 

in a wide range of biological literature. Often such claims were made merely because the 

author could not imagine a use for something. 

Objections to Darwin’s theory on the basis of ideas about genetics collapsed in the 1930s. 

Theoretical population geneticists were able to show that selection is effective in producing change 

even when the advantage of one variant over another is quite small. Consequently biologists from 

various disciplines created the so-called “synthetic theory” of evolution during the period from 

around 1935 to 1950. It was very much like Darwin’s original theory, but corrected with respect to 

matters of inheritance. Part of the synthesis involved taking a hard look at the supposedly maladaptive 

character of color patterns of butterflies and land-snails and re-interpreting them as adaptive 

features: often they were protective. Such efforts were really just beginning when, in 1959, the synthetic 

theorists celebrated their victory with the centennial of The Origin of Species (Tax, ed., 

1960). 

One point that Darwin had made, but which tended to be overlooked, or at least was neglected 

for some time, had to do with adaptation. Darwin conceived of adaptation by natural selection 

as resulting from differential reproductive success within species. The organism that has more 

descendants than its neighbor passes more of its traits to subsequent generations. Selection works 

through reproductive competition between individuals (not necessarily individual organisms as we 

shall see). That puts a severe restriction upon what evolutionary changes are possible. Yet if we 

understand that point, we are in a position to rule out certain kinds of explanations for the adaptive 

significance of one or another trait. It is not legitimate merely to suggest that a chemical that repels 

predators exists because it is “good for the species.” If the predator kills the organism with a defensive 

chemical, the species will remain unchanged or indeed selection might favor its loss. In studying 

such matters one has to specify how natural selection has favored the evolution of the chemical 

in question. Sometimes the answer is that the individual that gets selected is a family rather than 

a single organism, but we defer our discussion of such matters until a later chapter. 

Ruling out species-level or population level adaptation allowed for major advances in our 

understanding of adaptation in the 1960s and 1970s. But around 1975 something of a reaction sent 

in. This was in part linked to the controversy over “sociobiology” that emerged around that time. 

Some of the adaptive explanations that were being proposed were quite dubious, and open to criticism 

as having no more foundation than the products of imaginative literature. They were dismissed 

as “fairy tales” or “just-so stories.” Such criticisms, however valid, were sometimes carried 

too far. Adaptive explanations in science are just like other hypotheses. They are no more than 

interesting possibilities until they have been tested by the appropriate methods. Such methods have 

been available ever since Darwin, and the evidence that is needed to apply them continues to accumulate.


The division of labor among scientific disciplines has many advantages, but the specialization 

that it involves is by no means an unmixed blessing. Often there is a considerable delay before scientists 

understand and appreciate developments outside of their own fields. The notion that secondary 

metabolites are non-adaptive features was still being taken seriously in the natural products literature 

into the 1980s, to judge from the fact that papers rebutting it were being published (Seigler, 

1977; Jones, 1979; Ireland, Roll, Molinski, McKee, Zabriskie & Swersey, 1988). The ecological 

role of natural products has received an increasing amount of attention as their adaptive significance 

has gradually become more apparent. Ecological studies of secondary metabolites have been 

less concerned with evolution than one might expect. They have often addressed the question of 

adaptive significance, but the approach has tended to be an experimental one, and not the kind of 

comparative study that an evolutionary biologist would tend to favor. In general, experimental disciplines 

such as physiology and pharmacology have not focused much attention on evolutionary 

questions. We should point out, however, that among biochemists there has been a long tradition 

of addressing such topics as the origin and early evolution of life. Among the topics considered in 

that literature has been the evolution of biosynthesis. Although the origin of life is a topic for which 

few hard data are available, the evolution of biosynthesis can be studied by comparing living 

organisms. The biosynthesis of secondary compounds has been a major topic of interest to natural 

products chemists. One of our main reasons for writing this monograph has been to encourage them 

to study biosynthesis from an evolutionary point of view. 

Systematic biology is the discipline (or group of disciplines) devoted to the study of biodiversity 

as such. It is largely concerned with classification and emphasizes the comparative approach. 

Although systematics was to some extent transformed into an historical science under the influence 

of Darwin, its traditions are much older, and the process of assimilating evolutionary thinking is 

still going on. The old naturalists were quite successful in arranging the materials of natural history 

in groups and providing catalogs and classification systems. Pre-Darwinian comparative anatomy 

provided detailed comparisons of the structure of plants and animals that were later given evolutionary 

interpretations. However, it was possible to continue comparing and classifying organisms 

as if nothing had really happened. Groups of organisms could be discovered simply by putting 

specimens together on the basis of their shared characteristics, without giving much thought 

to the historical processes that have been responsible for the similarities and differences. A morphological 

tradition that goes back to the German poet Johann Wolfgang von Goethe (1749-1832) 

sought to compare organisms on the basis of purely formal properties and abstract patterns, and to 

treat function as unimportant. That tradition remains influential. 

Systematists, including botanists, zoologists, and bacteriologists, have often drawn upon secondary 

metabolites to supplement the usual anatomical or morphological features that are more 

readily seen and preserved in museum specimens. Often the goal has simply been to increase the 

number and variety of characters, especially in groups that have proved difficult to classify. We 

occasionally read of one metabolite or another being useful as a “taxonomic marker” or what a systematist 

would call a “diagnostic character.” Only gradually, and recently, have such efforts been 

enhanced by consideration of what these chemicals do in the lives of the organisms, and of how 

the pattern of diversity has been produced by evolutionary processes. 

The synthetic theory of evolution, which was considered essentially complete by the 1950s, 

largely, though not exclusively, focused upon those evolutionary processes that take place at the 

level of the species and the local population. Morphology and comparative anatomy contributed 

remarkably little at the time (Ghiselin, 1980, 2006). That was partly due to the fact that the architects 

of the theory were not particularly interested in them. For another thing, morphology had 

always de-emphasized function. And, finally, zoologists working with traditional materials and



approaches had little new to offer except, sometimes, speculations that filled in gaps in their data. 

There was an opportunity to extend the synthesis by using new materials and an improved 

methodology. Molecular biology was particularly promising, especially when rapid sequencing 

techniques for proteins and nucleic acids became available. The new molecular techniques largely 

supplanted older ones such as immunology, so calling this a “molecular revolution” is a bit hyperbolic. 

What might be called a “restoration” rather than a “revolution” was the rediscovery of the 

importance of branching sequences in addressing problems of evolutionary history. There had been 

too much emphasis on arranging the organisms on the basis of how primitive and advanced they 

are and of how one group has given rise to another. The problem-solving situation called for placing 

the branches of a phylogenetic tree next to their closest relatives, and asking how the various 

lineages have diverged. 

One of us (M.G.) did his doctoral research on the reproductive systems of opisthobranch gastropods, 

a group of mollusks that is closely related to the air-breathing snails and slugs called pulmonates. 

The change from snail to slug has occurred in many separate lineages of opisthobranchs 

and in several of pulmonates as well. “Parallelism” is the technical term for such an evolutionary 

pattern, in which several closely related lineages undergo the same basic modification. It is akin to 

what is called “convergence” in which initially different organisms become increasingly alike, usually 

because they occupy the same habitat or have the same way of life. Hummingbirds and hawkmoths 

provide a good example of convergent evolution. From a distance they look very much alike, 

but one does not have to be an expert to see that the resemblances are only superficial. Parallelism 

is much more difficult to recognize, for the resemblances, among slugs for example, can be quite 

detailed and extend to many parts of the body. Therefore parallel evolution poses an interesting 

methodological challenge. One solution to that problem is to find parts of the body that show divergence, 

rather than parallelism—in other words parts that become different instead of changing in 

the same basic way. The reproductive system evolves more or less independently of the rest of the 

body and is not much affected by the changes that are involved in transforming a snail into a slug. 

The resulting phylogenetic tree left many questions open, but it did have some interesting 

implications. Among these was the fact that the various lineages of opisthobranchs tended to specialize 

in feeding upon a particular kind of food, or, what amounts to much the same thing, to having 

the same basic feeding mechanism. Gastropods in general move around quite slowly, but they 

are adept at finding, subduing, and processing “difficult” food items. The oral cavity usually contains 

a tongue-like strap called a radula, covered with hard teeth, which is very effective in cutting 

and tearing. Opisthobranchs tend to specialize on food items that other animals leave more or less 

alone. A fair number eat other opisthobranchs. Some eat macroscopic or filamentous algae. Many 

feed upon sponges. How that relates to natural products chemistry was not obvious until D. John 

Faulkner of the Scripps Institution of Oceanography entered the picture. He and his collaborators 

had been studying the natural products chemistry of many marine organisms, including opisthobranchs, 

and posed the “which came first” question that was discussed earlier in this introduction. 

We found evidence that supported his idea that use of defensive metabolites preceded the loss of 

the shell. Not only that, the use of chemical defense turned out to be even more widespread and 

various within the group than had been anticipated. We concluded that chemical defense has been 

the “driving force” behind the large-scale evolution of the group (Faulkner & Ghiselin, 1983). 

Meanwhile, at Naples, where we would later join forces, G.C. had also become interested in 

the chemistry and biology of mollusks. He did his doctoral thesis on the black pigments called 

melanins of the cephalopod Sepia officinalis. Later he worked extensively on other marine animals 

including sponges. Toward the end of the 1980s he actively collaborated with Spanish biologists, 

notably the evolutionary ecologist Joandomenec Ros, and shifted his research program to opistho-


branch gastropods, especially to the biological role of the secondary metabolites that occur in them. 

There were obvious evolutionary implications. The data suggested stages, with accumulation of 

metabolites from the diet, followed by their transformation and finally by synthesis de novo. But 

the stages in question represented evolutionary grades, not the actual series of ancestors and 

descendants. What was needed was a detailed treatment of what had happened in different lineages. 

Upon getting together at Naples in 1995, we began to organize a collaborative research program. 

That collaboration benefited from the advice and assistance of colleagues at the California 

Academy of Sciences, which had become the leading center of research in the systematics of 

opisthobranchs thanks to the efforts of Terrence M. Gosliner and his group. We were thus in a position 

to combine the resources of state of the art laboratories in both natural products chemistry and 

opisthobranch systematics. 

We decided that the results of G.C. and his collaborators’ work could be recast in more strictly 

geneaological form and presented as review articles. For reasons of convenience we began with 

a discussion of one of the opisthobranch orders, Sacoglossa, a group for which there was ample 

material and for which a good classification was available (Cimino & Ghiselin, 1998). That was 

followed by a similar review of chemical defense and evolution in dorid nudibranchs that required 

more extended discussion (Cimino & Ghiselin, 1999). We then accepted an invitation to write a 

chapter entitled “Marine Natural Products Chemistry as an Evolutionary Narrative” in a book on 

marine chemical ecology (Cimino & Ghiselin, 2001). In that chapter we presented a somewhat 

broader survey of natural products chemistry and said something more about opisthobranchs but 

did not complete our survey of the group. 

To some extent this monograph reiterates, updates, and completes what was said in our earlier 

publications. However, much of what is said here is new, and has not been reviewed elsewhere. 

We have taken the opportunity to present these materials in a way that makes them accessible to a 

somewhat broader range of readers, although this is not intended as a “popular” book. On the other 

hand the illustrations have been chosen with their aesthetic qualities in mind, and we hope that an 

even larger audience will enjoy them. 

We begin with a survey of the main classes of metabolites that are of interest. Then we explain 

how they are synthesized and how they evolve. Then we discuss what happens to them in the bodies 

of the organisms. We consider the methods used, both experimentally and comparatively. 

Having completed such preliminaries we proceed to survey the groups of organisms that provide 

opisthobranchs with food and metabolites. Then we present a detailed evolutionary narrative, or 

scenario, for the evolution of chemical defense among opisthobranchs and some other gastropods. 

The scenario forms the bulk of the work. It is a bioeconomic scenario (Bertsch & Ghiselin, 1985). 

Bioeconomics is an emerging branch of knowledge that seeks to combine thinking like Charles 

Darwin with thinking like Adam Smith (Landa & Ghiselin, 1999). At the end we consider the 

implications of the scenario for our understanding of how life in general has diversified through 

time.



CHAPTER I 

BIOSYNTHESIS AND BIOTRANSFORMATION 

Part 1: Biosynthesis 

The ability of organisms to synthesize primary metabolites must have originated very early in 

the history of life. Indeed, we might go so far as to say that the origin of life and the origin of 

biosynthetic capacity are the same basic phenomenon. When a functional unit has arisen that is able 

to control and orchestrate a system of chemical reactions that sustain its existence and further its 

reproduction, we have what may reasonably be considered an organism. Much earlier, during what 

is considered prebiotic evolution, the precursors of such organized systems are supposed to have 

taken advantage of materials that were furnished by chemical reactions in the environment. The 

transition from the prebiotic to the biotic stage would then have involved the increasing ability to 

fabricate and transform a limited number of primary metabolites. Cells as we know them contain 

systems of biochemical pathways, such as the Krebs cycle, that make such metabolites available 

for the basic activities of the organism. Such activities are facilitated by enzymes, which are catalysts. 

Catalysts do not allow an organism to do anything contrary to the laws of nature. Instead they 

affect the rate at which reactions occur. In a biosynthetic pathway metabolites are modified step by 

step, with each step under enzymatic control. 

It has been speculated that the earliest enzymes were RNA molecules. Like DNA, which is the 

hereditary material in most organisms, RNA can be replicated within the cell. But unlike DNA, 

RNA has also been shown to function as a catalyst or enzyme. According to the “RNA world” theory, 

DNA gradually replaced RNA as the hereditary material, and proteins took over most (but not 

quite all) of the enzymatic activity. So, at present, the main activity of RNA is that of transforming 

amino acids into polymers (including enzymes) using the hereditary material in the DNA as a template. 

The evolution of biosynthetic pathways can occur by changes of the genes that control the 

structure of the enzymes. A mutation of a gene may alter the enzyme for which it codes such that 

it catalyzes another reaction and consequently gives rise to a different product. But that means losing 

the original product, which is not necessarily a good thing. New genes may also arise by duplication 

of a pre-existing one. Such gene duplication makes an identical enzyme available, which can 

then be modified, perhaps catalyzing reactions that did not occur previously. The pathway can 

thereby be changed by adding a new step at the end, or by giving rise to two different end products 

(Fischbach & Clardy, 2007). The history of the evolution of biosynthetic pathways can be reconstructed 

as a series of duplications and subsequent divergent modifications of the molecules and 

the genes that code for them. However, that is not the only thing that goes on, and we must avoid 

oversimplifying. In addition to genes that code for proteins, there are regulatory genes that affect 

what product is produced when, and where, and in what quantity. And the activities of cells and 

organs also come into play. 

The opportunistic character of evolutionary change in general provides an important basis for 

reconstructing evolutionary history. New features arise from the modification of pre-existing ones. 

Darwin’s follower Anton Dohrn (1840-1909) created the magnificent marine laboratory at Naples 

for the study of evolution among marine organisms. He also propounded what he called the principle 

of the succession of functions (Dohrn, 1875; translation in Ghiselin, 1994). According to 

Dohrn, new organs arise from earlier ones in an orderly and gradual sequence. A part begins having 

an initial main function, then it comes to have both the main function and a minor, additional 

one. With the passage of time the new function becomes increasingly important, finally replacing


the original one, and the organ as a whole becomes substantially modified in adaptation to the new 

function. Evolution by gene duplication is just a variation on that theme. In any case, research aims 

at establishing plausible precursors for modified structures. 

Biochemists, particularly those who are interested in biosynthetic pathways, have applied 

other evolutionary principles. One example is the so-called “principle of recapitulation,” which 

was popularized and elaborated by Darwin’s follower Ernst Haeckel (1834-1919). Actually 

Haeckel derived the principle from Fritz Müller, who in turn was following Darwin’s reinterpretation 

of pre-evolutionary concepts, but the details need not concern us here (see Ghiselin, 1997; 

Breidbach & Ghiselin, 2007). The simplistic version, in which the fine print is left out, tells us that 

ontogeny recapitulates phylogeny: in other words that as embryos develop they pass through a 

series of stages that repeat (recapitulate) the structures of their ancestors, beginning with a unicellular 

egg or zygote that is equivalent to a protozoan. Indeed, both Morowitz (1992) and Lahav 

(1999) treat the successive steps in biosynthetic pathways as exemplifying recapitulation at a 

molecular level. In many, perhaps most, cases, this interpretation is evidently correct and the reasons 

why are straightforward and clear. Suppose that there has been an evolutionary sequence in 

which the biosynthetic pathway has become increasingly lengthy by addition of a part at the end 

only. So, using a series of letters to represent the stages, we start with A→B, then go to A→B→C, 

then to A→B→C→D, and finally to A→B→C→D→E. Examples of such situations are available 

from the natural products literature. In some cases it is obvious that the intermediates, which are 

often present at low levels in the longer pathways, correspond to terminal products in ancestral 

organisms. The opisthobranch Scaphander lignarius contains a series of unique oxygenated arylalkenyl 

compounds (Atlas 71-77) and also, in minor amounts, a smaller ω-phenylpentadienal 

(Atlas 78) which may be its precursor in biosynthesis and perhaps in phylogeny (Della Sala, 

Cutignano, Fontana, Spinella, Calabrese, Domenech Coll, d’Ippolito, Della Monica & Cimino, 

2007). (See the chapter on Cephalaspidea for a discussion of these lignarenones.) 

Ordinarily the pathways can only be modified in certain respects. It is hard to imagine a case 

in which A→B→C→D could go to A→C→B→D, although perhaps D could drop out or B come 

from some other source. Evolutionary embryologists including Fritz Müller (1864), Aleksy 

Nikoliaevich Sewertzoff (1931) and later authors have stressed the point that recapitulation only 

applies to cases in which evolution has occurred by terminal addition. In some materials, terminal 

addition occurs, but it seems to be more the exception than the rule. What about biosynthesis? Is it 

possible to go, for example, from C→D to B→C→D to A→B→C→D? Here the stricture that 

changes must occur through stepwise changes applies, but the additions would be at the beginning, 

not the end. Our data suggested that something like this might happen in opisthobranchs, and we 

proposed that there can be evolution in the “retrosynthetic mode” in addition to the usual “anasynthetic 

mode” (Cimino & Ghiselin, 1999). Many years earlier Norman Horowitz (1945, 1965) had 

invoked evolution in the retrosynthetic mode in the context of a theory of the early evolution of 

life. In the hypothetical “soup” in which life is supposed to have evolved there would have been 

all sorts of molecules available in the environment and the organisms or pre-organisms would have 

used chemicals that resulted from a series of transformations that resulted from non-biotic activities. 

However, they would benefit from anything that increased the yield of such reactions, and 

genes giving rise to enzymes that catalyzed the final step would be favored by natural selection. 

New enzymes could then be added in the same way and for the same reason, working backwards. 

We were led to propose such a mechanism for opisthobranchs from having found evolutionary 

sequences in which the slugs began to derive metabolites from their food and to use them 

defensively, often in modified form (Cimino & Ghiselin, 1999). Later, however, they became able 

to synthesize similar metabolites themselves (de novo). The possibility then came to mind that a



given pathway might evolve beginning with an ability to modify a metabolite from the environment 

somewhat, perhaps to make it more or less toxic. Once an enzyme with that effect had 

become available, evolution by gene duplication could occur, working backward to establish an 

entire pathway. Biotransformation would precede biosynthesis. In such cases, ontogeny definitely 

would not recapitulate phylogeny. Whether that is what really happened remains an open question, 

but some of our research has been inspired by that possibility. There are other alternatives, such as 

lateral gene transfer, that also need to be considered. We will come back to such issues in later sections 

of this essay. 

This monograph uses a comparative approach to the diversity of both the animals and the 

metabolites, utilizing the systems of classification that have been worked out by biologists and 

chemists respectively. The text is organized so as to follow the biological system and tell an historical 

story, using some illustrations of the organisms and diagrams of their relationships. There is 

also a chemical classification, which has a different rationale and different rules of nomenclature. 

To facilitate comparison of the metabolites, we have presented structural diagrams of them classified 

on a chemical basis. This arrangement is presented as Appendix I. This “atlas” allows one to 

see the relevant similarities and differences among the metabolites. Another goal of this atlas has 

been to provide an inventory of the metabolites that are known from opisthobranch gastropods and 

their close relatives. We decided not to include a diagram of every known metabolite. Some of 

these are minor structural variants. Others are substances taken up with the food and not particularly 

interesting from the point of view of the biology of the animals. In both cases a few examples 

should suffice. Using the IUPAC rules of nomenclature, any organic compound can be given a 

name that describes the structure of the molecule, and occasionally we have given these. Of course 

the diagrams are much easier to use. Furthermore such names can be quite awkward. That helps to 

explain why kinds of molecules are given names that may be rather arbitrary and not very informative. 

Such names are often based upon the genus or species of the organism in which they were 

discovered. Some indication of the chemical structure is often given by means of suffixes, such as 

-ol for an alcohol or -al for an aldehyde. 

Secondary metabolites are biosynthesized from primary metabolites. The vast majority of secondary 

metabolites derive from just a few classes of simple starting materials. Likewise the mechanisms 

through which the molecules get modified are not very diverse. Therefore we can provide 

an elementary, or introductory, treatment without having to oversimplify the subject. For somewhat 

more advanced accounts that are intelligible to a broad audience, we recommend the textbooks of 

Hendrickson (1965), Mann (1994) and Dewick (1997). Our understanding of metabolism can be 

improved by greater emphasis on the bioeconomic point of view. The thermodynamic efficiency of 

metabolism has often been discussed, but that is only a beginning. Having a flexible system of 

interchangeable parts is an important feature of well organized systems of production. Modular 

organization, with a few basic components giving rise to a diversity of products, simplifies the production 

process and allows it to be more effectively controlled. 

Primary metabolism allows the organism to modify molecules and thereby make energy and 

materials available in ways that sustain life. The scheme shown in Figure I shows some of the main 

pathways that are involved in primary metabolism and how the primary metabolites provide materials 

that are used in constructing secondary metabolites. The anaerobic part, or glycolysis cycle, 

allows for the derivation of energy-rich compounds, such as ATP, from sugars and other chemicals 

either from photosynthesis or from food. The Krebs cycle makes use of oxygen and allows more 

energy to be derived. A pentose cycle is present in photosynthetic (more generally autotrophic) 

organisms only. It is absent in animals, and metabolites that derive from it must be obtained from 

food.


FIGURE I — Biogenesis of secondary metabolites. (Figure from “Chemical Aspects of Biosynthesis,” edited by John 

Mann [1994; fig. 1.2, p. 3]; reproduced by permission of Oxford University Press). 

The metabolites of interest here can be classified according to the biosynthetic pathways that 

give rise to them. These are: 1) the polyketide, 2) the isoprenoid, and 3) the amino acid pathways. 

The polyketide pathway starts with acetyl-CoA and gives rise to polyketides, polyphenols, and 

fatty acids. The acetyl-CoA provides two-carbon units that can be linked together head to tail to 

form polyketides. The polyketide pathway can give rise to linear chains, which then can give rise



to polyphenols through cross-coupling. There are also shikimic acid derivatives that have numerous 

hydroxyl groups. Fatty acids have acetyl-CoA as a starting point and through a complex series 

of reactions a linear chain is formed from a number of two-carbon subunits. The isoprenoid pathway 

again starts with acetyl-CoA, three units of which condense to form mevalonic acid, which 

gives rise to 5-carbon isoprene (2-methyl-1,3-butadiene) units. The isoprene units are linked up to 

form terpenes, steroids, carotenoids and similar compounds. The terpenes are classified according 

to the number of subunits in a way that sometimes confuses the beginner. A monoterpene consists 

of two isoprene units each with five carbon atoms. Therefore, the series goes: hemiterpenes (5 carbon 

atoms), monoterpenes (10), sesquiterpenes (15), diterpenes (20), sesterterpenes (25), triterpenes 

(30), etc. The amino acid pathway derives from various precursors in the Krebs cycle, the 

glycolytic and shikimic pathways, with some intermediate steps. These are nitrogenous compounds, 

and in general the nitrogenous secondary metabolites called alkaloids are derived from 

them. Amino acids also form peptides, which are sometimes cyclic ones, and a fair number of these 

are of interest from the point of view of chemical defense. The sacoglossan Elysia rufescens contains 

a peptide, Kahalalide F (Atlas 652), which has anti-tumoral properties and has been undergoing 

clinical tests (Hamann, Scheuer & Paul, 1994). 

Returning to Figure I, we see that the glycolysis pathway gives rise to acetyl-CoA, which, as 

we just said, forms polyketides and the mevalonic acid that begins the isoprenoid pathway. Primary 

metabolites within the glycolysis pathway give rise to several amino acids. 3-phosphoglyceric acid 

gives rise to the amino acid serine, which in turn is modified into two other amino acids, glycine 

and cysteine. Pyruvic acid, which is transformed into acetyl-CoA at the end of the glycolysis cycle, 

is also modified into three amino acids: valine, alanine, and leucine. Acetyl-CoA also enters into 

the Krebs cycle. Within the Krebs cycle there are two primary metabolites that are modified to form 

amino acids. Oxaloacetic acid is first transformed into aspartic acid, which in turn may be modified 

to form isoleucine, methionine and lysine. 2-oxoglutaric acid gives rise to three amino acids 

through a linear series of reactions: glutamic acid, then ornithine, then arginine. The other three primary 

amino acids (phenylalanine, tyrosine and tryptophan) are all cyclic. They are produced from 

shikimic acid, which is formed by the unification of phosphoenolpyruvic acid from the glycolysis 

pathway with erythrose-4-phosphate from the pentose phosphate cycle. The shikimic acid pathway 

does not occur in animals, so we have to derive these amino acids from our food. 

Making use of such simple starting materials, organisms are able to build up a vast variety of 

secondary compounds by combining subunits and variously modifying them by altering their composition 

and rearranging the parts. To understand how this is accomplished it will help to consider 

a series of examples. The particular examples have been chosen partly because they are relevant to 

what is said in later chapters. 

Let us begin with a fatty acid, stearic acid, CH 3(CH 2) 16COOH. It is a saturated fatty acid (the 

sort that one is admonished to eat less of) meaning that it has no double or triple bonds between 

the carbon atoms. Like other acetogenins it is synthesized from acetyl-CoA units. Two carbon 

atoms are added at each step, the details of which are too complex to concern us here. The reactions 

are facilitated by systems of enzymes called fatty acid synthases. The elongate stearic acid 

molecule that results can then be modified in various ways. For one thing, further two-carbon units 

can be added. Or the fatty acid can be desaturated, so that there are double or triple bonds between 

carbon atoms at various positions in the chain. Arachidic acid, CH 3(CH 2) 18COOH has the same 

number of carbon atoms as does arachidonic acid, with four double bonds, and eicosapentenoic 

acid with five double bonds. Eicosanoids and prostaglandins, which are formed from arachidonic 

and eicosapentenoic acid derivatives, are of considerable interest for the natural products chemistry 

of marine animals (see De Petrocellis & Di Marzo, 1994). Although originally found in human


prostate secretion, eicosanoids are widely distributed in animal tissues. They often have a signaling 

function. Some opisthobranchs synthesize them and use them defensively. Others defend themselves 

with eicosanoids derived from food. Acetylenic fatty acids, i. e., ones with triple bonds 

between at least two of their carbon atoms, are another important class of biologically active molecules. 

Not uncommon defensive metabolites in marine sponges and algae, they occasionally occur 

in the opisthobranchs that feed upon them. 

Head-to-tail condensation of acetate subunits can also produce polyketides characterized by 

their oxo-groups. These readily undergo cyclization, as we shall see, but in some cases the oxogroups 

are readily made out in larger molecules. The biosynthesis of polyketides, which is effected 

by systems of enzymes called polyketide synthases, is very similar to that of fatty acids 

(Staunton & Weissman, 2001). Polyketides that are not biosynthesized from acetyl-CoA are most 

unusual, but for that very reason they need to be discussed here. Certain bacteria, opisthobranchs 

and fungi have been thought to synthesize polypropionates, which are polyketides that consist of 

propionic acid units made from propionyl-CoA. In the fungi, it turns out that the molecules in question 

are not made that way after all (Pedras, Soledade & Chumala, 2005). They are polyketides 

formed from acetate and then methylated, with the methyl groups derived from the amino acid 

methionine. The fungi did not incorporate propionate into the metabolites in question. The original 

evidence for the opisthobranch molecules being polypropionates had been some experiments in 

which it was shown that propionate labeled with a reactive isotope was indeed incorporated into 

the molecules (Ireland & Scheuer, 1979; Di Marzo, Vardaro, De Petrocellis, Villani, Minei & 

Cimino, 1991; Vardaro, Di Marzo, Marin & Cimino, 1992; Cimino, Fontana, Cutignano & 

Gavagnin, 2004). The possibility had not been excluded, however, that the propionate was degraded 

into acetate, then condensed into a polyacetate, and finally methylated, as in the fungi. Therefore 

some experiments using propionate labeled appropriately with 13C were carried out, providing 

compelling evidence that the propionate units are incorporated intact (Cutignano, Fontana & 

Cimino, 2009). Propionate biosynthesis in opisthobranchs is therefore like that of bacteria. In a few 

cases to be mentioned later, there is evidence for opisthobranchs using butyrl-CoA in the biosynthesis 

of secondary metabolites. 

Alkaloids may be roughly characterized as nitrogenous compounds derived from amino acids 

(Christophersen, 1985a). For example, tryptamine (from tryptophan) combines with pyruvic acid 

to form 1-methyl-β-carboline. However, alkaloids are often synthesized from other precursors such 

as isoprenoid compounds (Roddick, 1980) and purines (Misra, Luthra, Sing & Kumar, 1999). Leete 

(1983) discusses the problem of how the term “alkaloid” should be defined, given that any definition 

tends to exclude some of them. Pelletier’s definition “a cyclic organic compound containing 

nitrogen in a negative oxidation state which is of limited distribution among living organisms” is 

the one that Leete prefers, but he notes that it excludes, for example, such acyclic compounds as 

spermine. In terms of formal logic, it would seem that the term “alkaloid” is a cluster concept or a 

term that is disjunctively defined. The alkaloids that do not have the defining properties shared by 

all of the “typical” ones are included in the class by allowing for exceptions and alternatives. 

Alkaloids are very common in terrestrial plants, and include such familiar products as strychnine, 

caffeine, and nicotine. In marine environments they are largely produced by bacteria, often ones 

that live within the bodies of various animals, such as sponges. The alkaloids of marine organisms 

often contain halogen atoms, usually chlorine or bromine. The famous “purple of Tyre,” a dye that 

has been extracted from marine mollusks since antiquity, is a dibromo derivative of indigo 

(Christophersen, 1983). 

As is common knowledge, proteins are polymers made up of amino acid subunits. Although 

proteins are synthesized by the ribosomes, using DNA as a template, many of the shorter amino



acid polymers are made without the participation of ribosomes. Rather there is a protein template. 

The peptides thus produced sometimes function as antibiotics (bacitracin is a familiar example), as 

do peptides made using ribosomes and DNA. Peptides having biological activity are of some 

importance in marine environments. Janolusimide (Atlas 600), from the nudibranch Janolus 

(Photo 119), is one example (Sodano & Spinella, 1986). Like all tripeptides it was obtained by coupling 

three amino acids, in this case N-methylalanine, 4-amino-3-hydroxy-2-methylpentanoic acid, 

and a cyclic hydroxyamide. 

Part 2. Biotransformation 

Natural products chemists often describe the “total synthesis” of a secondary metabolite. In 

principle that means that they have made it in the laboratory, starting with the elements of which 

the molecule is composed. In practice they do not bother to carry out all those steps themselves, 

but begin at a somewhat later stage, as has been explained in an amusing paper by Cornforth 

(1983). Likewise, “de novo” biosynthesis of a secondary metabolite does not mean that the organism 

begins with elemental carbon, hydrogen, oxygen and the like, but with primary metabolites. 

What is called “biosynthesis” may involve taking molecules apart as well as putting them together, 

and changing their structure as well as adding or replacing components. “Biotransformation” 

means altering the molecule. It is primarily of interest when the properties of that molecule are 

changed in a way that affects the biology of the organism. There are various reasons why a metabolite 

might be transformed in this manner. For example, a more stable metabolite might be stored 

more easily than a less stable one. This is probably a minor advantage, at least relative to two other 

ones: detoxification and enhancement of the toxic effect. 

Detoxification. An animal that feeds upon another animal or a plant that contains a defensive 

metabolite obviously needs to avoid any damage that the metabolite might inflict upon it. There are 

various ways of accomplishing that. One of the most straightforward is selective feeding, mainly 

by avoiding the part of the food item in which the defensive metabolite is most concentrated. 

However, there are no documented examples of that for opisthobranchs. Once the food has been 

ingested, it may be possible to avoid absorbing the defensive metabolite from the digestive tract. 

If it does make its way into the body, it can be excreted via the kidney. Or the physiology of the 

animal may be such that the metabolite does little harm. 

The nudibranch Hypselodoris orsini, a pair of which are shown in Photo 95 (also called by its 

junior synonym H. coelestis, and often misidentified as Glossodoris tricolor), provides an example 

of such detoxification (Cimino, Fontana, Giménez, Marin, Mollo, Trivellone & Zubia, 1993). 

This Mediterranean sea slug occurs in association with a sponge referred to in the literature as 

Cacospongia mollior (actually C. scalaris and more recently called Scalarospongia scalaris) 

(Demospongiae: Dictyoceratida: Thorectidae), upon which it feeds. The sponge contains the sesterterpenoid 

scalaradial (Atlas 486), which has a pair of aldehyde groups that are responsible for 

its activity. It is modified by the slug in two steps. First, it is converted by selective reduction of 

the aldehyde at C-17 to deoxoscalarin (Atlas 483). Then the molecule is converted by oxidation to 

6-keto-deoxoscalarin (Atlas 489), which is then concentrated in specialized organs (mantle dermal 

formations) at the surface of the animal’s body. The location of 6-keto-deoxoscalarin suggests it is 

deployed against predators. However, the structure of the molecule suggests that it is biologically 

inactive, and therefore it has been proposed that the mantle dermal formations are a kind of excretory 

organ (Avila & Durfort, 1996). This interpretation is questionable. The glands are well positioned 

for a defensive function, and getting rid of metabolites via the gut or kidney would be much 

easier. One might reply, perhaps, that they represent an evolutionarily modified form of glands that 

previously did deploy some kind of defensive metabolite.


Enhancement of toxic effects. Provided that an animal that derives defensive metabolites from 

food can tolerate them, the metabolites can be used in that animal’s own defense, and there are various 

ways in which the defense can be rendered more effective. One way, already just alluded to, 

is positioning the metabolites in a part of the body where they will be delivered to the attacking 

predator with maximal effect and minimal damage. This often means moving the metabolites from 

the digestive tract to the skin. A second way is increasing the concentration of the metabolite. Third, 

the molecule can be modified so that it is more toxic (or more distasteful) to predators. A good 

example of this is the Mediterranean Oxynoe olivacea, and some other animals of the order 

Sacoglossa (Photo 27). They feed upon a green alga, Caulerpa prolifera, in which there is a toxic 

sesquiterpene, caulerpenyne, with a terminal 1,4-diacetoxybutadiene moiety (Atlas 206). The mollusks 

modify caulerpenyne to the more toxic oxytoxin 1 by selective hydrolysis of one of the two 

enol acetate moieties (Atlas 207). Then they modify it again to form the still more toxic oxytoxin 

2(Atlas 208). In general it is not easy to provide compelling evidence for biotransformation. In 

spite of some experimental evidence that records the absence of caulerpenyne in Oxynoe olivacea, 

in which oxytoxin 1 is compartmentalized in the detachable tail, this biotransformation could be 

refuted. Some authors (Guerriero, Marchetti, D’Ambrosio, Sinesi, Dini & Pietra, 1993) have suggested 

that minor dietary metabolites are accumulated selectively, whereas others (Jung & Ponhert, 

2001) have hypothesized the biotransformation of the major metabolite mediated by algal lipases 

during grazing by the slug on the algae. Recently it has been rigorously proved that the biotransformation 

can be attributed to hydrolytic lipases produced by the slugs, whereas the activity is not 

present in the alga (Cutignano, Notti, d’Ippolito, Domenèch Coll, Cimino & Fontana, 2004). 

Part 3. Deployment of metabolites 

In order to explain how opisthobranchs obtain, modify, and utilize secondary metabolites we 

herein provide some additional details about their basic anatomy. The ancestral gastropod is generally 

thought to have had a coiled shell and an asymmetrical, twisted body. The gill was located 

near the front of the animal, over the head, as was the anus. Accompanying the gradual reduction 

of the shell, the gill and anus have moved backward toward the rear of the body, straightening the 

animal out somewhat. When a snail gets transformed into a slug, the soft part of the body gets 

expanded relative to the shell, and the animal loses the ability to withdraw into the shell. At later 

stages the shell becomes lost or virtually lost, except that in larvae it generally is relatively large 

and still protects the animal. The muscular foot continues to serve as the main organ of locomotion 

and extensions of it called parapodia may expand and cover much of the body. The foot allows the 

animal to move, albeit slowly, from place to place. It also permits the animal to cling to the substrate 

while moving about or when apt to be dislodged by waves or currents. Such an arrangement 

is effective for an animal that grazes upon food items that live attached to the surface (sessile organisms) 

such as plants and sponges, or pursues sedentary or slow-moving prey such as clams and 

snails. 

Combined with this mode of locomotion is a feeding mechanism that allows snails and slugs 

to subdue and utilize food sources that have effective mechanical defense. Gastropods are generally 

equipped with a rasp-like structure called a “radula,” which may be compared to a tongue covered 

with teeth. They can grab or scrape with it, usually with the two actions working in tandem. 

Food is taken into the gut and passed to a stomach, where it usually gets broken down somewhat. 

Then particles of food are passed to a structure called a digestive gland where digestion occurs 

intracellularly—i. e., inside the cells that line the gland. Nineteenth-century zoologists called the 

digestive gland a “liver” but, because it is only superficially similar to that of vertebrates (i.e., the



namesakes are analogous, not homologous), the term is no longer used. However, like the vertebrate 

liver, it is an important site of detoxification. 

The stomach and digestive gland of opisthobranchs have been convenient sources of interesting 

metabolites for investigation. However, they do not provide very effective defense in that position, 

and getting them to more appropriate locations is an important evolutionary theme. The 

metabolites generally become concentrated in the skin of the animal, and in particular locations 

where they will be most effective. Specialized “repugnatorial glands” are common, and the mantle 

dermal formations already mentioned are a good example. 

Sea slugs are rich in mucus, and may release copious quantities of it when they are attacked. 

This mucus may contain a substantial amount of secondary metabolites, even when the basic effect 

on the predator is a mechanical one. Mucus evidently represents the first line of chemical defense, 

and the repugnatorial glands come into play when mucus is not sufficient to repel the predator and 

the mollusk is bitten (Mollo, Gavagnin, Carbone, Guo & Cimino, 2005). Another place where secondary 

metabolites may be concentrated is the gonad, which in opisthobranchs is called the “hermaphroditic 

gland” because every animal is both male and female at the same time and produces 

both sperm and eggs. The eggs are enveloped in protective mucus, and it is they (or the layer of 

nutritive albumen surrounding them), that contain the metabolites. 

CHAPTER II 

COMPARISONS AND EXPERIMENTS 

Part 1. Introduction 

Epistemology is the branch of philosophy that is often defined as the theory of knowledge. It 

considers the question “How do we know what is true?” Among scientists, practical epistemological 

issues are often discussed under such rubrics as methodology and experimental design. When 

scientists start writing polemics about methodology it usually is not a good sign, because it suggests 

that they cannot find a straightforward means of settling their differences. In this chapter we 

try to present a straightforward, yet philosophical, explanation of how research in the areas of interest 

is carried out and why it is done that way. Scientific research is not easy, and we illustrate some 

of the difficulties and pitfalls with examples drawn from our own research as well as that of others. 

On a more positive note, there are also examples of ingenious experiments and clever arguments 

from which valuable lessons can be learned. 

Part 2. Systematics 

Opisthobranchs of the order Anaspidea are called “sea-hares” because of their fanciful resemblance 

to a bunny (Photo 17). The comparison has never fooled anybody. But it illustrates the point 

that much more is involved in classification than just putting similar objects together. Scientists go 

out of their way to avoid being deceived by appearances, and this is especially true of systematic 

biologists, who often get burned by them. They need to sort their materials out into groups of 

objects that correspond to objective reality, and that is not always easy. The problems are notoriously 

difficult even at the most basic level of classification: the species. Here we will evade the 

controversial aspects of what it means to be a species by referring the interested reader to the 

inevitably long and difficult book that one of us has written on such topics (Ghiselin, 1997). 

In evolutionary biology, a species is a reproductive community that is held together by sex.


Such units are important because they evolve. That means that they can become transformed 

through time. It also means that they can undergo only a limited amount of diversification because 

sexual reproduction tends to homogenize the group. Within species, diversity often takes the form 

of local populations that are supposedly adapted to local conditions of existence. But if evolutionary 

diversification is to go further, it is necessary for the populations to become reproductively isolated 

from one another—in other words to become separate reproductive communities even when 

they are located in the same area. When that happens speciation has occurred, and the populations 

can continue to diversify, forming genera, and, through repeated speciation events, families, orders, 

and higher groups. Each node in a phylogenetic tree corresponds to a speciation event. 

Organisms belonging to closely related species tend to differ somewhat in their important 

properties, including such ecological ones as diet and microhabitat. Sometimes they have “diagnostic” 

characteristics that make it fairly easy to identify a specimen as belonging to one species 

or another. Life, however, is not always that simple, and what really matters is not whether we can 

identify organisms to species but whether the organisms themselves can do so. Organisms that look 

alike to us may have important differences. Since these differences are often matters of physiology 

or behavior, perhaps with respect to what they feed upon and what metabolites they may utilize, 

they may be of particular significance to the natural products chemist. Species that are hard for us 

to tell apart are called “cryptic species” and generally these are closely related. They are particularly 

common in several groups of marine animals, and in some of these the number of species 

turns out to have been underestimated by a factor of ten (Knowlton, 1993). Such an underestimate 

can give a serious misconception of ecological importance and evolutionary rates within a group. 

It also distorts our understanding of how new species are formed and of the role of speciation in 

evolution. The detection of cryptic species has been facilitated by modern genetical techniques, 

which provide a better index of physiological differentiation. It also may be possible to detect them 

by means of behavioral studies and genital anatomy. 

The other side of the coin is species within which there is a great deal of variation, whether 

local or otherwise. Opisthobranchs often have what are described as “color morphs” within a 

species (Ros, 1976). They may have very different color patterns. We have already mentioned 

another evolutionary phenomenon that may prove misleading. This is “mimicry,” in which animals 

of one species come to resemble those of another because the resemblance as such affords protection 

or some other advantage. Such mimicry is not uncommon where chemical defense is involved. 

As was mentioned above, in Batesian mimicry an unprotected “mimic” resembles a protected 

“model,” whereas in Müllerian mimicry two or more protected forms advertise their distastefulness 

using the same pattern. Both kinds of mimicry have been found in opisthobranchs (Gosliner & 

Behrens, 1990; Gosliner, 2001). Photo 59 shows the close resemblance between the dorid nudibranchs 

Chromodoris geometrica (above) and Phyllidia pustulosa, which are in different families. 

In the case of certain insects, members of the same species mimic different models, and this polymorphism 

may occur locally as well as geographically. 

Misidentifying an organism of interest can have serious consequences for scientific research, 

and our own experience provides a good example. The animal that had been known to local naturalists 

as Cylindrobulla fragilis, shown in Photo 25, was found to have some very interesting natural 

products (Gavagnin, Marin, Castelluccio, Villani & Cimino, 1994). Because Cylindrobulla, 

shown in Photo 24, is considered to be very close to the common ancestor of the order Sacoglossa, 

this creature was of particular interest in our effort to reconstruct the evolutionary history of that 

group. However, we realized that the identification had been made from the shell. Upon checking 

out the internal anatomy, it became obvious that we were dealing not with Cylindrobulla, but with 

Ascobulla, which is not even in the same family, although perhaps it should be. The shell has



evolved much more slowly than the feeding apparatus. Fortunately we found this out before we 

published our review article (Cimino & Ghiselin, 1998). 

Our interpretation of evolutionary history depends on our knowledge of the relationships 

between the various lineages and groups of lineages sharing common ancestors (clades) that make 

up the genealogical, or phylogenetic, tree. Techniques for working out the relationships have been 

the subject of a vast technical literature. Our aim here is to provide an introductory treatment that 

will allow our readers to understand what is said later on. Of particular importance is the point that 

various classifications are available in the literature, and that although these tend to reflect the 

genealogical relationships, the correspondence may be only approximate, especially in what we 

may call “traditional” systems. With the passage of time, classifications are being revised so as to 

make them come closer to the genealogical ideal, but this is work in progress. 

Merely putting those animals together that have characters in common often gives misleading 

results. As we have mentioned, the opisthobranchs have repeatedly evolved from snails into slugs. 

If we divided them into two groups, snails and slugs, the latter assemblage would not share a common 

ancestor, except in the trivial sense that all the organisms in the world share a common ancestor 

if one goes far enough back in time. A group (taxon) consisting of all slug-like opisthobranchs 

would be called a “polyphyletic” one, meaning that it is made up of several lineages. The other 

assemblage, consisting of opisthobranchs minus those that have become slugs, would be called a 

“paraphyletic” taxon. They are, respectively, polyphyletic and paraphyletic grades, rather than 

clades. Clades are complete branches of the tree, including a common ancestor and all of its 

descendants. A taxon that corresponds to such an entire branch is said to be (strictly) monophyletic 

or, by some authors, holophyletic. 

The gastropods (including both snails and slugs) as a whole are thought to constitute a single 

branch of the animal tree and form, therefore, a monophyletic taxon, the class Gastropoda. All of 

them share a unique, derived character (synapomorphy) that indicates a single origin for the group. 

This is “torsion” (see Ghiselin, 1996a). Not to be confused with the snails’ coiling, it is a rotational 

movement of the upper part of the body, including the gills and the anus, from the posterior part 

of the body to the anterior, with the result that the body of the animal is asymmetrical. Torsion can 

be observed in developing embryos. 

In opisthobranchs there is partial detorsion, so that the gills and the anus get displaced backwards 

again and bilateral symmetry is partly re-established, although as we have just noted, traces 

of torsion are still detectable in the embryos and larvae, which still have a shell, and also in some 

internal organs. The result of detorsion is obvious in dorid nudibranchs such as Chromodoris 

quadricolor, shown in Photo 73. Here, the anus and gills have returned to the posterior end of the 

body, though the openings of the reproductive system are near the anterior end, on the right side. 

It is conceivable that torsion may have occurred more than once (things like it occur in other 

groups). The reason why torsion is thought to have occurred only once in the evolution of gastropods 

is that it does not conflict with other characteristics. When there are such conflicts it is 

assumed that the correct relationships are those that represent the least number of evolutionary 

innovations. This is called the “principle of parsimony” and we will say more about it later. 

Traditionally, and the tradition goes back to the early nineteenth century, gastropods have been 

divided into three major groups: the sub-classes Prosobranchia, Opisthobranchia, and Pulmonata. 

The original idea, which seems rather quaint from our modern point of view, was to have important 

subdivisions that would be based on properties of the respiratory apparatus. The prosobranchs 

would have the original condition, with the gills pointing forward (Gk. proso- front). The opisthobranchs 

would have various degrees of detorsion, such that the gills would be near the rear of the 

animal (Gk. opistho- rear). And finally, the pulmonates would have a lung instead of gills (Gk.


pulmo- lung). (Actually one of the originally paired gills is generally lost, so that an opisthobranch 

has only one of them, and some pulmonates have a gill in addition to a lung.) 

This higher-level classification has persisted to the present day. It does sort the gastropods out 

into three more or less distinct groups. However, it illustrates some of the problems with traditional 

classifications. If we tried to interpret it as a tree, we would get a “trichotomy” as follows: 

┌─ Prosobranchia 

─┼─ Opisthobranchia 

└─ Pulmonata 

The diagram suggests that the common ancestor of Gastropoda split up into three species, each 

of which gave rise to one of the three subclasses. From what we can tell, things were very different. 

Pulmonata does seem to be a single lineage, in other words a monophyletic taxon. At least we 

can make a case for that on the assumption that the mantle cavity, a depression that surrounds the 

gill in many gastropods, was converted into a lung just once, or at least that the transition to breathing 

air happened in that lineage alone. The presence of a lung is a derived character (synapomorphy) 

that is shared by all pulmonates and is not inherited from their forebears. It is somewhat more 

difficult to find a good synapomorphy for Opisthobranchia, though the folded gill that characterizes 

many of them might be invoked. Part of the trouble here is that Pulmonata and 

Opisthobranchia are very closely related. For that reason they are often placed together in a larger 

assemblage called “Euthyneura,” so called because the twisting of the nervous system that took 

place as a result of torsion is no longer so obvious. Quite a number of rather obscure characters 

have been used as synapomorphies for Euthyneura. Unfortunately they often occur in some other 

gastropods. They include a peculiar larval shell, a spermatozoon with a keel, and the hermaphroditic 

reproductive system and some of its features. But Prosobranchia shares only the ancestral 

characters inherited from the gastropod common ancestor, and Euthyneura is closer to some prosobranchs 

than to others. In other words, Prosobranchia is a paraphyletic grade. In such modern classifications 

as that of Ponder and Lindberg (1997) Euthyneura, together with its closest relatives 

forms a monophyletic group called Heterogastropoda. Within the Euthyneura the trees give somewhat 

ambiguous results and the classification remains in a state of flux. 

Might Opisthobranchia or Pulmonata turn out to be paraphyletic? This seems a distinct possibility 

in view of the modest amount of change that would have to be involved in transforming 

something like a primitive opisthobranch into a pulmonate. Pulmonates might easily be more closely 

related to some opisthobranchs than others. Indeed there was a brief period when it was claimed 

that some marine pulmonates are really not pulmonates at all, but opisthobranchs. It turned out, 

however, that the opisthobranch characters on which this claim was based were merely symplesiomorphies, 

showing only that pulmonates are gastropods (Ghiselin, 1996b). Unfortunately the 

confusion created problems for the natural products literature when metabolites from pulmonates 

were said to be from opisthobranchs (Ireland & Faulkner, 1978). 

The basic procedure, then, in reconstructing genealogical relationships, is to put the animals 

together on the basis of shared, derived characters. But we run into difficulties in such apparently 

unproblematic issues as what is a character, and how we know that it is derived. It is more or less 

obvious that the habit of breathing air and the presence of a lung in pulmonates represent derived 

conditions. We can tell this partly by outgroup comparison: mollusks in general are aquatic animals 

with gills. But we also know that life originated in the sea, and that very few lineages have returned 

to it. One reason why somebody might come up with a classification that puts slugs together into 

a polyphyletic assemblage is that so many parts of the body are involved. It is not just the shell, but 

other parts that are associated with it, that get lost. For example, in the generality of prosobranchs



the opening of the shell is closed by a door-like structure, the operculum. According to the principle 

of parsimony, the best tree is the one that invokes the least number of character changes. In such 

reasoning we would want to avoid counting the same character twice, and having physiologicallycorrelated 

features or something linked to the same environment might give us a misleading 

impression. Therefore it is reasonable to include evidence from a wide range of body parts and 

organ systems. 

Extending that same line of reasoning we might resort to properties that are supposedly far 

removed from the anatomy and the environmental influences that might give us a misleading 

impression. During the last few decades, molecular data have been increasingly used, not necessarily 

as a replacement for, but quite often as a supplement to, the traditional evidence. We might mention 

the use of chromosome numbers and chromosome morphology as an early precursor of the 

molecular approach. Within the opisthobranchs there is an apparent clade, consisting of 

Nudibranchia plus Notaspidea, that can be characterized by a distinct drop in chromosome numbers 

from an initial 17 (haploid) to 12 or 13 (Inaba, 1961; Patterson, 1969; Vitturi, Rasotto, 

Parrinello & Catalano, 1982; Curini-Galletti, 1985, 1988; Wägele & Stanjek, 1996). Most of the 

new evidence, however, comes from sequence data, either of nucleic acid polymers (RNA and 

DNA) or proteins. 

Since the work of Field, Olson, Lane, Giovannoni, Ghiselin, Raff, Pace and Raff (1988) on the 

phylogeny of the animal kingdom, the preferred molecule has been 18S (small-subunit) rRNA. 

Ribosomes play a crucial role in protein synthesis, and are highly conserved. They evolve slowly, 

but enough changes appear that they have proven very useful for studying relationships that are not 

very recent. Mitochondria contain somewhat smaller ribosomes, and their 16S mRNA, which 

evolves somewhat faster, is more useful for more recent relationships. The ribosomal RNA or the 

corresponding DNA is sequenced using electrophoretic techniques, revealing the order of the 

nucleotides of which the molecule is composed. The next step is to “align” the molecules from the 

different organisms of interest, so that what appears to be the same site has identical nucleotides if 

no evolutionary change has taken 

place, or different ones, if one 

nucleotide has been replaced by another. 

Some aligned sequence data from 

Rebecca Johnson’s work-in-progress 

on dorid nudibranchs of the family 

Chromodorididae are shown in Table 

1. The nucleotides at several of the 

sites are all identical, indicating no 

evolutionary change. In Hypselodoris 

kanga there are two alignment gaps, 

where no nucleotide is present. This 

probably means that a pair of them has 

been lost. Nucleotides may also be 

gained. It is possible to misalign the 

sequence, and that may create errors, 

both major and minor. 

Once the nucleotide data have 

been aligned, the next step is to do 

some kind of statistical analysis that 

will estimate the best tree. There are 

TABLE 1. Some aligned sequence data from Rebecca 

Johnson’s work-in-progress on dorid nudibranchs of the family 

Chromodorididae. 

Risbecia tryoni CCTAAATAATTATTTGAAGTT 

Risbecia tryoni CCTAAATAATTATTTGAAGTT 

Hypselodoris bertschi CTTAACTAATTATTTGAAATT 

Hypselodoris maritima CCTAACTAATCACTTGAAATT 

Hypselodoris cf. nigrolineata CCTTATTAATTAATTGAAATT 

Hypselodoris kanga CCTTA−TAATTATTTGAA−TT 

Hypselodoris infucata CCTTAATAATTATTTGAAATT 

Hypselodoris obscura CCTTAATAATTATTTGAAATT 

Hypselodoris obscura CCTTAATAATTATTTGAAATT 

Hypselodoris kaname CCTTATTAATCATTCGAAATT 

Hypselodoris paulinae CCTTATTAGTCATTCGAAATT 

Hypselodoris bollandi CCTCAACAATTATTCGAAGTT 

Hypselodoris jacksoni CCTGATTAATTATTTGAAATT 

Hypselodoris jacksoni CCTGATTAATTATTTGAAATT 

Hypselodoris regina CCTGATTAATTATTTGAAGTT 

Hypselodoris reidi CCTGATTAATTATTTGAAATT 

Hypselodoris zephyra CTTAATTAATTATTCGAAGTT 

Hypselodoris zephyra CTTAATTAATTATTCGAAATT 

Hypselodoris zephyra CTTAATTAATTATTCGAAATT 

Noumea crocea CTAAACTATTTAGTTGAATTT 

Noumea flava CTAAATTAATTATTTGAAGTT


various ways of doing that, but the basic one is parsimony analysis, which minimizes the number 

of evolutionary steps needed to produce a tree on the assumption that the tree with the smallest 

number of changes is the one least likely to be false. Because, however, the approach is basically 

a statistical one, the picture that we get is inevitably somewhat distorted by chance as well as other 

things. The more likely events obviously occur more often, but the less likely ones occasionally 

happen too. On top of that the approach works better if the molecules have been evolving at the 

same rate, which is by no means always the case. 

The study of Field, Olsen, Lane, Giovannoni, Ghiselin, Raff, Pace and Raff (1988) provides 

some examples of what happens to the available body of evidence when molecular results are 

added. In general it tended to confirm traditional views, but there were some surprises. First, the 

animal kingdom seemed not to be monophyletic. The first branch, or coelenterates, seemed to be 

closer to plants than to other animals. As it turned out, the result was not statistically significant. 

Without enough characters, the coelenterates had slipped off onto an adjacent branch, but then 

again they had not gone very far. Something similar happened to the mollusks, but for a slightly 

different reason. The group broke up and its subunits became associated with several related lineages. 

Such a phenomenon had already been anticipated, and is very easily explained. The mollusks 

and their relatives diversified very rapidly and there was insufficient time for enough changes in 

the molecule to reveal what had happened. Three other interesting, and to some degree unexpected, 

results are worth noting. First, the brachiopods, which had been widely considered relatives of 

chordates and echinoderms were far removed from that position, and much more closely related to 

mollusks and annelids. This finding has been consistently supported by later evidence. Second, the 

arthropods turned out to be less closely related to annelids than conventional reasoning would have 

had it. Again this has been confirmed by subsequent research, which led to the discovery of a hitherto 

unexpected group, Ecdysozoa, consisting of arthropods, nematodes, and some others 

(Aguinaldo, Turbeville, Linford, Rivera, Garey, Raff & Lake, 1997). And finally, the mollusks, 

annelids, brachiopods and some other groups turn out to form a unit called Lophotrochozoa. 

Supporters of the flatworm theory of molluscan origins lost this round in the long debate, and opinion 

has swung in favor of the annelid theory (Ghiselin, 1988; Lindberg & Ghiselin, 2003). 

The lesson to be learned from such experience is that although ribosomal RNA or protein 

sequence data can be compelling when the issue is the approximate position of a group within the 

tree, the exact branching sequences are generally too close to call. Supposedly, one can hope to get 

more compelling results by sampling a larger part of the ribosome (28S rRNA), by adding protein 

sequence data, and of course by using the traditional “morphological” or better, anatomical, characters. 

There is another possibility, however, and that is mapping, and comparing, entire genomes, 

or at least large parts of them. The basic technique was first applied to the comparison of chromosome 

maps of Drosophila (Dobzhansky & Sturtevant, 1938). Recent studies are sometimes based 

on the sequence of genes in mitochondria, which have a small genome of their own (Grande, 

Templado, Cervera & Zardoya, 2002; Kurabayashi & Ueshima, 200). Groups of genes occasionally 

move from one place to another within the genome (translocation). In other cases a portion of 

the genome is turned around so that it faces in the opposite direction (inversion). The rationale for 

using inversions as evidence for relationships is that it is highly improbable that an identical inversion 

will evolve more than once. A part of the chromosome has to be detached at two identical sites, 

and then reattached. This approach has given some very valuable results, and we will discuss some 

of them below. It has the obvious drawback of not working within lineages in which there have 

been no rearrangements.



Part 3. Metabolite Chemistry and Physiology 

Modern techniques make it possible to detect and identify compounds in very small quantities. 

Mass Spectrometry (MS) and nuclear magnetic resonance (NMR) are particularly appropriate for 

characterizing the structure of organic compounds such as secondary metabolites. MS gives complete 

information on the elemental composition of the molecule. NMR makes it possible to connect 

all of the atoms, in particular the hydrogen and carbon atoms, in the structure of interest. The 

NMR and sometimes the MS techniques require getting the materials into solution and this task is 

not as easy as it might sound. The solvent has to be selected so as to avoid interactions with the 

extractable compounds that could lead to artifacts. Naturally it is difficult to prove that a compound 

from an extract is identical to that present in the natural source. To avoid such complications it is 

important to minimize the number of steps between the extraction of the material and the isolation 

of pure compounds. One useful stratagem is to record the NMR spectrum of the entire extract. That 

would provide a fingerprint of all the compounds that are extractable from the natural source. 

When chemists search for secondary metabolites the usual technique has been to extract the 

whole organism using a solvent such as acetone or methanol and see what turns up in the solution. 

Any metabolite that looks interesting may then be purified and characterized. Such a whole-body 

approach may be all that is necessary if the goal is merely to discover previously unknown compounds, 

but otherwise it is only a beginning. It does not tell us where the metabolite was located 

in the body. The gut is apt to contain a variety of metabolites derived from food, only some if any 

of which are used defensively, but their detection at least gives something of an idea of what the 

animals eat and what their foods contain. 

To get a better picture of what is going on within the animal as a whole, it is often appropriate 

to separate out the various parts of the body in the expectation that metabolites will be concentrated 

in the places where they are stored and deployed. They may, for example, be more or less 

restricted to the skin, where they are in a good position to protect the animal from predators, or in 

the ovarian tissue, indicating that they protect the eggs, developing embryos and larvae. It may be 

problematic whether the presence or absence of a given metabolite in a sample actually represents 

the physiological situation in the organism. The molecules may undergo chemical reactions. Some 

compounds detected by chemists have turned out to be degradation products. Intermediates in a 

series of synthetic reactions may not be present all the time, or they may exist at very low levels 

and be hard to detect. A defensive metabolite of interest may be formed only when the animal is 

under attack. And it may be unstable, as is polygodial (Atlas 235). 

When metabolites are accumulated and transformed it is generally possible to follow them 

through the various parts of the body and through the food chain. The transfer of secondary 

metabolites from prey to predator and to various tissues is merely suggested by the distribution of 

the metabolites in both organisms. However, the evidence can be quite compelling. For example it 

was found that the nudibranch Hypselodoris webbi (now H. picta) eats sponges of the genus 

Dysidea (Demospongiae: Dictyoceratida: Dysideidae). A specimen of Dysidea fragilis was collected 

from Mar Menor in Spain and offered to Hypselodoris picta Photo 97, which is altogether 

absent from that area (Fontana, Giménez, Marin, Mollo & Cimino, 1994). The nudibranch immediately 

started to eat the sponge and, not surprisingly, it was possible to document the transfer of 

the sponge metabolite, (-)furodysinin (Atlas 328), to the nudibranch and to the repugnatorial 

glands (mantle dermal formations) where they are well-situated to deter predators, being concentrated 

near the vulnerable organs (gills and rhinophores). 

If an animal is dependent upon its food as a source for metabolites this can be documented by 

means of experiments in which the food supply is manipulated. Or a kind of natural experiment can 

be done. Because the availability of food varies from place to place, the metabolites will not always


be present locally. Animals that derive the secondary metabolites from food will therefore tend to 

vary geographically in both the amount and kind of metabolites that they contain. If, on the other 

hand, the animals that accumulate the metabolites are able to synthesize them, they are not dependent 

upon the environment, and the level of metabolites will be constant over a wide geographical 

area. This kind of evidence was first invoked by Faulkner and his collaborators (Faulkner, 

Molinski, Andersen, Dumdei & de Silva, 1990) in a study on Eastern Pacific dorid nudibranchs. 

(See also Kubanek, Faulkner & Andersen, 2000). We should note a couple of complications, however. 

If the animal is so specialized that it eats only one species of food organism, we should not 

expect it to vary geographically in its metabolites. And it might vary geographically with respect 

to what metabolites it synthesizes. 

De novo synthesis can be documented experimentally, but it is not always easy to do so and 

not much work along these lines has been done. The method used is to inject the animal with precursors 

of secondary metabolites containing an isotopic label, such as radioactive carbon. Alternatively, 

the transformation of the probe molecule can be tested in rough enzymatic (cell-free) preparations 

obtained from either whole animals or particular parts of them. If the animal can biosynthesize 

the secondary metabolites, and if all else goes well, the metabolites will contain the label. 

Working with a radioactive precursor, the detection of radioactivity in the secondary metabolites 

proves that this metabolite is biosynthesized by the animal, but not that the precursor itself is incorporated, 

for the possibility that radioactivity has contaminated some catabolites is not excluded. 

Although less sensitive than radioactive labels, stable isotopes give less equivocal results 

because their precise position in the molecule can be determined and the label does not contaminate 

other molecules (Cimino, Fontana, Cutignano & Gavagnin, 2004). Different atoms in the precursor 

can be labeled. Doing so provides a way of showing how the parts of the primary metabolite 

molecule or other precursor get incorporated into the secondary metabolite molecule. That may 

help to reveal the intermediate steps through which biosynthesis takes place. 

It is generally understood that biosynthetic processes are under the control of enzymes. This 

aspect of secondary metabolite biosynthesis has been extensively studied in terrestrial plants. 

Unfortunately we have very little information about the role of enzymes in the biotransformation 

and biosynthesis of secondary metabolites in mollusks. The glycosidases of the anaspidean Aplysia 

fasciata have, however, been characterized (Giordano, Andreotti, Mollo &Trincone, 2004). Lipase 

activities have also been described for the sacoglossan Oxynoe olivacea (Cutignano, Notti, 

d’Ippolito, Domènech Coll, Cimino & Fontana, 2004). These lipases are very selective. 

Cyclooxygenase is known to play a role in the synthesis of prostaglandins by Tethys. 

The secondary metabolites of terrestrial plants are familiar to us largely because of their effects 

on human beings and other animals. Many are responsible for the chemicals in flowers that attract 

insect pollinators and are used in perfumes. Plants such as garlic and a host of herbs that we raise 

in our gardens to flavor our meals owe their distinctive tastes to chemicals that repel insects. 

Likewise, the narcotics and alkaloids that are used in medicine and that people often abuse are there 

because they protect the plants that produce them. It stands to reason that pharmacologists and others 

have devoted a great deal of effort to studying such metabolites, and that much is known about 

how they affect our bodies and those of insects. Marine natural products, however, do not provide 

us with important flavorings, perfumes, pesticides, narcotics or stimulants. There are quite a number 

of marine organisms that kill human beings, but they have attracted attention mainly as things 

to avoid. Research aimed at finding new drugs from the sea has largely involved screening of 

metabolites for possible activity as antibiotics, tumor-suppressants and the like. When such activity 

is found, the compound is studied to see whether it, or something like it, is promising for medicinal 

use.



There has been very little work, from a chemical point of view, on how the secondary compounds 

of marine organisms produce their effects on the animals that eat them. An interesting 

example of what can be done along those lines is a study by Caprioli, Cimino, Colle, Gavagnin, 

Sodano and Spinella (1987) on what we might call the “business end” of dialdehyde compounds 

with an adjacent double bond, such as polygodial (Atlas 235). These generally have a 1,4-conjugated 

aldehyde moiety, which is able to react with primary amines. The effect at the molecular level 

was established by comparing the effects of a series of analogs, some natural, and others synthetic. 

It depends upon the distance between the two aldehyde groups. This molecular configuration 

results in a peppery taste, and many plants, such as peppers, as well as fungi have metabolites with 

it (Jonnassohn, 1996). As to marine organisms, conjugated 1,4-dialdehydes have been detected not 

only in opisthobranchs but also in pulmonate gastropods, sponges and algae, where they are present 

in protected form as bisenolacetate. Some nudibranchs are able to biosynthesize their dialdehydes, 

some to modify those present in sponges so as to reduce their toxicity, and some to hydrolyze 

the algal enolacetates to improve their protective efficacy. 

Part 4. Metabolite Ecology and Adaptive Significance 

As we mentioned earlier, the notion that secondary metabolites are excretory products or otherwise 

non-adaptive components of the organism is no longer taken seriously. This does not mean, 

however, that their adaptive significance is uncontroversial. On the contrary, there have been lively 

debates about such matters, and the arguments will no doubt continue. When we say that secondary 

metabolites are “defensive” it should be taken only as a broad generalization. Many might 

better be called “offensive” rather than “defensive” and we have to include actions against competitors 

as well as predators as part of the larger picture. Furthermore, many secondary products 

play important roles in reproduction, species recognition, and other important biological activities. 

Even where a given metabolite does repel predators, there is no reason why it cannot do something 

else as well, such as attract potential mates. And some of the secondary compounds are only indirectly 

connected with the biologically active ones. They may be precursors, byproducts, protected 

forms of the molecules, the products of detoxification, or molecules that have become altered while 

being processed for chemical study. Therefore it is important to have criteria for establishing the 

adaptive significance of the metabolites. 

Simple experiments often provide convincing evidence that a metabolite renders a food item 

distasteful or toxic. The usual procedure has been to mix some of the metabolite of interest with a 

solidifying agent such as agar, and then present it to fish, together with a similar preparation that 

does not contain that metabolite. If the fish rejects the former, but eats the latter, we have positive 

evidence that when the metabolite is present it can deter at least some predators. Strictly speaking 

the “food” without the metabolite is not a control, but it does show that its presence or absence 

makes a difference. Negative results are another matter. Absence of evidence that something happens 

is not evidence that it does not happen. 

A particularly instructive example of negative evidence is provided by the eicosanoids of gorgonian 

corals. Early workers assumed that the reaction of fishes to defensive compounds would be 

immediate. However, Gerhart (1984, 1986, 1991), noting that eicosanoids induce vomiting when 

taken orally by humans, experimented with their effects on fish, and found that they have the same 

effect. Thus fish might learn to avoid the food item even though it was not distasteful, and even 

though the negative experience was somewhat delayed. A similar emetic effect has been found in 

a diterpenoid (Atlas 355) that bears the amusing name “pukalide” (Gerhart & Coll, 1993). In 

unpublished work Arnaldo Marin showed that fishes can memorize the patterns associated with


distasteful chemicals. He offered edible models resembling some opisthobranchs in shape and 

color to populations of a wrasse, Thalassoma pavo. He found that the fish first eats the model without 

any compound, then refuses otherwise identical models treated with compounds, and subsequently 

avoids untreated models. 

Negative results with experiments on fish might tend to be misleading when the “target” 

predatora are not fish, but other animals, such as crustaceans or gastropods. It would be like testing 

the effects of secondary metabolites from land plants on mammals and not bothering to consider 

their effectiveness as insecticides. There are also a wide variety of fishes, and it might make 

a difference which of them is chosen as an assay organism. Often it has been just one species, and 

a freshwater one at that, confined to an aquarium. To make the experiments more realistic, they are 

often carried out in the field, using a variety of predators considered likely to be important inhabitants 

of the environment of the organism that is supposedly protected by the metabolite in question. 

It may also make a considerable difference whether the metabolite is part of a living animal 

or an artificial bait. Penney (2004) presented specimens of the dorid nudibranch Cadlina luteomarginata 

to various predators. His results showed the predators rejecting the nudibranchs more consistently 

than in earlier studies using food that had been coated with chemical extracts or single 

compounds. Evidently the metabolites in the extracts are unstable. Gosliner (2001) offered nudibranchs 

and sacoglossans to fish of four different species. In many cases the nudibranchs were 

taken up, but regurgitated, sometimes injured but generally unharmed. 

Another pitfall that experimentalists need to avoid is making the assumption that defensive 

metabolites have to be distasteful to the predators. Some defensive chemicals work by jamming the 

chemoreceptors of predators (Kitteredge, Takahashi, Linsley & Lasker, 1974). 

It is not necessary to “experiment” in the sense of manipulating the organisms to test the 

hypothesis that a metabolite plays a defensive role. Such an hypothesis gains favor if the metabolite 

is distributed in such a way that it enhances that effect, rather than being distributed more or 

less at random in the body. The defensive metabolites tend to be concentrated in those regions 

where they will first come in contact with the predator. This generally means the surface of the 

body of the prey. In opisthobranchs they are often concentrated along the rim of the mantle, where 

an attacking fish is apt to grab them or have a nibble. There is anatomical apparatus that mobilizes 

the metabolites and deploys them at the predator (repugnatorial glands, or mantle dermal formations) 

(Garcia-Gómez, Cimino & Medina, 1990; Garcia-Gómez, Medina & Coveñas, 1991; Avila, 

2006; Wägele, Ballesteros & Avila, 2006). This effect is reinforced by coloration patterns, often a 

series of lines at the edge, or spots surrounding the concentrations of glands. 

Furthermore, the glands with their advertisements are often positioned in a manner that directs 

the predator’s attack away from places where an attack might do serious harm. Photo 87 shows a 

specimen of Mexichromis macropus with bright red spots around the slightly uplifted mantle rim. 

Underneath the red spots, repugnatorial glands (mantle dermal formations) can be seen by transparency. 

The delicate gill can be seen at the left (posterior) end of the animal. Near the anterior end 

are located a pair of sensory rhinophores rendered less conspicuous by having the same violet color 

as spots on the dorsum. The presence of mantle dermal formations is a synapomorphy that differentiates 

the family Chromodorididae from their apparent sister group, Actinocyclidae and most 

other dorids (Gosliner & Johnson, 1994). The metabolites are in fact deployed at the time when the 

slug is hassled by predators: a diver studying opisthobranchs in the field often evokes their discharge 

when handling the animal. Furthermore, different metabolites are effective against different 

predators, and against different kinds of attack. Accordingly there may be different metabolites in 

the eggs (and ovaries) and in the embryos and larvae on the one hand, and in such locations as the 

skin or mucous secretions of the adult animals on the other.



It would be fallacious to argue against the protective role of a metabolite on the grounds that 

the delivery system might be improved. The most effective arrangements must have been evolved 

over a long series of generations, and we would only expect to find intermediate stages in their 

elaboration. Likewise, one must not be misled by the fact that defensive metabolites are not completely 

effective against predators. We should expect them to reduce the amount of predation, and 

to occur together with other means of defense. The opisthobranch Oxynoe feeds upon the alga 

Caulerpa, and uses metabolites from it defensively. However, it is well camouflaged on the alga. 

In Photo 27, a specimen of Oxynoe olivacea on Caulerpa prolifera can be seen exuding a cloud of 

toxic material. Oxynoe can also deal with predators by autotomy. Like lizards that shed their tails 

when caught, these slugs can break off the end of their foot and crawl away. Such autotomy is quite 

common in opisthobranchs, and is often accompanied by behavioral and physiological adaptations 

that enhance the effect. We discuss a few examples in later sections of this monograph. 

Many opisthobranchs have escape reactions that are elicited by the attack of a predator. These 

often involve detachment from the substrate and writhing from side to side allowing the slug to be 

carried away from the predators by currents. In some cases opisthobranchs have well-coordinated 

swimming movements due to undulations of the body or the flapping of parapodia. The two orders 

of pteropods, Thecosomata and Gymnosomata are characterized by the presence of “wings” that 

allow them to swim very effectively and spend their lives in the open water. This kind of locomotion 

could easily have been derived from swimming used to escape predators. 

Considering the various forms of defense that occur in opisthobranchs from a bioeconomic 

point of view, there is a complex pattern of costs and benefits that deserves further study. We have 

noted that there may be several lines of defense, and some of these are more costly than others. 

Avoiding the attacks of visual predators by some kind of crypsis, such as camouflage or nocturnal 

habits, is very common among opisthobranchs. A slug that is overlooked expends very little in the 

way of resources for the very reason that it does not get attacked. Crypsis, however, restricts the 

animal to those times and places where it is effective and may conflict with a need to forage for 

food or find a mate. Chemical defense may allow an opisthobranch to survive in more exposed 

positions, and if very effective the animals may be virtually immune from predators. The metabolites 

must cost something—how much nobody has yet attempted to estimate. Obtaining them from 

food must be cheaper than biosynthesizing them de novo, but the cost of foraging must be balanced 

against the savings thus realized. 

Chemically defended opisthobranchs are often attacked, as is shown by the frequency with 

which damaged specimens are found in natural environments. Although they often survive, they 

would be better off not having been attacked at all. Autotomy may allow an animal to crawl away 

while the predator feeds upon the autotomized part. The autotomized parts are often dorsal processes 

that writhe and squirm when detached. Having the dorsal processes contain diverticula of the 

gut, rather than more nutritious parts of the body such as gonads, is one way of reducing the costs 

of autotomy. Swimming may allow a slug to escape from benthic predators, and if faced with a high 

probability of being eaten, exposure to other predators may be a risk well worth taking. Once the 

predator has been evaded, however, there are a whole new set of problems. The slug may have a 

hard time locating an appropriate environment. 

Defensive anatomy, for instance, that of shells, displays trends that can be followed in the fossil 

record as well as on a geographical basis (Vermeij, 1978, 1987). Animals are particularly well 

defended in places where species diversity is high, as in the seas around New Guinea and the 

Philippines. Although chemical defense had not left a fossil record per se, nonetheless the same 

kinds of trends that characterize shells have been documented in metabolites. Just as tropical shells 

tend to be more robust, tropical marine animals tend to more toxic (Bakus, 1974, 1981; Coll,


LaBarre, Sammarco, Paul, Williams & Bakus, 1982). This has been well corroborated, though the 

Antarctic fauna does not fit the trend very well, being a rich source of defensive metabolites 

(McClintock & Baker, 1997). There are similar trends that go along with the seasons. 

The problem of what causes such global patterns, including those of species diversity, body 

size, the amount of genetical recombination, and all sorts of other things may have no simple 

answer (Ghiselin, 1974). But they do indicate adaptation, however obscure the causes may be. One 

interesting study on the seasonal changes in the amount of toxic materials in a sponge shows a low 

level in the late winter and a higher one in the summer and fall (Turon, Becerro & Uriz, 1996). The 

kind of naïve reasoning that would relate the difference to temperature as such does not work, for 

the curve lags far behind. The pattern is rather like that of the number of eggs per clutch in certain 

birds, which declines during the reproductive season as food becomes more limited and it is more 

important to protect the young from predators. We say more about such topics at the end of this 

monograph. 

Many of the metabolites that occur in marine animals are pigments, a heterogeneous class of 

colorful compounds (Bandaranayake, 2006). Some of these are photosynthetic pigments contained 

in symbiotic algae and cyanobacteria. In other cases they are thought to be sun-screens that prevent 

damage from ultraviolet light. Others, including alkaloids produced by symbionts, are toxic or distasteful. 

Still others would appear to have mainly a visual effect, providing for color patterns that 

may conceal the animals on the one hand (camouflage), or render them conspicuous on the other 

(warning coloration). 

The fact that animals rich in secondary metabolites are often brightly colored is one more piece 

of evidence in favor of their having a defensive role. They supposedly have a kind of warning coloration 

that advertises the fact that they are distasteful to the predators. Some of the most conspicuous 

opisthobranchs in tropical waters are ones that have high levels of metabolites. For instance, 

dorid nudibranchs of the family Phyllidiidae, such as Phyllidia ocellata shown in Photo 64, which 

are well protected by isocyanides and have few natural predators, are generally active during the 

day and are quite conspicuous (Brunckhorst, 1991). On the other hand it has often been pointed out 

that many of the colorful opisthobranchs are actually quite inconspicuous when on their food. The 

mimics of brightly-colored animals may not be as distasteful as their models. Furthermore, the 

mere fact that an animal is drab and inconspicuous does not necessarily mean that it lacks chemical 

defense. Opisthobranchs that live among algae and feed on them are often well camouflaged, 

yet have well-developed chemical defense. Warning coloration is most strongly developed in those 

opisthobranchs that for one reason or another benefit from being able to venture out into the open 

with relative impunity. For example, dorid nudibranchs of the genus Roboastra pursue other nudibranchs 

and eat them, thereby deriving both nutriment and defensive metabolites (see Chapter X). 

Warning coloration and mimicry are controversial topics that have received a great deal of 

attention from biologists (for opisthobranchs see the works of Edmunds, 1974, 1987, 1987, 1991; 

Gosliner & Behrens, 1990; Gosliner, 2001). We will not discuss the issues in detail, but there are 

some peculiarities of opisthobranchs that make them particularly interesting in this connection. It 

has been something of a puzzle how natural selection could favor the evolution of conspicuous 

color patterns in the first place. One might think that a predator interacting with a varied population 

of prey would tend to notice and to eat the more conspicuous items first. The more conspicuous 

organisms would be the ones most often to die and would fail to pass their genes on to the next 

generation. The simplest answer is that often enough the prey escape either uninjured or not mortally 

so. There is experimental evidence for this (Penney, 2004; Gosliner, 2001). Furthermore, 

many animals tend to avoid conspicuous prey. Various other ways of getting around that problem 

have been suggested, but we will only consider one of them (but see Marples, Kelly & Thomas,



2005). This is kin selection, or, if you prefer, familial selection (Harvey, Bull, Pemberton & Paxton, 

1982). Basically the idea here is that the unit that gets selected is not an organism, but a family unit 

made up of close relatives. This would work in such terrestrial animals as butterflies, in which the 

larvae (caterpillars) hatch out of eggs that are laid in the same place and then hatch out and grow 

up in close proximity to their siblings. If one of them gets eaten by a predator, and if the predator 

is repelled, then the remainder of the family will be spared. With most marine gastropods, including 

most opisthobranchs, these conditions are not met, as was first pointed out by Faulkner and 

Ghiselin (1988). Tulrot and Sandberg (1991) provided the same argument. It was further developed 

by Rosenberg (1989, 1991). The usual pattern in opisthobranchs is for the fertilized eggs to be laid 

in a clutch protected by transparent coverings made up largely of mucopolysaccharide secretion 

from the genital duct. The embryos remain in the egg mass while they develop. During that period 

they are in close proximity to their siblings, and therefore the conditions for kin selection are in fact 

met. Indeed, the eggs of opisthobranchs are often brightly colored and loaded with metabolites as 

well. By the end of their embryonic development, however, they hatch out as larvae, swim about 

in the water until they find a suitable place for metamorphosis, and settle on the bottom. Only then 

do they grow up into mature adults. In consequence, the gene pool gets “stirred up” and the siblings 

are separated from one another. 

It would appear, then, that the kin or familial mechanism of selection will not work. But things 

are not all that straight forward after all (Cimino & Ghiselin, 2001). Opisthobranchs, although they 

are simultaneous hermaphrodites, generally do not self-fertilize. They fertilize their eggs with 

sperm from the prospective father that is stored in a special organ (receptaculum seminis) until the 

mother fertilizes the eggs. More sperm than are necessary for fertilization are produced, and some 

of the partner’s sperm may be digested in an organ called the gametolytic gland or bursa copulatrix. 

This allows for a kind of recycling, allowing the sperm-donors to contribute to the next generation 

but bringing about sperm competition among them. The animals tend to congregate in small 

groups, and they may copulate repeatedly. Sometimes, as in the case of Notaspidea, they can be 

found in the field living as pairs. The body of any such animal that has copulated contains not only 

his and her own germ plasm in the form of unfertilized eggs, but also that of other individuals in 

the form of viable sperm. Consequently, from a Darwinian point of view a dead opisthobranch is 

still very much alive, so long as the sperm are capable of engendering offspring. 

Perhaps the best way to close this methodological excursus is to emphasize the point that quite 

a variety of evidence can be brought to bear upon the problems of adaptive significance. 

Experiments, whether in the field or the laboratory, comparisons whether of behavior or anatomy, 

and the historical data of biogeography and phylogenetics all provide useful evidence and lend one 

another mutual support. 

CHAPTER III 

PRODUCERS AND TRANSFORMERS OF SECONDARY METABOLITES 

Part 1. Introduction 

Although many opisthobranchs biosynthesize defensive metabolites de novo, their doing so is 

a later evolutionary development. Originally they obtained the metabolites from food, and this 

remains the general rule. Therefore some background material on the organisms from which the 

metabolites are obtained will be useful in helping us understand the evolution of chemical defense


in opisthobranchs. We shall discuss these organisms in an order that roughly corresponds to their 

evolutionary relationships and note which metabolites are present in the various taxonomic groups. 

Naturally we pay most attention to the organisms that play a role in our evolutionary scenario. The 

branches of interest are treated in an order that puts the gastropods and other mollusks last, thereby 

providing a smooth transition to the chapters that follow. Before doing that, however, we will 

briefly consider how the organisms’ feeding mechanisms and ways of life relate to how they are 

defended, whether chemically or otherwise. This provides an ecological, rather than an historical 

classification. Therefore it often places genealogically unrelated groups together. 

Microorganisms include bacteria and unicellular plants and fungi. What they all have in common 

is, by definition, small size. For that reason many of them can live in small spaces, such as 

between sand grains or inside other organisms. Organisms that live in close association with other 

organisms of different species are called “symbionts” and, so far as the interest of the “host” organism 

goes, these may be innocuous commensals, harmful parasites, or helpful mutualists. Many of 

the natural products that are extracted from marine animals are widely believed to be produced by 

symbiotic bacteria or fungi. With a few exceptions, however, the evidence for this is weak. In the 

case of opisthobranchs there is no evidence for it whatsoever. 

Autotrophs are organisms that produce their own food from energy of non-biological origin, 

mainly by photosynthesis. Most of the supply of energy to the food chain in the sea is provided by 

unicellular plants that exist as plankton in the water. There is no place for them to hide under such 

circumstances. Often they are protected by shells or spines, but chemical defense is not unusual. 

On land the main photosynthetic organisms are macroscopic plants, which live rooted in the soil 

and for that reason cannot get away from grazing animals. Attached (sessile) plants are also abundant 

in the sea, but they are mostly restricted to hard bottoms in shallow water. Like terrestrial 

plants, they cannot run away from grazing animals, and, again like terrestrial plants, they often 

defend themselves by means of secondary metabolites. 

Sessile and sedentary animals are very abundant in the sea. They may live firmly attached to 

rocks or other hard surfaces. Many burrow in sand or mud. Such animals are heterotrophs, meaning 

that they depend upon material of biological origin for their energy supply. They feed mainly 

on material that is suspended in the water or that settles out on the bottom as a deposit. Again, such 

a life style makes it difficult to run away from grazers or predators, and alternative means of 

defense are common, including chemical defense. 

Many marine animals make their living by slowly crawling about and grazing upon sessile or 

sedentary animals and plants. The majority of opisthobranchs can be so characterized, as can seastars. 

They have to be adept at overcoming the defenses of the prey, including the chemical ones. 

At the same time they are themselves vulnerable to attack by faster-moving predators. One way in 

which they can defend themselves from such predators is by means of chemical defense. Secondary 

metabolites derived from food provide a convenient supply. 

Chemical defense is less of an advantage to highly motile grazers and predators that can effectively 

dodge or out-run their attackers or perhaps fight them off. Chemical defense is common 

among gastropods, though only in those in which the shell is somewhat reduced. In cephalopods, 

which are active predators that have largely dispensed with a shell, chemical defense is unusual. 

The little blue-ringed octopus, Hapalochlaena maculosa, appears to be an exception. However, this 

tropical animal kills by means of its venom, which is also used to subdue prey. The venom, 

tetrodotoxin, evidently of bacterial origin, is contained in the salivary glands (Sheumack, Howden, 

Spence & Quinn, 1978). Its bite can be fatal to human beings. It has brilliant warning coloration. 

In general, one expects marine animals that are brightly colored to have an unpleasant taste due to 

secondary metabolites.



Part 2. Prokaryotes 

Prokaryotes are distinguished from eukaryotes on the basis of the structure of the cell. The 

prokaryote cell is simpler than the eukaryote cell and lacks such features as a nucleus and the membrane 

that surrounds it. The prokaryotes consist of two major groups of bacteria, Archaebacteria 

and Eubacteria. The Eukaryotes are more closely related to the Archaebacteria than to Eubacteria: 

in other words the bacteria are a paraphyletic group. The Eubacteria include all of the bacteria that 

are of interest in this discussion, and these belong to two closely-related lineages, the 

Actinobacteria and Cyanobacteria. The Cyanobacteria were formerly considered plants and were 

called blue-green algae, or Cyanophyta. They form small filaments that are readily visible to the 

naked eye, and superficially resemble some true algae. A case of poisoning that occurred when people 

in Hawaii ate the red alga Gracillaria coronopifolia was later attributed to the cyanobacteria 

growing epiphytically on it (Nagai, Yasumoto & Hokama, 1997). 

Animals that feed on prokaryotic or eukaryotic “algae” sometimes have switched from one to 

the other during the course of evolution. This is but one example of how the texture and metabolite 

content of the food are often more important than its taxonomy. Bacteria are noteworthy for 

their chemical versatility. Many of them synthesize metabolites that eukaryotes do not. They are 

particularly important as symbionts that synthesize alkaloids, macrolides, and polyketides. Bacteria 

that live as symbionts within the bodies of marine animals such as sponges and sea-squirts are the 

source of alkaloids and some other secondary metabolites. (For review of marine microorganisms 

and fungi with secondary metabolites, see Pietra, 1997; Bernan, 2001; Engel, Jensen & Fenical, 

2002). 

Some unfortunate claims have occasionally made, even in print, about the putative role of 

symbionts in producing secondary metabolites. A particularly glaring example is to be found in a 

recent publication by Castoe, Stephens, Noonan and Calestani (2006:“2”): “Polyketide compounds, 

used as defensive mechanisms to deter predation, have been isolated from some marine 

invertebrates (e.g., sponges and mollusks; Garson, 1989), although these polyketides were subsequently 

found to be produced by bacterial symbionts (and not encoded in the animal genomes).” 

What the authors allege simply is not true. They do not cite a single publication in favor of their 

claim, and had anything of the sort been published it would surely have been brought to our attention. 

One way or another, what perhaps began as a mere speculation thrown out in casual conversation 

has become a rumor, or even what is sometimes called an “urban myth.” Now, given the fact 

that some, indeed many, animals make use of metabolites that are produced by their symbionts, it 

is perfectly reasonable to ask, in any given case, whether it is the host or some guest that synthesizes 

it. There are two possibilities and we need to apply the proper canons of evidence to decide 

between them, just as we do when deciding whether metabolites are produced endogenously or are 

derived from food. Many opisthobranchs obtain metabolites by eating other organisms that in turn 

get them from symbionts. It has not been difficult to recognize those symbionts, which exist in substantial 

numbers and are located in particular tissues and specialized organs within the body of the 

host. In opisthobranchs there are no tissues or organs that are reasonable candidates for harboring 

such a population of symbionts, and no such populations have been identified. In those cases where 

biosynthesis has been studied experimentally, and in which the biology of the animals is well 

understood, the production of metabolites by symbionts, although perhaps not as rigorously 

excluded as a hostile critic might demand, is highly implausible. In the cephalaspidean Haminoea, 

for example, the animal biosynthesizes defensive metabolites called fusipyrones. But the animals 

also biosynthesize a series of metabolites called haminols, which are not defensive. Rather they 

function as alarm pheromones, which alert conspecifics to attack by predators, and probably also


function in mate recognition. Different species have different pheromones (see the section on 

Cephalaspidea). Our credulity is strained by the notion that the system of haminols would evolve 

by modification of biosynthetic pathways in the guest rather than in the host. The symbionts are 

figments of the imagination, in which they function as nothing more than ad hoc hypotheses. 

Part 3. Plants and fungi 

Except for a few vascular plants such as turtle grass, “marine plants” means algae. Each of the 

three major groups of algae (Phyophyta, Rhodophyta and Chlorophyta) has given rise to multicellular 

lineages and each of these is a source of metabolites that are of interest to this discussion. The 

brown algae (Phyophyta) include the macroscopic sea-weeds called kelps. They are rich in terpenoids, 

such as the highly toxic dolabellanes (Atlas 373) that were first found in the anaspidean 

opisthobranch Dolabella (Photo 19). The red algae (Rhodophyta) are currently treated as a division 

Rhodophycota, with a single class, Rhodophyceae, having two subclasses: Bangiophycideae 

and Florideophycideae. The Bangiophycideae, which are supposedly more primitive, seem to lack 

defensive metabolites. On the other hand a wide variety of them have been recorded from the 

Floridiophycideae. The green algae (Chlorophyta) are the closest relatives of “higher” plants. 

Green algae of the families Udoteaceae and Caulerpaceae are of particular interest because many 

opisthobranchs of the order Sacoglossa feed upon them by sucking the sap out of their cells. 

Probably Udotaceae is paraphyletic, for Caulerpaceae has only one genus, Caulerpa. 

Terrestrial fungi are familiar to us as yeasts, moulds and mushrooms. They are important 

sources of antibiotics and other secondary metabolites of medical interest. Marine fungi are usually 

inconspicuous organisms. A substantial number of fungi that produce secondary metabolites 

occur as symbionts in sponges (Pietra, 1997; Abrell, Cheng & Crews, 1994; C. Smith et al., 2000; 

Edrada et al., 2002). Recently quite a number of secondary metabolites have been recovered from 

fungi that live in association with algae (Abdel-Lateff, König, Fisch, Höller, Jones & Wright, 

2002). 

Part 4. Animals 

The following is a simplified phylogenetic tree of the multicellular animals (Metazoa) with 

Algae and Fungi shown as outgroups. 

┌ Algae 

─┤┌ Fungi 

└┤┌ Porifera 

└┤┌ Cnidaria 

└┤ ┌ Echinodermata 

│┌┼ Hemichordata (Deuterostomia) 

└┤└ Chordata 

│ ┌ Arthropoda 

│┌┤ (Ecdysozoa) 

└┤└ Nematoda 

│ ┌ Brachiopoda 

│┌┤ 

└┤└ Phoronida 

│ (Lophotrochozoa) 

│┌ Annelida 

└┤ 

└ Mollusca 

Some groups that might have been shown are left out, mainly because they do not play a sig-



nificant role in this discussion. Although the branching sequences shown are debatable, they represent 

the generally accepted view of things, arrived at by combining the molecular data that have 

been accumulating over the last few years with the more traditional anatomical and embryological 

evidence. What sort of animal occupied the first node within the animals, i. e., the (latest) common 

ancestor, is hard to say, though the monophyly of the group implies that it was multicellular. From 

that ancestor there are two major lines of descent, the sponges (Porifera) and all the rest. On the 

basis of some molecular evidence it has been suggested that one lineage of sponges is closer to 

other animals than to some other sponges. If this be so, then Porifera is paraphyletic and all animals, 

including ourselves, are modified sponges. The Cnidaria or Coelenterata in the strict sense 

are such familiar animals as sea-anemones and jellyfishes. Their distinct gut unites them with all 

the remaining animals, which are called Bilateria, on the basis of their bilateral symmetry. Within 

the Bilateria there are two very distinct clades that owe their names to the way in which the mouth 

is formed during embryological development: Deuterostomia and Protostomia. 

Deuterostomia consists of three phyla: Echinodermata, Hemichordata, and Chordata. The 

adults of these three groups are very different, and the connection between them is obvious only 

when one looks at the early developmental stages. Echinoderms, such as sea-stars and sea-urchins, 

are here treated as an unresolved trichotomy with Chordata and Hemichordata, as shown on the 

tree. Chordata includes us vertebrates (Vertebrata), the simple, fish-like creatures called 

“Amphioxus” (Cephalochordata) and a group of filter-feeders (Urochordata) or tunicates. Among 

the tunicates, one group (Ascidiacea), the ascidians or sea-squirts consists of sessile animals that 

are important sources of secondary metabolites. 

Protostomia is a much larger group, for it contains several major phyla including Arthropoda, 

Nematoda, and Mollusca, as well as most of the minor ones. On the basis of molecular data two 

major clades within the Protostomia have been recognized: Ecdysozoa and Lophotrochozoa. 

Ecdysozoa derives its name from the characteristic feature of molting the exterior layer of the body 

(ecdysis) and includes the arthropods (Arthropoda) and nematodes (Nematoda). Lophotrochozoa 

takes its name from characteristic features of two groups of phyla. The lophophorates (Tentaculata) 

have a crown of tentacles with which they feed. Three phyla have traditionally been placed in 

Tentaculata: Phoronida, Ectoprocta (=Bryozoa in the strict sense) and Brachiopoda. Phoronids are 

tube-dwelling worms. Ectoprocts are colonial creatures sometimes called “moss animals.” 

Brachiopods have bivalved shells, and have a superficial resemblance to mollusks of the class 

Bivalvia. The Trochozoa are named after the so-called trochophore larva. The segmented worms 

(Annelida) and the mollusks (Mollusca) are familiar examples, but the group also contains some 

of their more obscure relatives. 

Let us briefly consider an example of how a diagram like this one can be used to address historical 

questions. The phyla Hemichordata, Phoronida, and Annelida occupy quite distant positions 

on the tree. Some of these animals live as burrowers in marine mud. Among the hemichordates the 

Enteropneusta have a wide variety of secondary metabolites that are said to have antimicrobial 

activity but are believed to play a role in deterring predators. These compounds include bromophenols, 

halogenated indoles, and ingotin pigments (halogenated alkaloids) (Higa, Fujiyama & 

Scheuer, 1980; Higa, Ichiba & Okuda, 1985; King, 1986; Higa, Okuda, Steverns, Scheur, He & 

Clardy, 1987). A burrowing annelid, Thelepus setosus, contains a series of five brominated phenolic 

compounds (Higa & Scheuer, 1974, 1975). And finally, Phoronopsis viridis, a tube-dwelling 

phoronid worm that is abundant on mudflats, contains the halogenated phenolics 2,6-dibromophenol 

and 2,4,6-tribromophenol (Sheikh & Djerassi, 1975). Given that these animals have such a 

remote common ancestry, it seems more than likely that they evolved similar metabolites in 

response to similar environmental circumstances.


Part 5. Animals: Porifera 

Sponges have been particularly rich sources of secondary metabolites (Dumdei, Blunt, Munro, 

Battershill & Page, 1998). They are sessile filter-feeders. Water is taken up from the exterior via 

numerous small pores that lead into a system of internal channels. The small particles of food that 

the water contains are extracted by cells that line the chambers. Sponges are loosely integrated and 

have nothing equivalent to a nervous system. In addition to the soft tissue, there is generally a substantial 

amount of skeletal material. Although it seems obvious that the skeletal material provides 

support, to what extent it functions defensively remains an open question (cf. Chanas & Pawlik, 

1995; Burns & Ilan, 2003). The skeleton of sponges, when present, generally consists of fibrous 

protein called spongin, spicules, or both. The bath sponges of commerce are made up of spongin. 

Spicules are mineral (or occasionally protein) formations. Their structure and chemical composition 

are important in classification. Additional material, living or not, may be incorporated within 

a sponge. 

Bacteria and fungi can make up a considerable proportion (up to 40%) of a sponge’s body, and 

this is important because these symbionts are sometimes the source of secondary metabolites that 

get passed up the food-chain (Bewley, Holland & Faulkner, 1996). Most of the metabolites, however, 

are produced by the sponge, not the symbionts (Faulkner, Harper, Haygood, Salomon & 

Schmidt, 2000; Salomon, Deerinck, Ellisman & Schmidt, 2001). It seems to be a general rule that 

the sponges themselves produce terpenoids and their symbionts amino acid derivatives. However, 

the production of the terpenoids by the sponges has not yet been rigorously confirmed by experiments. 

In Dysidea herbacea (Demospongiae: Dictyoceratida: Dysideidae), the sponge itself produces 

sesquiterpenoids, whereas its symbiotic cyanobacteria produce amino acids (Unson & 

Faulkner, 1993). In Suberea creba (Demospongiae: Verongida: Aplysinellidae), the sponge produces 

quinolines, and the symbionts tyrosin metabolites (Faulkner, Harper, Haygood, Salomon & 

Schmidt, 2000). The bacterial symbionts are transmitted to the next generation via the ova and larvae 

(Lévi & Lévi, 1976; Sciscioli, Lepore, Gherardi & Scalera-Licali, 1995). 

Three extant classes of Porifera have long been recognized: Hexactinellida, Calcarea, and 

Demospongiae. The three groups are quite distinct, but the relationships among them are uncertain. 

They differ with respect to the structure and the composition of the skeleton. The mineralized 

spicules are calcareous in Calcarea, and siliceous in the other two classes. The overwhelming 

majority of secondary metabolites that have been reported in the literature are from the 

Demospongiae, which is the most diverse and best studied of the three, and most of the opisthobranchs 

that obtain their defensive metabolites from sponges get them from this group. However, 

a few secondary metabolites are known from Calcarea and Hexactinellida. Likewise, as we shall 

see, a few opisthobranchs feed on Calcarea or Hexactinellida and obtain metabolites from them. 

Because Porifera is about half a billion years older than Opisthobranchia, it is not an illustration of 

the two groups coevolving as a unit, but rather of the opisthobranchs taking advantage of different 

food sources with similar texture and metabolites. 

Sponges are hard to classify and a system that reflects the genealogical relationships is definitely 

work in progress. The community of sponge taxonomists has recently produced a provisional 

system that has no pretensions to do more than improve upon its predecessors (Hooper & Van 

Soest, 2002). Therein the families of Demospongiae are arranged in a series of ten orders, most of 

which roughly correspond to natural groups. The classification definitely tends to put those 

sponges that have similar metabolites together. We have followed this classification in the text. 

Sponges are also hard to identify. That creates serious problems when we try to interpret the 

literature. The sponges fed upon by opisthobranchs have often been misidentified, sometimes being



placed in the wrong family. Rudman and Bergquist (2007), respectively specialists on the systematics 

of nudibranchs and sponges, have made a valuable contribution by correcting numerous 

misidentifications. A number of recent molecular studies provide good evidence that many 

“species” of sponges are really groups of several cryptic species (Solé-Cava & Thorpe, 1986; Solé- 

Cava, Klautau, Boury-Esnault, Borojevic & Thorpe, 1991; Klatau, Solé-Cava & Borojevic, 1994; 

Muricy, Boury-Esnault, Bézac & Vacelet, 1996; Muricy, Solé-Cava, Thorpe & Boury-Esnault, 

1996; Boury-Esnaut, Klautau, Bézac, Wulff & Solé-Cava, 1999; Nichols & Barnes, 2005; Blanquer 

& Uriz, 2007). Treating such assemblages as if they were species can have numerous unfortunate 

consequences. It gives the false impression that certain species are cosmopolitan. It makes it appear 

that particular species of sponges contain a wider range of metabolites than they actually do. And 

it distorts our conception of symbiont specificity in the sponges and of feeding specificity of the 

animals that eat them. Tedania ignis, which has been studied extensively from the point of view of 

metabolites (Schmitz, Gunaserka, Gopichand, Hossain & Van der Helm, 1984), has a close relative, 

T. klausi, from which it differs ecologically (Wulff, 2006). Seastars that eat the former species 

reject the latter, and angelfish likewise consume T. klausi less rapidly. 

Part 6. Animals: Cnidaria 

The phylum Cnidaria is also known as Coelenterata, although the latter term has sometimes 

been used for a larger assemblage that also includes the “comb-jellies” (Ctenophora), which may 

or may not be closely related to them. The group includes such relatively familiar animals as jellyfish, 

sea-anemones, and various corals and hydroids. Diagnostic of Cnidaria is the presence of 

cnidae, or stinging capsules. These are organelles that are produced within specialized cells. Upon 

receiving the appropriate stimulus they release a threadlike process. The cnidae may contain venom 

and are used both defensively and in capturing and subduing prey. In some cases the venom is powerful 

enough to kill a human being. Some of the opisthobranchs that eat cnidarians use the cnidae 

in their own defense (see Chapter XI). Cnidarian life cycles often include two distinct stages, the 

polyp and the medusa. As a rule, the polyp is a sessile creature that lives as colonies formed by 

asexual reproduction. The medusa is a jellyfish that, as a general rule again, swims about in the 

open water. It is noteworthy that the majority of secondary metabolites that are known from cnidarians 

were found in the polyp stage. 

There are three (or in some classifications four) classes of Cnidaria: Anthozoa (anemones and 

corals), Hydrozoa (hydroids), and Scyphozoa (true jellyfish). It is currently understood that 

Anthozoa is the sister group of the other two. Lack of a medusa in this group can nonetheless be 

interpreted as secondary (Scholtz, 2004). Be this as it may, anthozoans are benthic animals with 

large polyps that often form colonies. The group is subdivided into two subclasses: Hexacorallia 

and Octocorallia. Hexacorallia includes anemones (order Actiniaria) and the reef-building corals 

(Scleractinia). There are three orders of Octocorallia (octocorals) with many species that are very 

rich in secondary metabolites. Two of these orders deserve mention at this time. The gorgonians 

are called sea-whips and sea-fans. They have a hard skeleton covered with tissue that contains the 

feeding polyps. This tissue generally contains hard spicules (sclerites) that help to resist the attack 

of grazers, as well as secondary metabolites. Soft corals are, as the name suggests, soft-bodied, and 

defensive metabolites are abundant in these as well. Sea pens have a muscular peduncle and live 

anchored in soft or unconsolidated substrates. 

Gerhart (1983) studied the terpenoids of gorgonians from a phylogenetic point of view. He 

noted that the group can be divided into two lineages. In one branch, consisting of the genera 

Gorgonia, Pseudopterogorgia, Plexaurella, and Muricea, there are sesquiterpenes but not diter-


penes. In the other, consisting of Briareum, Eunicella, Eunicea, and Pseudoplexaura, there are 

diterpenes; sesquiterpenes do occur, but they are limited to Briareum and Eunicella, which constitute 

a derived branch within the group. Therefore it seems likely that the defensive use of sesquiterpenes 

has evolved twice in the gorgonians. Diterpenes also occur in other Octocorallia, but the carbon 

skeletons are different from those that occur in sponges. In Octocorallia they are cembranolides, 

whereas in the majority sponges they display the tricyclic spongiane skeleton. Because the 

mode of biosynthesis is different from that of sponges, and also because there is a different pattern 

of cyclization, it would seem that they do not go all the way back to the common ancestor of 

Metazoa (Dai, Garson & Coll, 1991). Another class of metabolites for which the gorgonians are 

celebrated is the eicosanoids, such as punaglandin-1 (Atlas 14), that have already been mentioned. 

These molecules, however, are widely distributed in animals, where they serve a variety of signaling 

functions. What is unusual about the gorgonians’ eicosanoids is the defensive role that they 

have come to play. 

Part 7. Animals: Deuterostomia (Echinodermata, Hemichordata, and Chordata) 

The echinoderms are some of the most structurally and physiologically aberrant organisms in 

the animal kingdom. Their relationship to other deuterostomes is anything but obvious from adult 

anatomy. This extreme divergence does not settle the question of their relationships to the other two 

phyla. They are slow-moving animals, and not surprisingly they are rich in defensive chemicals 

that have been useful for classification within the phylum. However these metabolites give no hint 

of their relationship to other animals. They are noteworthy for the presence of saponins, which are 

steroid and triterpenoid oligosaccharides (Kalinin, Levin & Stonik, 1994). Some plants, but no 

other animals, have similar metabolites and use them defensively. 

Hemichordates, briefly discussed above (p. 212), do not play an important role in our opisthobranch 

scenario. The chordates are a different matter. One group of these, the subphylum 

Urochordata, contains a largely sessile group, the sea-squirts or ascidians (Ascidiacea). They live 

mainly on hard surfaces, and obtain food from the water by filtering it with their gills. Colonies are 

often formed through budding of the separate “persons” or zooids. As with many other sessile 

organisms, both physical and chemical defense are well developed. There is a thick, rubbery covering 

called a tunic, made up largely of β-cellulose. A wide variety of secondary metabolites are 

present as well. Some of these metabolites are produced by symbiotic algae and bacteria (Kang, 

Jensen & Fenical, 1996). It seems likely that at least some of the symbionts are transmitted via the 

eggs and larvae. Some of these metabolites occur in opisthobranchs that feed upon ascidians. 

Other metabolites are produced by the ascidians themselves. Some ascidians of the genus 

Didemnum produce eicosanoids, providing an interesting analogy with gorgonians (Lindquist & 

Fenical, 1989; Niwa, Inagaki & Yamada, 1991). Particularly curious chemicals that are thought to 

play a defensive role in ascidians are the elemental vanadium and related metals that are produced 

together with sulphuric acid and unstable hydroquinoid compounds called tunichromes (Stoecker, 

1980a, 1980b, 1980c). 

Part 8. Animals: Ecdysozoa, Platyhelminthes, Nemertea, Annelida 

Ecdysozoa includes the largest phylum in the animal kingdom, Arthropoda, as well as 

Nematoda and several other phyla that do not interest us here. Arthropods are numerically dominant 

on the land because there are so many insects, and in the sea because there are so many crustaceans. 

Marine ecdysozoans, including crustaceans, do have some chemical defense but it has had 

little if any impact on the opisthobranchs. The same may be said of flatworms (Platyhelminthes),



and nemerteans or ribbon worms (Nemertea). Some annelids or segmented worms (Annelida) have 

defensive metabolites. Poisonous annelids are eaten by one very obscure group of opisthobranchs, 

cephalaspideans related to Acteon and Hydatina, but data on their secondary metabolites are known 

for only one of these, Micromelo undata, and its polypropionates (Atlas 152, 153) are probably 

biosynthesized de novo, not derived from food. 

Part 9. Animals: Ectoprocta and Mollusca 

The Ectoprocta, or Bryozoa in the strict sense, are popularly known as “moss animals” because 

the branching colonies may resemble moss. They are sessile, colonial animals that feed on particles 

in the water by means of a crown of tentacles. The small zooids that bear the tentacles are generally 

protected by some kind of external covering. This is in addition to chemical defense 

(reviews: Christophersen, 1985; Sharp, Winston & Porter, 2007). Ectoprocts are rich in alkaloids 

and macrocyclic polyethers, and for both of these compounds a bacterial origin has been claimed 

(Anthoni, Nielsen, Pereira & Christophersen, 1990). Ectoprocts brood the developing embryos, 

and this evidently facilitates the transfer of symbionts from one generation to the next. Woollacott 

(1981) found, in the larvae of some ectoprocts, bacteria that are suspected of producing macrocyclic 

polyethers called bryostatins (review in Newman, 2005). Formerly it was thought that the 

ectoproct Bugula neritina contains a variety of bryostatins. It turns out, however, that Bugula neritina 

is not a single species, but rather a complex of several cryptic ones, which have different bacterial 

symbionts (Davidson & Haygood, 1999). 

Mollusks for the most part are slow-moving animals that are defended from predators by a 

strong shell. Bivalves of the genus Pinna live attached to the bottom in the tropics and their shell 

is not very strong. They have been found to contain the polyether alkaloid pinnatoxin (Atlas 62) 

(Chou, Haino, Kuramoto & Uemura, 1996). Some other bivalves contain secondary metabolites 

derived from food that render them poisonous to human beings and other animals. A shell has been 

dispensed with in the fast-moving cephalopods such as squid, which are adept at evading predators. 

The powerful beaks that cephalopods use in subduing prey and dealing with predators are supplemented 

by venomous secretions. 

CHAPTER IV 

INTRODUCTION TO GASTROPOD DIVERSITY AND SYSTEMATICS 

The gastropod common ancestor probably was herbivorous, or perhaps omnivorous with a 

substantial amount of plant material in its diet. The radula allowed it to scrape up algal materials, 

which were then swallowed and digested. Numerous lineages subsequently switched to other kinds 

of food, although many remained herbivorous. In other words, the broad picture of gastropod evolution 

has been an adaptive radiation based on taking advantage of a diverse food supply. It is perhaps 

better to view the gastropods as “entrepreneurs” rather than as avoiders of competition. 

Reiterating what has been said about their higher taxonomy, gastropods have been subdivided 

into three subclasses: Prosobranchia, Opisthobranchia, and Pulmonata. Pulmonates and opisthobranchs 

are modified prosobranchs, and Prosobranchia is a paraphyletic grade that represents what 

is left over after Opisthobranchia and Pulmonata have been removed. The pulmonates and opisthobranchs 

form a group called Euthyneura, and share a common ancestry with some of the more 

advanced prosobranchs called mesogastropods. This group forms a grade in an old fashioned clas-


sification that goes back to Johannes Thiele (1931), who divided Prosobranchia into the orders 

Archaeogastropoda, Mesogastropoda and Neogastropoda. In modern classifications Euthyneura is 

placed with some poorly-understood but evidently related forms in a group called 

Heterogastropoda. 

Contemporary systematists accept the monophyly of Pulmonata and Euthyneura, but there is 

much uncertainty as to where the various groups of opisthobranchs and their somewhat more 

remote relatives fit in. It is possible that some groups of opisthobranchs are genealogically closer 

to pulmonates than to other opisthobranchs. There are some minor groups that probably belong 

somewhere close to the opisthobranchs but exactly where is uncertain. For the present discussion 

what really matters is that one order of opisthobranchs, Cephalaspidea, evidently gave rise to all 

the other orders and perhaps to Pulmonata as well. At present approximately eight such orders are 

recognized, and evidently most of them arose from different lineages within the Cephalaspidea. In 

other words, Cephalaspidea is a highly paraphyletic group. The following tree shows Pulmonata as 

the sister group of Opisthobranchia with a lineage consisting of two orders, Notaspidea and 

Nudibranchia forming a first branch, followed by two families of the order Cephalaspidea and 

finally a branch consisting of the orders Anaspidea and Sacoglossa. 

┌ Basommatophora 

┌┤ (Pulmonata) 

─┤└ Stylommatophora 

│ ┌ Notaspidea 

│┌┤ (Acoela) 

└┤└ Nudibranchia 

│ ┌ Haminoeidae 

│┌┤ 

└┤└ Scaphandridae 

│┌ Anaspidea 

└┤ 

└ Sacoglossa 

Before discussing the opisthobranchs and pulmonates let us provide a little information about 

those prosobranchs that are of interest from the point of view of chemical defense. One of these is 

a group of snails, the Lamellariidae, that feed upon tunicates and use the alkaloids from them 

defensively (Andersen, Faulkner, He, Van Duyne & Clardy, 1985; Carroll & Scheuer, 1990; 

McClintock, Baker, Hamann, Yoshida, Slattery, Heire, Bryan, Joyablake & Moon, 1994; Kitahara, 

Nakahara, Yonezwa, Nagatsu, Shibano & Kubo 1997). In some of these animals the shell is considerably 

reduced and overgrown by the mantle, giving them a superficial resemblance to nudibranchs, 

for which they are often mistaken. They can be remarkably well camouflaged when resting 

on colonies of tunicates (Ghiselin, 1964). Juveniles of the cowrie Ovula ovum mimic the distasteful 

dorid nudibranchs Phyllidia varicosa and P. elegans (Gosliner & Behrens, 1990; E. Mollo, 

personal communication). Photo 60 shows the cowrie with its expanded mantle above a detail of 

the integument of the nudibranch. 

Limpets, like slugs, are not a natural group of mollusks. They are a polyphyletic assemblage 

of snails in which the shell has become cap-shaped, covering the animal’s dorsal surface. This configuration 

means that the snail can no longer withdraw within its shell and close the opening with 

an operculum, but it can protect itself by clinging to a firm substrate. Limpets have evolved from 

coiled snails several times in Prosobranchia, Opisthobranchia, and Pulmonata. Among prosobranchs 

there is one group, Patellogastropoda, in which an intertidal limpet, Lottia limatula (formerly 

Acmaea limatula, then Collisella limatula), supplements mechanical defense with chemical 

defense. It contains triterpenoids such as limatulone (Atlas 517) (Albizati, Pawlik & Faulkner,



1985; Mori, Takikawa, Kido Albizati, & Faulkner, 1992; Pawlik, Albizati & Faulkner, 1986). 

Superficially similar triterpenoids, testudinariols A and B (Atlas 515, 516), occur in an opisthobranch, 

Pleurobranchus testudinarius (Photo 43) (Spinella, Mollo, Trivellone & Cimino, 1997). 

Testudinariol B also occurs in an as yet unidentified species of Pleurobranchus from China 

(Carbone, 2007). The metabolites in both the prosobranch and the opisthobranchs exhibit a 

squalane skeleton that apparently is a dimer, formed by the union of a pair of farnesyl sesquiterpenoid 

moieties. 

We begin our account of Euthyneura by an effort to reconstruct the features on the common 

ancestor of opisthobranchs and pulmonates. This has been attempted by several authors, mainly on 

the basis of comparing them to more distantly related animals and trying to decide what the primitive 

conditions are on a physiological basis (Ghiselin, 1966b; Gosliner, 1981). One criterion that 

needs to be avoided is that of treating such “primitive” animals as the cephalaspidean opisthobranch 

Acteon, and especially its best-known representative, A. tornatilis, as if it were the common 

ancestor. Although primitive in many respects, such as having a rather well developed shell and 

less of the detorsion that is characteristic of opisthobranchs, Acteon has some derived characters, 

most notably a carnivorous diet and a reproductive system with a separate vas deferens instead of 

an open, ciliated groove. Presence (primitive) or absence (derived) of an operculum in the adult 

varies within the family Acteonidae. A. tornatilis has a much modified radula, assuming that what 

has been called a radula is not something else (Gabe & Prenant, 1953). 

The common ancestor had a shell, well enough developed that the animal could withdraw into 

it, supplemented by an operculum. The nervous system did not display many of the effects of detorsion 

and concentration of ganglia that characterize the more derived representatives of the group. 

The animal fed mainly on plant material, perhaps including some detritus. It had a relatively unspecialized 

radula, and its gut possessed at most some cuticularizations rather than the gizzard plates 

that characterize some of the more derived forms. We may speculate that some reduction of the 

shell had already begun, perhaps as a consequence of feeding on chemically protected food organisms. 

A benthic habitat with a significant amount of sediment can be justified on the basis of the 

changes in the gills and their surrounding (mantle) cavity that can be documented in both opisthobranchs 

and pulmonates. The mechanisms causing movement of water through the cavity and over 

the gill have changed, and in correlation so too has the structure of the gill. Instead of the respiratory 

current being produced mainly by cilia that cover the gill surface, water is moved by the action 

of bands of cilia behind the gill, and the gill itself presents a series of folds, or plicae, rather than 

comb-like structures to the water that flows over it (in other words there was a plicate rather than 

a pectinate gill). 

The ancestor was a simultaneous hermaphrodite with an undivided gonoduct, organs that 

stored and processed spermatozoa, and a series of regions that deposited three layers of material 

(albumen, membrane, and mucus) around them to form an egg mass. From the common opening 

there was a ciliated groove that conveyed sperm to the penis, which was located at the anterior end 

of the body. The life cycle included a free-swimming larva that emerged from a protective egg 

mass. 

Some authors have advocated alternative views about the ancestral state of the gills and the 

male portion of the reproductive system. So far as the gills go, the “evidence” is merely that the 

gills are different, not that there is anything implausible about the derivation. The claim that the 

male part of the system has evolved from a closed duct into an open groove is obviously an attempt 

to justify physiologically implausible results instead of asking what went wrong with the analysis. 

Molecular as well as anatomical evidence indicates that both Opisthobranchia and Pulmonata 

are monophyletic lineages. The possibility that one opisthobranch lineage or another is closer to


the pulmonates or branched off earlier cannot be ruled out, however It seems likely, then, that the 

pulmonate stock branched off before the origin of the head-shield that is so conspicuous in many 

cephalaspideans, and from which they take their name. 

In the pulmonates, the mantle cavity has been converted into a lung. Arguments against this 

homology have been firmly and effectually refuted by Ruthensteiner (1997). One lineage of 

Pulmonata, Stylommatophora, derives its name from the stalked eyes that are so conspicuous in 

garden snails. Stylommatophorans are remarkably successful as terrestrial animals. Another lineage, 

Basommatophora, is named on the basis of such stalks not being present. Basommatophorans 

are largely fresh-water animals, though a few — the ones that interest us — remain marine. There 

are a few pulmonates of uncertain relationships, including some marine forms with stalked eyes, 

such as Onchidium, which likewise interest us. Because there are only two pulmonate lineages to 

deal with, all we need to know is that they are distinct, and therefore we will not go further into 

pulmonate relationships. 

The notion that marine pulmonates are secondarily so is a myth, easily refuted by the fact that 

after hatching out of their egg masses they swim about as “veliger” larvae like those of many other 

marine gastropods, including opisthobranchs. Marine pulmonates flourish as intertidal animals. 

They benefit from the ability to breathe and remain active both when the tide is in and when the 

tide is out, generally obtaining food by grazing on small plants that live on the surface of rocks, 

plants and animals. 

The marine Basommatophora that interest us are all intertidal limpets. The genus Siphonaria 

(reviewed by Hodgson, 1999) has been extensively studied because it contains polypropionates 

(Hochlowski & Faulkner, 1983, 1984; Capon & Faulkner, 1984; Hochlowski, Faulkner, 

Matsumoto & Clardy, 1983; Hochlowski, Coll, Faulkner, Biskupiak, Ireland, Zheng, He & Clardy, 

1984; Manker & Faulkner, 1986, 1989a, 1989b; Arimoto, Yokoyama, Nakamura, Okumura & 

Uemura, 1996; Norte, Cataldo & Gonzáles, 1988). The polypropionates are quite diverse, even 

when laboratory artifacts are discounted. These animals graze upon the material that covers intertidal 

surfaces and we may assume that they are basically herbivorous. The absence of polypropionates 

in the gut suggests that they are not of dietary origin. Their location in the mucus and around 

the rim of the mantle is what one would expect if they are in fact defensive. Hochlowski, Faulkner, 

Matsumoto and Clardy (1983) found that they are toxic to fish. 

Darias, Cueto and Díaz-Marrero (2006) divided the propionates of Siphonaria into two distinct 

classes, I and II. The class I propionates, such as siphonaienolone (Atlas 161), are essentially 

acyclic and have a linear chain, and differ from one another mainly in the length of the chain. They 

are similar in their structure to polypropionates that occur in opisthobranchs of the order 

Cephalaspidea (see below). The class II polypropionates, such as siphonarin A (Atlas 160), are 

much more complicated and variable and bear considerable resemblance to compounds that are 

known from actinomycetes. But they also have some structural analogies with propionates that 

occur in pulmonates of the family Onchidiidae, to be discussed later in this chapter. The same as 

well as other authors have made some vague remarks about common origins, but it is far from clear 

what these are supposed to be. It is possible that the similarities represent common ancestral conditions, 

in other words, plesiomorphies. Although the cephalaspideans and marine pulmonates are 

on separate branches there is no reason why they could not have retained some primitive characters. 

Alternatively, there could have been a certain amount of evolutionary parallelism or convergence. 

Until the sources of these metabolites have been studied there will probably be no clear 

solution to this problem. 

Basommatophorans of the genus Trimusculus feed with a mucous net, with which they capture 

plankton (Rice, 1985). Polypropionates have not been found in this genus, and it is not because of



failure to look for them. The four species that have been studied contain unique diterpenoids (Atlas 

460) (Manker & Faulkner, 1987, 1996; Díaz-Marrero, Dorta, Cueto, Rovirosa, San-Martín, Loyola 

& Darias, 2003; Darias, Cueto & Díaz-Marrero, 2006; Van Wyk, Gray, Whibley, Osoniyi & 

Hendricks, 2008). They are very similar to some metabolites (Atlas 351, 352) found in the notaspidean 

Pleurobranchaea meckelii (see below). Although these limpets are effective in defending 

themselves from attacks by sea-stars, those predators that ingest the limpets seem not to be harmed 

(Rice, 1985). There is no clear answer to the question of whether Trimusculus never evolved propionates 

or whether it changed from propionates to terpenoids as defensive metabolites. Given, 

however, the fact that the defensive use of polypropionates has evolved repeatedly in euthyneurous 

gastropods, the former hypothesis is at least plausible. 

The other group of marine pulmonates of interest to us is the family Onchidiidae, in which a 

shell is entirely lacking in the adults. Their stalked eyes suggest that they should be placed in the 

Stylommatophora together with terrestrial snails and slugs, but it is common practice to put them 

in a separate group. There is no gill, and they breathe air through an opening at the posterior end 

of the body. Some respiratory exchange also occurs via the general surface of the body. The dorsum 

is somewhat leathery, and there are repugnatorial glands that contain defensive metabolites. 

These metabolites include sesquiterpenoids, depsipeptide acetates, and propionates. In Onchidella 

binneyi, the secretion consists largely of the enol acetate sesquiterpenoid onchidal (Atlas 216) 

(Ireland & Faulkner, 1978). This is the protected form of the molecule. When the animal is 

attacked, onchidal is changed into the active form, ancistrodial (Atlas 217), which has the common 

dialdehyde structure with an adjacent double bond. Ancistrodial is also present in the defensive 

secretion of a termite (Baker, Briner & Evans, 1978). 

Abramson, Radic, Manker, Faulkner and Taylor (1989) found geographical differences in the 

concentration of onchidal from different species in different places. Onchidella binneyi from Baja 

California had 230 micrograms per animal, whereas O. borealis from California had only 33 micrograms 

per animal, showing the usual pattern of more chemical defense in lower latitudes. 

Nonetheless, the repugnatorial gland secretion of O. borealis is strikingly effective in deterring 

attacks by seastars, and the slugs are largely left alone by predators (Young, Greenwood & Powell, 

1986). Peronia peroni has polypropionates called peronatriols (Atlas 158). These animals are eaten 

by human beings, but evidently only after the dorsal surface has been cleaned off (Biskupiak & 

Ireland, 1985). 

A cytotoxic depsipeptide called onchidin (Atlas 675) has been recorded from an unidentified 

tropical species of the genus Onchidium (Rodíguez, Fernández, Quiñoá, Riguera, Debitus & 

Pouchet, 1994). A similar depsipeptide, onchidin B, occurs in a likewise unidentified Onchidium 

(Fernández, Rodríguez, Quiñoá, Riguera, Muñoz, Fernández-Suárez & Debitus, 1996). The same 

group of investigators found cytotoxic acetates and propionates in another unidentified tropical 

Onchidium species (Rodíguez, Riguera & Debitus, 1992). Ilikonapyrone (Atlas 151) esters have 

been reported from Onchidium verrucatum (Ireland, Biskupiak, Hite, Rapposch, Scheuer & Ruble, 

1984). 

In pulmonates, then, polypropionates are widespread, but other metabolites occur in addition 

to, or instead of, them in what would seem to be the more modified representatives of the group. 

This pattern is rather difficult to interpret historically. One possibility is that initially the marine 

pulmonates were defended chemically by some other metabolite and began to secrete polypropionates 

when they shifted to the intertidal habitat. The substitution of diterpenoids for polypropionates 

in Trimusculus would then be a secondary shift, resulting from the availability of new 

metabolites when a new feeding mechanism evolved. In Onchidium and its relatives an analogous 

change might have led to additional compounds being added to the secretion of the repugnatorial


glands. It may be, however, that the defensive use of polypropionates goes back to the common 

ancestor of pulmonates and opisthobranchs. 

CHAPTER V 

OPISTHOBRANCH SYSTEMATICS AND PHYLOGENY 

Traditionally, the opisthobranchs have been treated as a sub-class divided into approximately 

eight orders, namely: Cephalaspidea, Anaspidea, Sacoglossa, Notaspidea, Nudibranchia, 

Acochlidiacea, Thecosomata, and Gymnosomata. Let us briefly characterize these groups, preparatory 

to a discussion of their genealogy. 

The following diagram indicates likely relationships of five of them, leaving out the paraphyletic 

Cephalaspidea and the groups for which there are no data on chemical defense: 

┌ Notaspidea 

┌┤ (Acoela) 

─┤└ Nudibranchia 

│┌ Sacoglossa 

└┤┌ Anaspidea 

└┤ 

└ Gymnosomata 

The Cephalaspidea derive their name from the head-shield at the front of the body. This structure 

is conspicuous in the specimen of Bulla striata shown with its eggs in Photo 9. They are also 

called Bullomorpha by allusion to the genus Bulla. The vernacular name, “bubble-shell,” alludes 

to the fragile shells of many cephalaspideans. The shell may be well developed, but all stages of 

reduction occur. Cephalaspidea is considered the ancestral stock from which the other opisthobranch 

groups, or at least some of them, have separately evolved. The group as traditionally conceived, 

however, is a paraphyletic grade. To make it monophyletic it would be necessary to remove 

some lineages from this group, and taking this step recently has been suggested by Malaquias, 

Mackenzie-Dodds, Gosliner, Bouchet and Reid (2009). 

The Anaspidea derive their name from the secondary modification of the head shield. They are 

also called Aplysiomorpha by reference to the familiar genus Aplysia, which has been a favorite 

experimental subject for neurophysiology (Photos 16 & 18). The head shield has been modified so 

that there are two pairs of rolled projections called “rhinophores” that resemble ears. These have a 

sensory function. One genus, Akera, however, still retains the unmodified head shield and fragile 

shell, making it a good transitional form connecting the group with Cephalaspidea (Photo 17). 

Otherwise the body has expanded considerably and the shell is proportionally reduced. 

The Sacoglossa, or Ascoglossa, are named on the basis of the sac, or ascus, that holds used 

teeth. Lobiger serradifalci (Photo 28) and Calyphilla mediterranea (Photo 40) are good examples. 

There is no vernacular name, but they are sometimes called “sap-sucking slugs” from the way they 

feed upon algae by piercing the cell with their highly modified radular teeth, and then sucking in 

the contents. Typically they have a single pair of rolled rhinophores, resembling those of anaspideans, 

but the retention of a head shield in more primitive representatives of both groups shows 

that this is a result of evolutionary parallelism or convergence. Some sacoglossans again have 

shells like those of cephalaspideans, and old-fashioned systematists classified them as such. In one 

lineage, the shell has been modified so that it looks like the bilaterally divided shell of bivalves



rather than the coiled shell of gastropods. But complete loss of the shell in the adults is the general 

rule. 

The Notaspidea have a “shield” on the dorsal surface that is not equivalent to the head shield 

of other opisthobranchs. Pleurobranchaea meckelii, shown with its eggs in Photo 45, is a good 

example. The shell is considerably reduced in all notaspideans, and the mantle cavity has virtually 

disappeared, so that it no longer covers the gill, which lies along the right side of the animal’s body. 

This configuration led to the coinage of a rather ludicrous vernacular name “side-gilled slug,” but 

“pleurobranch” seems a more sensible term. Another name for the group is Pleurobranchomorpha, 

after the genus Pleurobranchus. Recent phylogenetic studies have suggested that some of the animals 

traditionally treated as the most basal notaspideans are related to other lineages of opisthobranchs. 

A group Nudipleura would therefore consist of the remaining notaspideans and their closest 

relatives, the nudibranchs. 

The Nudibranchia, or nudibranchs, derive their name from the naked gills. Gills, when present, 

may occur as a cluster near the posterior end of the body as they do in such dorid nudibranchs 

as Hypselodoris nigrostriata (Photo 93). Or they may take the form of elongate projections of the 

dorsal surface of the body (cerata), as in Godiva quadricolor, shown with its eggs in Photo 126. 

The head almost always bears rhinophores. The shell is absent, except in the larvae. 

Acochlidiacea is the name for an obscure group of sand-dwelling opisthobranchs that includes 

the genus Acochlidium. Because these animals have not been studied from the point of view of 

chemical defense we need only mention them. 

The last two orders are called “pteropods” on the basis of the wing-like projections of the foot, 

with which they swim about in the plankton. They were long considered a polyphyletic group, but 

an increasing amount of evidence seems to indicate that they are a monophyletic assemblage closely 

related to Anaspidea (see p. 240). 

Thecosomata, the thecosomes, or thecosomatous pteropods, usually have their bodies protected 

by a shell or some other firm covering. They are herbivores that feed on phytoplankton by means 

of mucous nets. Chemical defense has not yet been recorded from this group. 

Gymnosomata, the gymnosomes, or gymnosomatous pteropods, have naked bodies; in other 

words they have no shell as adults. They are carnivores, often feeding on thecosomes. Chemical 

defense is known in only one species. 

Students of opisthobranch phylogenetics have had to deal with a situation in which snails have 

repeatedly evolved into slugs. In some cases, it has been a fairly straightforward task to show, for 

example, that the resemblances between nudibranchs and shell-less sacoglossans are superficial 

(Russell, 1929). Efforts to arrange opisthobranchs into series of grades, from primitive to advanced 

(Boettger, 1954), have always failed. However, subsequent efforts to infer branching sequences 

have suffered somewhat from the use of characters that are apt to evolve repeatedly in separate lineages, 

and from using only a very limited sample of the available evidence. The morphological 

trees recently published by Mikkelsen (1996, 2002) and others do not give a consistent picture of 

the relationships, and the molecular trees (Wägele, Vonnemann & Wägele 2003; Vonnemann, 

Schrödl, Klussmann-Kolb & Wägele, 2005) leave some of the more interesting relationships undetermined. 

An effort to use sequences of histone H3 genes to determine deeper relationships within 

the Euthyneura gave disappointing results (Dinapoli, Tamer, Franssen, Waduvilozhath & 

Klussmann-Kolb, 2007). Exact branching sequences are notoriously difficult to obtain. Some 

groups, such as the pleurobranch genus Tylodina, move all over the place, depending on which 

lines of evidence are utilized. Nonetheless, many relationships are well enough supported by these 

studies that we can utilize them for our purposes. Research based on a larger and more diverse data 

base will probably give much better trees than those that have been produced by formal cladistic


analyses thus far. For part of the tree we already have that. Meanwhile it will be necessary to make 

do with the best available evidence. 

Whatever the evidence that is used, it is obvious that Cephalaspidea in the traditional sense 

(Cephalaspidea sensu lato) is a paraphyletic grade, from which several of the other orders have 

evolved. The problem then becomes one of associating the various cephalaspidean lineages with 

the derived orders, and with one another. There is good evidence for treating some of the orders as 

sister groups. One of these is Notaspidea + Nudibranchia. This group was called “Acoela” by 

Thiele (1931); more recent authors have introduced various synonyms. The morphological evidence 

is reasonably consistent with the molecular trees. To that may be added the chromosome 

numbers. The pleurobranch Tylodina, as mentioned above, is problematic in the extreme. Its chromosome 

number is unknown. Beyond the naturalness of Acoela, however, we cannot say very 

much. It does not show a clear relationship to any other lineage of opisthobranchs. It may be the 

first lineage of opisthobranchs to have branched off after the separation of the pulmonates. That 

does not matter very much for the present analysis however. Another clade that may be recognized 

consists of Anaspidea + Sacoglossa. It is reasonably consistent with the published molecular and 

morphological trees, and additional evidence, often overlooked, supports it as well. We will discuss 

that in the appropriate place (pp. 228-229). 

Diversification within the Opisthobranchia has been marked by the evolution of more specialized 

herbivores on the one hand and shifts to various kinds of animals as food on the other. That 

same pattern may be observed within the Cephalaspidea. In many cephalaspideans there are welldeveloped 

gizzard plates used in processing the food, but others have little more than a cuticle in 

the same location. Therefore it does not seem likely that there were well-developed gizzard plates 

in the ancestral opisthobranch or the ancestral cephalaspidean. With shifts to a soft diet, the plates 

often become lost, so that their absence is not necessarily the original condition. 

Turning now to cephalaspidean relationships, it is much easier to establish a few groups of 

close relatives on the basis of derived characters than it is to relate those groups to one another. 

Traditional classifications generally list a series of families, with familial rank being largely a 

euphemism for uncertainty as to relationship. We will put these together in three groups, the relationships 

among which are problematic. 

To begin, we have four families that are related to Acteon: Acteonidae, Bullinidae, Hydatinidae 

and Ringiculidae. Leaving the last of these out of consideration, three main points need to be 

stressed. First, although Acteon is not the living fossil it is sometimes considered, in most phylogenetic 

analyses it comes out in a basal position and often is associated with other clades. Second, 

Acteon shares derived characters of the reproductive system with Hydatina (Hydatinidae) and its 

relatives. And third, the Acteonidae and Hydatinidae are no longer herbivorous, but have switched 

to feeding upon annelids, which are soft-bodied worms. Therefore gizzard plates would be of no 

advantage to these animals, and given the switch in diet the absence of such plates could be secondary. 

On the basis of reproductive anatomy Ghiselin (1966b) suggested a possible relationship 

between the Acteonidae and Hydatinidae on the one hand and the Notaspidea and Nudibranchia on 

the other. This relationship has been supported by molecular (rRNA) evidence (Vonnemann, 

Schrödl, Klussmann-Kolb & Wägele, 2005). This puts two groups lacking a gizzard together and 

it may be a primitive trait. The Ringiculidae, with the genus Ringicula, are of uncertain relationships 

and have not yet been studied from the point of view of chemical defense. They do, however, 

have repugnatorial glands on the cephalic shield. The presence in this genus of a (primitive) 

monaulic (undivided) reproductive system implies that they are the sister group of the rest 

(Gosliner, 1981). On the basis of new results, Malaquias, Mackenzie-Dobbs, Gosliner and Reid 

(2009) have advocated recognizing a separate taxon for this lineage, and placing most of the other



cephalaspideans in Cephalaspidea sensu strictu. 

Next, there are several families that (evidently) retain the herbivorous diet: Bullidae, 

Haminoeidae, and Runcinidae, and perhaps Diaphanidae and Notodiaphanidae (which are not 

closely related to each other) as well. Gizzard plates are present in the Bullidae, Haminoeidae and 

Runcinidae, and the latter two families can be united by the structure and manner of functioning of 

the gizzard plates, which rock against each other from anterior to posterior and shred the algae or, 

in the case of a small group within Haminoea, cyanobacteria, upon which the animals feed. The 

resemblance is highly detailed, not, as Mikkelsen (2002:98) says, superficial, although there are 

four plates, not three. Such characters as the presence of a seminal bulb that forms spermatophores 

are possible synapomorphies connecting them with Cephalaspidea sensu strictu However, molecular 

studies seem to indicate that the family Runcinidae, although monophyletic, is not closely 

related to other cephalaspideans (Malaquias, Mackenzie-Dobbs, Gosliner & Reid, 2009). The trouble 

is that these studies do not indicate the relationship of Runcinidae to any other lineage. In the 

Bullidae the plates are less elaborate and crush rather than shred the food, as do those of other 

groups to be discussed later. This herbivorous assemblage is probably a paraphyletic grade rather 

than a single lineage. However, it does contain some well-supported monophyletic groups, most 

notably one consisting of Atys, Haminoea, Phaneropthalmus, and Smaragdinella (see Malaquias, 

Mackenzie-Dobbs, Gosliner & Reid, 2009), for which we have a considerable amount of data on 

chemical defense. 

And finally, there are several families of carnivorous opisthobranchs in which there are gizzard 

plates, or in which there is good reason to believe that such plates have been lost: Retusidae, 

Scaphandridae, Philinidae, Aglajidae, Gastropteridae and Philinoglossidae. These plates are usually 

three in number, not counting any accessory ones that may be present. They are used in crushing 

shelled prey, such as mollusks and even foraminiferans. The plates squeeze together due to the 

action of muscles, and in the most extremely developed forms they act rather like a nutcracker. 

Shells are well developed in some members of the group but these tend to become much reduced. 

When there has been a shift towards eating somewhat more motile prey items that are not well 

defended by shells, such as opisthobranchs, the gizzard and shell both become reduced. It seems 

likely that this is a polyphyletic assemblage, reflecting a shift to carnivory. But there is good evidence 

for a monophyletic group that consists of Philine, Navanax, Aglaja, and related genera. 

Again, there are data on chemical defense for this assemblage. 

The following tree corresponds to the best estimate we can give at this time of the relationships 

among the cephalaspideans with chemical defense: 

┌ Acteonidae 

─┤ 

│ ┌ Cylichnidae 

│┌┤ Philinoidea 

││└ Aglajidae 

└┤┌ Bullidae 

└┤┌ Haminoeidae 

└┤ 

└ Smaragdinellidae 

The Acteonidae and allies are treated as the first branch to have diverged from the cephalaspidean 

stock. There is evidence that these are the closest relatives of nudibranchs and notaspideans. 

A second lineage of cephalaspideans, herbivorous and without gizzard plates, gave rise to the 

remaining opisthobranchs, including Cephalaspidea sensu strictu, the first branch of which, 

according to Malaquias, Mackenzie-Dobbs, Gosliner and Reid (2009) consists of the genus


Diaphana without gizzard plates and supposedly primitively so. The remaining Cephalaspidea s.s. 

are the herbivorous forms such as Bullidae and Haminoeidae, together with carnivorous lineages 

derived from herbivores, primitively with gizzard plates. No other orders derived from this assemblage. 

CHAPTER VI 

CEPHALASPIDEA 

We are now in a position to discuss the evolution of chemical defense within the (paraphyletic) 

assemblage Cephalaspidea sensu lato, or, in other words, Architectibranchia and Cephalaspidea 

sensu strictu. Details of the classification of other orders will be provided later. Given the common 

ancestry of pulmonates and opisthobranchs it seems clear that the ancestral cephalaspidean was 

herbivorous and also that it already possessed some kind of chemical defense. On the other hand, 

exactly what it fed on, what metabolites it might have derived from that source, and whether it used 

polypropionates or something else are questions that we cannot answer at this time. 

Acteon and its allies have been little studied from the point of view of chemical defense. The 

group as a whole appears to consist of animals that feed upon annelids, some of which are toxic. 

Acteon has a well developed shell, as do its close relatives such as the Oregonian Rictaxis punctocaelatus, 

shown in Photo 2. However, in the tropical genera Hydatina and Micromelo, shown in 

Photos 3 and 4, the shell is fragile, considerably reduced, and colorful. Polypropionates 

(Micromelones A and B) (Atlas 152, 153) that may have a defensive function have lately been 

described from Micromelo undata (Napolitano, Souto, Fernández & Norte, 2008). Such noncontiguous 

polypropionates are most unusual, although some have been found in Notaspidea (see 

Chapter IX). 

Chemical defense is widespread in the herbivorous group that includes Bulla, Haminoea, and 

Smaragdinella. Bulla itself is a generalist herbivore with a relatively primitive gizzard. 

Polypropionates that resemble those of pulmonates have been found in two species of this genus. 

The Mediterranean Bulla striata (Photo 9) produces a series of polypropionates called aglajnes 

(Atlas 114-116). These metabolites were first detected in a cephalaspidean of the family Aglajidae, 

Philinopsis depicta (formerly Aglaja)(Photo 12) (Cimino, Sodano & Spinella, 1987), which feeds 

upon Bulla and uses the polypropionates defensively. The polypropionates are located in a series 

of white glands along the margin of the mantle (Marin, Alvarez, Cimino & Spinella, 1999). The 

Californian Bulla gouldiana contains a similar series of polypropionates that get transferred to 

another cephalaspidean of the family Aglajidae, Navanax inermis (Photo 13). Spinella, Alvarez 

and Cimino (1993) did bioassays of niuhinone-B (Atlas 113), isopulo’upone (Atlas 70) and 5,6dehydroaglajne-3 

(Atlas 117). The first of these compounds was not toxic to mosquito fish, but it 

was toxic to brine shrimp. The latter two were very toxic to both mosquito fish and brine shrimp. 

The family Haminoeidae contains a large number of species of small animals with delicate and 

often transparent shells. A wealth of secondary chemicals have been described from them, but 

many forms have not yet been investigated. From Haminoea cymbalum (Photo 8), Poiner, Paul, 

and Scheuer (1989) recovered a halogenated polyacetate, kumepaloxane (Atlas 204). This metabolite, 

which is exuded in mucus when the animal is molested, deters feeding by fish. It is unusual, 

but related metabolites have been found in the red alga Laurencia and in a sponge, Haliclona 

(Demospongiae: Haplosclerida: Haplosclerina: Chalinidae) (Atlas 205) (Capon, Ghisalberti & 

Jefferies, 1982). The same compound was later found in Haminoea cymbalum from India (Fontana, 

Ciavatta, D’Souza, Mollo, Naik, Paarameswaran, Wahidula & Cimino, 2001) and in the



Mediterranean Haminoea cyanomarginata (Photo 7) (Carbone, 2007; Mollo, Gavagnin, Carbone, 

Castelluccio, Pozone, Roussis, Templado, Ghiselin & Cimino, 2008). Such a compound, which is 

biogenetically related to a typical Laurencia sesquiterpenoid, obtusenal, is very unusual in sponges 

(Capon, Ghisalberti & Jefferies, 1982). Both of these cephalaspidean species are brightly colored 

and conspicuous, suggesting warning coloration. Haminoea templadoi contains an unusual fatty 

acid, 10,15-eicosadienoic acid (Atlas 2) (Carballeira, Anastacio, Salvà & Ortega, 1992). It has not 

been implicated in chemical defense. 

A series of 3-alkylpyridine alkaloids called haminols, such as haminol-A and haminol-B 

(Atlas 79, 80), have been described from several Mediterranean species of Haminoea (Cimino, 

Passeggio, Sodano, Spinella & Villani, 1991). These polyacetate molecules are biosynthesized in a 

unique manner, using nicotinic acid as a starter unit to which acetic acid units are sequentially 

added (Fontana, 2006). That they are biosynthesized by the mollusks has been rigorously proved 

in Haminoea orbignyana (Photo 5) by using precursors labeled with stable isotopes, deuterated 

nicotinic acid (Cutignano, Tramice, De Carlo, Villani, Cimino & Fontana, 2003) and acetate 

labeled at one or both positions with 13C (Cutignano, Cimino, Giordano, d’Ippolito & Fontana, 

2004). 

Haminols have been characterized as “alarm pheromones,” as have similar compounds in 

other cephalaspideans. The animals follow one another’s mucous trails. Haminols in the mucus 

elicit an escape reaction. They are exuded when the cephalaspidean is attacked, but it is thought 

that they do not repel the predator. The haminols appear to be characteristic of each species of 

Haminoea. Specificity depends upon the distribution of the two or three double bonds along the 

chain of the molecule. Alarm pheromones are also known from the prosobranch mud snail 

Nassarius obsoletus (Atema & Stenzler, 1977). 

From the point of view of evolutionary theory it is somewhat problematic why these snails 

would inform their conspecifics that they are alarmed, whether by a predator or something else. 

They are not close relatives and they do not engage in cooperative defense of the group. We have 

considered this matter before. And one wonders why there is so much specificity to the response. 

Why should it make a difference when spreading the alarm, to spread it only to conspecifics? The 

possibility is worth considering, that the secretion has some other function, whether a primary 

function or an auxiliary one. Among these are species recognition and isolating mechanisms. 

In Philinopsis (see below) the pheromones are indeed used in locating mates. Haminols have 

only been found in some species of Haminoea, all of them from the Mediterranean. But similar 

compounds occur in Navanax. Haminoea callidegenita contains a series of alkylphenols (Atlas 81) 

that are similar to navenone-C (Atlas 67) (Spinella, Alvarez & Cimino, 1998; Marin, Alvarez, 

Cimino & Spinella 1999) and are therefore suspected of being alarm pheromones. Haminoea fusari 

contains, in addition to several haminols, fusaripyrones, which have an unusually long, 11-subunit 

chain of propionate units (Atlas 154-157) (Cutigano, Blihoghe, Fontana, Villani, d’Ippolito & 

Cimino, 2007). The starter unit could be propionate and elongated with additional propionate units, 

but acetate chain formation followed by subsequent methylation has not been excluded. 

In the family Smaragdinellidae, Smaragdinella calyculata (Photo 10) contains the 2-alkylpyridine 

naloamine (Atlas 82) and the polypropionate nalodionol (Atlas 118) (Szabo, Nakao, Yoshida 

& Scheuer, 1996). This makes it very much like Bulla. Smaragdinella, which lives high up in the 

intertidal zone, shows a greater degree of shell reduction than does Haminoea. Usually cephalaspideans 

contain either polyacetates or polypropionates, but some contain both. Smaragdinella, like 

Haminoea, is an example of the latter. They are located in different parts of the body and perhaps 

function differently. 

The carnivorous cephalaspideans in which gizzard plates are present or have been secondari-


ly lost are generally placed in the superfamily Philinoidea, which is subdivided into the families 

Cylichnidae and Aglajidae. The former contain the more primitive forms with well-developed 

shells, but often the shell is considerably reduced. The latter have undergone more shell reduction, 

and the gizzard plates are lost. 

Let us consider the Cylichnidae first. In Philine aperta as well as other species in the same 

genus, sulphuric acid from the surface of the body deters predation by fish (Thompson, 1960, 

1986). In Scaphander lignarius, and supposedly in others of its genus, such as Scaphander japonicus 

(Photo 11), there are glands within the mantle cavity comparable to those of other cephalaspideans 

and anaspideans that produce secretions for which defensive functions have been implicated 

(Perrier & Fischer 1908, 1911). Its lignarenones, such as lignarenone-A and lignarenone-B 

(Atlas 71, 72), which are ω-arylmethylketones, have been considered potential alarm pheromones 

(Cimino, Spinella & Sodano, 1989b). More recently a series of metabolites, either with an additional 

carbon or else reduced, have also been detected (Atlas 73-78) (Della Sala, Cutignano, 

Fontana, Spinella, Calabrese, Domenech Coll, d’Ippolito, Della Monica & Cimino, 2007). 

Lignarenones, by analogy with haminols, should be biosynthesized by the mollusk according 

to a polyketide pathway that involves benzoic acid or cinnnammic acid as the starter unit and 

acetate in the elongation step. Recently it has been rigorously proved that lignarenones are biosynthesized 

by the mollusk. Using stable isotopes, clear labeling was detected in the aromatic ring and 

in the alkyl chain (Cutignano, Avila, Domenech-Coll, d’Ippolito, Cimino & Fontana, 2008). In particular, 

benzoic acid is elongated with two units of acetate, one of propionate, and then one of 

acetate, which is intact in lignarenone C (Atlas 73), but loses a carbon in lignarenones A and B 

(Atlas 71, 72). At least these polyketides are very similar in structure to the alarm pheromones of 

Navanax (such as navenone-B) (Atlas 66). 

The family Aglajidae has been extensively studied from a chemical perspective, especially the 

genera Philinopsis and Navanax. As already mentioned, these animals often feed upon other 

opisthobranchs, and obtain metabolites such as polypropionates from them. They also contain 

alarm pheromones. Navenones A, B, and C (Atlas 65-67) were first described from Navanax inermis 

(Photo 13) (Sleeper & Fenical, 1977). They occur in the bright yellow secretion of a specialized 

gland, which has a location that is not optimally positioned for repelling predators. Navanax 

locates both prey and mates by following another animal’s slime trail. When disturbed it secretes 

large quantities of the pheromones into the slime trail, and other individuals react by avoidance 

maneuvers when they contact it. The slugs are cannibalistic, and secretion was not elicited when a 

small animal was attacked by a larger one (Sleeper, Paul & Fenical, 1980). 

In an experimental effort to see if Navanax inermis was the source of the navanones in its own 

body, Fenical, Sleeper, Paul, Stallard and Sun (1979) got some incorporation of sodium acetate 

labeled with 14C, suggesting that the pheromones are produced by the animals themselves. 

However, the experiments designed to test for synthesis did not rigorously exclude the possibility 

of dietary origin of the metabolites. It would seem, therefore, that polypropionates collected in 

Philinopsis and Navanax should derive them by feeding on other cephalaspideans, in particular 

Bulla. Propionates that occur in Bulla gouldiana occur in Navanax inermis (Atlas 113, 117) 

(Spinella, Alvarez & Cimino, 1993). They are assumed to be defensive, but this has not been tested. 

The picture is more complete for the Mediterranean Bulla striata (Photo 9) and the cephalaspideans 

that feed upon it. Recent evidence has shown that B. striata biosynthesizes aglajnes (Atlas 

114-116)) making it a very plausible source for these metabolites (Fontana, Cutignano, Giordano, 

Domenèch Coll & Cimino, 2004). Polypropionates derived from B. striata occur as defensive 

metabolites in Philinopsis depicta (Photo 12) (Cimino, Sodano & Spinella, 1987; Cimino, Sodano,



Spinella & Trivellone, 1985). Naturally the metabolites are quite similar. Philinopsis speciosa from 

Hawaii contains the polypropionate metabolites niuhinone A and B (Atlas 112, 113), as well as a 

pyridine derivative pulo’upone (Atlas 69) (Coval, Schulte, Matsumoto, Roll & Scheuer, 1985; 

Coval & Scheuer, 1985) the source of which is unknown but which may reasonably be assumed to 

be cephalaspideans. An isomer of pulo’upone (Atlas 70) has been found in Bulla gouldiana and 

Navanax inermis (Spinella, Alvarez & Cimino, 1993). 

In Philinopsis speciosa there have also been found a depsipeptide, kulolide-1 (Atlas 633) 

(Reese, Gulavita, Nanda, Nakao, Hamann, Yoshida, Coval & Scheuer, 1996), a linear tetrapeptide, 

pupukeamide (Atlas 634) (Nakao, Yoshida & Scheuer, 1996), additional peptides (Atlas 635) and 

the macrolide tolytoxin-23-acetate (Atlas 662) (Nakao, Yoshida, Szabo, Baker & Scheuer, 1998). 

The structure of these metabolites suggests that they are ultimately derived from cyanobacteria, 

probably via anaspideans and perhaps other opisthobranchs that graze upon them. 

The family Gastropteridae consists of a few species of small animals that, so far as known, 

feed upon sponges. Sagaminopteron psychedelicum and Sagaminopteron nigropunctatum have 

been found to feed upon a sponge that is closely related to Dysidea granulosa (Demospongiae: 

Dictyoceratida: Dysideidae) and to contain defensive metabolites (Becerro, Starmer & Paul, 2006). 

The sponge contains three polybrominated diphenyl ethers, of which one, 3,5-dibromo-2-(2′,4′dibromophenoxy)phenol 

(Atlas 177), is concentrated in the parapodia of the slugs. Sagaminopteron 

psychedelicum (Photo 15) is strikingly aposematic, as is Sagaminopteron ornatum, 

shown in Photo 14. Sagaminopteron nigropunctatum, however, is not aposematically colored. 

Both Anaspidea and Sacoglossa have “primitive” genera in which the shell is relatively well 

developed, and in which there is a head-shield and other “typical” cephalaspidean anatomy. They 

are excellent examples of genera that are transitional between one order and another. This was recognized 

long ago, and it was only the tradition of gradal classification that kept Akera out of 

Anaspidea and Cylindrobulla and others out of Sacoglossa. Both anaspideans and sacoglossans are 

obviously highly modified herbivorous cephalaspideans, but we must remember that herbivory is 

a plesiomorphy so it does not tell us anything about their relationships. The gizzard in Anaspidea 

does not display such specializations as three major plates that are characteristic of the “higher” 

cephalaspideans, and in Sacoglossa its absence could mean either that it has never been present or 

that it has been lost because of the liquid diet. The place to look for a link to cephalaspideans and 

for evidence of a relationship between Anaspidea and Sacoglossa is therefore among such obscure 

little cephalaspideans as Diaphana. 

The molecular evidence published to date is not very encouraging with respect to this problem, 

as is true of many of the “deeper” relationships. This situation is exacerbated because, 

although there is an excellent sample of anaspidean sequence, including the primitive genus Akera, 

data for sacoglossans are sparse, and the shelled forms, and most importantly the most primitive 

among these, are sometimes not included. That makes it very likely that there will be “long branch 

attraction,” which tends to cause a lineage to slip out of place and connect to a distant branch. Data 

on 16S RNA are available for Diaphana minuta (Wägele, Vonnemann & Wägele, 2003: 21 figures 

8.3 and 8.4). This animal appears at the base of a clade made up of the higher cephalaspideans and 

is the sister group of Anaspidea in a parsimony analysis. However, in a distance analysis it is considerably 

more distant, and Anaspidea and Sacoglossa appear as sister groups, the cephalaspideans 

and sacoglossans in effect switching positions. COI (cytochrome oxidase I) sequence studies show 

the cephalaspideans closer to the anaspideans, but the sacoglossans not far distant. The position of 

Sacoglossa is much more distant in other molecular trees, but these are not consistent with one 

another in their position (Dayrat, Tillier, Lecointre & Tillier 2001; Thollesson, 1999). The molecular 

evidence therefore does not provide much support for an anaspidean-sacoglossan relationship,


but it does not provide grounds for rejecting one either. 

As to more traditional evidence processed in a cladistic spirit, it is interesting that Mikkelsen 

(2002) places the anaspideans and higher cephalaspideans together with the nudibranchs and 

notaspideans, with the sacoglossans as the sister group. Gizzard plates are scored as lacking in 

sacoglossans, even though that condition may be secondary. The shell adductor muscles that are 

found in the sacoglossan Cylindrobulla and in the anaspidean Akera are considered to have evolved 

twice, and they are not scored in the shell-less relatives of those two genera in which they have 

been, or may have been, lost. Such character conflicts are the inevitable result of the methodology. 

Of course one can argue that letting the majority of characters determine the results compensates 

for the small number of characters used and the inability to deal with parallel evolution and secondary 

loss. 

Actually the shell adductors are part of an entire suite of characters that, together with others, 

have been used in the past to connect Anaspidea and Sacoglossa with each other and with their possible 

relatives within the Cephalaspidea. The connection between Anaspidea and Diaphana and its 

allies was made on the basis of the shell structure by Thiele (1935) and on the basis of soft-part 

anatomy by Odhner (1939). More recently a close relationship between Sacoglossa and the 

Diaphanidae has been maintained by Jensen (1996a). A proper understanding of the shell and its 

associated musculature depends upon knowing how the whole functional system works. Among 

opisthobranchs in general, the reduction of the shell has been accompanied by an increase in the 

amount of protein and carbohydrate, making it more flexible and less fragile (Poulicek, Voss- 

Foucart & Jeuniaux, 1991). In Akera and the shelled sacoglossan Oxynoe, the protein is rich in 

hydroxyproline, an amino acid that is characteristic of collagen, evidently lending the protein and 

the shell an extra degree of flexibility (Ghiselin, Degens, Spencer & Parker, 1967). The ability of 

the shell to bend is facilitated by an uncalcified, membranous area adjacent to where the rim of the 

shell connects to the main whorls. Contraction of adductor muscles narrows the opening, and in 

some cases has been observed to produce a respiratory current. In anaspideans, such an arrangement 

occurs only in Akera, and understandably, since the shell has been much further reduced in 

all the others. In sacoglossans it occurs in Cylindrobulla, which is thought to be the sister group of 

the rest of them, implying again that it was present in the ancestors of the ones without shells or in 

which the shells have been much reduced. 

The similarity in structure of the shells in Akera and Cylindrobulla is quite striking when they 

are viewed from the apex. However, such a condition is maintained in many shelled sacoglossans, 

such as Ascobulla and, as already mentioned, Oxynoe. In one lineage of shelled sacoglossans, the 

so-called “bivalved gastropods,” the shell has been subdivided, giving an animal that looks very 

much like a clam. The adductors now close the valves by pulling them together. The exact homologies 

of the muscles have not been worked out, but that is irrelevant to the functional and structural 

continuity of the arrangement in Anaspidea and Sacoglossa. The only remaining question has to 

do with the relationship of Diaphana and its relatives to these groups. In fact, the shell of Diaphana 

looks very much like that of Akera, and it is possible that it occupies a position on the branch that 

led to the anaspideans. On the other hand, the best molecular tree that we have for cephalaspideans 

places Diaphana at the base of Cephalaspidea s.s. (Malaquias, Mackenzie-Dodds, Gosliner, 

Bouchet & Reid 2009), and not closely related to either Anaspidea or Cephalaspidea. It is possible 

that the aforementioned anatomical similarities are plesiomorphies, though some might want to 

treat them as convergent. For our discussion of the evolution of chemical defense, all that matters 

is that Sacoglossa and Anaspidea are only distantly related to Cephalaspidea in the strict sense and 

that the common ancestor was probably herbivorous.



CHAPTER VII 

ANASPIDEA AND PTEROPODS 

The Anaspidea, or sea-hares, form a distinct group, the naturalness of which has never been 

contested. They can easily be recognized by the presence of two pairs of rolled rhinophores, which 

are sensory structures derived by modification of the head-shield. Sacoglossans also have rolled 

rhinophores, but only a single pair. The systematics of the order is fairly straightforward and roughly 

approximates the evolutionary relationships. Molecular studies tend to substantiate the system 

that was worked out by traditional systematists (Martinez, 1995; Medina & Walsh, 2000, 2001; 

Medina, Collins & Walsh, 2005; Klussmann-Kolb, 2004). Although the precise relationships are 

not always well resolved, we will present tree diagrams in the text that close enough approximations 

for our purposes, especially since the natural products of many of the species have not been 

studied. Akera, as discussed in the last chapter, forms a nice morphological transition to 

Cephalaspidea. As can be seen from Photo 16, which depicts the animal swimming by means of 

parapodial lobes, the cephalic shield is like that of cephalaspideans and there are no rhinophores. 

Akera feeds upon green algae, but no data on secondary metabolites have been reported in the literature. 

It does produce a purple secretion (Thompson & Seward, 1989). This genus forms the sister 

group of all the rest, which consist of two major lineages, variously classified. 

Here we will follow an old-fashioned arrangement and treat each of these three groups as families 

(Akeridae, Aplysiidae, and Dolabellidae), the first constituting a superfamily Akeroidea and 

the second two the superfamily Aplysioidea. The family Aplysiidae contains a single subfamily, 

Aplysiinae, consisting of the genus Aplysia and the rather aberrant Syphonota. In the Aplysiinae the 

body is relatively high and the parapodia, which are extensions of the foot, provide partial coverage 

for a mantle cavity containing gills and a rudimentary shell. The second lineage is the third 

family, Dolabellidae, subdivided into three subfamilies. 

Akeroidea 

Akeridae 

Akera 

Aplysioidea 

Aplysiidae 

Aplysiinae 

Syphonota 

Aplysia 

Dolabellidae 

Dolabellinae 

Dolabella 

Notarchinae 

Notarchus 

Bursatella 

Stylocheilus 

Dolabriferinae 

Dolabrifera 

Petalifera 

Phyllaplysia 

We will follow this sequence in the text, in which trees are also presented. 

Anaspideans are all herbivorous. With few exceptions they feed upon macroscopic algae, at 

least as adults. Because they feed upon a wide range of algae, anaspideans have been a rich source 

of metabolites of interest to natural products chemists. A great deal is known about their feeding 

biology. Food is ingested by means of a radula aided by jaws, then passed to a crop and gizzard 

where it is triturated by heavy, irregular plates that are strengthened by carbohydrates but not calcified. 

Subsequently the food is moved to the digestive glands where it is absorbed. Secondary 

metabolites from the food are dealt with in the digestive gland, where they and their breakdown 

products may occur in high concentrations. Older work on the biology of anaspideans, including 

their feeding and metabolites, was admirably reviewed by Carefoot (1987). However, many of the


metabolites have little relevance to the basic theme of this monograph, which is chemical defense. 

Therefore we focus mainly on the more recent literature, and do not provide as detailed coverage 

as we have for other groups. 

The toxicity of anaspideans was known in classical antiquity (Caprotti, 1977). According to 

Pliny the Elder, the Romans used them for inducing abortions. The Lepus Marinus is listed among 

poisonous animals by the seventeenth-century Jesuit polymath Athanasius Kircher (1665, vol. 1, p. 

144). Sakamoto, Nakajima, Misawa, Ishikawa, Itoh, Nakashima, Okanoue, Kashima and Tsuji 

(1998) discussed a case of acute liver damage in a patient who had ingested Aplysia kurodai. This 

case is unusual, but by no means unique (Sorokin, 1988). Sea-hare flesh is not commonly eaten by 

human beings, and that it is not palatable should be obvious from its smell. Mazzarelli (1893:48) 

cites Rang for Dolabella being eaten by humans at Tubai, in the Society Islands. According to a 

personal communication from Michael Hadfield and Marilyn Switzer-Dunlap to Pennings and Paul 

(1993), the natives of some Pacific islands do eat them, but only after removing the viscera. 

Kamiya, Sakai and Jimbo (2006:216) remark that in Japan “people on Okinoshima Island eat 

cooked local species of Aplysia as a delicacy after removing the viscera and washing the body surface 

with common salt.” These authors also review poisoning due to the ingestion of sea-hare eggs, 

which have been used in traditional medicine. 

Various non-human animals can and do eat sea-hares, but they avoid the parts in which secondary 

metabolites are concentrated. Winkler and Tilton (1962) discuss the sea anemone 

Anthopleura xanthogrammica preying on Aplysia californica. Mazzarelli (1893) reported feeding 

by Dromia and other brachyuran crabs on Aplysia and their eggs, but said that these were the only 

predators of Aplysia known to him. Pennings (1990a) fed Aplysia californica on Ulva (without 

metabolites) and Plocamium (with metabolites) to fish. He found that those fed with Plocamium 

had more of an emetic effect than those fed on Ulva, yet the fish still rejected those fed on Ulva. 

Pennings, Nastich, and Paul (2001) tried raising Stylocheilus on diets with and without metabolites 

and then feeding them to fish: there was little evidence of deterrence, and which fish ate the slugs 

seemed to depend upon the species of fish. On the other hand there are experiments conducted by 

Eisner (reported in Kinnel, Dieter, Meinwald, Van Engen, Clardy, Eisner, Stallard & Fenical, 1979) 

on Aplysia brasiliana. Sharks, which ignored the slugs that were offered as food, were tricked by 

sandwiching chunks of slug between fish fillets. The sharks spat out the slug meat. However, they 

did eat the buccal mass, an internal organ in which one might well expect defensive metabolites to 

be absent. 

In addition to metabolites in the digestive gland, reproductive system and skin of anaspideans, 

there are also some secretions from glands located in the mantle cavity near the gill that have long 

been implicated in defense. These secretions include the purple material that the animal often 

exudes when disturbed, as is commonly observed by even casual visitors to the shore. The evolutionary 

history of the glands that produce these secretions has been extensively discussed in the scientific 

literature. In prosobranchs there is an organ called the “hypobranchial gland,” which helps 

to keep the gill free of sediment. It is also implicated in producing the halogenated alkaloids that 

occur in some prosobranchs (Baker, 1974; Benkendorff, Bremer & Davis, 2000). According to an 

excellent review by Hoffmann (1932-1940), a hypobranchial gland is present in some cephalaspideans, 

including Acteon and Scaphander. It also is said to occur in anaspideans and sacoglossans 

that retain a well developed shell, and likewise in Thecosomata (Wägele, Ballesteros & Avila, 

2006). The mantle cavity opened out when the shell became reduced, and water could now flow 

over the gill and cleanse it without the need of the secretions of the hypobranchial gland. New 

glands then arose from the epithelium of the mantle, becoming larger and more localized, and 

undergoing a division of labor. There are two kinds of secretion, one opaline or whitish, the other



usually purple. The former is produced by the opaline gland (gland of Bohadsch), which is generally 

considered unique to the Anaspidea (Nolen & Johnson, 2001). Ghiselin (1963), following earlier 

authors, referred to a problematic organ in the cephalaspidean Runcina (=Metaruncina) setoensis 

as an opaline gland, as did Baba (1967). This homology is dubious. The gland produces a 

whitish secretion, but it does not appear to be used defensively. The glands of Blochmann in cephalaspideans 

do not produce ink, but they do produce certain other secretions, and are sometimes considered 

homologous to the ink glands of anaspideans. The opaline glands are perhaps a locally differentiated 

derivative of Blochmann’s glands. 

Both secretions are thought to be defensive, but they function in somewhat different ways and 

have different chemical properties. The opaline secretion provides for defense from crabs 

(Mazzarelli (1893). Kamiya, Muramoto, Goto, Sasakai, Endo and Yamazaki (1989) extracted a 

thermolabile protein from the opaline gland secretion of Aplysia juliana. It was toxic to crabs but 

showed no antibacterial activity. The purple secretion is likewise defensive. Although this secretion 

is not purple in Aplysia juliana, Kamiya, Muramoto, Goto, Sakai, Endo and Yamazaki (1989) 

found that it was likewise toxic to crabs and had strong antibacterial activity as well. Yamazaki, 

Tansho, Kisugi, Muramoto and Kamiya (1989) isolated a cytolytic protein from the purple secretion 

of Dolabella auricularia. Kicklighter, Shabani, Johnson and Derby (2005) studied the interactions 

between Aplysia californica and a spiny lobster that preys upon it, Panulirus interruptus. 

These authors point out that chemical defense mechanisms may function in ways that would not be 

revealed by experiments that merely test the reactions of predators to the chemicals. Of course if 

the assay organism is a fish rather than a crustacean, negative results might be misleading. The 

secretions have various effects on the lobster, stimulating appetitive and feeding behavior and also 

evoking escape responses and grooming. The opaline gland also contains a chemical deterrent that 

suppresses feeding. The lobster is deceived into attending to a false food stimulus, and the sensory 

mechanisms involved in feeding are disrupted. The inking response has been compared to that 

of cephalopods, which, however, is directed against visual predators. Instead of looking like food, 

the anaspidean secretions taste and smell like food (Derby, 2007). L-amino acid oxidases such as 

escapin are enzymes that oxidatively deaminate l-amino acids, rapidly releasing a variety of active 

compounds, including hydrogen peroxide, ammonium ions, α-keto acids, and carboxylic acids. Llysine 

is oxidized by escapin to various products (Kamiya, Sakai & Jimbo, 2006). The enzyme is 

present in the ink gland, whereas its substrate is concentrated in the opaline gland. The reactions 

occur when the two are released together and mixed, giving products that suppress feeding by crustaceans 

(Derby, 2007). 

Since anaspideans of the genus Aplysia are abundant and readily obtained, and since they are 

also familiar as classical materials for neurophysiological and behavioral research (Kandel, 1979), 

it is hardly surprising that much of the early work on defensive metabolites was done on them. On 

top of that, a wide variety of metabolites turned up, giving rise to an extensive literature. These 

metabolites are generally derived from food, but their names are often based on the opisthobranchs 

in which they were found. The food items are almost always algae or cyanobacteria, and the algae 

include representatives of the three major groups (Chlorophyta, Rhodophyta and Phaeophyta). 

Green algae, which may be the ancestral food in Anaspidea, are often eaten, but they seem not to 

be an important source of metabolites in this group. At least they are often said to be the diet of 

sea-hares that lack dietary defensive metabolites, such as Aplysia juliana according to Pennings 

and Carefoot (1995). Brown algae are commonly eaten as well. But it is from the red algae that 

much of the dietary secondary metabolites are derived. Often they come from the genus Laurencia, 

for which Eriksen (1983) has written an excellent, if now somewhat dated, review. Plocamium is 

also an important source.


Aplysia, like some other anaspideans, owes much of its ecological success to its ability to feed 

upon a wide variety of toxic seaweeds, and to deal with the secondary metabolites therein contained. 

It is particularly adept at dealing with halogenated terpenoids. The wide variety of seaweeds 

that it consumes is reflected in the diversity of metabolites that can be recovered from animals of 

a single species. Natural products chemists have created a long list of these, partly by sacrificing a 

large number of animals, with somewhat unfortunate consequences for conservation (Wessels, 

König & Wright, 2000). Aplysia is considered a generalist herbivore, though of course there are the 

usual differences among the species in what they eat. However, there is a noteworthy shift from 

specialization to generalization as the animals get older (Pennings, 1990a, 1990b). In the 

Mediterranean, as shown by their metabolites, Aplysia fasciata feeds upon red algae whereas 

Aplysia depilans feeds upon brown algae. 

Most of the metabolites from Aplysia have been obtained from the digestive gland, which is 

where detoxification occurs, and the same is true of other anaspidean genera. As mentioned earlier, 

this is not the optimal location for them from the point of view of chemical defense. That point 

has been largely responsible for some biologists downplaying the importance of chemical defense 

(Pennings, 1994). However, some metabolites do make their way from the gut to places where they 

are apt to be much more effective. Miyamoto, Higuchi, Marubayashi and Komori (1988) obtained 

two polyhalogenated monoterpenes in the body wall of Aplysia kurodai, together with some unusual 

degraded sterols (Atlas 561, 562). Surprisingly, closely related steroids were also found in 

exposed portions of the body in both Mediterranean (Atlas 563, 564) (Spinella, Gavagnin, 

Crispino, Cimino, Martinez, Ortea & Sodano, 1992) and Atlantic (Atlas 565) (Ortega, Zubia & 

Salvà, 1997) specimens of Aplysia fasciata. 

Recently Gavagnin, Carbone, Nappo, Mollo, Roussis, and Cimino (2005) isolated two closely 

related degraded sterols (Atlas 566, 567) from the skin of Syphonota geographica (also known 

as Aplysia geographica) (Photo 23). Likewise aplyolides A-E (Atlas 44-48), which are lactonized 

dihydroxy fatty acids, were detected in the integument of Aplysia depilans (Spinella, Zubia, 

Martînez, Ortea & Cimino, 1997). There is some evidence that these metabolites, which are known 

to be toxic to fish, are synthesized de novo. Notably, Siphonota geographica feeds upon a marine 

grass, whereas Aplysia depilans eats algae. There is ample evidence that the skin of anaspideans is 

distasteful (De Nys, Steinberg, Rogers, Charlton & Duncan, 1996) and that metabolites are 

sequestered (Rogers, Steinberg & De Nys, 1995; Rogers, De Nys, Charlton & Steinberg, 2000). 

The egg masses of Aplysia juliana contain unsaturated fatty acids in high enough concentrations to 

prevent the growth of bacteria (Benkendorff, Davis, Rogers & Bremner, 2005). 

The secondary metabolites from Aplysia and Syphonota are known from thirteen of the 

approximately forty species within the family Aplysiidae. Even so, only a few of these species have 

been thoroughly studied. Furthermore, the metabolites are largely derived from the plants upon 

which the animals feed, and only a few of these would seem to play an important role in defense. 

Nonetheless an effort to organize the material phylogenetically seems desirable. We will therefore 

survey the various species using the following tree, which is a fair approximation to the classification 

of Eales (1960) and to the findings of recent research:



┌ Syphonota geographica 

─┤ ┌ Aplysia parvula 

│┌┤ 

└┤└ Aplysia punctata 

│ ┌ Aplysia vaccaria 

│ ┌┤ 

│┌┤└ Aplysia depilans 

└┤└ Aplysia juliana 

│┌ Aplysia fasciata 

└┤┌ Aplysia californica 

└┤┌ Aplysia kurodai 

└┤ ┌ Aplysia dactylomela 

│┌┤ 

└┤└ Aplysia oculifera 

└ Aplysia brasiliana 

Syphonota is the sister group of Aplysia. We have already mentioned the degraded sterols of 

S. geographica (Gavagnin, Carbone, Nappo, Mollo, Roussis & Cimino, 2005; Carbone, 2007; 

Carbone, Gavagnin, Mollo, Bidello, Roussis & Cimino, 2008). Noteworthy are two new degraded 

sterols, aplykurodinones 1 and 2 (Atlas 566, 567). They occur in the mantle, not the gut. Such 

unusual compounds are known from the mantles of other anaspideans, namely Aplysia fasciata and 

A. kurodai (see below). These species are not closely related, and they occur in widely separated 

geographical areas. Although feeding upon algae is the usual pattern among anaspideans, S. geographica 

has been found to contain large amounts of a sea-grass, Halophila stipulacaea, in its 

stomach. Quite a number of metabolites apparently derived from this vascular plant have been 

recovered from the digestive gland. The main secondary metabolite of both the sea-grass and the 

slug is syphonoside (Atlas 450), a macrocyclic glycoterpenoid (Gavagnin, Carbone, Amodeo, 

Mollo, Vitale, Roussis & Cimino, 2007). 

The first branch of the tree contains two species, Aplysia parvula (shown swimming in Photo 

18), and A. punctata, which form a well-recognized clade. Aplysia parvula, studied in Guam, was 

found to feed preferentially upon the red alga Portieria hornemannii, which contains variable 

amounts of the halogenated monoterpenes apakaochtodene A and B (Atlas 190-191). The slugs, 

which were somewhat deterred from feeding when metabolite concentration was high, nonetheless 

accumulated them and were shown experimentally to be defended from fish predation (Ginsburg 

& Paul, 2001). A. parvula has been found to contain, in its digestive gland, aplyparvunin (Atlas 

38), a brominated acetogenin that is a dicyclic ether (Miyamoto, Ebisawa & Higuchi, 1995). It also 

contains a halogenated cyclic acetogenin, (3Z)-bromofucin (Atlas 28) (MacPhail & Davies- 

Coleman, 2005). Specimens studied in New Zealand were found feeding on the red alga 

Plocamium costatum (, Appleton & Copp, 2005). The main metabolite in the alga, a brominated 

and chlorinated terpenoid called costatone (Atlas 202), was found to be fourteen times as concentrated 

in the slug, almost all of it in the digestive gland. Although the metabolite evidently is not 

optimally positioned for defense, large fish that ingested the slugs rapidly rejected them. 

The closely related Aplysia punctata is likewise noteworthy for halogenated monoterpenes. A 

series of seven of these were described by Quiñoa, Castedo and Riguera (1989) and several more 

(Atlas 194-199) by Ortega, Zubía, and Salvà (1997). They were recovered from the animals’ defensive 

secretion and seem to be derived from the red alga Plocamium coccineum. There are also epidioxy 

sterols (Jiménez, Quiñoa, Castadeo & Riguera, 1986). 

Aplysia juliana, A. vaccaria, and A. depilans have been placed in the same subgenus together 

with some species the secondary metabolites of which are as yet unknown.


Aplysia juliana was found under certain circumstances to feed only on the green alga Ulva and 

to contain no metabolites (Rogers, Steinberg & De Nys, 1995). Kobayashi, Kanda and Kamiya 

(1991) briefly noted two pyropheophorbides from the viscera of this species. A halogenated diterpenoid 

lactone, angasiol acetate (Atlas 372), has also been recorded from this species (Atta-ur- 

Rahman, Alvi, Abbas, Sultana, Choudhary & Clardy, 1991). 

Aplysia vaccaria was found to contain non-halogenated diterpenoids called crenulides in its 

digestive gland (Midland, Wing & Sims, 1983), typical of the brown alga Dictyota crenulata. One 

of these, acetoxycrenulide (Atlas 371), is highly toxic to fish (Sun, McEnroe & Fenical, 1983). 

Aplysia depilans has a larger number of known metabolites than do the above species, perhaps 

because it has been more intensively studied. On the other hand it has not been a particularly rich 

source of them, and this may have something to do with the animals’ diet. We have detected 

metabolites from brown algae in this species. Quiñoa, Castedo, and Riguera (1989) found no halogenated 

compounds in this species. They found only green algae in the specimens of A. depilans 

that they studied. Aplysia depilans does, however, contain non-halogenated diterpenes, such as dictyol-A 

(Atlas 370), one of a series of perhydroazulene diterpenes so named because they occur in 

brown algae of the family Dictyotaceae (Minale & Riccio, 1976). A depilans has also been a source 

of steroids (Lupo di Prisco & Dessi Fulgheri, 1973; Voogt & Van Rheenen, 1973). Jiménez, 

Quiñoa, Castedo and Riguera (1986) record peroxy sterols from this species as well as from A. 

punctata (noted above). 

Aplysia fasciata is noteworthy for having a variety of ichthyotoxic degraded sterols. These 

include 4-acetylaplykurodin-B (Atlas 563) and aplykurodinone B (Atlas 654) (Spinella, Gavagnin, 

Crispino, Cimino, Martinez, Ortea & Sodano, 1992), the defensive importance of which has 

already been discussed above, and a C-3 epimer of the latter compound, 3-epi-aplykurodinone B 

(Atlas 565) (Ortega, Zubía & Salvà, 1997). Halogenated monoterpenes have also been found in 

this species (identified as Aplysia limacina) (Imperato, Minale & Riccio, 1977). In the 

Mediterranean these animals have been found to feed upon red algae. 

Aplysia californica undergoes metamorphosis on various red algae, including Rhodomenia 

californica, Agardhiella subulata, Laurencia pacifica, Corallinia officinalis, Plocamium cartilagineum, 

and Gracilliaria sp. (Pawlik, 1989; Nadeau, Paige, Starczak, Capo, Lafler & Bidwell, 

1999). Although red algae are more effective in inducing metamorphosis, brown algae 

(Dictyopteris undulata, Pachydiction coriaceum) and even green algae (Ulva) have been shown to 

work too. The animals have been found to contain halogenated monoterpenes derived from red 

algae of the genus Plocamium, upon which these animals feed. The first of these to be isolated was 

(3R,4S,7S)-trans,trans-3,7-dimethyl-1,8,8-tribromo-3,4,7-trichloro-1,5-octadiene (Atlas 188) 

(Faulkner, Stallard, Fayos & Clardy, 1973). Another was 7-chloro-3,7-dimethyl-1,4,6-tribromo-1octen-3-ol 

(Atlas 189) (Faulkner & Stallard, 1973). Subsequent investigations turned up quite a 

number of halogenated terpenoids from the digestive glands of A. californica, some of which could 

not be found in the local algae which were sampled as plausible sources (Stallard & Faulkner, 

1974; Ireland, Stallard, Faulkner, Finer & Clardy, 1976). Some of the compounds were found to 

have been transformed within the digestive glands (Stallard & Faulkner, 1974). 

Aplysia kurodai has received considerable attention from Japanese investigators, no doubt in 

part because of its availability. It was found to contain three cytotoxic polyketide macrolides, aplyronine 

A, aplyronine B and aplyronine C (Atlas 663-665) (Yamada, Ojika, Ishigaki & Yoshida, 

1993). Halogenated monoterpenes have been recovered from the digestive gland (Ksumi, Uchida, 

Inouye, Ishitsuka, Yamamoto & Kakisawa, 1987). Two halogenated monoterpenes have been isolated 

from parts of the body where they are likely to function in chemical defense (Miyamoto, 

Higuchi, Marubayashi & Komori, 1988; Inouye, Uchida, Kusumi & Kakisawa, 1987). These are a



cyclic molecule, aplysiaterpenoid-A (Atlas 192) and a linear one, aplysiaterpenoid B (Atlas 193). 

Another halogenated monoterpene from A. kurodai is kurodainol (Katayama, Ina, Nozki & 

Nakamura, 1982). The halogenated diterpenes, aplysin-20 (Atlas 364) (Yamamura & Hirata, 1963, 

1971) and isoaplysin-20 (Yamamura & Terada, 1977) have also been recorded from this species. 

Another is the brominated diterpenoid aplysiadiol (Atlas 365) (Okija, Yoshida, Okumura & Ieda 

1991). There are also some degraded sterols, aplykurodin A and B (Atlas 561, 562) (Miyamoto, 

Higuchi, Komori, Fujioka & Mihashi, 1996). A. kurodai has also been the source of several new 

alkaloids. The phenolic alkaloids aplaminone, neoaplaminone, and neoaplaminone sulphate (Atlas 

166-168) are said to be cytotoxic but their locality in the animal was not specified by the authors 

(Kigoshi, Imamura, Yoshikawa & Yamada, 1990). Aplydilactone (Atlas 43) is a dieicosanoid lactone 

(Okija, Yoshida, Nakayama & Yamada, 1990). Aplysepin (Atlas 620), a 1,4-benzodiasepine 

alkaloid, was recovered from whole body extracts (Ojika, Yoshida & Yamada, 1993). 

Aplysia brasiliana, the repugnancy of which to sharks has been discussed above, contains the 

acetylenic chloroether brasilenyne (Atlas 26) and another haloether, cis-dihydrophytin (Atlas 27) 

(Kinnel, Dieter, Meinwald, Ven Engen, Clardy, Eisner, Stallard & Fenical, 1979). Also distasteful 

to sharks is panacene, an aromatic bromoallaene (Kinnel, Duggan, Eisner, & Meinwald, 1977). A. 

brasiliana is the source of two bromosesquiterpenes, brasudol (Atlas 280) and isobrasudol (Atlas 

281) (Dieter, Kinnel, Meinwald & Eisner, 1979). Non-halogenated, rearranged sesquiterpene alcohols 

were also isolated from it (Stallard, Fenical & Kittredge, 1978). They probably were derived 

from the red alga Laurencia. Aurisides (Atlas 55, 56), which are macrocyclic fatty acid lactones, 

also occur in it (Sone, Kogoshi & Tamada, 1996). 

Aplysia oculifera has been found to contain srilankenyne (Atlas 35), an acetylenic C-15-tetrasubstituted 

tetrahydropyran, surmised to be derived from the red alga Laurencia (De Silva, 

Schwartz, Scheuer & Shoolery, 1983). Two brominated, isomeric acetylenes (Atlas 36, 37) have 

also been recorded from the digestive gland (Schulte, Chung & Scheuer, 1981). 

Aplysia dactylomela has been the most prolific source of secondary metabolites in its genus. 

One indication of its being chemically defended is that it is mimicked by a fish (Heck & Weinstein, 

1978). With respect to polyketides evidently derived from red algae, A. dactylomela has proven a 

particularly rich source of cyclic, often acetylenic, ethers. The source is indicated in the name of 

the dibromochloro ether dactylyne (Atlas 25) (McDonald, Campbell, Vanderah, Schmitz, 

Washecheck, Burks & Van Der Helm, 1975). An isomer of this compound, isodactylyne, has also 

been recorded (Vanderah & Schmitz, 1976). A group of these that resemble some algal ethers were 

recovered from the digestive gland (Gopichand, Schmitz, Shelly, Rahman & Van Der Helm, 1981). 

A series of such ethers (Atlas 29-34) have been described by Manzo, Ciavatta, Gavagnin, Puliti, 

Mollo, Guo, Mattia, Mazzarella and Cimino (2005). Three of these proved to be new: (-)- 

3E,6R,7R-pinnatifidenyne, (+)-3E,6R,7R-obtusenyne, and (+)-3Z,6R,7R-obtusenyne. These were 

enantiomers of known compounds. Two previously known ones were also found: (+)-3E-pinnatifidenyne 

(Atlas 33) and (+)-laurenyne (Atlas 34). The former had been found in the red alga 

Laurencia pinnatifida, the latter in L. obtusa. In addition, these authors found (+)-brasilenol (Atlas 

225), which is a sesquiterpene ether known from L. obtusa and Aplysia brasiliana. It was later 

found that Aplysiols A (Atlas 63) and B (Atlas 64) are the main triterpene polyethers in the mantle 

(Manzo, Gavagnin, Bifulco, Cimino, Di Micco, Ciavatta, Guo & Cimino, 2007). These are 

closely similar, but not identical, to metabolites of Laurencia. Other sesquiterpene ethers that have 

been found in Aplysia dactylomela are dactyloxene-B (Atlas 224) (Schmitz & McDonald, 1974; 

Schmitz, McDonald & Vanderah, 1978) and dihydroxydeodactol monoacetate (Schmitz, Michaud 

& Hollenbeak, 1980). Dactylallene (Atlas 39) is a halogenated bicyclic C-15 ether (Ciavatta, 

Gavagnin, Puliti, Cimino, Martínez, Ortea & Mattia, 1997). Aplysia dactylomela, as its probable


synonym A. angasi, was the source for aplysiastatin, a brominated polyether sesquiterpenoid that 

is evidently derived from an alga of the genus Laurencia (Pettit, Herald, Allen, Dreele, Vanell, Kao 

& Blake, 1977). Other halogenated sesquiterpenes have also been recorded (Ichiba & Higa, 1986; 

Kaiser, Pitombo & Pinto, 1998; McPhail, Davies-Coleman, Copeley & Eggleston, 1999). There is 

also a series of brominated diterpenes, such as parguerol (Atlas 367), deoxyparguerol, and isoparguerol 

(Schmitz, Michaud & Schmidt, 1982). Aplysia dactylomela has been found to contain two 

molecules consisting of a diterpenoid part linked to an aromatic ring, stypoldione and (+)-epitaondiol 

(Atlas 171) (Gerwick, Fenical, Van Eagen & Clardy, 1979). These compounds, present in the 

alga Stylopodium upon which the juvenile sea-hares were observed feeding, are concentrated in the 

animals. Another compound, 3-ketoepitaondiol (Atlas 172) was present only in the sea-hares, providing 

evidence for biotransformation. Isolated from the gut of A. dactylomela, and from the alga 

Cladophora fascicularis upon which it was observed feeding, was the biologically active diphenyl 

ether 2-(2′,4′dibromophenoxy)-dibromoanisole (Atlas 173) (Kiniyoshi, Yamada & Higa, 1995). 

The remaining Anaspidea have been classified in the outline above as the family Dolabellidae, 

with three subfamilies: Dolabellinae, Notarchinae and Dolabeliferinae. Dolabellids tend to be 

rather flattened animals, and the parapodia are relatively smaller than they are in Aplysia. The following 

tree better expresses their likely phylogenetic relationships: 

┌ Akera 

─┤┌ Aplysia 

└┤┌ Dolabella 

└┤ ┌ Stylocheilus 

│ ┌┤(Notarchinae) 

│┌┤└ Bursatella 

└┤└ Notarchus 

│┌ Dolabrifera 

└┤┌ Petalifera 

└┤(Dolabriferinae) 

└ Phyllaplysia 

The genus Dolabella itself makes up the first branch. There may be more than two species, but 

the only ones that have been studied from the point of view of ecology and natural products chemistry 

are the Indo-Pacific Dolabella auricularia and the Eastern Pacific D. californica, which may 

be a synonym. Photo 19 shows a specimen of D. auricularia resting on sand. When encountered 

among rocks and on algae they are inconspicuous. The head with its four rhinophores is on the 

right. Toward the left is an opening through which the respiratory current exits. They are tropical 

to subtropical animals, and they feed much like Aplysia on a wide variety of algae. Pennings and 

Paul (1992) treat them as generalized, nocturnal grazers. The metabolites are mainly the sort that 

one might expect to recover from an algivorous opisthobranch, but some of them, including 

polypropionates and proteins, are clearly of endogenous origin (see also Pennings, Paul, Dumbar, 

Hamann, Lumbang, Novack & Jacobs, 1999). 

In the following survey of the metabolites of Dolabella we will not attempt to separate the two 

putative species. Yamada and Kigoshi (1997) have provided an excellent review of the chemicals. 

Among polyketides, the cytotoxic macrolides known from D. aurantica are noteworthy. Aurisides 

A and B (Atlas 55, 56) are both halogenated (Sone, Kigoshi & Yamada, 1996), as are the polyethers 

anrilol and enshuol (Atlas 57, 58) (Suenaga, Shibata, Takada, Kigoshi & Yomada, 1998). 

Dolabelides A and B (Atlas 51, 52) (Ojika, Naagoya & Yamada, 1995) and C and D (Atlas 53, 54) 

(Suenaga, Nagoya, Shibata, Kishogi & Yamada (1997) are not. Doliculols A and B (Atlas 41, 42)



are non-halogenated, acetylenic cyclic ethers (Ojika, Nemoto & Yamada, 1993). Similar cyclic 

ethers, but halogenated ones, are typical of the red algal genus Laurencia and also occur in other 

sea-hares. 

Dolabella is one of the many scattered opisthobranchs in which polypropionates have been 

detected. D. auricularia was the source for very small quantities of the polypropionates known as 

auripyrone-A and auripyrone-B (Atlas 120, 121) (Suenaga, Kigoshi & Yamada, 1996). Supposedly 

these polypropionates are biosynthesized de novo by the slug, for there is no dietary source for 

them in an herbivorous animal. They occur only in the internal organs. They were detected in very 

low levels: 1.0 and 1.7 mg. were recovered from 452 kg. of material. A defensive role for them 

seems most unlikely, but it is anything but obvious what their function might be. They resemble 

propionates isolated from Dolabrifera (see below). 

Turning to terpenoid compounds, diterpenes have been found in Dolabella californica 

(Ireland, Faulkner, Finer & Clardy, 1976; Ireland & Faulkner, 1977, 1977). These were the first 

reports of this skeleton. They are called dolabellanes, and they include dolabelladiene, which is 

similar to 10-acetoxy-18-hydroxy-2,7,-dolabelladiene (Atlas 373). Similar metabolites occur in 

brown algae of the family Dictyotaceae, indicating the dietary source. A similar molecule, dolatriol 

(Atlas 374), occurs in Dolabella auricularia (Pettit, Ode, Harald, Dreele & Michel, 1976). It 

was also found in what has been called Dolabella ecaudata from the Indian Ocean, and therefore 

probably the same species, together with an apparent monoterpenoid compound, (-)-loliolide 

(Atlas 226) (Pettit, Herald, Ode, Brown, Gust & Michel, 1980). It may be a degraded carotenoid 

derived from food. The brominated triterpenoid aurilol, a polyether isolated from D. auricularia 

(Atlas 57), is similar to compounds known from the red alga Laurencia (Suenaga, Shibata, Takada, 

Kigoshi & Yamada, 1998). Aurisides (Atlas 55, 56), which are macrocyclic fatty acid lactones, also 

occur in it (Sone, Kigoshit & Yamada, 1996). 

Dolabella is noteworthy for various linear peptides and cyclic peptides, especially those 

known as dolastatins, for which there is a large literature (reviewed by Pettit, 1997). They were 

found to have anti-tumor activity, and one of them, dolastatin 10 (Atlas 639), has been found effective 

in the treatment of human prostate cancer (Turner, Jackson, Pettit, Wells & Kraft, 1988). On 

the basis of structural analogy it seems likely that these peptides are produced by cyanobacteria that 

are taken up with the algae on which the slugs feed. The cyclic peptide dolastatin 3 was isolated 

from D. auricularia (Pettit, Kamano, Brown, Gust, Inoue & Herald, 1982). A series of dolastatins, 

dolastatins 10 (Atlas 639) to 15 (Atlas 640), have also been described from D. auricularia (Pettit, 

Kamano, Herald, Fujii, Kizu, Boyd, Boettner, Doubek, Schmidt, Chapuis & Michel, 1993). Among 

these, dolastatin 13 is a biologically active depsipeptide from D. auricularia (Pettit, Kamano, 

Herald, Dufresne, Cerny, Herald, Schmidt & Kizu, 1989). Dolastatin 19 (Atlas 61), characterized 

as a new 14-membered macrocyclic lactone linked to a 2-4,di-O-methyl-L-α-rhamnoyroside, 

together with the known macrolides debromoaplysiatoxin and anhydrodebromoaplysiatoxin (see 

below), was isolated from 600 kilograms wet weight of animals from the Gulf of California (Pettit, 

Xu, Doubek, Chapuis & Schmidt, 2004). Dolastatin H and isodolastatin H are cytotoxic peptides 

from D. auricularia (Atlas 644, 645) (Sone, Shibata, Fujita, Ojika & Yamada, 1996). Dolastatin D 

is a cytotoxic cyclic depsipeptide from D. auricularia (Sone, Nemoto, Ishiwata, Ojika & Yamada, 

1993). Dolastatin G and nordolastin G are cyclodepsipetides from D. auricularia (Mutou, Kondo, 

Ojika & Yamada, 1996). Another cytotoxic cyclodepsipeptide from D. auricularia is aurilide 

(Atlas 641) (Suenaga, Mutou, Shibata, Itoh, Kigoshi & Yamada, 1996; Suenaga, Mutou, Shibata, 

Itoh, Fujita, Takada, Hayamizu, Takagi, Irifune, Kigoshi & Yamada, 2004). 

Kisugi, Kamiya and Yamazaki (1989) obtained an antineoplastic glycoprotein from the body 

fluid of Dolabella auricularia. Kisugi, Ohye, Kamiya and Yamazaki (1992) found what they call


Photo Gallery of Animals 

Discussed in Text



1 Cyphoma gibbosum, a prosobranch gastropod that lives and feeds on the gorgonian 

Gorgonia ventalina. Photograph by Ernesto Mollo. 

2 Rictaxis punctocaelatus, a primitive cephalaspidean from California. Photograph by 

Terrence Gosliner. 

3 Hydatina physis, a tropical cephalaspidean. Photograph by Terrence Gosliner. 

4 Micromelo undata, a tropical cephalaspidean. Photograph by Terrence Gosliner. 

5 Haminoea orbignyana, a cephalaspidean of the family Haminoeidae. Photograph by 

Guido Villani. 

6 Haminoea orteai. Photograph by Guido Villani. 

7 Haminoea cyanomarginata. Photograph by Ernesto Mollo. 

8 Haminoea cymbalum. Photograph by Ernesto Mollo.


1 2 

3 4 

5 6 

7 8



9 Bulla striata, with an egg mass. Photograph by Guido Villani. 

10 Smaragdinella calyculata. Photograph by Terrence Gosliner. 

11 Scaphander japonicus. Photograph by Terrence Gosliner. 

12 Philinopsis depicta. Photograph by Guido Villani. 

13 Navanax inermis. Photograph by Terrence Gosliner. 

14 Sagaminopteron ornatum. Photograph by Ernesto Mollo. 

15 Sagaminopteron psychedelicum. Photograph by Terrence Gosliner. 

16 Akera bullata, a primitive anaspidean, swimming. Photograph by Terrence Gosliner.


9 10 

11 12 

13 14 

15 16



17 Aplysia pulmonica. Photograph by Terrence Gosliner. 

18 Aplysia parvula swimming. Photograph by Guido Villani 

19 Dolabella auricularia. Photograph by Ernesto Mollo. 

20 Stylocheilus striatus. Photograph by Terrence Gosliner. 

21 Bursatella leachii. Photograph by Terrence Gosliner. 

22 Dolabrifera dolabrifera. Photograph by Terrence Gosliner. 

23 Syphonota geographica. Photograph by Ernesto Mollo. 

24 Cylindrobulla sp., a primitive sacoglossan. Photograph by Terrence Gosliner.


17 18 

19 20 

21 22 

23 24



25 Ascobulla fragilis (formerly Cylindrobulla fragilis). Photograph by Ernesto Mollo. 

26 Volvatella vigorouxi exuding defensive secretion. Photograph by Ernesto Mollo. 

27 Oxynoe olivacea on Caulerpa prolifera. Photograph by Ernesto Mollo. 

28 Lobiger serradifalci. Photograph by Ernesto Mollo. 

29 Bosellia mimetica, with eggs, on Halimeda. Photograph by Guido Villani. 

30 Elysia timida. Photograph by Guido Villani. 

31 Elysia viridis. Photograph by Guido Villani. 

32 Elysia subornata. Potograph by Ernesto Mollo.


25 26 

27 28 

29 30 

31 32



33 Plakobranchus sp. Photograph by Ernesto Mollo. 

34 Thuridilla hopei. Photograph by Guido Villani. 

35 Thuridilla gracilis. Photograph by Terrence Gosliner. 

36 Costasiella ocellifera. Photograph by Ernesto Mollo. 

37 Placida dendritica. Photograph by Guido Villani. 

38 Ercolania funerea. Photograph by Guido Villani. 

39 Cyerce cristallina. Photograph by Ernesto Mollo. 

40 Calyphilla mediterranea. Photograph by Ernesto Mollo.


33 34 

35 36 

37 38 

39 40



41 Tylodina fungina, a primitive notaspidean. Photograph by Terrence Gosliner. 

42 Umbraculum umbraculum. Photograph by Guido Villani. 

43 Pleurobranchus testudinarius. Photograph by Guido Villani. 

44 Pleurobranchus membranaceus. Photograph by Guido Villani. 

45 Pleurobranchaea meckelii, with eggs. Photograph by Guido Villani. 

46 Hexabranchus sanguineus, a dorid nudibranch, swimming. Photograph by 

Ernesto Mollo. 

47 Polycera elegans on bryozoans. Photograph by Guido Villani. 

48 Tambja capensis. Photograph by Terrence Gosliner.


41 42 

43 44 

45 46 

47 48



49 Tambja morosa. Photograph by Terrence Gosliner. 

50 Tambja eilora. Photograph by Terrence Gosliner. 

51 Roboastra tigris. Photograph by Terrence Gosliner. 

52 Roboastra europaea. Photograph by Guido Villani. 

53 Nembrotha kubaryana. Photograph by Terrence Gosliner. 

54 Aegires gardineri. Photograph by Terrence Gosliner. 

55 Acanthodoris nanaimoensis, two views. Photographs by Terrence Gosliner 

56 Doriopsilla areolata, with eggs. Photograph by Guido Villani.


49 50 

51 52 

53 54 

55 56



57 Doriopsilla pelseneeri. Photograph by Ernesto Mollo. 

58 Dendrodoris limbata. Photograph by Ernesto Mollo. 

59 Chromodoris geometrica (above) and Phyllidiella pustulosa (below). Photograph 

by Ernesto Mollo. 

60 Ovula ovum (above), a prosobranch, mimics Phyllidia carlsonhoffi (below, left) 

and P. pustulosa (below, right). Photograph by Ernesto Mollo. 

61 Phyllidia varricosa. Photograph by Terrence Gosliner. 

62 Phyllidia coelestis. Photograph by Ernesto Mollo. 

63 Phyllidia flava. Photograph by Guido Villani. 

64 Phyllidia ocellata. Photograph by Ernesto Mollo.


57 58 

59 

60 

61 62 

63 64



65 Phyllidella pustulosa. Photograph by Terrence Gosliner. 

66 Reticulidia fungia. Photograph by Terrence Gosliner. 

67 Cadlina pellucida. Photograph by Ernesto Mollo. 

68 Glossodoris cincta. Photograph by Ernesto Mollo. 

69 Glossodoris pallida. Photograph by Ernesto Mollo. 

70 Glossodoris rufomarginata. Photograph by Ernesto Mollo. 

71 Glossodoris averni. Photograph by Ernesto Mollo. 

72 Glossodoris vespa. Photograph by Ernesto Mollo.


65 66 

67 68 

69 70 

71 72



73 Chromodoris quadricolor. Photograph by Ernesto Mollo. 

74 Chromodoris elisabethina. Photograph by Terrence Gosliner. 

75 Chromodoris lochi. Photograph by Terrence Gosliner. 

76 Chromodoris hamiltoni. Photograph by Terrence Gosliner. 

77 Chromodoris luteorosea. Photograph by Ernesto Mollo. 

78 Chromodoris marislae. Photograph by Terrence Gosliner. 

79 Chromodoris geminus. Photograph by Terrence Gosliner. 

80 Chromodoris annulata. Photograph by Terrence Gosliner.


73 74 

75 76 

77 78 

79 80



81 Chromodoris reticulata. Photograph by Ernesto Mollo. 

82 Chromodoris purpurea. Photograph by Ernesto Mollo. 

83 Chromodoris macfarlandi. Photograph by Terrence Gosliner. 

84 Chromodoris norrisi. Photograph by Terrence Gosliner. 

85 Ceratosoma trilobatum. Photograph by Ernesto Mollo. 

86 Ceratosoma gracillimum. Photograph by Ernesto Mollo. 

87 Mexichromis macropus. Photograph by Ernesto Mollo. 

88 Mexichromis porterae. Photograph by Terrence Gosliner.


81 82 

83 

84 

85 86 

87 88



89 Risbecia pulchella. Photograph by Ernesto Mollo. 

90 Risbecia imperialis. Photograph by Terrence Gosliner. 

91 Hypselodoris capensis. Photograph by Terrence Gosliner. 

92 Hypselodoris maridadulus. Photograph by Terrence Gosliner. 

93 Hypselodoris nigrostriata. Photograph by Ernesto Mollo. 

94 Hypselodoris villafranca. Photograph by Guido Villani. 

95 Hypselodoris orsini. Photograph by Guido Villani. 

96 Hypselodoris fontandraui. Photograph by Guido Villani.


89 

90 

91 92 

93 94 

95 96



97 Hypselodoris picta. Photograph by Ernesto Mollo. 

98 Hypseoldoris agassizii. Photograph by Terrence Gosliner. 

99 Hypselodoris californiensis. Photograph by Terrence Gosliner. 

100 Hypselodoris ghiselini. Photograph by Terrence Gosliner. 

101 Aldisa smaragdina. Photograph by Ernesto Mollo. 

102 Doris odhneri. Photograph by Terrence Gosliner. 

103 Doris verrucosa. Photograph by Guido Villani. 

104 Doris montereyensis. Photograph by Terrence Gosliner.


97 

99 

101 

103 

98 

100 

102 

104



105 Doris tanya. Photograph by Terrence Gosliner. 

106 Diaulula sandiegensis. Photograph by Terrence Gosliner. 

107 Jorunna funebris. Photograph by Ernesto Mollo. 

108 Asteronotus caespitosus. Photograph by Terrence Gosliner. 

109 Peltodoris nobilis. Photograph by Terrence Gosliner. 

110 Peltodoris atromaculata. Photograph by Guido Villani. 

111 Halgerda terramtuentsis. Photograph by Terrence Gosliner. 

112 Halgerda willeyi. Photograph by Terrence Gosliner.


105 

107 

109 

111 

106 

108 

110 

112



113 Tochuina tetraquetra. Photograph by Terrence Gosliner. 

114 Tritonia hamnerorum on a sea fan, with egg masses. Photograph by Terrence 

Gosliner. 

115 Tethys fimbria. Photograph by Guido Villani. 

116 Melibe viridis. Photograph by Ernesto Mollo. 

117 Dermatobranchus ornatus. Photograph by Ernesto Mollo. 

118 Leminda millecra. Photograph by Terrence Gosliner. 

119 Janolus cristatus. Photograph by Guido Villani. 

120 Flabellina pedata on a hydroid. Photograph by Ernesto Mollo.


113 

115 

117 

119 

114 

116 

118 

120



121 Flabellina affinis. Photograph by Ernesto Mollo. 

122 Glaucus atlanticus. Photograph by Terrence Gosliner. 

123 Phyllodesmium magnum. Photograph by Ernesto Mollo. 

124 Cratena peregrina. Photograph by Guido Villani. 

125 Flabellina lineata. Photograph by Guido Villani. 

126 Godiva quadricolor. Photograph by Guido Villani. 

127 Phestilla melanobrachia. Photograph by Terrence Gosliner. 

128 Caloria indica. Photograph by Ernesto Mollo.


121 

123 

125 

127 

122 

124 

126 

128



Page intentionally left blank


an antibacterial protein from the albumen gland (part of the reproductive system that deposits nutriment 

around the eggs) of the same species. These of course are produced by the animals themselves. 

Turning to the Notarchinae, there are no data on secondary metabolites in Notarchus itself. 

Stylocheilus striatus (Quoy & Gaimard, 1832) (previously known as S. longicaudus), shown in 

Photo 20, provides an interesting example of an herbivore that has switched from algae to 

cyanobacteria as a source of food and defensive metabolites. This animal, which is widely distributed 

in the Pacific, often occurs in large aggregations. Kato and Scheuer (1974, 1975) described 

two polyethers from it, and gave them the misleading names aplysiatoxin (Atlas 59) and debromoaplysiatoxin 

(Atlas 60). Rose, Scheuer, Springer & Clardy (1978) found these slugs feeding on 

the red alga Acanthophera spiculifera and the cyanobacterium Lyngbya majuscula, and described 

a non-toxic amide from it, stylocheilamide. The structure was revised as being identical to acetyl 

malyngamide (Atlas 605) detected in Lyngbia majuscula by Todd and Gerwick (1995). 

Stylocheilus striatus has been found to contain complex proline esters (Gallimore, Galario, Lacy, 

Zhu & Scheuer, 2000) and various alkaloids (Gallimore & Scheuer, 2000). 

Paul and Pennings (1991) found that Stylocheilus striatus feeds on a cyanobacterium and 

derives secondary metabolites from it, although it does feed on true algae as well. Feeding preference 

experiments indicated that they favor the cyanobacterium and grow better on it. Deterrence 

experiments using fish showed that the wrasse, Thalassoma hardwicki, although somewhat slowed 

down, finally ate it. Pennings and Paul (1993) identified the cyanobacterium as Microcoleus lyngyaceus, 

and observed that the slug sequesters malyngamide A (Atlas 607) and B (Atlas 610), converting 

some of the malyngamide B into the acetate (Atlas 611). They found that malyngamide 

would deter feeding, as would some other metabolites. Further deterrency studies were reported by 

the same group (Pennings & Paul, 1993; Pennings, Pablo, Paul & Duffy, 1994; Pennings, Weiss & 

Paul, 1996; Nagle, Camacho and Paul (1998). The results indicated that earlier studies of deterrency 

were flawed because of the concentrations used. Perhaps their most interesting result was that 

malyngamides and majusculamides acted as feeding attractants at low concentrations and as powerful 

deterrents at high concentrations. There are similar cases in other animals, including opisthobranchs. 

Pennings, Nastich, and Paul (2001) raised Stylocheilus on artificial diets, with and without 

metabolites, and fed them to fish in the wild; they concluded that there was little evidence for 

a protective role. But, as with the skepticism about Aplysia, such negative results are hard to interpret. 

In another study, crude extracts of Lyngbya majuscula were tested against various small predators 

(Capper, Cruz-Rivera, Paul & Tibbetts, 2006). Stylocheilus was stimulated to feed by the 

extracts, whereas others, including the cephalaspidean Diniatys dentifer, were repelled. (See also 

Capper, Tibbetts, O’Neill and Shaw, 2005). 

The other genus in the Notarchinae for which we have data on secondary metabolites is 

Bursatella (B. leachii, Photo 21). It contains a diol nitrile alkaloid called bursatellin (Atlas 619), 

which is structurally related to the antibiotic chloramphenicol (Gopichand & Schmitz, 1980). The 

originally proposed structure has been somewhat revised (Cimino, Gavagnin, Sodano, Spinella, 

Strazzullo, Schmitz & Gopichand, 1987). There are supposedly three subspecies: Bursatella leachii 

plei from Puerto Rico, B. leachii leachii from the Tyrrhenian Sea, and B. leachii savignyana from 

the Adriatic. The mantles of the latter two subspecies were extracted separately (Cimino, Gavagnin, 

Sodano, Spinella, Strazzullo, Schmitz & Gopichand, 1987). It was found that bursatellin occurred 

in the mantle tissues of both subspecies, but only B. leachii savignyana had it in the digestive 

glands. Surprisingly, the two subspecies contained two enantiomers of bursatellin, the + isomer in 

B. leachi leachi and the - form in B. leachii savignyana. 

Specimens of Bursatella leachii from New Zealand reveal that it contains other very unusual



metabolites. It is known to feed on cyanobacteria and to contain their typical metabolites and the 

alkaloids dactylamides A and B (Atlas 601, 602) (Appleton, Sewell, Berridge, & Copp, 2002; , 

Appleton & Copp, 2005). Animals from Thailand were found to contain a chlorinated alkaloid 

(Atlas 594) (Suntornchashwei, Chaichit, Isobe & Suboriux, 2005). Four antitumor substances were 

identified in extracts of an organism from the South China Sea, reported as “Notarchus (Bursatella) 

leachii cirrosus (Stimpson 1855)” (Lin, Zhang, Yi, Shen, Guo & Shao, 2001; Lin, Tang, Liu, 

Zhang, Shen, Hua & Wu, 2002). Two of these are chlorinated monoterpene esters, whereas the others 

are steroids. 

The Dolabriferinae include the genera Petalifera, Phyllaplysia, and Dolabrifera, in which 

there has been a change in diet. These animals graze on diatoms, often those that live epiphytically 

on marine plants such as seaweeds and marine “grasses”. Secondary metabolites have been 

found in only one species of these anaspideans (Ciavatta, Gavagnin, Puliti & Cimino, 1996). 

Dolabrifera dolabrifera, shown in Photo 22, contains the polypropionate dolabriferol (Atlas 119). 

This is a non-contiguous polypropionate, which is most unusual. Such compounds have been found 

only in some pulmonates, Pleurobranchus membranaceus and Micromelo undata. Dolabriferol 

does not occur in the digestive gland, but is limited to the integument. Therefore it seems quite likely 

that, like other propionates in herbivorous opisthobranchs and pulmonates, it is biosynthesized 

de novo, although this has not been confirmed experimentally. It provides a nice example of de 

novo synthesis making an appearance when there has been a change in diet and exogenous defensive 

metabolites are no longer available. This has happened well within the group: Dolabrifera is 

not very closely related to Dolabella, which is the only other anaspidean in which polypropionates 

have been found. However, the polypropionates from Dolabella were from the internal organs of 

the animal. They are not in the appropriate place, nor are they in high enough concentration, to 

defend the animal from predators. Furthermore Dolabella is very well protected by exogenous 

metabolites. The hypothesis that the propionates derive from sacoglossans inadvertently ingested 

along with algae seems dreadfully ad hoc. The obvious alternative is that polypropionates are more 

widespread than the lack of evidence suggests. A concerted effort to find them might yield valuable 

results. 

The pteropods are pelagic opisthobranchs, so called after the wing-like extensions of the foot 

with which the animals swim. Two separate orders are recognized — Thecosomata and 

Gymnosomata — so-called because the body is covered by a shell in the former, whereas the latter 

are “naked.” They are quite different in both structure and way of life. Thecosomes are herbivores 

that feed with mucous nets. Gymnosomes are active predators and eat small animals, especially 

thecosomes. Pteropods were formerly treated as a single group, but the Belgian malacologist 

Paul Pelseneer (1899, 1906) decided that the Gymnosomata are derived from Anaspidea, whereas 

the Thecosomata are derived from Cephalaspidea. It was not clear which group of cephalaspideans 

was supposed to have given rise to the thecosomes. Furthermore, anaspideans themselves are modified 

cephalaspideans. The possibility that both groups of pteropods are derived from a stock closely 

related to Anaspidea was maintained by various authors, including one of us (Ghiselin, 1996b). 

A molecular study based on 28S ribosomal RNA sequence data has given strong support to that 

relationship (Dayrat, Tillier, Lecointre & Tillier, 2001). Additional molecular evidence leads to the 

same conclusion (Klussmann-Kolb & Dinapoli, 2006; Malaquias, Mackenzie-Dobbs, Gosliner & 

Reid, 2009). 

The issue of pteropod relationships is somewhat obscured by the tradition of leaving them out 

of consideration in many discussions of the opisthobranchs in general. For our purposes it is not a 

crucial matter. There are no published reports of defensive metabolites among the Thecosomata. In 

Gymnosomata only one species, Clione antarctica, is known to have defensive metabolites. It con-


tains pteroenone (Atlas 83), a polypropionate (Yoshida, Bryan, Baker & McClintock, 1995; 

McClintock & Baker, 1998). Pteroenone does not occur in Limacina, the thecosome upon which 

C. antarctica feeds, making it seem unlikely that the propionate is derived from food (Bryan, 

Yoshida, McClintock & Baker, 1995). An amphipod crustacean protects itself by a kind of parasitism, 

carrying the pteropod about (McClintock & Janssen, 1990). Once again, we find that the use 

of defensive polypropionates accompanies a major shift in diet and habitat. 

CHAPTER VIII 

SACOGLOSSA 

The sacoglossans, or ascoglossans, are remarkably specialized herbivores. The radula has been 

modified, so that it has a single row of teeth, allowing the animals to pierce the cells of algae and 

suck out the soft and nutritious contents. The worn-out teeth are deposited in a sac, or ascus, hence 

the names. Sometimes called “sap-sucking slugs,” they have been compared to aphids and other 

insects that feed on terrestrial plants. This comparison is in some ways apt, but there are many differences 

too. In the slugs, as in most other benthic marine animals, it is the larval stage that disperses 

and locates the food, whereas in the aphids (and terrestrial animals in general) it is the adult 

(Duffy, Paul, Renaud & Fenical, 1990). Their chemical defense has been treated from an evolutionary 

point of view by Cimino and Ghiselin (1998) and by Marin and Ros (2004), and from an ecological 

one by Cimino, Fontana, and Gavagnin (1999). 

In some lineages within the group a remarkable way of exploiting the algae upon which the 

animals feed has evolved (Muscatine & Greene, 1973; Hind & Smith, 1974; Clark & Busacca, 

1978; Ros & Marin, 1991; Rumpho, Sumner & Manhart, 2000; Wägele & Johansen, 2001). The 

chloroplasts are separated from the remaining part of the algal material that has been ingested and 

then kept alive and functioning inside cells that line the diverticula of the slugs’ digestive systems. 

Evidently the use of chloroplasts from food as captive photosynthetic apparatus was preceded by 

an earlier stage when their green color provided for camouflage (Clark, Jensen & Stirts, 1990). 

Algal chloroplasts evolved from free-living, photosynthetic bacteria. The bacteria got incorporated 

within the cells of eukaryotic organisms, allowing them to become photosynthetic and derive 

their energy from sunlight. The chloroplasts are much simplified organisms, and highly dependent 

upon the rest of the plant cell for support. Chloroplasts cannot be kept alive in culture for very long 

because they are dependent upon materials from the nucleus of the plant. Some sacoglossans can 

keep the chloroplasts alive and functioning for months on end. It was proposed that there has been 

a transfer of genes from the nucleus of the plant to that of the slugs (Pierce, Massey, Hanten & 

Curtis, 2003). Subsequently it has been shown that in Elysia chlorotica functional algal nuclear 

genes are indeed present in the nucleus of the slug and that they are transmitted to the slug’s offspring 

(Pierce, Curtis, Hanten, Boerner & Schwartz, 2007; Rumpho, Worful, Lee, Kannan & Tyler, 

2008). The sacoglossans are ectoparasites of the endosymbiotic chloroplasts. It has been speculated 

that the relationship is a mutualistic one, and that the algae, though not the chloroplasts, derive 

some kind of benefit from it (Ros & Marin, 1991). The evidence presented suggests, at most, that 

the harm is not as great as it seems. 

When the nutritive symbiosis is well developed, the slugs become independent of any other 

source of energy. Elysia crispata (formerly Tridachia crispata) is said to stop feeding when it 

reaches a length of around 13 mm, although it grows to a considerably larger size (Thompson & 

Jarman, 1989). Plakobranchus (Photo 33), which can often be found basking in the sun in shallow 

waters in the tropics, has been considerably modified in adaptation to this way of life. The dorsal



surface of this animal is bright green, thanks to the abundant concentration of chloroplasts in 

branches of the digestive gland. The sides of the foot can be extended over the green area, and 

when this is done the animal is relatively inconspicuous on sandy bottoms. Microscope studies 

showed very little evidence of algal material in the gut, indicating that the chloroplasts are retained 

for a considerable period (Eiuchi, 2005). Young ones raised on sterile sand without food were 

found to continue to grow and reproduce, thus relying entirely upon the symbionts for nutrition 

(Marilyn Switzer-Dunlap, personal communication). 

The following diagram suggests the relationships among sacoglossans: 

┌ Cylindrobulla 

─┤ ┌ Lobiger 

│ ┌┤ 

│┌┤└ Oxynoe 

└┤└ Ascobulla 

│ ┌ Plakobranchus 

│ ┌┤ 

│ ┌┤└ Thuridilla 

│┌┤└ Elysia 

└┤└ Bosellia 

│┌ Stiligeridae 

└┤ 

└ Caliphyllidae 

The genealogical relationships of sacoglossans are fairly well understood, thanks largely to the 

contributions of Gosliner (1995) and Jensen (1996, 1997, 1997). As mentioned earlier, efforts to 

place them in the tree of the opisthobranchs as a whole have given equivocal results, but their having 

a close relationship to anaspideans and perhaps to cephalaspideans of the family Diaphanidae 

has been maintained by Ghiselin (1966) and Jensen (1996) as well as some earlier authors. The 

group would therefore have arisen from an herbivorous ancestry that became specialized for feeding 

suctorially on siphonaceous algae, which are vulnerable because their cells are continuous. 

Which alga was the ancestor has been the subject of some uncertain speculation. Because the genus 

Caulerpa is the host of many sacoglossans, it has been a popular candidate. However, it has seemed 

likely that it was some other member of its family, such as Udotea. 

The most primitive genus within the Sacoglossa is Cylindrobulla, an unidentified species of 

which is shown in Photo 24 (see Jensen, 1989). Although some species of this genus feed on 

Caulerpa, some are known to feed on Halimeda as well. Cylindrobulla may reasonably be assumed 

to have branched off before all other sacoglossans, because it lacks the ascus from which the group 

derives its name. Presence of an ascus then is a shared, derived character indicating that the rest of 

the sacoglossans form a natural group. Many sacoglossans have shells, but even more of them have 

evolved into slugs. At one time it was generally assumed that the transition from snail to slug 

occurred in several independent lineages. However, this was just a guess, and no evidence was presented 

to connect the slug-like forms to two different shelled lineages. Therefore we accept the 

view that the shelled forms other than Cylindrobulla form a natural group and that the shell-less 

forms are its likewise monophyletic sister group. We will now treat these two groups, beginning 

with the shelled ones. 

All of the “higher” shelled sacoglossans feed upon algae of the genus Caulerpa and live in 

close association with it. None of them have been found to utilize photosynthesizing chloroplasts 

as a source of energy. Among these the genus Ascobulla is the most primitive in structure and 

habits. It looks very much like Cylindrobulla externally but it does have the characteristic radula


and ascus. It still lives and feeds buried in the substrate. Photo 26 shows another sacoglossan, 

Volvatella vigourouxii, exuding metabolites from the posterior end of the shell. Ascobulla fragilis, 

shown in Photo 25, feeds upon Caulerpa prolifera and utilizes the algal secondary metabolite in 

its own defense. The plant contains a sesquiterpenoid, caulerpenyne (Atlas 206), which has already 

been discussed from a chemical point of view. It sequesters the caulerpenyne and modifies it to 

form the more toxic oxytoxin-1 (Atlas 207) and the still more toxic oxytoxin-2 (Atlas 208) 

(Gavagnin, Marin, Castelluccio, Villani & Cimino, 1994). The oxytoxin-2 is secreted in mucus 

when the animal is molested by a predator. It has been proved, as we noted above, that some selective 

lipases are active in Oxynoe olivacea. 

In Oxynoe and Lobiger, the shell is somewhat more reduced and the animals live on the 

exposed parts of Caulerpa, where they are well camouflaged, as can be seen in Photo 27, in which 

metabolites are being discharged by a specimen of Oxynoe olivacea. This animal feeds upon 

Caulerpa prolifera, and, again, modifies the caulerpenyne into oxytoxin-1 and oxytoxin-2. These 

defensive compounds are produced by the slug itself, by enzymatic hydrolysis of the algal metabolite 

(Cutignano, Notti, d’Ippolito, Domènech Coll, Cimino & Fontana, 2004). When attacked by a 

predator the animal waves the back end of the foot, which it can break off (autotomize) and then 

regenerate, much as happens to the tails in some lizards (Stamm, 1968; Lewin, 1970; Warmke & 

Almovódar, 1972). Note that the animal has several means of protection, of which autotomy is the 

most expensive. In Lobiger the shell is somewhat more reduced and the animal has large parapodial 

lobes. These are autotomized when the animal is molested (Gonor, 1961; Stamm, 1968). 

Lobiger serradifalci, shown in Photo 28, feeds on Caulerpa prolifera. It was found to contain oxytoxin-1 

and oxytoxin-2 but no caulerpenyne. 

The above Mediterranean shelled sacoglossans have relatives in the Caribbean. A comparative 

study showed that Ascobulla ulla (which feeds on Caulerpa fastigiata), Oxynoe antillarum (which 

feeds on an unidentified Caulerpa), and Lobiger souberveii (which feeds on Caulerpa racemosa), 

have the same basic patterns of metabolite utilization as do their Mediterranean counterparts 

(Gavagnin, Marin, Castellucio, Villani & Cimino, 1994; Gavagnin, Mollo, Montanaro, Ortea & 

Cimino, 2000). In Ascobulla ulla there are metabolites, ascobullin A and B (Atlas 209, 210), 

obtained by oxidation and reduction of the more toxic caulerpenyne (Atlas 206). This suggests an 

unspecialized condition relative to other sacoglossans. Volvatellin (Atlas 211) from an Indian 

species has also been recorded (Fontana, Ciavatta, Mollo, Naik, Wahidulla, D’Sousa & Cimino, 

1999). There are no published reports on secondary metabolites from the “bivalved gastropods” 

mentioned earlier in this chapter. 

Passing now to the remainder of the Sacoglossa, which are all forms in which a shell is absent 

except in the larva, they seem to consist of two natural groups, which can easily be separated on 

the basis of external anatomy. The first of these is the family Plakobranchidae (or Elysiidae). In 

these animals the body is rather leaf-shaped and the edge of the foot extends as parapodia, rather 

like those of anaspideans. The second consists of two families: Caliphyllidae and Stiligeridae. Here 

there are dorsal processes called cerata (singular ceras) that occur in two series down the animal’s 

back. Similar structures, also called cerata, occur in some nudibranchs, and the superficial resemblance 

was once interpreted to indicate a close relationship. 

Gosliner (1995) has identified three clades within the Plakobranchidae. The first of these consists 

of the genus Bosellia. It is the sister group of a clade consisting of the other two, which are 

Elysia in a broad sense on the one hand and Plakobranchus + Thuridilla on the other. Within the 

group there have been noteworthy shifts from one food item to another, but usually within the same 

order of plants (Bryopsidales = Caulerpales = Codiales = Siphonales). The exact evolutionary 

sequence of algae used as food is uncertain. Jensen (1993a, 1993b, 1993c, 1996b) has suggested



that the initial food was not Caulerpa, but perhaps some other siphonaceous algal genus such as 

Halimeda, Udotea or Chlorodesmis. 

The genus Bosellia, which makes up the first branch of the Elysiidae, is not a good model for 

the common ancestor of the family. It is highly modified in many respects, and even has an unusually 

low chromosome number. Instead of crawling about with its parapodia somewhat upraised, it 

lies flat on the surface of the alga on which it feeds with the parapodia outstretched, as can be seen 

in Photo 29, which shows the animal next to its eggs. This alga is Halimeda, which is protected as 

a result of being highly calcified as well as by having secondary metabolites. A good example is 

Bosellia mimetica, which lives on Halimeda tuna (Gavagnin, Marin, Mollo, Crispino, Villani & 

Cimino, 1994). The defensive metabolite is the diterpenoid halimedatrial (Atlas 377), which is 

formed by activation of halimedatetracetate (Atlas 376) (Paul & Fenical, 1983, 1984; Paul & Van 

Alstyne, 1988, 1988, 1992). This diterpenoid metabolite differs from the sesquiterpenoid caulerpenyne 

(Atlas 206) of Caulerpa in having 20 rather than 15 carbon atoms, but otherwise it is quite 

similar. The active sites are identical, and in both a protected conjugated 1,4-dialdehyde gets activated 

by removal of the acetate group. Shifting from one of these metabolites to another would not 

be very difficult, but it is not obvious which came first in evolutionary history. 

In the genus Elysia there are a number of species that feed upon Caulerpa and its close relatives 

(Gavagnin, Mollo, Montanaro, Ortea & Cimino, 2000). These generally utilize metabolites 

from the algae defensively. Elysia subornata lives on Caulerpa prolifera, which contains caulerpenyne. 

The slug contains both caulerpenyne and oxytoxin-1, implying that, like shelled sacoglossans, 

it can modify the algal metabolites (Gavagnin, Mollo, Montarno, Ortea & Cimino, 2000). The 

same metabolites are also found in Elysia patina, and E. nisbeti, which derive them from unidentified 

Caulerpa. Specimens of what has been tentatively identified as Elysia expansa were found 

to contain large amounts of caulerpenyne, together with minor amounts of dihydrocaulerpenyne 

(Atlas 213) and expansinol (Atlas 214) suggesting that the animal can reduce metabolites derived 

from the alga (Ciavatta, Lopez Gresa, Gavagnin, Manzo, Mollo, D’Souza & Cimino, 2006), showing 

some analogies with Ascobulla ulla. Two species feed on Halimeda and utilize its terpenoids. 

Elysia pusilla (formerly called E. halimedae) derives halimedatetraacetate and halimedatrial from 

Halimeda macroloba (Paul & Van Alstyne, 1988). Elysia tuca gets halimedatetraacetate (Atlas 

376) from Halimeda incrassata (Gavagnin, Mollo, Montanaro, Ortea & Cimino, 2000). Elysia 

translucens feeds upon Udotea from which it derives the linear diterpenoid udoteal (Atlas 375) 

(Gavagnin, Marin, Mollo, Crispino, Villani & Cimino, 1994). This metabolite is closely related to 

halimedatetraacetate (Atlas 376) (Paul, Sun & Fenical, 1982; Paul & Fenical, 1984). 

Several species of Elysia feed upon other algae and have quite different chemical defense. 

Elysia rufescens obtains toxic polypeptides (Atlas 647-654) from the Bryopsis upon which it feeds 

(Hamann & Scheuer 1993; Hamann, Otto, Scheuer, & Dunbar, 1996; Becerro, Goetz, Paul & 

Scheuer, 2001). Two acyclic kahalalides have also been reported from this species (Goetz, Nakao 

& Scheuer 1997). These are the first of a long series of similar compounds that have been 

described. A depsipeptide (Atlas 657) has been recorded from Elysia ornata and an unidentified 

Bryopsis (Horgen, de los Santos, Goetz, Sakamoto, Kan, Nagai & Scheuer, 2000). Further kahalalides 

(Atlas 655, 666) have been reported from Elysia grandifolia (Ashour, Edrada, Ebel, Wray, 

Wätgen, Padmakumar, Müller, Lin & Proksch, 2006). In what is said to be the same species two 

new ones (Atlas 658, 659) were found together with three others, but only one of these was recovered 

from Bryopsis plumosa, upon which it feeds (Tilvi & Naik, 2007). The two groups of investigators 

named two slightly different cyclic peptides in the same manner, so that kahalalides R and 

S both refer to two different molecules. The kahalalides are produced by bacteria, and the metabolite 

content of the food would seem to be variable.


Other sacoglossans biosynthesize polypropionates de novo instead of deriving metabolites 

from food. A good example is Elysia timida (Photo 30), which feeds selectively upon Acetabularia 

acetabulum, and contains three different propionates (Atlas 123, 126, 131), none of which occur 

in the alga (Gavagnin, Spinella, Castelluccio, Cimino & Marin, 1994). This species has been studied 

experimentally in order to determine its effectiveness as a feeding deterrent. Using model 

sacoglossans, fish were taught to associate color patterns with particular metabolites (Giminez- 

Casalduero, Muniain & Garcia-Charton, 2002). Elysia viridis (Photo 31) feeds upon Codium vermiliara 

and synthesizes the polypropionate (+)elysione (Atlas 130) (Gavagnin, Marin, Mollo, 

Crispino, Villani & Cimino, 1994). Elysione is also produced by Elysia chlorotica (Dawe & 

Wright, 1986). It feeds on Cladophora (Jensen, 1980). 

Closely related to Elysia timida are two species of Elysia formerly called Tridachia crispata 

and Tridachiella diomedea (Gosliner, 1995). They produce unusual propionate-derived γ-pyrones 

such as tridachiapyrone A to F (Atlas 134-141). It has been suggested that tridachiapyrone A is the 

enantiomer of (+)elysione (Dawe & Wright, 1986). (See also Ireland, Faulkner, Solheim & Clardy, 

1978; Ireland & Faulkner, 1981; Ksebati & Schmitz, 1985). Absolute configuration has recently 

been suggested by synthesis (Bourdron, Commeiras, Audran, Vanthuyne, Hubaud & Parrain, 

2007). These are animals that photosynthesize using captive chloroplasts. The defensive role of 

these metabolites has been denied, though largely on the basis of negative evidence. But, supposing 

that they are not protective, what are they doing? Ireland and Scheuer (1979) proposed that they 

act as sunscreens, protecting the photosynthetic apparatus. This hypothesis is quite reasonable, and 

the photoreactivity of such compounds has been extensively studied. But there is still no compelling 

evidence in its favor. 

More recent studies have revealed that the polypropionates serve as traps for oxygen and are 

photosensitized by singlet oxygen. This development has stimulated a considerable amount of new 

research on their photochemistry. The γ-pyrones have greater photosensitizing capability than do 

the α-pyrones and slugs evidently produce them preferentially. The photosensitized compounds, 

which are hydroperoxides and endoperoxides, are thought to have irritant properties, and therefore 

it has been suggested that these are the active agents in chemical defense (Zuidema & Jones, 2006). 

Recently a series of rigorous biosynthetic experiments with stable isotopes ( 13C) led to unambiguous 

proof of the biosynthesis of (+)elysione in Elysia viridis (Cutignano, Cimino, Villani & 

Fontana, 2009). In addition, it was observed that the epoxy derivative of elysione, an optical isomer 

of tridachiapyrone-C (Atlas 138), was more abundant in the dark than in the light. It should 

be a protected form of elysione. In fact, it is stable when exposed to light whereas elysione is rapidly 

transformed into other isomers including the enantiomer of crispatene (Atlas 133). In addition, 

the acyclic precursor of elysione was detected only from animals maintained in the dark. The general 

course of events seems to move from propionic acid followed by elongation with seven other 

propionic units, leading to the acyclic precursor of elysione that is in equilibrium under enzymatic 

control, with its epoxy derivative. The instability of elysione confirms the “sunscreen” protection 

after secretion into the mucus. 

A population of Elysia (=Tridachia) crispata from Venezuela has been found to contain some 

polypropionates along with other secondary compounds, including crispatenine (Atlas 215), which 

is a sesquiterpenoid (Gavagnin, Mollo, Castelluccio, Montaro, Ortea & Cimino, 1997; Bourdron, 

Commeiras, Audran, Vanthuyne, Hubaud & Parrain, 2007). In addition to typical algal metabolites, 

this species has been found to contain a rather similar sesquiterpenoid, onchidal (Atlas 216), which 

is otherwise known only from the pulmonate Onchidella (Gavagnin, Mollo, Montanaro, Ortea & 

Cimino, 2000). It is remarkable for having adopted all strategies: bioaccumulation, biotransformation, 

and biosynthesis. It should be mentioned that what has been called Elysia crispata from the



Florida Keys turns out to be a distinct species recently named as Elysia clarki (Pierce, Curtis, 

Massey, Bass, Kari & Finney, 2006). 

Plakobranchus and Thuridilla are the remaining Plakobranchidae. Plakobranchus was already 

mentioned in connection with its use of chloroplasts. In the laboratory it feeds on Udotea and 

Chlorodesmus (Jensen, 1992). Plakobranchus ocellatus and Plakobranchus sp. (Photo 33) contain 

propionate-derived γ-pyrones (Atlas 142, 143) that have been thought to be sun screens much like 

those of Elysia crispata (formerly Tridachia crispata) and E. diomedea (formerly Tridachiella 

diomedea) (Ireland & Scheuer, 1979; Manzo, Ciavatta, Gavagnin, Mollo, Wahidulla & Cimino, 

2005). Fu, Hong and Schmitz (2000) also studied a series of polypropionate pyrones from what 

they identified as Plakobranchus ocellatus. Some of these (Atlas 146-149) were structurally related 

to the 9,10-deoxytridachione (Atlas 126) that had been found in Elysia diomedea whereas 

(Atlas 150) others were structurally related to the tridachiahydropyrone (Atlas 124) known from 

Elysia crispata (Gavagnin, Mollo, Cimino & Ortea, 1996). Related polypropionates, ocellapyrones 

(Atlas 142-143) and elysiapyrones (Atlas 144-145) were also found, respectively, in Plakobranchus 

ocellatus (Manzo, Ciavatta, Gavagnin, Mollo, Wahidulla & Cimino, 2005) and Elysia 

diomedea (Cueto, D’Croz, Maté, San Martin & Darias, 2005; Díaz-Marrero, Cueto, D’Croz & 

Darias, 2008). 

Thuridilla is mainly tropical. It differs from most other sacoglossans in being, with a few 

exceptions, brilliantly colored and conspicuous rather than cryptic — a good sign of chemical 

defense. Furthermore, the more basal members are cryptic, whereas the more derived taxa exhibit 

aposematic coloration (Gosliner, 1995). The only species of this genus for which data are available 

is Thuridilla hopei (Photo 34), which contains three diterpenoids, thuridillin-A, thuridillin-B, and 

thuridillin-C (Atlas 378-380) (Gavagnin, Spinella, Crispino, De Almeida Epifanio, Marin & 

Cimino, 1993). It feeds upon a very small alga, Derbesia tenuissima (Gavagnin, Marin, Mollo, 

Crispino, Villani & Cimino, 1994). The alga contains a diterpenoid (Atlas 381) displaying the very 

active conjugated dienolacetate moiety. Two thuridillins seem to be oxidized forms of the molecule 

derived from the food and the other a reduced one. Both mechanisms should protect the mollusk 

from the toxicity of the algal metabolite. The animal may therefore eat up its local food supply and 

need protection while moving from one patch of algae to another. At least one other species of this 

genus, Thuridilla gracilis as (T. ratna), shown in Photo 35, has functional chloroplasts (Wägele & 

Johnsen, 2001), and that gives the animals one more reason for being out in the sun. 

The sacoglossans that have cerata, or are descended from ancestors that did have them, are 

thought to form a monophyletic unit, and to be the sister group of the Plakobranchidae (Jensen, 

1996). A recent molecular study suggests that the “polybranchidae” arose well within the 

Plakobranchidae (Händler & Wägele, 2007). This alternative would not have much effect upon our 

general conclusions. The group with cerata is divided into two subunits, the families Stiligeridae 

and Caliphyllidae. 

Among the Stiligeridae, Costasiella ocellifera (= C. lilianae), shown in Photo 36, feeds on the 

green alga Avrainvillea longicaulis. It contains a brominated diphenylmethane derivative, 

avrainvilleol (Atlas 170) that has been shown experimentally to deter feeding by fish quite effectively 

(Hay, Duffy, Paul, Renaud & Fenical, 1990). Likewise, an as yet unidentified species of 

Costasiella collected in the Gulf of Mannar fed preferentially on Avrainvillea erecta even though 

it had access to several other green algae (Ernesto Mollo, personal communication). Placida dendritica, 

shown in Photo 37, feeds upon both Bryopsis and Codium. According to Trowbridge 

(1991) it can switch from one of these algal genera to the other, but only with difficulty. The slug 

makes use of the algal chloroplasts for camouflage, but evidently not as an energy source. 

However, it contains polypropionate γ-pyrones (Atlas 100-103) (Vardaro, Di Marzo & Cimino,


1992). A recent work (Cutignano, Cimino, Villani & Fontana, 2009) suggests that these are synthesized 

de novo, following a biosynthesis (mixed acetate-propionate) similar to that observed in bacteria, 

but different from that of some fungi, in which there is methylation of polyacetate, and which 

contain metabolites displaying almost identical structural features. In addition to γ-pyrones P. dendritica 

contains α-pyrones (Placidenes C-F)(Atlas 104-107) and a remarkable hydroperoxide 

(Atlas 101) (10-hydroperoxyl placidene A (Cutignano, Fontana, Renzulli & Cimino, 2003). 

Ercolania funerea (Photo 38), which eats Chaetomorpha, contains γ pyrone polypropionates 

(Vardaro, Di Marzo, Marin & Cimino, 1992). One of these, 7-methyl-cyercene-1 (Atlas 98) has 

also been recovered from media used to culture a phytopathogenic fungus, Phoma tracheiphila 

(Tringali, Parisi, Piattelli & Magnano di San Lio, 1993). Before we jump to the conclusion that 

some kind of lateral gene transfer or symbiotic organism is responsible for the existence of this 

metabolite in the mollusks, we should consider a much more straightforward explanation: coincidence. 

There are a wide variety of cyercenes and it is hardly surprising when one of them happens 

to have the same structure as a compound from some unrelated organism. Furthermore, as mentioned 

above, fungal propionic units are biosynthesized from acetate and then methylated, whereas 

opisthobranchs really do make them from propionate. 

Among the Caliphyllidae, endogenous polypropionates (Atlas 88-91) are also found in Cyerce 

cristallina, (Photo 39) of uncertain feeding relationships (Di Marzo, Vardaro, De Petrocellis, 

Villani, Minei & Cimino, 1991; Vardaro, Di Marzo, Crispino & Cimino, 1991), and in Cyerce 

nigricans (Atlas 86-87) which feeds upon Chlorodesmis (Roussis, Pawlik, Hay & Fenical, 1990) 

and contains the diterpenoid chlorodesmin (Atlas 383). Mourgona germaniae is known to obtain 

prenylated bromohydroquinones such as cyclocymopol (Atlas 169) from Cymopolia barbata, the 

calcareous green alga upon which it feeds (Högberg, Thompson & King, 1976). This compound is 

structurally related to the brominated diphenylmethane derivative found in the Costasiella pcellifera-Avrainvillea 

longicaulis pair. It also secretes a viscid mucus that is toxic to various animals 

(Jensen, 1984). Caliphylla mediterranea, shown in Photo 40, feeds upon Bryopsis plumula, on 

which it is well camouflaged thanks, in part, to symbiotic chloroplasts. It seems not to have chemical 

defense (Di Marzo, Marin, Vardaro, De Petrocellis & Cimino, 1993). 

Propionates that are synthesized de novo are often associated with defensive autotomy of the 

cerata, and in some cases these compounds have been found to stimulate regeneration of the cerata 

(Di Marzo, Marin, Vardaro, De Petrocellis, Villani & Cimino, 1993). Among the Stiligeridae, 

Ercolania funerea (Photo 38) autotomizes readily (Vardaro, Di Marzo, Marin & Cimino, 1992). 

Regeneration in this species occurs less rapidly than it does in Cyerce cristallina. However, Placida 

dendritica, shown in Photo 37, does not autotomize. Its polypropionate γ-pyrones seem to be used 

only in chemical defense because they do not stimulate regeneration (Di Marzo, Marin, Vardaro, 

De Petrocellis & Cimino, 1993). Like other γ-pyrones mentioned above, cyercene A (Atlas 88) 

from Cyerce cristallina is able to link singlet oxygen at a significantly higher rate than the corresponding 

α-pyrone isomer. The placidenes and cyercenes of Caliphyllidae are involved in both 

defense and regeneration. Cyerce cristallina autotomizes the cerata when it is attacked. These 

regenerate rapidly. One of the metabolites, which is found only in the cerata, has been shown to 

stimulate regeneration in experiments with Hydra. This well-known and much-studied freshwater 

cnidarian is an animal that responds to many growth and regeneration factors (Di Marzo Marin, 

Vardaro, De Petrocellis & Cimino, 1993). Caliphylla mediterranea is highly camouflaged rather 

than aposematically colored, and does not autotomize readily. Polypropionates have not been 

detected in this species. 

A recent study on Aplysiopsis formosa confirmed the presence of pyrones in Stiligeridae. In 

fact, the mollusk contained aplysiopsenes A-D, which are α-pyrones with a limited extra-ring con-



jugation (Atlas, 108-111) (Ciavatta, Manzo, Nuzzo, Villani, Cimino, Cervera, Malaquias & 

Gavagnin, 2009). 

One might wonder if perhaps these de-novo synthesized compounds originated as defensive 

metabolites and then were pressed into service as stimulants to regeneration. On the other hand, 

somewhat the opposite scenario also comes to mind. If the original function was not defense, but 

some kind of signaling function within the body of the slugs, then the ancestral metabolite could 

have been modified so as to function in either defense or wound healing, or perhaps both. Such a 

scenario is not without precedent among opisthobranchs. Some nudibranchs, as we shall see, have 

defensive metabolites that are derived from prostaglandins and are likewise implicated in the 

regeneration of autotomized cerata. 

Summing up the historical aspect of this chapter, the sacoglossans seem to have started out as 

burrowing herbivores that became able to exploit siphonaceous algae as a food source. The defensive 

use of caulerpenyne and its derivatives from the algae allowed them to move above the substrate. 

They then diversified, exploiting a variety of different algae as a source of food and defensive 

metabolites. When the shift meant a loss of protection from metabolites in the food, the animals 

often switched to de novo biosynthesis of polypropionates. The apparent lack of polypropionates 

in shelled sacoglossans could mean that they were lost in that lineage. But it may mean that 

they were present at low levels and had some other function, as we have suggested for other groups 

of opisthobranchs. The involvement of polypropionates in the regeneration of autotomized cerata 

makes one suspect that their absence may be more apparent than real. Correlated with reliance 

upon chloroplasts for energy and a habit of basking in the sun is the presence of photoactive 

polypropionates. These might function as sunscreens, as defensive chemicals, or very likely as 

both. 

CHAPTER IX 

NOTASPIDEA 

Notaspidea is a small group of animals that have long been considered the closest relatives of 

a much larger one, Nudibranchia. As was explained earlier, the two orders have been grouped 

together in an assemblage called Acoela. Recent molecular research has failed to confirm the 

monophyly of Notaspidea as traditionally conceived. Tylodina and Umbraculum are therefore 

removed and relegated to a kind of taxonomic Limbo, and Notaspidea is restricted to the remainder, 

which, together with Nudibranchia form a taxon called Nudiplura. Here we will not take a definite 

stand on this matter but treat the lower “notaspideans” first, with the understanding that they 

are incertae sedis within Opisthobranchia. After all, we have to put them somewhere. Notaspideans 

(in either the broader or the narrower sense) have many characters that make them seem more primitive 

than, and transitional to, nudibranchs. As usual, however, they have diverged since common 

ancestry and they have undergone a minor adaptive radiation of their own. Some authors have 

speculated that the nudibranchs evolved polyphyletically from more than one group of notaspideans. 

This notion has not been substantiated and most recent workers do not take it seriously. 

However the possibility that Notaspidea is paraphyletic remains open. 

The following tree indicates probable relationships among the notaspideans that are of interest 

here:


┌ Tylodina 

─┤ Umbraculum 

│ ┌ Pleurobranchaea 

│ ┌┤ 

│┌┤└ Pleurobranchella 

└┤└ Euselenops 

│┌ Pleurobranchus 

└┤┌ Berthella 

└┤ 

└ Bathyberthella, Berthellina, Pleurhedera 

This tree shows an unresolved trichotomy for Tylodina, Umbraculum and other notaspideans 

to reflect the fact that the position of Tylodina has been rendered questionable by molecular studies. 

The families Umbraculidae and Tylodinidae have traditionally been treated as the first branch 

of the notaspideans (e. g., Vayssière, 1885). Schmeckel (1985) created an order Umbraculomorpha 

for them. For our purposes we need concern ourselves with just two genera, Umbraculum and 

Tylodina. Willan (1987) published a phylogenetic tree in which the families Tylodinidae and 

Umbraculidae were treated as the sister group of all the rest of the Notaspidea. Cervera, Gosliner, 

Garcia-Gomez and Ortea (2000) criticized this work on the grounds that it was not based on parsimony. 

Nonetheless they maintained the traditional view, although most of the characters uniting 

Umbraculum and Tylodina may be plesiomorphies. One molecular study shows a close relationship 

between these two genera but places them next to Runcina and Cephalaspidea ss., quite distant 

from Nudipleura (Grande, Templado, Cervera & Zardoya, 2004). Gosliner (1991) gave good 

arguments for keeping Umbraculum in Notaspidea. Some authors have noted its similarity to 

anaspideans: Thompson (1973) with respect to spermatozoon ultrastructure and Van den Biggelaar 

and Haszprunar (1996) with respect to egg cleavage patterns. Be this as it may, animals of both 

genera have cap-shaped shells, a feature that does not occur in any other opisthobranchs. The shell 

of Tylodina is larger, relative to the rest of the body, than that of Umbraculum. In Umbraculum it 

does not fully cover the body, though it seems to have done so in some fossil forms (Valdés & 

Lozuet, 2000). Animals of both genera feed upon sponges, and this may be a primitive condition 

for both Notaspidea and Nudibranchia. 

Tylodina fungina (Photo 41) from the Gulf of California was found to contain metabolites 

including an ester of a brominated alkaloid derived from unspecified species of sponges of the 

genus Verongia, now synonymized with Aplysina (Demospongiae: Verongida: Aplysinidae) 

(Andersen & Faulkner, 1972). The Mediterranean species Tylodina perversa derives similar 

metabolites from Aplysina crassa, formerly called Verongia aerophoba (Teeyapant, Kreis, Wray, 

Witte & Proksch, 1993). The notaspideans are also able to feed upon another closely-related 

sponge (Thoms, Ebel & Proksch, 2006). The metabolites are brominated alkaloids thought to be 

derived from 3,5-dibromotyrosine. These metabolites (579-580) deter predation on the sponges 

(Thoms, Wolff, Padmakumar, Ebel & Proksch, 2004). They are sequestered by the slugs and occur 

at high levels in the mantle, mucus, reproductive organs and egg masses (Ebel, Marin & Proksch, 

1999). Some tissues of the sponge contain cyanobacteria, and the slugs feed preferentially on the 

tissues that contain them (Becerro, Turon, Uriz & Templado, 2003). Uranidine (Atlas 162) a phenolic 

pigment that darkens upon exposure to the air, is also derived from the sponge (Cimino, De 

Rosa, De Stefano, Spinella & Sodano, 1984; Cimino & Sodano, 1994). 

Photo 42 shows a specimen of Umbraculum mediterraneum perched atop a sponge. The shell, 

which is much reduced, can barely be seen, but the gill is quite conspicuous just beneath it. The 

integument of Umbraculum mediterraneum contains fatty acid esters that have been shown to be



toxic to fish (Cimino, Crispino, Spinella & Sodano, 1988; Gavagnin, Spinella, Cimino & Sodano, 

1990). Two are diacylglycerols, such as umbraculumin-A (Atlas 519) and umbraculumin-B (Atlas 

521) whereas umbraculumin-B (Atlas 520) is a bis hydroxybutyric acid ester (Cimino, Spinella, 

Scopa & Sodano, 1989). This material occurs in parts of the sponge that are adjacent to the slug, 

evidently because the metabolites have diffused into it, and not because it is an inducible defense 

(Cimino & Sodano, 1994). The structure of the diacylglycerol umbraculumin-A has been justified 

by synthesis (DeMedeiros, Herbert & Taylor, 1990). 

In the remaining Notaspidea the shell is much reduced, or even absent (in the adults), and is 

not cap-shaped. They form a clade with two major branches, according to Willan (1987). The first 

branch consists of the genera Euselenops, Pleurobranchella, and Pleurobranchaea. The second 

branch has Pleurobranchus as the sister group of Berthella + Bathyberthella, Berthellina and 

Pleurhedera. Basically the same arrangement is given by Cervera, Gosliner, Garcia-Gomez & 

Ortea (2000). 

This group of notaspideans is noteworthy for defensive dermal glands in the skin that produce 

sulphuric acid (Panceri, 1869; Thompson & Slinn, 1969). One survey found that acid was secreted 

from the integument upon disturbance by all of the species of notaspideans studied: 

Pleurobranchaea californica, Pleurobranchus membranaceus, Pleurobranchus strongi, Berthella 

plumula, and Berthellina citrina (Gilette, Saeki & Huang, 1991). Thus defensive acid secretion 

occurs in all of the main branches mentioned above. The presence of acid secretion has perhaps 

dissuaded chemists from paying much attention to other defensive chemicals, but some very interesting 

examples have nonetheless been studied. There is also an acid-producing gland that opens 

into the anterior part of the gut, near the mouth. Pleurobranchaea californica uses this acid (pH 

1.2) secretion in subduing prey (Morse, 1984). 

Pleurobranchaea is thought to be a generalized scavenger, but it also is known to feed upon 

slow-moving animals (Willan, 1984). It has a distinct preference for sea anemones and other 

cnidarians, but it has also been found to feed upon sponges, various nematodes, polychaetes, 

amphipods, opisthobranchs, ophiuroids, squid, and fish parts (Cattaneo-Vietti, Burlando & Senes, 

1993). Pleurobranchaea meckelii, shown with its eggs in Photo 45, has been found to contain labdane 

aldehydes (Atlas 351-352) in the skin (Ciavatta, Villani, Trivellone & Cimino, 1995). No data 

on chemical defense are available for other notaspideans of the first major branch. 

In the second major branch, the skin of Pleurobranchus membranaceus (Photo 44) has been 

found to contain polypropionates called membrenones (Ciavatta, Trivellone, Villani & Cimino, 

1993). The structure of (-)-membrenone-C (Atlas 85) has been confirmed by synthesis (Perkins & 

Sampson, 2001). The possibility that these are biosynthesized de novo seems reasonable, but no 

experimental work has been done to test that hypothesis. This species, which has a large acidsecreting 

gland in its buccal cavity, has been observed to feed upon the ascidians Botryllus 

schlosseri and Ascidia mentula (Thompson & Slinn, 1959). Both Pleurobranchus albigutattus and 

P. forskalii that had been feeding on the tunicate Lissoclinum contained the kind of chlorinated 

diterpenes that occur in such food items (Fu, Palomar, Hong, Schmitz & Valeriote, 2004). 

The Mediterranean Pleurobranchus testudinarius (Photo 43) has two triterpenoids, testudinariol 

A and B (Atlas 515-516), that resemble those of sponges in the skin and mucus (Spinella, 

Mollo, Trivellone & Cimino, 1997). An unidentified species of Pleurobranchus from the South 

China Sea, already mentioned above, contains the halogenated algal sesquiterpene pacifenol (Atlas 

277) and also testudinariol B (Atlas 516) (Carbone, 2007). Since these animals are carnivorous, it 

seems likely that the sesquiterpenoid is derived from food, perhaps from herbivorous prey, or perhaps 

ingested incidentally. On the contrary, the triterpenoids have been found in the mantle, but not 

in the digestive gland, suggesting de novo synthesis. Another study on Pleurobranchus forskalii


revealed a cyclic peptide, keenamide-A (Atlas 638) (Wesson & Hamann, 1996). This is again one 

of a class of metabolites that commonly occur in tunicates. It is worth pointing out that tunicates 

have cells that contain highly acidic secretions. Berthella and Berthellina on the other hand mainly 

feed on sponges, especially Demospongiae, though there are reports of their feeding on calcareous 

sponges and corals (Willan, 1984). Except for the acid secretions noted above, chemical 

defense has not been recorded from these pleurobranchs. Since they are common animals this probably 

does not mean that nobody has studied them. 

There exists a curious pattern of similarity between the metabolites of some notaspideans and 

those of intertidal limpets (Díaz-Marrero, Dorta, Cueto, Rovirosa, San-Martín, Loyola & Durias, 

2003). Pleurobranchaea meckelii has two diterpenes (Atlas 351, 352) that resemble one (Atlas 

353) from a pulmonate, Trimusculus reticulatus. Pleurobranchus membranaceus has a polypropionate, 

membrenone-C (Atlas 85) that resembles one, vallartanone-D (Atlas 84) from another pulmonate 

limpet, Siphonaria maura. Pleurobranchus testudinarius has triterpenoids, testudinariols 

(Atlas 515-516) much like limatulone (Atlas 517) of a prosobranch limpet, Lottia limatula. 

Although the two pulmonates are closely related, and are distant relatives of opisthobranchs, the 

prosobranch represents a very early branch of the gastropods, not at all close to either pulmonates 

or opisthobranchs. The limpets in question share a common habitat and a cap-shaped shell, but 

there is no evident causal basis for this pattern. So far as we can tell, it is just a curious coincidence. 

A close relationship between the two major groups of notaspideans and the nudibranchs might 

be taken as an indication that sponge feeding was the ancestral state in Notaspidea. But these relationships 

are most uncertain. At any rate, within the second group, dermal acid secretion as a defensive 

mechanism is generally present and it evidently represents the ancestral state. Acidic secretion 

from the gut is used in dealing with a variety of prey organisms. Some metabolites derived from 

food are used defensively. The polypropionates of Pleurobranchus membranaceus may be a 

replacement for dietary metabolites from some ancestral food item, but it is not clear from the data 

whether this is what happened or what that food might have been. 

As to the nudibranchs themselves, they are commonly divided into two main groups: 

Holohepatica and Cladohepatica. The names refer to the digestive gland or hepatopancreas being 

entire (holohepatic) or branched (cladohepatic). Alternative names for these two groups are 

Anthobranchia and Cladobranchia and Euctenidiacea and Actenidiacea. The term Cladobranchia is 

not very appropriate because it implies that the gills themselves are branched. Holohepatica is 

equivalent to one of the four traditional orders of nudibranchs, Doridacea, whereas Cladohepatica 

consists of the other three: Dendronotacea, Arminacea and Aeolidiacea. It is likely that 

Dendronotacea and Arminacea are paraphyletic grades. The cladohepatic condition is associated 

with feeding on cnidarians and is obviously derived from the holohepatic condition. The ancestral 

food of the nudibranchs and their pleurobranch forebears was very likely sponges, but there is no 

compelling evidence for that. 

CHAPTER X 

NUDIBRANCHIA: DORIDACEA 

The following tree represents the likely relationships among the major groups of dorid nudibranchs 

as presently understood. More detailed trees for some of these groups are given below. 

This one shows the more basal relationships.



┌ Bathydoris 

─┤┌ Hexabranchus 

└┤┌ Polyceratidae 

└┤┌ Aegiridae 

└┤┌ Suctoria 

└┤ 

│ ┌ Dendrodorididae 

│┌┤(Porostomata) 

└┤└ Phyllidiidae 

│ ┌ Discodorididae 

│┌┤ 

└┤└ Dorididae 

│(Labiostomata) 

│┌ Chromodorididae 

└┤ 

└ Actinocyclidae 

Much of the discussion about the origin of the dorid nudibranchs, and of nudibranchs in general, 

has focused upon the primitive genus Bathydoris (Minichev, 1969; Wägele, 1989). The name 

of this genus is taken from its deep-water habitat, but it ranges into shallower waters in the 

Antarctic. Evans (1914) considered the single species of Bathydoris that he studied to be omnivorous, 

though the sponges in its gut suggested that it had “predilections” for them. More recently 

Bathydoris hodgsoni has been found to contain hodgsonal (Atlas 243), a 2-substituted drimane 

sesquiterpene having a skeleton that is typical of sponges (Iken, Avila, Ciavatta, Fontana & Cimino, 

1998; Avila, Iken, Fontana & Cimino, 2000); the drimane skeleton is also biosynthesized by porostome 

nudibranchs of the family Dendrodorididae (q.v.). That this metabolite is concentrated in the 

skin makes it seem likely that it is synthesized de novo. If it is not synthesized de novo, the obvious 

interpretation is that Bathydoris has expanded its diet yet remains dependent on sponges for 

metabolites derived from food. If, on the other hand, it is synthesized de novo, then it would seem 

that eating sponges was the original condition and that the relative omnivory is secondary. 

On the other hand, Valdés (2004) proposes essentially the opposite scenario. He suggests that 

the ancestral condition was as in Bathydoris, with an omnivorous organism having de novo synthesis 

of protective metabolites. The animals then shifted to feeding upon sponges. Subsequently de 

novo synthesis has been replaced by the sequestration of metabolites from food in various groups 

of dorids. The trouble with this scenario is that dorid nudibranchs of various groups biosynthesize 

a variety of metabolites de novo. They are related to dorids that derive those metabolites, or very 

similar ones, from their food. The ancestral dorid could not have possessed the capacity for de novo 

biosynthesis in general or in the abstract, but would have had to biosynthesize some particular 

metabolite. Valdés (2002) also maintains that Bathydoris gave rise to two lineages of nudibranchs, 

one of these being the dorids and the other all the rest of the nudibranchs. Although the treatment 

of the data would seem to be sound, this inference of paraphyly is based upon the presence of a few 

characters that may have evolved in parallel. 

Hexabranchus sanguineus, commonly known as the “Spanish dancer,” is a large, brightly-colored 

dorid that is quite common in the tropics. As can be seen in Photo 46, the animal swims by a 

dorso-ventral undulatory movement. It shows a “startle response” (Edmunds, 1968). 

Hexabranchus is considered the sister group of all dorids except for Bathydoris. It contains 

macrolides that are evidently derived from sponges of the genus Halichondria (Demospongiae: 

Halichondrida: Halichondriidae) (Kernan, Molinski & Faulkner, 1988; Matsunaga, 2006). The 

macrolides, such as ulupualide B (Atlas 667), which have been shown to deter predators, occur in


the digestive gland, the integument, the reproductive organs and the egg masses (where they were 

first discovered) (Roesener & Scheuer, 1986; Pawlik, Kernan, Molinski, Harper & Faulkner, 1988; 

Matsunaga, Fusetani, Hashimoto, Kanahisa, Koshi, Noma, Noguchi & Sankawa, 1989). An esterified 

carotenoid pigment, hurgadin (Atlas 513), is located in portions of the mantle, where it probably 

functions both as a visual signal and in chemical defense (Guo, Gavagnin, Mollo, Trivellone, 

Cimino & Fakhr, 1988). This molecule seems to be a protected form of a conjugated dialdehyde, 

structurally analogous to many other defensive chemicals. These dialdehydes are similar to those 

found in the porostome family Dendrodorididae. A single specimen collected in the South China 

Sea contained three sesquiterpenes and one diterpene (Atlas 459) (Zhang, Gavagnin, Guo, Mollo, 

Ghiselin & Cimino 2007). Two of the sesquiterpenes (Atlas 315-316), displaying the same skeleton 

but with a formamide substituent at different positions, were sequestered in the integument, but 

the usual macrolides were not detected. There were also isocyanides like those found in the porostome 

family Phyllidiidae. Isocyanides are also found in Halichondria (Demospongiae: 

Halichondrida: Halichondriidae) (Molinski, Faulkner, Van Duyne & Clardy, 1987). As if that were 

not enough, there were also 15-20 carbon terpenoids like those found in Chromodorididae. This is 

a truly remarkable assemblage of metabolites. The diversity of secondary compounds stands in 

stark contrast to the specialized arsenals of other nudibranchs. This animal is a generalist with 

respect both to the sponges on which it feeds and the metabolites that it uses defensively. 

The remaining dorid nudibranchs have traditionally been divided into Phanerobranchia and 

Cryptobranchia. The cryptobranchs are able to protect their gills by withdrawing them into a pouch. 

The gills of phanerobranchs are not entirely unprotected, however. They are retractile and may be 

surrounded by projections of the body. The ability to withdraw the gills into a pouch is obviously 

a derived character, and it serves as a good synapomorphy for Cryptobranchia, indicating the 

monophyly of the group. On the other hand the phanerobranchs have the primitive condition for 

dorids as a whole so the group may well be a paraphyletic grade. The Phanerobranchia have been 

divided into Suctoria and Nonsuctoria, based on the presence or absence of a pump used in feeding. 

Again, Suctoria can be diagnosed on the basis of a derived character, but Nonsuctoria is very 

likely a paraphyletic grade, and Suctoria appears to be the sister group of Cryptobranchia (Fahey 

& Gosliner, 2004). The sequence leading to Cryptobranchia is therefore a series of branches leading 

to Bathydoris, then Hexabranchus, then Polyceratidae, then Aegiridae, then Suctoria. Many 

organisms in the more basal lineages contain alkaloids, often from calcareous sponges or bryozoans 

upon which the animals feed. 

Among the first branch, Polyceratidae, alkaloids have been recorded, derived from bryozoans 

and other soft bodied animals or sometimes synthesized de novo. Photo 47 shows a specimen of 

Polycera elegans crawling on a bryozoan colony. Triopha catalinae and Polycera tricolor have 

diacylguanidine alkaloid, triophamine (Atlas 581) (Gustafson & Andersen, 1982). There is good 

evidence for de novo synthesis of this compound (Graziani & Andersen, 1996; Kubanek & 

Andersen, 1997). The animals were able to incorporate both acetate and butyrate in experiments 

with the labeled molecules. Limaciamine (Atlas 582), another diacylguanidine, occurs in the 

integument of Limacia clavigera (Graziani & Andersen, 1998). 

Other nudibranchs of the family Polyceratidae, currently treated as the subfamily 

Nembrothinae, are remarkable for the manner in which they exploit a series of alkaloids called tambjamines 

(Atlas 583-586) (Carté & Faulkner, 1983, 1986). These compounds are evidently the 

products of symbiosis of bacteria with bryozoans. Tambja capensis (Photo 48) contains two tambjamines 

(Atlas 583, 587) and a blue tetrapyrrole pigment, which is a stereoisomer of one found 

(Atlas 589) in some species of Nembrotha (Paul, Lindquist & Fenical, 1990) from the blue bry-



ozoan Bugula dentata upon which it feeds (Rapson, 2004, cited in Davies-Coleman, 2006). Tambja 

verconis and Tambja morosa (Photo 49) obtain a series of alkaloids from Bugula dentata 

(Appleton & Copp, 2005). Since they contain a wider variety of metabolites than the bryozoans do, 

it has been suggested that the slugs biotransform them. Tambja abdere and T. eliora (Photo 50) 

obtain tambjamines by feeding on the bryozoan Sessibugula translucens. These two nudibranchs 

are eaten by another nudibranch, Roboastra tigris, shown in Photo 51, which then uses the tambjamines 

in its own defense. Roboastra europea, shown in Photo 52, is strikingly aposematic. In its 

tropical and semi-tropical environments Roboastra is often found crawling about quite openly and 

in broad daylight. Therefore it would seem that the chemical defense is very effective. 

Another source of tambjamines (Atlas, 587, 588) among nudibranchs of the subfamily 

Nembrothinae are ascidians of the genus Apatozoa, which are fed upon by Nembrotha (Paul, 

Lindquist & Fenical, 1990; Lindquist & Fenical, 1991). Not surprisingly, given their food, a blue 

tetrapyrrole (Atlas 589) has been isolated from Nembrotha kubaryana, shown in Photo 53 (Karuso 

& Scheuer, 2002). 

A recent phylogenetic analysis based on both molecular and morphological evidence has clarified 

the relationships among the various genera and species within this assemblage (Pola, Cervera 

& Gosliner, 2007). Both Nembrotha and Roboastra are holophyletic, whereas Tambja is paraphyletic. 

Roboastra falls well within a clade of Tambja and some species of Tambja are closely 

related to Nembrotha. In other words, Roboastra is a modified Tambja that has shifted from bryozoans 

to nudibranchs as a source of food and metabolites, and Nembrotha would seem to have had 

a similar history, but be derived from a different lineage and seems to have shifted from bryozoans 

to tunicates. The diet of the mollusks here is obviously not dependent upon the taxonomic position 

of the organisms that are eaten. Rather, in the course of evolution they have shifted from feeding 

upon one soft-bodied animal to another, all of which contain metabolites that get pressed into service 

in chemical defense. 

In the Aegiridae, the only animals for which data on chemical defense are available are Aegires 

gardineri (Photo 54) and A. citrina (both as Notodoris), which derive 2-iminoimidazole alkaloids 

such as naamidine-A (Atlas 590) from calcareous sponges of the genus Leucetta (Calcarea: 

Calcinea: Clathrinida: Leucettidae) (Carmely, Bowden & Coll, 1993; Carmeley, Ilan & Kashman, 

1989; Alvi, Crews & Loughhead, 1991; Alvi, Peters, Hunter & Crews, 1993; Carroll, Bowden & 

Coll 1993). (The genus Notodoris has been synonymized with Aegires by Fahey & Gosliner, 2004). 

In Suctoria of the family Onchidorididae, there are also some animals that contain terpenoids, 

supposedly derived from the bryozoans on which these animals feed. Adalaria loveni contains a 

degraded triterpenoid, lovenone (Atlas 518) (Graziani, Allen & Andersen, 1995). In Acanthodoris 

nanaimoensis, two specimens of which are shown in Photo 55, there are sesquiterpenoids such as 

nanaimoal (Atlas 227), acanthodoral (Atlas 229), and isoacanthodoral (Atlas 228) (Ayer, 

Andersen, He & Clardy, 1984; Ayer, Hellou, Tischler & Andersen, 1984; Liu, Ulibarri & Nelson, 

1990). This group of compounds was shown to be biosynthesized de novo (Graziani & Andersen, 

1996); the animals incorporated labeled acetate. Acanthodoris hudsoni, a less common species that 

occurs in the same area, contains the same metabolites, but in a different ratio: 1:10:40 instead of 

40:10:1 (Andersen, Desjardine & Woods, 2006). Animals of both species have a pleasant smell. 

The remaining dorids are cryptobranchs. Typically they feed upon sponges of the class 

Demospongiae. Cryptobranchia as here conceived includes the Porostomata, or radula-less dorids, 

in some of which the retractile, flower-like gill has been lost. Valdés (2002), whose phylogenetic 

arrangement we will follow here, treats the Porostomata as the sister group of all other 

Cryptobranchia, for which he has introduced the name Labiostomata. 

Porostomata is now understood, on the basis of both molecular and anatomical evidence, to be


a monophyletic group (Valdés & Gosliner, 1999; Valdés, 2003). Its polyphyly was suspected on the 

basis of the ease with which the radula might be lost and the many differences between the two 

main groups (Brunckhorst, 1993). The radula, however, has not simply been lost. The pharynx has 

been converted into a long, tubular structure that allows the animals to feed suctorially on the tissues 

of sponges. Porostomata is now divided into three families, Maneliidae, Dendrodorididae, and 

Phyllidiidae. In the Mandeliidae and Dendrodorididae the typical dorid gill is retained, whereas in 

the Phyllidiidae it has been lost and, with few exceptions, replaced by a series of lamellae on each 

side of the foot. Animals of both of the latter two families have been extensively studied from the 

point of view of chemical defense. 

In the Dendrodorididae two genera are currently recognized: Doriopsilla and Dendrodoris. In 

their gonads all of these nudibranchs studied thus far contain drimane sesquiterpenoid fatty acid 

esters (Atlas 236), which may be biosynthesized de novo, and in some cases rigorous experimental 

evidence of this is available. These compounds are transferred to the eggs. They can be broken 

down into two parts, one of which provides the developing larva with an energy source like ordinary 

yolk, while the other serves a protective function. In other parts of the bodies of the adults 

there are sesquiterpenoids (Atlas 237-239) that at least sometimes are biosynthesized de novo. One 

of them, olepupuane (Atlas 237), delivers poygodial (Atlas 235) that is very harmful to predators. 

The compounds recorded from the nudibranchs are similar, and sometimes identical, to those that 

occur in sponges. However, there is no evidence for the incorporation of defensive metabolites 

from the sponges. Evidently these mollusks are descended from ancestors that obtained defensive 

metabolites from the sponges upon which they fed but they no longer do so, and have not done so 

since common ancestry of the two genera. Let us now consider the comparative and experimental 

work on which this inference is based. 

Doriopsilla areolata, shown with its coiled egg mass in Photo 56, was not found to contain 

sponge metabolites in the digestive gland (Spinella, Alvarez, Avila & Cimino, 1994; Gavagnin, 

Mollo, Calado, Fahey, Ghiselin, Ortea & Cimino, 2001). However there are metabolites of that sort 

elsewhere in the body, suggesting that the animals have evolved the capacity for biosynthesizing 

them de novo. In the gonad, there is a mixture of drimane fatty acid esters (Atlas 236) that gets 

incorporated in the eggs and serves the developing embryo as both a store of energy and a means 

of defense. Related drimane sesquiterpenoids (Atlas 237-239, 342) were detected on the mantle. 

The sesquiterpenoid (-)ent-pallescenscin-A (Atlas 339) occurs in the gill, and two of its apparent 

derivatives in the border of the mantle: 15-acetoxy-ent-pallescensin-A (Atlas 340) and 2,15-diacetoxy-ent-pallescensin-A 

(Atlas 341). An enantiomer of the latter, (+)pallescenscin-A, occurs in the 

sponge Dysidea pallescens (Demospongiae: Dictyoceratida: Dysideidae)(Cimino, De Stefano, 

Guerriero & Minale, 1975). Surprisingly, the A/B ring junctions of the two series, drimane and 

pallescenscin, of sesquiterpenoids were the opposite. The observation that in another sponge of the 

genus Dysidea the sesquiterpenoids ent-pallescenscin-A and euryfuran with an opposite A/B ring 

junction were found suggests that the compounds in the nudibranchs might indeed be of dietary origin 

(Butler & Capon, 1993). However, experiments with labeled mevalonate showed a substantial 

amount of incorporation in both drimane and pallescensin sesquiterpenoids, clearly indicating de 

novo biosynthesis (Gavagnin, Mollo, Castellucio, Ghiselin, Calado & Cimino, 2001; Gavagnin, 

Mollo, Castelluccio, Ghiselin, Calado & Cimino, 2001). Experiments with labeled glucose confirmed 

the mevalonate pathway (Fontana, Tramice, Cutignano, d’Ippolito, Gavagnin & Cimino, 

2003). Both the drimane esters and the ent-acetoxypallescensin can be derived from a single pool 

of trans, trans-farnesyl diphosphate that isomerizes before cyclization. 

Another species, Doriopsilla pelseneeri, shown in Photo 57, has given rather similar results 

(Gaspar, Gavagnin, Calado, Castelluccio, Mollo & Cimino, 2005). It was also found to contain, in



addition to drimane sesquiterpenoids, clearly biosynthesized by the mollusks (Cutignano et al., in 

Press), two furanosesquiterpene alcohols, pelseneeriol-1 (Atlas 317) and pelseneeriol-2 (Atlas 

318), which differ only in relative stereochemistry (being epimers at C-3) as proved experimentally 

by Gaspar, Cutignano, Ferreira, Calado, Cimino and Fontana (2008). Pelseneeriols are monocyclic 

furanoterpenes structurally related to microcionins, which are sesquiterpenoids possessed by 

the Mediterranean sponge Fasciospongia cavernosa (Demospongiae: Dictyoceratida: Thorectidae; 

misidentified as Microciona toxystila) (Cimino, De Stefano, Guerriero & Minale, 1975). 

Doriopsilla pharpa is protected from crabs and fish by polygodial (Atlas 235). (Long & Hay, 

2006). Polygodial is a metabolite present in all of the porostome nudibranchs belonging to the genera 

Dendrodoris and Doriopsilla that have been studied. Experiments with fish of two species, 

Fundulus heteroclitus and Chasmodes bosquianus, showed that the fish learned to avoid pieces of 

squid containing the metabolite, but that both the mechanisms and the outcomes were different. C. 

bosquianus regurgitated the treated food, and then came to avoid such food irrespective of whether 

it was treated or not. F. heteroclitus did not regurgitate, and learned to avoid only the food that had 

been treated. The latter mechanism would exclude fewer food items from the diet of the fish and 

should have various other ecological consequences. 

More data, giving patterns similar, but not identical, to those of Doriopsilla, are available for 

the genus Dendrodoris. In Dendrodoris krebsi, variabilin (Atlas 472), a sponge-derived sesterterpene, 

occurs in the digestive gland but not elsewhere in the body (Gavagnin, Mollo, Calado, Fahey, 

Ghiselin, Ortea & Cimino, 2001). The gonad, like that of Doriopsilla areolata, contains a mixture 

of drimane fatty acid esters. Again, in the gills there is a metabolite that occurs in sponges, but in 

this case it is the (+)pallescensin A (Atlas 344) enantiomer, not (-)pallescensin A (Atlas 339) 

(which occurs in D. areolata). A derivative of it occurs along the rim of the mantle. According to 

Okuda, Scheuer, Hochlowski, Walker and Faulkner (1983), polygodial (Atlas 235) and olepupuane 

(Atlas 237) occur in Dendrodoris tuberculosa and Dendrodoris nigra, as well as in Dendrodoris 

krebsi. Dendrodoris denisoni, from New Zealand, contains olepupuane (Atlas 237) and polygodial, 

as well as a similar compound, cinnamolide (Atlas 240), otherwise known from terrestrial plants 

(Grkovic, Appleton & Copp, 2005). Olepupuane was found to be transformed into polygodial via 

an intermediate methoxy acetal. However, the origin of polygodial from olepupuane was previously 

rigorously proved. 

In fact, olepupuane is the main metabolite present in the skin of Dendrodoris limbata (Photo 

58). It is a protected form of polygodial that is immediately delivered when the mollusk is molested 

(Cimino, Sodano & Spinella, 1998). Likewise the gonad of Dendrodoris limbata contains a mixture 

of 7-deacetoxy-olepupuane fatty acids (Atlas 236) that provision the eggs and protect them 

(Cimino, Sodano & Spinella, 1988; Avila, Cimino, Crispino & Spinella, 1991). The de novo synthesis 

of 7-deacetoxyolepupuane (Atlas 239) and its derivatives has been established by the incorporation 

of labeled mevalonic acid (Fontana, Ciavatta, Miyamoto, Spinella & Cimino, 1999). The 

biosynthetic pathway has been more rigorously confirmed by means of glucose labeled with 13C 

(Fontana, Villani & Cimino, 2000). 7-deacetoxyolepupuane is the only one of these sesquiterpenoids 

that is present in the juveniles (Avila, 1993). In the adults it is concentrated in the gills. It 

plays a pivotal role in the biosynthesis of the defensive compounds. On the one hand it forms drimane 

esters. It also gives rise to olepupuane, which is found in the mantle and is transformed into 

the more toxic polygodial (Atlas 235), which occurs in the mucus. It also gives rise to 6-acetoxyolepupuane 

(Atlas 238), which occurs in the mantle, and to 6-β-acetoxypolygodial (Atlas 241), 

which occurs in the mucus. 7-Deacetoxyolepupuane (Atlas 239) has also been found in a sponge 

of the genus Dysidea (Demospongiae: Dictyoceratida: Dysideidae), and this led to the suggestion, 

which we now believe is incorrect, that the metabolites found in the mollusks are of dietary origin


(Garson, Dexter, Lambert & Liokas, 1992). 

Dendrodoris grandiflora is closely related to D. limbata (Valdés & Gosliner, 1999). It also has 

the same pattern of drimane sesquiterpenoids. De novo synthesis has likewise been established 

experimentally (Cimino, De Rosa, De Stefano, Morrone & Sodano, 1985; Cimino & Sodano, 1994; 

Avila, Cimino, Crispino & Spinella, 1991; Fontana, Villani & Cimino, 2000). The steroids of this 

species have also been studied (Cimino, De Stefano, De Rosa, Sodano & Villani, 1980). Although 

the digestive gland contains an extraordinary series of typical sponge metabolites, none of these 

occur elsewhere in the body where they might be used defensively. In the field, D. grandiflora 

seems not to be associated with sponges, suggesting that it feeds, unlike the stenophagous D. limbata, 

upon a wide variety of them, perhaps small ones. In this respect it would be rather like the 

sacoglossan Thuridilla (see above). 

Dendrodoris arborescens, from the Pacific, was studied along with Dendrodoris limbata and 

Dendrodoris grandiflora in the biosynthetic work of Fontana, Ciavatta, Miyamoto, Spinella and 

Cimino (1999). The results were essentially the same. Sixteen drimane sesquiterpenoids (Atlas 

252-265), of which fourteen were new, have been described from a single 2 kg specimen of D. carbunculosa 

(Sakio, Hirano, Hayashi, Komiyama & Ishibashi, 2001). 

The other family of Porostomata, Phyllidiidae, consists of several genera, but only four of 

these have been studied from the point of view of chemical defense: Phyllidiopsis, Phyllidiella, 

Phyllidia and Reticulidia. The first of these genera is thought to have branched off first 

(Brunckhorst, 1993; Valdés & Gosliner, 1999). These animals have lost the flower-like gill that is 

present in most dorids. In all but one genus it has been replaced by secondary folds at the side of 

the foot. So far as is known, all of the animals in this group are defended by isocyanide terpenoid 

metabolites (Atlas 283-306) that occur in the sponges on which they feed. Such isocyanide terpenoids 

have been recorded from a large number of sponges of the orders Axinellida and 

Halichondrida. Their presence has been treated as an indication that the two orders are sister groups 

(Van Soest, 1991). De novo synthesis of defensive metabolites has not been recorded for this group 

of nudibranchs. There is weak but legitimate negative evidence against it, in that animals that are 

kept isolated do not replenish their defensive metabolites (Chang & Scheuer, 1990). 

Phyllidiopsis krempfi has been found to contain the same isocyanide terpenoids (Atlas 299- 

302) as a sponge, Acanthella cavernosa (Demospongiae: Halichondrida: Dictyonellida), upon 

which it feeds (Fusetani, Hirota, Okino, Tomono & Yoshimura (1996). The same sponge is the 

source for metabolites in Phyllidia species noted below. Valdés (2001) observes that Phyllidiopsis 

includes a very large proportion of the Phyllidiidae of deeper waters. Some of these are associated 

with hexactinellid sponges. Phyllidiopsis krempfi lives in shallow water. 

Dumdei, Flowers, Garson, and Moore (1997) gave labeled cyanide and thyocyanide to both 

Phyllidiella pustulosa (Photo 65) and the sponge upon which it feeds, Acanthella cavernosa 

(Demospongiae: Halichondrida: Dictyonellidae). These precursors gave rise to axisonitrile-2 

(Atlas 287) in the sponge, and the negative results on the nudibranch are in line with other failures 

to get evidence for biosynthesis by nudibranchs of this family. In the same species, which they 

called Phyllidia pustulosa, Kassühlke, Potts and Faulkner (1991) found nitrogenous sesquiterpenes 

(Atlas 290-294) such as 4α-isocyanogorgon-11-ene derived from Halichondria (Demospongiae: 

Halichondrida: Halichondriidae). On the other hand, Wright (2003) found that the same species, 

again referred to Phyllidia pustulosa, feeds largely on Phakellia carduus (Demospongiae, 

Halichondrida: Axinellidae). He isolated a new metabolite, 10-isothiocyano-4-cadinene (Atlas 

300), from them as well as axisonitrile-3 (Atlas 298) and various similar sesquiterpenoids. Quite a 

number of isocyanide terpenoids have been described from this species (see Okino, Yoshimura & 

Hirota 1996; Fusetani, Hiroto, Okino, Tomono & Yoshimura, 1996; Hirota, Okino, Yoshimura &



Fusetani, 1998). A series of nitrogenous diterpenes (Atlas 454-457) and sesquiterpenes (Atlas 303- 

305) were detected in Phyllidiella pustulosa from the South China Sea (Manzo, Ciavatta, 

Gavagnin, Guo & Cimino, 2004). The diterpenes are unusual for Phyllidia; all the others studied 

thus far are sesquiterpenes. Although these metabolites were concentrated in the mantle, they were 

also found in the internal organs. The main metabolite is an enantiomer of stylotellin, a sesquiterpene 

that has been found in a sponge identified as belonging to the genus Stylotella, which has been 

synonymized with Hymeniacidon (Demospongiae: Halichondrida: Halichondridae). 

In Phyllidia bourguini, Fusetani, Wolstenholme and Matsunaga (1990) found 9-isocyanopupukeanone 

(Atlas 283) and its epimer, 9-epi-9-isocyanopupukeanone (Atlas 284). 

In Phyllidia flava, recorded as Phyllidia pulitzeri, Cimino, De Rosa, De Stefano and Sodano 

(1982) described an isocyanoterpene (Atlas 298) obtained from Axinella (Demospongiae, 

Halichondrida: Axinellidae). Yasman, Edrada, Wray and Proksch (2003) described some new 9thiocyanopupukeanane 

sesquiterpenes (Atlas 313, 314) from Phyllidia varicosa and the sponge 

Axinyssa aculeata, upon which it feeds. In the closely related Phyllidia ocellata (Photo 64) (as P. 

pustulosa) Fusetani, Wolstenholme, Matsunaga, and Hirota (1991) found two new sesquiterpene 

isonitriles (Atlas 297, 298), and some nitrogenous sesquiterpenoids that were previously known 

from Acanthella (Atlas 295, 296) (Demospongiae: Halichondrida: Dictyonellidae) (Fusetani, 

Wolstenholme, Shinoda, Asai, Matsunaga, Onuki & Hirota, 1992). Fusetani, Hirota, Okino, 

Tomono, and Yoshimura (1996) got a variety of isocyanide and related sesquiterpenes from the 

sponge Acanthella cavernosa (Demospongiae: Halichondrida: Dictyonellidae) and from Phyllidia 

ocellata, Phyllidia varicosa, and Phyllidiopsis krempfi. From Phyllidia varricosa and the sponge 

upon which it was found feeding, Hymeniacidon (Demospongiae: Halichondrida: Halichondridae), 

Burreson, Scheuer, Finer, and Clardy (1975) isolated for the first time two tricyclic sesquiterpene 

isocyanides (Atlas, 283, 284). Okino, Yoshimura, Hirota, and Fusetani (1996) reported additional 

sesquiterpenes from Phyllidia ocellata (Photo 64), Phyllidia varicosa (Photo 61) and Phyllidella 

pustulosa. In Reticulidia fungia (Photo 66), Tanaka and Higa (1999) found sesquiterpenoids that 

have a rare functional group, N=CCl 2 (carbonimidic dichlorides). 

The Porostomata thus show two different patterns of metabolite usage. With the exception of 

the stenophagous Dendrodoris limbata, nudibranchs of the family Dendrodorididae feed on a wide 

variety of sponges, and this euryphagy seems to be facilitated by the capacity for de novo biosynthesis. 

Phyllidiidae evidently are restricted to a group of sponges that contain isocyanide terpenoids. 

They do not seem to be highly specialized so as to feed only upon a few sponges or utilize 

only a few metabolites, but this may be just an impression. They utilize very effective defensive 

metabolites from their food. There would seem to be no advantage for them to engage in de 

novo biosynthesis and that may be the reason why no evidence of it has been found. 

Having completed our discussion of the Porostomata, we may now turn to the Labiostomata, 

which are the remaining dorid nudibranchs. The first lineage, and sister group to all the remainder, 

consists of the Actinocyclidae, known only from our own unpublished work, and the 

Chromodorididae, which have been extensively studied and with very interesting results. Here we 

will present the materials following the tree published by Gosliner and Johnson (1999) and updated 

through personal communications with Johnson, but will simplify it by not bothering to discuss 

genera for which no chemical data are available. 

This tree differs in some respects from the more subjective one published by Rudman (1984). 

Rudman treated the genus Cadlina as the first branch of the Chromodorididae. According to 

Johnson it is not a chromodorid, but is the sister group to Aldisidae. We will consider Cadlina first 

without placing it within the tree. According to the scenario of Rudman and Bergquist (2007) the 

Chromodorididae have specialized so as to feed upon sponges that are not defended by spicules.


The Actinocyclidae they interpret as sometimes feeding on sponges of the family Halisarcidae 

(Demospongiae: Halisarcida), in which defensive metabolites are unknown, including Halisarca, 

which is neither spiculate nor fibrous. A more basal position of Cadlina would make this scenario 

even more plausible. 

┌ Actinocyclidae 

─┤ 

│┌ Glossodoris (some) and Ardeadoris 

└┤ ┌ Glossodoris (some) 

│ ┌┤ 

│┌┤└ Tyrinna 

└┤└ Chromodoris 

│┌ Ceratosoma 

└┤ ┌ Thorunna 

│┌┤ 

││└ Mexichromis 

└┤ 

│┌ Risbecia 

└┤ 

└ Hypselodoris 

The tree shows some species of Glossodoris forming a branch together with Ardeadoris, and 

others together with Chromodoris and Tyrinna. In other words, Glossodoris is biphyletic. 

Cadlina is a rather flattish animal with protective spicules in its tissues, supplementing its 

well-developed chemical defense. The main object of research has been Cadlina luteomarginata, 

which is quite common along the more northerly Pacific coasts of North America. There are some 

differences between the northern and southern populations, and they may actually be two distinct 

species. Be this as it may, the animal feeds upon a wide range of sponges, and a large number of 

metabolites derived from sponges have been isolated from it, all of them terpenoids (Gustafson, 

Andersen, He & Clardy, 1985; Tishler, Andersen, Choudhary & Clardy, 1991). These include isocyanides 

(Thompson, Walker, Wratten & Faulkner, 1982; Burgoyne, Dumdei & Andersen, 1993). 

Glaciolide (Atlas 386) is a degraded diterpenoid that also occurs in the sponge Aplysilla glacialis 

(Demospongiae: Dendroceratida: Darwinellidae) (Tischler & Andersen, 1989). Other terpenoid 

metabolites are biosynthesized de novo (Dumdei, Kubanek, Coleman, Pika, Andersen, Steiner & 

Clardy, 1997; Kubanek, Graziani & Andersen, 1997). These are the sesquiterpenoid albicanyl 

acetate (Atlas 246), and the degraded sesterterpenoids cadlinaldehyde (Atlas 479) and luteone 

(Atlas 480). Unlike the metabolites derived from food, they do not vary geographically. 

Experiments using labeled acetate and mevalonate gave good incorporation in all three of these 

metabolites. It was rigorously demonstrated that both the cadlinaldehyde and the luteone are produced 

through degradation of a common precursor, which is cleaved in two different places and 

then gets rearranged. Albicanyl acetate, the most repugnant compound, is accumulated in the eggs 

as well as the skin. 1α,2α-diacetoxy-albicanyl acetate (Atlas 244) is accumulated only in the eggs. 

The amount of material biosynthesized increases when the eggs are being produced. The other two 

compounds are mainly found in the integument. The animal has a fruity odor, which has been 

attributed to the luteone (Hellou, Andersen, Rafii, Arnold & Clardy, 1981; Hello, Anderson & 

Thompson, 1982). 

Cadlina limbaughorum and Cadlina flavomaculata selectively accumulate only one or two 

metabolites from a range of them (Thompson, Walker, Wratten & Faulkner, 1982). These include 

isonitriles identical to those from the sponge Axinella (Demospongiae, Halichondrida:



Axinellidae). The metabolites of two species from the Cantabrian Sea, Cadlina laevis and Cadlina 

pellucida, which are closely related to each other, have also been surveyed (Fontana, Gavagnin, 

Mollo, Trivellone, Ortea & Cimino 1995). A specimen of Cadlina pellucida is shown in Photo 67. 

The animals feed upon a wide variety of sponges, making it evident that euryphagy in the genus is 

a general rule. They contain a mixture of sesquiterpenes (Atlas 345-349) and sesterterpenoids 

(Atlas 465-466, 481). The sponges upon which Cadlina feeds are defended by spicules, unlike 

those that are fed upon by the nudibranchs that definitely belong to the Chromodorididae. 

As suggested above, Glossodoris is probably biphyletic, with one lineage branching off early 

and another more closely related to Chromodoris and Tyrinna. We will treat both groups of 

Glossodoris together, followed by Tyrinna. 

The sample of Glossodoris for which data on secondary metabolites are available contains a 

good representation of the various color groups of Rudman (1985) and therefore probably gives a 

fair idea of the range of variation. These groups are: 1) The Glossodoris atromarginata group; 2) 

the Glossodoris pallida group; 3) the Glossodoris sedna group; 4) the Glossodoris cincta/hikuerensis 

group. These assemblages appear to be consistent with the phylogeny worked out by Johnson 

(in progress). According to Rudman and Bergquist (2007), all of the species of Glossodoris for 

which data are available feed upon sponges of the family Thorectidae. Some of the organisms that 

have been studied, however, have been found to contain metabolites that are characteristic of 

Spongiidae and lack the ones that are characteristic of Thorectidae. To make sense out of the data 

we need to provide some basic information about the metabolites in question. 

All of the metabolites here considered are terpenoids. The ones that seem to derive from 

sponges of the family Spongiidae are typical diterpenoids (Somerville, Mollo, Cimino, Ruangprom 

& Garson, 2006). Those from Thorectidae are scalarane sesterterpenoids. These include scalaradial 

itself (Atlas 486) and two similar compounds, deacetylscalaradial (Atlas 487), and deoxoscalarin 

(Atlas 483). Scalaradial and deacetylscalaradial retain the dialdehyde configuration, whereas 

deoxyscalarin is a protected form of scalaradial and very likely has been modified by the nudibranchs. 

There also is a series of scalarane sesterterpenoids that have been modified by the nudibranchs 

in a manner without precedent in any other organisms (Manzo, Gavagnin, Somerville, 

Mao, Ciavatta, Mollo, Schupp, Garson, Guo & Cimino, 2007). The animals are able both to reduce 

the aldehyde group, generally at position 17, and to oxidize the hydroxy substituent at carbon 12. 

Consequently, whereas there is an acetyl group at position 12 in scalaradial and deoxoscalarin, it 

has been replaced by an oxo (=O) group in 12-keto scalaranes, such as 12-deacetoxy-12oxoscalaradial 

(Atlas 491), 12,16,-deacetoxy-12-oxo-scalarafuran (Atlas 492), and 19-acetyl-12deacetoxy-12-oxo-deoxoscalarin 

(Atlas 493). These compounds occur only in the nudibranchs, 

and they are considered enzymatically transformed detoxification products (Rogers & Paul, 1991; 

Avila & Paul, 1997; Fontana, Mollo, Ortea, Gavagnin & Cimino, 2000; Gavagnin, Mollo, Docimo, 

Guo & Cimino, 2004; Manzo, Gavagnin, Somerville, Mao, Ciavatta, Mollo, Schupp, Garson, Guo 

& Cimino, 2007). 

Glossodoris cincta (Photo 68) collected from Hurgada on the Red Sea and earlier misidentified 

as G. atromarginata, was found to contain nine spongian diterpenes (Atlas 429-437) (Fontana, 

Mollo, Ricciardi, Fakhr & Cimino, 1997; Wahidullah, Guo, Fakhr & Mollo, 2006). Specimens of 

G. cincta from Guam were found to contain scalaradial and a few other scalarane sesterterpenes 

including a protected form of scalaradial, 12-deacetyl-12-epi-scalaradial, heteronemin (Atlas 488), 

derived from sponges of the genus Hyrtios (Demospongiae: Dictyoceratida: Thorectidae) (Rogers 

& Paul, 1991). The heteronemin occurs in both the body of the slug and the eggs. However, 12ketoscalaranes 

have not been reported from this population. Like some of the other sponges upon 

which the nudibranch has been said to feed, Hyrtios belongs to the family Thorectidae, not


Spongiidae (Rudman & Bergquist, 2007). This finding has been reconfirmed. 

Specimens of Glossodoris hikuerensis from Guam contained scalarane compounds of dietary 

origin, in this case derived from sponges of the genus Hyrtios (Demospongiae: Dictyoceratida: 

Thorectidae). These did not include scalaradial (Atlas 486), 12-deacetoxy-12-oxo-scalaradial 

(Atlas 491), 12,16-deacetoxy-12-oxo-scalarafuran (Atlas 492), or any 12-ketoscalaranes, but they 

did contain heteronemin (Atlas 488), in the body but not in the eggs (Rogers & Paul, 1991; Manzo, 

Gavagnin, Somerville, Mao, Ciavatta, Mollo, Schupp, Garson, Guo & Cimino, 2007). The specimens 

of Glossodoris hikeuerensis from Guam, therefore, have a pattern of metabolites very close 

to that of G. cincta from the same area. Rudman and Bergquist (2006) point out that these species 

belong to a distinct group within the family, one in which the mechanism of delivering the metabolites 

is rather different from the rest. 

Glossodoris atromarginata presents a rather confusing pattern of geographical distribution and 

taxonomic uncertainty. At least some of the sponges purportedly of the family Spongiidae upon 

which they feed actually belong to the family Thorectidae, not Spongiidae (Rudman & Bergquist, 

2007). And, indeed, animals of this species collected in India contained three scalarane sesterterpenes 

including one 12-keto scalarane (Fontana, Cavaliere, Ungur, D’Souza, Parameswaran & 

Cimino, 1999; Fontana, Ciavatta, D’Souza, Mollo, Naik, Parameswaran, Wahidulla & Cimino, 

2001); all these are known from that family of sponges but only one was found to be present in the 

sponge upon which these nudibranchs fed. Animals from Sri Lanka (referred to as Casella atromarginata) 

on the other hand contained furanoditerpenes typical of Spongiidae (De Silva & 

Scheuer, 1982). A population from South-East Queensland, Australia, was found to contain a series 

of furanoditerpene compounds of the sort that occur in Spongiidae from a sponge that has been 

identified as Spongia sp. (Demospongiae: Dictyoceratida: Spongiidae) (Somerville, Mollo, 

Cimino, Rungprom & Garson, 2006). One of these (spongia-13(16),14-dien-3-one) (Atlas 438) 

was recovered from the internal organs as well as the mantle, three only from the internal organs, 

two from the mantle and one from the mantle glands. Surprisingly, the less polar compound (Atlas, 

433) was detected only in some mantle glands. 

More accurate studies on G. atromarginata from China confirmed the ability of the mollusk to 

selectively accumulate the fully acetylated spongiane in the mantle glands (E. Mollo, unpublished 

data) whereas the corresponding alcohol was detected mainly in the digestive glands. The acetate 

was extremely active as a feeding deterrent against the shrimp Palaemon elegans. Like the Sri- 

Lankan animals these ones depart from the usual pattern in Glossodoris of feeding only on sponges 

of the family Thorectidae rather than Spongiidae. There seems to have been a shift within 

Glossodoris from one taxon of sponges to another. The possibility that this is more than one species 

of nudibranch has not been excluded. 

Glossodoris sedna (as Chromodoris) was found to contain some homoscalarane derivatives 

(Atlas 509-512) with additional carbon atoms (Hochlowski, Faulkner, Bass & Clardy, 1983). As 

these tetracyclic terpenes were variable it was inferred that they were of dietary origin. Specimens 

of Glossodoris sedna from Costa Rica likewise contained only homoscalarane compounds of 

dietary origin (Fontana, Mollo, Ortea, Gavagnin & Cimino, 2000). 

Specimens of Glossodoris dalli from Costa Rica likewise contained scalarane compounds of 

dietary origin (Fontana, Mollo, Ortea, Gavagnin & Cimino, 2000). These included the modified 

form deoxoscalarin (Atlas 483) but no 12-ketoscalaranes (Manzo, Gavagnin, Somerville, Mao, 

Ciavatta, Mollo, Schupp, Garson, Guo & Cimino, 2007). 

Glossodoris pallida (Photo 69) from Guam has been found to contain scalaradial (Atlas 486) 

(as the main metabolite), deacetylscalaradial (Atlas 487), and deoxoscalarin (Atlas 483) (in both 

the body and the eggs), but no 12-ketoscalaranes (Rogers & Paul, 1991; Manzo, Gavagnin,



Somerville, Mao, Ciavatta, Mollo, Schupp, Garson, Guo & Cimino, 2007). It is said to feed almost 

exclusively on sponges of the genus Cacospongia (Demospongiae: Dictyoceratida: Thorectidae), 

for which there have been some problems of identification. According to Rudman and Bergquist 

(2006) it feeds on Semitaspongia (Demospongiae: Dictyoceratida: Thorectidae). 

On the other hand, Glossodoris pallida from Hainan contains deoxoscalarin, but neither 

deacetylscalaradial nor scalaradial itself. It does contain six other scalarane compounds (Atlas 491- 

496), including four 12-ketoscalaranes among which is 12-deacetoxy-12-oxoscalaradial (Atlas 

491) (Manzo, Gavagnin, Somerville, Mao, Ciavatta, Mollo, Schupp, Garson, Guo & Cimino, 

2007). 

A very similar distribution pattern has been found in Glossodoris rufomarginata (Photo 70) 

from Hainan (Gavagnin, Mollo, Docimo, Guo & Cimino, 2004), but fewer metabolites were 

recorded. Again, it contains deoxoscalarin and some 12-ketoscalaranes, including 12-deacetoxy- 

12-oxoscalaradial (Atlas 491), but only three of them, all of which occur in G. pallida. G. rufomarginata 

was misidentified as Chromodoris youngbleuthi and said to feed upon a spongid, whereas 

it actually feeds upon a thorectid (Terem & Scheuer, 1986; see Rudman & Bergquist, 2007). 

Glossodoris averni (Photo 71), from Moolooloba, Australia, again displayed a rather similar 

pattern (Manzo, Gavagnin, Somerville, Mao, Ciavatta, Mollo, Schupp, Garson, Guo & Cimino, 

2007). Again, it contains only one scalaradial epimer, deoxoscalarin (Atlas 481), and some 12ketoscalaranes, 

including 12-deacetoxy-12-oxoscalaradial (Atlas 491), but only two of them plus 

one other. 

Glossodoris vespa (Photo 72), also from Moolooloba, Australia, contained no scalaradial 

epimers, but it did contain one 12-ketoscalarane, namely12-deacetoxy-12-oxo-scalaradial (Atlas 

491), and also another scalarane derivative, 16-deacetoxyscalarafuran (Atlas 498). 

Very little is known about the chemical defense of Tyrinna. It has reduced spicules, hinting at 

a trend that goes on within the family. Tyrinna nobilis from Patagonia was found to contain a mixture 

of furanosesquiterpenoids (Atlas 326) and a seco-11,12-spongian diterpenoid, tyrinnal (Atlas 

449) (Fontana, Muniaín & Cimino, 1998). 

Chromodoris is a large and mainly tropical to semitropical genus that has been extensively 

sampled by natural products chemists. As a general rule, they contain rearranged spongiane diterpenoids 

that are concentrated in the mantle rim, rather than in mantle dermal formations. They tend 

to be quite colorful, as the name suggests. A particularly striking example is Chromodoris quadricolor, 

shown in Photo 73. Like Cadlina they are generally rather stout and flattish animals, but 

unlike Cadlina they lack spicules in the integument. The phylogeny of the genus has been studied, 

but not to the extent that we would like for our purposes. A recent molecular study indicates that 

the group can be divided into two clades that can be diagnosed on the basis of the structure of the 

egg masses (Wilson & Lee, 2005; see also Wilson, 2002). Rebecca Johnson has kindly provided us 

with additional data based on her as yet unfinished molecular and morphological research. 

For the first of these two clades (the “black line group”), data on secondary metabolites are 

available for three species: the more basal Chromodoris elisabethina (Photo 74) and a more closely 

related pair of species, Chromodoris lochi (Photo 75) and Chromodoris hamiltoni (Photo 76). 

Latrunculins are nitrogenous macrolides that seem to be characteristic of this clade. It is believed 

that they are produced by symbionts of the sponges (personal communication from P. T. Murphy 

to Rudman & Bergquist 2007). Latrunculin-A (Atlas 617) was originally found in Chromodoris 

elisabethina (Okuda & Scheuer, 1985). Its name derives from one of the sponges that this slug eats, 

and from which it obtains the metabolite, originally identified as Latrunculia magnifica, but probably 

Negombata (Demospongiae: Poecilosclerida: Mycalina: Podospongiidae). It also occurs in


some sponges of the order Dictyoceratida and family Thorectidae. The latrunculin-A protects the 

nudibranch from predation by fish. 

Chromodoris lochi, which, like its associated sponge, supposedly Spongia mycofijiensis 

(Demospongiae: Dictyoceratida: Spongiidae), but evidently Petrosaspongia mycofijiensis 

(Demospongiae: Dictyoceratida: Thorectidae), contains the sesquiterpenoid dendrolasin (Atlas 

346) and latrunculin-A (Atlas 617) (Kakou, Crews & Bakus, 1987). The same species of nudibranch 

also contains the macrocyclic fatty acid lactones laulimalide (Atlas 49) and isolaumalide 

(Atlas 50) that derive from a sponge identified as Hyattella sp. (Demospongiae: Dictyoceratida: 

Spongiidae) (Corley, Herb, Moore, Scheuer & Paul, 1988). Animals of several other Chromodoris 

species were also observed feeding on the same sponge. Chromodoris hamiltoni, from South 

Africa, was found to contain both latrunculin-A (Atlas 617) and latrunculin-B (Atlas 618), a series 

of four chlorinated homoditerpenes (hamiltonins A-D) (Atlas 425-428) and a new sesterterpene, 

hamiltonin E (Atlas 502) (Pika & Faulkner 1995). In another study on specimens of the same 

species from Mozambique, there were found latrunculin-B (Atlas 618) and two new spongian 

diterpene lactones, 7β,11β-diacetoxy-16-oxospongian-17-al (Atlas 423), and 7β,11β-diacetoxy-16oxospong-12-en-17-al 

(Atlas 424) (McPhail & Davies-Coleman, 1997). 

In the second group the majority are Indo-West Pacific, but what appears to be an early branch 

occurs in the Atlantic. Specimens of Chromodoris luteorosea (Photo 77) from both Italy and Spain 

were found to contain the rearranged diterpenoids luteorosin (Atlas 418) and macfarlandin-A 

(Atlas 417) (Cimino, Crispino, Gavagnin & Sodano 1990; Gavagnin, Vardaro, Avila, Cimino & 

Ortea, 1991). (For a general review on diterpenoids in opisthobranchs, see Gavagnin & Fontana, 

2000).The Italian specimens also contained aplysillins (Atlas 419, 420) similar to those that occur 

in the sponge Aplysilla rosea (Demospongiae: Dendroceratida: Darwinellidae), upon which the 

animal is suspected of feeding (Kazlauskas, Murphy, Wells & Daly, 1979). The Spanish specimens 

also contained a similar diterpenoid, norrisolide (Atlas 384). Some of these compounds had 

already been found from nudibranchs collected in the Eastern Pacific. The norditerpene acetate 

macfarlandin-A (Atlas 417), which resembles metabolites found in Aplysilla sulphurea 

(Demospongiae: Dendroceratida: Darwinellidae), was originally found in Chromodoris macfarlandi 

(Photo 100) (Molinski & Faulkner, 1986; Molinski, Faulkner, He, Van Duyne & Clardy, 1986). 

Norrisolide (Atlas 384) and similar compounds were found in Chromodoris norrisi (Photo 84) 

(Hochlowski, Faulkner, Matsumoto & Clardy, 1983). It resembles metabolites from Aplysilla 

polyraphis (Demospongiae: Dendroceratida: Darwinellidae) (Bobzin & Faulkner, 1989). Again, 

Chromodoris marislae (Photo 78) likewise contains rearranged diterpenoids derived from sponges 

(Hochlowski & Faulkner, 1981). This second group obviously specializes on sponges of the order 

Dendroceratida and family Darwinellidae, as has been emphasized by Rudman and Bergquist 

(2007). 

Rearranged diterpenoids have also been found in Chromodoris from the Indian Ocean. De 

Silva, Morris, Miao, Dumdei and Andersen (1991) described several of them, such as shahamin K 

(Atlas 396), from the integument of Chromodoris gleniei, Chromodoris geminus (Photo 79), 

Chromodoris annulata (Photo 80), and “Chromodoris inopinata” (probably C.. reticulata or C. 

tinctoria) collected in Sri Lanka. Chromodoris cavae contains two others, chromodorolides A 

(Atlas 394) and B (Atlas 395) (Dumdei, De Silva, Andersen, Coudhary & Clardy, 1989; Morris, 

De Silva & Andersen 1991). Chromodoris obsoleta has been found to contain a series of spongian 

diterpenoids called dorisenones (Atlas 407-409) (Miyamoto, Sakamoto, Arao, Komori, Higuchi & 

Sasaki, 1996). “Chromodoris inornata” (subsequently reidentified as C. orientalis, but evidently C. 

aspersa) from Japan was found to contain toxic sesterterpenoids (Miyamoto, Sakamoto, Amano, 

Higuchi, Komori & Sasaki, 1992). Three of these were cytotoxic inorolides (Atlas 485, 499, 500),



six were scalarins, and two were scalarobutenolides. Miyamoto (2006) proposed that all of these 

molecules could be derived from a common precursor, cheilanthane, by different kinds of ring closure 

for each of the three classes of metabolites. Sesterterpenoids have also been found in 

“Chromodoris funerea” (C. lineata) (Carté, Kernan, Barrabee & Faulkner, 1986). Some display the 

scalarane skeleton, whereas others, such as luffariellins C and D (Atlas 477, 478), are monocyclic 

sesterterpenoids. A comparison of specimens from inside and outside a marine lake in Palau 

showed that the former sample contained only sesterterpenes, whereas the others contained a wide 

range of other metabolites, including polybrominated biphenyl esters. Evidently the animals are not 

dependent on a particular diet for their defensive metabolites (Kernan, Barrabee & Faulkner, 1988). 

Specimens of Chromodoris reticulata (not C. inopinata) (Photo 81) from the South China Sea 

were separated into mantle and visceral portions and their metabolites identified (Carbone, 2007). 

The mantle was found to contain three diterpenoids with a spongian skeleton. 7-α-acetoxy-spongian-16-one 

(Atlas 416) is known from the sponge Aplysilla rosea (Demospongiae: 

Dendroceratida: Darwinellidae) and also occurs in Chromodoris inopinata and what may be a synonym 

for it, C. obsoleta. 7α-acetoxydendrillol-3 (Atlas 415) has also been found in C. obsoleta. 

Aplysioroseol-2 is known from sponges. Traces of it occur in the digestive gland and much higher 

concentrations in the mantle tissues, indicating that it is actively concentrated by the slug. 

Chromodoris geometrica seems to be a mimic of porostome dorids of the family Phyllidiidae, 

as can be seen from Photo 59, in which this animal is shown crawling over a specimen of Phyllidia 

pustulosa. Specimens from Hainan were separated into mantle and visceral samples and their 

metabolites identified. Recovered were the rearranged diterpenoids macfarlandin-E, which is 

known from C. macfarlandi, dendrillolide-A (Atlas 404), known from a sponge, and norrisolide 

(Atlas 384), also known from C. norrisi. 

The previous finding of spongian diterpenoids from “Ceratosoma brevicaudatum” (Ksebati & 

Schmitz, 1987), later identified as Chromodoris epicuria, further confirmed the typical 

Chromodoris chemical pattern (Ksebati & Schmitz, 1988). 

What has been called “Chromodoris petechialis” has been found to contain spongiane-16-one 

(Karuso & Scheuer, 2002). 

In general, then, the metabolites recovered from Chromodoris specimens are diterpenoids, but 

occasionally there are sesterterpenoids. These exceptions occur in two distinct clades, but the data 

now available do not tell us whether the sesterterpenoids occur in closely related animals in the second 

group. Latrunculins seem to occur in closely related animals that feed on a particular group of 

sponges, but the sponges are not closely related; rather they have the same metabolites. It seems 

likely that within the genus as a whole there is a trend in the direction of increased feeding specificity 

and the use of a smaller range of defensive metabolites. But this specialization has not been 

complete. 

The remaining genera within the Chromodorididae tend to be more elongate than 

Chromodoris, and there seems to be a general trend toward the animals having somewhat higher 

bodies and a less extensive dorsum, so that they do not hug the substrate so closely. Such a configuration 

is etymologically expressed by the name of the genus Hypselodoris. A more extreme development 

of this tendency is seen in the genus Ceratosoma. 

Ceratosoma 

Ceratosoma has a distinctive body shape, as can be seen from Photos 84 and 85. The side of 

the foot is quite high and the notum is considerably reduced. Accompanying this development there 

are projections of the body in the vicinity of the gill, which are armed with repugnatorial glands.


The color pattern is such that it diverts the attention of potential predators away from the gill and 

toward the repugnatorial glands. It is easy to imagine how a fish nibbling at the nudibranch would 

get a dose of distasteful chemicals in its mouth. In Ceratosoma brevicaudatum these are said to be 

sesquiterpene furans and thiosesquiterpenes (Ksebati & Schmitz, 1988). There are also furanosesquiterpenoids 

in C. trilobatum (Photo 84) and C. gracillimum (Photo 85) (Mollo, Gavagnin, 

Carbone, Guo & Cimino, 2005; Wahidulla, Guo, Fakhr & Mollo, 2006), the main one being (-)furodysinin 

(Atlas 328), which is both deterrent and toxic to fish. These compounds are known 

from sponges of the genus Dysidea (Demospongiae: Dictyoceratida: Dysideidae) (Cimino, De 

Stefano, Guerriero & Minale, 1975). These metabolites are concentrated in the repugnatorial 

glands. Surprisingly Grkovic, Appleton, and Copp (2005) recently reported having found a typical 

red algal metabolite, the terpenoid allalaurinterolacetate (Atlas 282), in Ceratosoma amoena from 

New Zealand and in an alga, Hymenea variolosa, upon which it was collected. They explained this 

anomaly by suggesting that although the mollusk is a carnivore it could also prey upon eggs of herbivores, 

such as Aplysia, that feed upon red algae containing halogenated sesquiterpenoids. Other 

possibilities might well be considered. For starters, some dorid nudibranchs that feed upon sponges 

also eat detritus (Kitting, 1991). 

The remaining Chromodorididae consist of Thorunna and Mexichromis plus Risbecia and 

Hypselodoris. Provisionally we assume that these are a single clade with two branches, each made 

up of two genera. In general they feed upon sponges of the family Dysideidae in the order 

Dictyoceratida. 

Thorunna 

Thorunna daniellae, formerly placed in Hypselodoris, is the only representative of its genus 

for which data on secondary metabolites have been studied (Schulte & Scheur, 1982). It contains 

the sesquiterpenoid spiniferin-2 (Atlas 332), which originally was found in the sponge 

Pleraplysilla spinifera (Demospongiae: Dictyoceratida: Dysideidae). Nudibranchs of this genus 

are known to feed upon sponges of the family Dysideidae. 

Mexichromis 

Mexichromis (Photo 87-88) is now understood to be the sister group of Risbecia and 

Hypselodoris, from which it was separated. What is now called Mexichromis porterae (Photo 88) 

contains the sesquiterpenoids furodysinin (Atlas 328) and euryfuran (Atlas 342, 343), derived 

from Dysidea amblia (Demospongiae: Dictyoceratida: Dysideidae) (Hochlowski, Walker, Ireland 

& Faulkner 1982). Such metabolites are typical of Risbecia and Hypselodoris, which are the 

remainder of this clade and will now be considered. 

Risbecia 

Risbecia godfroyana, previously placed in Hypselodoris, was found to contain two furanosesquiterpenoids 

derived from the sponge Dysidea fragilis (Demospongiae: Dictyoceratida: 

Dysideidae) (Schulte, Scheuer & McConnell 1980). Similar metabolites occur in Risbecia pulchella 

from the Red Sea (Photo 89) (Ernesto Mollo, personal communication). Photo 90 shows 

Risbecia imperialis. 

Hypselodoris 

Gosliner and Johnson (1999) based their phylogeny of Hypselodoris on morphology. They 

also analyzed the biogeography of the various lineages within the genus. They distinguished two



major clades. The first is an Indo-Pacific clade. Although this group is the more diverse of the two 

at the species level, data on its metabolites are sparse. Indeed metabolites have only been described 

from three species, Hypselodoris nigrostriata, H. capensis, and H. maridadilus. The other occurs 

in the Atlantic and the Eastern Pacific. The richer literature on the second group may have something 

to do with its accessibility to two major centers of research on marine natural products chemistry! 

Within the second group, Hypselodoris orsini, from the Mediterranean, is understood to have 

branched off before the rest of them. These form two clades, one largely Atlantic, the other from 

the Pacific coast of North America. We will treat them in that order. 

Beginning with the Indo-Pacific clade, Hypselodoris capensis (Photo 91) contains terpenoids 

that would seem to be derived from an unidentified species of the sponge Fasciospongia 

(Demospongiae: Dictyoceratida: Thorectidae) (McPhail, Davies-Coleman & Coetzee 1998). The 

slugs were found to contain linear β-substituted furan sesterterpenes (Atlas 471-473) as well as 

sesquiterpenes such as nakafuran-8 (Atlas 338). Hypselodoris maridadilus (Photo 92) contains 

nakafurans, which are furanosesquiterpenes, derived from the sponge Dysidea fragilis 

(Demospongiae: Dictyoceratida: Dysideidae) (Schulte, Scheuer & McConnell, 1980). 

Hypselodoris nigrostriata (Photo 93), which ranges from the western Indian Ocean to Hong Kong 

contains the sesquiterpenoid furodysinin (Atlas 328), which also occurs in sponges of the genus 

Dysidea (Fontana, Ciavatta, D’Souza, Mollo, Naik, Parameswaran, Wahidulla & Cimino, 2001). It 

is the major metabolite in the repugnatorial glands of these beautiful animals. 

Turning now to the Atlantic/Pacific clade, Hypselodoris villafranca (Photo 94), recorded as H. 

gracilis by Cimino, De Stefano, De Rosa, Sodano, and Villani (1980) and as H. villafranca by 

Avila, Cimino, Fontana, Gavagnin, Ortea and Trivellone (1991), was found to contain furanosesquiterpenoids 

(Atlas 347-349) derived from Dysidea fragilis (Demospongiae: 

Dictyoceratida: Dysideidae) and typical of that genus. The metabolites are concentrated in the 

digestive gland, mucus, and mantle dermal formations. 

Hypselodoris orsini, (Photo 95) formerly called H. coelestis, has often been misidentified as 

Glossodoris tricolor. It contains sesterterpenoids rather than sesquiterpenoids, making it one of the 

occasional exceptions (together with H. capensis and H. ghiselini) to the rule in its genus (Cimino, 

Fontana, Giminéz, Marin, Mollo, Trivellone & Zubia, 1993). It feeds upon the sponge 

Cacospongia mollior (Demospongiae: Dictyoceratida: Thorectidae), which is rich in scalaradial 

(Atlas 486). It then modifies this metabolite by selective transformations including the oxidation 

of deoxoscalarin (Atlas 483) to 6-keto-deoxoscalarin (Atlas 489), which gets transferred to the 

mantle dermal formations (Cutignano & Fontana, personal communication). Because this modified 

metabolite seems to be biologically inactive, it has been speculated that the mantle dermal formations 

are serving as a kind of excretory organ (Avila & Dufort, 1996). 

A wide range of furanosesquiterpenoids have been derived from Hypselodoris cantabrica, 

which is the sister group of the remaining species to be discussed (Fontana, Avila, Martinez, Ortea, 

Trivellone & Cimino, 1993). 

The remaining species of Hypselodoris are thought to form a monophyletic unit with two 

major branches. The first of these contains Hypselodoris bayeri and the closely related 

Hypselodoris zebra and Hypselodoris picta (formerly Hypselodoris webbi). 

Hypselodoris zebra and Hypselodoris picta are closely related. Hypselodoris zebra from the 

Pacific contains furanosesquiterpenes that also occur in the sponge Dysidea etheria 

(Demospongiae: Dictyoceratida: Dysideidae) (Grode & Cardellina, 1984). Hypselodoris picta 

(Photo 97) contains furanosesquiterpenoids (Fontana, Giménez, Marin, Mollo & Cimino, 1994). 

In this paper it was rigorously proved that the mollusk is able to transfer sponge metabolites into 

mantle dermal formations that are strategically placed along the border of the mantle. Related to


them is Hypselodoris bayeri, which again contains furanosesquiterpenoids (Fontana, Trivellone, 

Mollo, Cimino, Avila, Martinez & Ortea, 1994). 

The remaining branch consists mainly of Eastern Pacific animals (Hochlowski, Walker, 

Ireland & Faulkner, 1982). Hypselodoris agassizi (Photo 98) is thought to be the sister group of 

Hypselodoris californiensis and Hypselodoris ghiselini. Hypselodoris agassizi was found to contain 

a sesquiterpene furan, agassizin (Atlas 327). Specimens of Hypselodoris californiensis (Photo 

99) from the Gulf of California contained the sesquiterpenes dendrolasin (Atlas 346) and nakafuran 

8 (Atlas 338), whereas specimens from San Diego contained furodysinin (Atlas 343), euryfuran 

(Atlas 342) and pallescensin A (Atlas 344). Nakafuran-8 and nakafuran-9 (Atlas 338, 349) 

have been found in sponges of the genus Dysidea (Demospongiae: Dictyoceratida: Dysideidae). 

Hypselodoris ghiselini (Photo 100) contained a diterpene epoxide called ghiselinin (Atlas 396) and 

also the sesquiterpenoids dendrolasin (Atlas 346), nakafuran-9 (Atlas 349) and a methoxy butenolide. 

H. orsini, H. capensis and H. ghiselini are the three known exceptions to the rule that 

Hypselodoris contains only furanosesquiterpenoids. It would appear that Hypselodoris ghiselini is 

less specialized in its use of a range of metabolites than the generality of its genus. If it occupied a 

more basal position in the tree, one would suspect that this euryphagy is primitive; but, given its 

close relationship to trophic specialists, this condition is probably secondary. The similarities in 

coloration among Hypselodoris agassizi, Hypselodoris californicus, and Hypselodoris ghiselini 

suggest a mimetic complex among these aposematic organisms. Some specimens of the cephalaspidean 

Navanax inermis collected in the same area also display a similar pattern, as does a flatworm. 

The remaining dorids constitute a single lineage. They have been divided into two main 

groups, which Valdés (2002) calls the families Dorididae and Discodorididae. 

The Dorididae for which we have chemical data are Aldisa, which is basal to the remainder 

(and probably the sister group of Cadlina), Doris, and two genera which are probably quite closely 

related: Archidoris and Austrodoris (of which Anisodoris is considered a synonym). The relationships 

between them are shown in the following tree: 

┌ Aldisa 

─┤┌ Doris 

└┤┌ Archidoris 

└┤ 

└ Austrodoris 

Aldisa sanguinea contains steroids (Atlas 572, 573), one of which repels predators (Gustafson 

& Andersen, 1982, 1985). They occur only in the integument, not in the digestive gland, and the 

sponge upon which it feeds has neither of those found in the nudibranch, but instead contains the 

non-repellant steroid cholestenone. Evidently steroids from the food are modified by the slug. 

Aldisa smaragdina, from the Mediterranean contains a structurally similar steroid which could 

have the same steroid (Atlas 574) precursor (Gavagnin, Ungur, Mollo, Templado & Cimino, 2002). 

However, 3-ketosteroids were completely absent from the sponge on which the animal lives. Photo 

101 shows this animal well concealed on the sponge, which has been identified as Phorbas fictitius 

(Poecilosclerida: Myxillina: Hymedesmiidae). 

Doris verrucosa (Photo 103) contains toxic esters called verrucosins (Atlas 529, 530). These 

are diterpenoic acid diglycerides (Cimino, Gavagnin, Sodano, Puliti, Mattia & Mazzarella, 1988; 

Avila, Ballesteros, Cimino, Crispino, Gavagnin & Sodano, 1990; Gavagnin, Ungur, Castelluccio & 

Cimino, 1997; De Petrocellis, Orlando, Gavagnin, Ventriglia, Cimino & Di Marzo, 1996). The verrucosins 

do not occur in the sponge, Hymeniacidon sanguinea (Demospongiae: Halichondrida: 

Halichondridae), upon which the nudibranch feeds, nor do they occur in the digestive glands. Initial



results suggesting de novo biosyntheses were confirmed experimentally in a paper by Gustafson 

and Andersen (1985). More direct evidence was provided by experiments with labeled glucose and 

pyruvate, showing how they are incorporated in the molecules (Fontana, Tramice, Cutignano, 

D’Ippolito, Renzulli & Cimino, 2003). Doris verrucosa also biosynthesizes an unusual nucleoside 

(Atlas 609), which is an analog of methylthioadenosine, and uses it defensively in its eggs 

(Cimino, Crispino, De Stefano, Gavagnin & Sodano, 1986; 2877; Porcelli, Cacciapuoti, Cimino, 

Gavagnin, Sodano & Zappia, 1989). 

The same nucleoside has been found in animals from Brazilian waters that would appear to be 

of the same species (Granato, Berlink, Magaljaes, Scheffer, Ferreira, De Sanctis, De Freitas, Hajdu 

& Migotto, 2000). In Doris odhneri (Photo 102) and D. montereyensis (Photo 104), reported as 

the synonymous genus Archidoris (Anderson & Sum, 1980; see also Gustafson & Andersen 1985), 

some terpenoid acid glyceride esters (Atlas 523-526; 535-537) were found. De novo synthesis of 

such glycerides was established by injection of labeled mevalonate (Gustafson, Andersen, Chen, 

Clardy & Hochlowski, 1984). Feeding experiments with stable isotopes confirmed these results 

(Graziani, Andersen, Krug & Faulkner, 1996). In addition, biosynthesis was proven for the 

sesquiterpenoid glycerides (Atlas 527, 528) from Doris tanya (as Sclerodoris tanya) (Photo 105). 

This animal was found to contain sesquiterpenoids linked to glycerol in the same way as the diterpenoids 

found in other Dorididae (Krug, Boyd & Faulkner, 1995). The presence of tanyolide A 

(Atlas 527) and tanyolide B (Atlas 528) in the mantle but not in the digestive glands suggested de 

novo synthesis. One of these compounds, tanyolide B, was subsequently shown conclusively to be 

synthesized de novo by injection of labeled 2- 13C mevalonolactone (Graziani, Andersen, Krug & 

Faulkner, 1996). 

Doris pseudoargus, originally misidentified as Archidoris tuberculata, was found to have acylglycerols 

(Atlas 532) esterified in position 2-sn by diterpenoid acids (Cimino, Crispino, Gavagnin, 

Trivellone, Zubia, Martinez & Ortea, 1993; Zubia, Gavagnin, Crispino, Martínez, Ortea & Cimino 

1993). Their presence in the integument but not the digestive gland again was strongly suggestive 

of de novo synthesis. Huysecom, Van de Vyver, Braekman and Daloze (1999) characterize this 

species as being euryphagous and preferring to feed upon non-toxic sponges. This again makes 

sense in an animal that relies upon metabolites that it biosynthesizes rather than obtaining them 

from food. Soriente, Sodano, Reed, and Todd (1993) independently described the same diacylglycerol, 

but with the diterpenoid erroneously linked at position 1-sn, from what they called Archidoris 

pseudoargus. They found that it was toxic to fish. 

In addition, the same pair of diterpenoid glycerides (Atlas 536, 537), previously described 

from Doris montereyensis (Gustafson & Andersen 1985) was detected. Apparently identical compounds 

(Atlas 533, 534) differing only in stereochemistry of the diterpenoid were found in 

Anisodoris fontaini, discussed originally as Anisodoris carvi. The absolute stereochemistry of the 

diterpenoid is the opposite (Gavagnin, Ungur, Castelluccio, Muniain & Cimino 1998). 

Austrodoris, as the name suggests, is a southern genus and much of the work on it has been 

done in Antarctica and adjacent regions. It is now considered a synonym of Doris, and we will follow 

that innovation here. Doris kerguelenensis was found to contain diterpenoic acid glycerides 

(Atlas 552-556) that resemble those of other Doris species, which are known to be synthesized de 

novo (Davies-Coleman & Faulkner 1991). According to a personal communication to these authors 

the animals feed on sponges of the class Hexactinellida, but no metabolites were found in the 

sponges, again suggesting de novo synthesis. Wägele (1989) confirms the observation that the slug 

sits on hexactinellids (Rossella and Scolymastra). On the other hand, Barnes & Bullough (1996) 

say that this species is a specialist on Dendrilla antarctica, a sponge of the class Demospongiae 

(Dendroceratida: Darwinellidae). Evidently the association is not obligatory as had been suspect-


ed. Gavagnin, Trivellone, Castellucio, Cimino and Cattaneo-Vietti (1995) described a glyceryl 

ester of a halimane diterpenoic acid (Atlas 558) from the integument of this species. The compound 

is probably biosynthesized de novo (Gavagnin, Fontana, Ciavatta & Cimino, 2000). The 

metabolites do not occur in the gut, pointing to the same conclusion. The echinoderm Odontaster 

validus is deterred by diterpene diacylglycerides and monoglycerides of regular fatty acids that 

occur in the mantle tissue (Iken, Avila, Fontana & Gavagnin, 2002). Nor-sesquiterpenes (Atlas 

248, 249) have been characterized (Gavagnin, Carbone, Mollo & Cimino, 2003a) and confirmed 

by synthesis (Gavagnin, Carbone, Mollo & Cimino (2003b). They turn out to have the same stereochemistry 

as similar metabolites from other dorids. 

Thus the animals that we have just surveyed under the rubric of Dorididae generally contain 

terpenoid esters in the integument, and there is much evidence for these being biosynthesized de 

novo. They also frequently contain other metabolites, some of which are obtained from food. The 

earliest branch of this group for which we have data, Aldisa, does not fit this pattern, but instead 

contains steroids perhaps derived from food, but modified. We defer considering whether this is 

what the common ancestor did, or whether it is a specialization of this genus. 

Let us now turn to the other branch, or Discodorididae of Valdés (2002). These are the remainder 

of the dorids and have been broken down into two clades, as represented in the following tree: 

┌ Sclerodoris 

┌┤ 

┌┤└ Jorunna 

─┤└ Diaulula 

│┌ Peltodoris 

└┤┌ Paradoris 

└┤┌ Halgerda 

└┤ 

└ Asteronotus 

We will first consider the clade that has been diagnosed on the basis of possessing caryophyllidia, 

which are specialized sensory organs of unknown function on the dorsal surface (Valdés & 

Gosliner, 2001). The genera for which data on secondary metabolites are available are Diaulula 

and Jorunna. 

Diaulula sandiegensis (Photo 106) was found to contain nine chlorinated polyacetylenes 

(Atlas 3-11) (Walker & Faulkner, 1981). A variety of sponges were found in the animal’s gut, but 

none of these contained acetylenes. Later, however, these polyacetylenes plus two new ones were 

recovered from the sponge Haliclona lunisimilis (Demospongiae: Haplosclerida: Haplosclerina: 

Chalinidae) (de Jesus & Faulkner, 2003). However, the absence of ketones in the sponge led the 

authors to suggest that the mollusk is able to synthesize these compounds by oxidation of the corresponding 

alcohols. Acetylenes are rare in marine organisms though they sometimes occur in 

algae, sponges and corals. From a sample taken in a more northerly part of the range, two new 

steroids, diaulusterols A and B (Atlas 577, 578), which resemble various hormones, were obtained 

from skin extracts (Williams, Ayer & Andersen, 1968). There is compelling experimental evidence 

for biosynthesis of the polyacetate portion of the molecule, but not for the steroid part (Kubanek 

& Andersen, 1999). 

Jorunna funebris, shown in Photo 107, was found to contain isoquinoline quinones (Kubo, 

Kitahara & Nakahara, 1989). These were said to come from an otherwise unidentified sponge of 

the genus Xestospongia (Demospongia: Haplosclerida: Petrosina: Petrosiidae). From the integument 

and mucus of animals of the same species there was also isolated an isoquinoline alkaloid, 

jorumycin (Atlas 629), similar to ones known from bacteria, sponges and tunicates (Fontana,



Cavaliere, Wahidulla, Naik & Cimino, 2000). The nudibranch was taken from a sponge of the 

genus Oceanapia (Demospongia: Haplosclerida: Petrosina: Phleodictyidae), which did not contain 

such metabolites, although it did contain the monomeric isoquinolines, which may be breakdown 

products of jorumycin. Specimens from Thailand contained three new isoquinoline alkaloids 

(Atlas 630) together with previously known ones (Charupant, Suwanborirux, Annuoypol, Saito, 

Kubo & Saito, 2007). A derivative of one of these alkaloids, Zalapsis®, is now undergoing clinical 

trials as an anticancer drug. 

The remaining Discodorididae lack caryophyllidia but have a notched anterior end of the foot 

and digitate oral tentacles. Taken in order of branching, the genera of interest here are: Peltodoris, 

Paradoris, Asteronotus, and Halgerda. 

In Peltodoris atromaculata (Photo 110) a variety of sterols and high-molecular-weight polyacetylenes 

(Atlas 12, 13) have been found, all supposedly derived from the sponge Petrosia ficiformis 

(Demospongia: Haplosclerida: Petrosina: Petrosiidae) (Castiello, Cimino, De Rosa, De 

Stefano, Izzo & Sodano, 1979; Castiello, Cimino, De Rosa, De Stefano & Sodano, 1980; Cimino, 

de Stefano, De Rosa, Sodano & Villani, 1980; Guo, Gavagnin, Trivellone & Cimino, 1994). The 

steroid petrosterol (Atlas 569) was present in both the sponge and the nudibranch. Behavioral 

experiments using Y-tubes showed that the nudibranchs prefer the sponge and also an aqueous 

extract of it, but not extracts without the lipid fraction. On the other hand Avila and Dufort (1996) 

point out that the metabolites accumulate only in the gut, and therefore are not defensive. 

Preference of Peltodoris atromaculata for certain haplosclerid sponges has also been shown on the 

basis of field observations and fecal analysis (Gemballa & Schermutzki, 2004). The sponges fed 

upon turn out to be two species of Petrosia, not just one, and Haliclona fulva (Demospongiae: 

Haplosclerida: Haplosclerina: Chalinidae). The former are more common, and therefore more of 

them are consumed, but the latter are preferred. Both contain the acetylenes, and these also occur 

in other sponges and the nudibranchs that feed upon them. Gemballa and Schermutzki (2004) conclude 

that the nudibranchs are defended by their spicules, and have specialized on toxic sponges as 

a source of food, not defensive metabolites. It is surprising that both of the sponges contain very 

unusual polyacetylenes with a long alkyl chain with 46 carbon atoms (personal communication 

from Letizia Ciavatta). 

Peltodoris nobilis (Photo 109) contains a pharmacologically active N-methylpurine riboside 

(Atlas 615) that was extracted from the digestive glands and resembles molecules known from a 

sponge (Fuhrman, Fuhrman, Kim, Pavelka & Mosher, 1981; Fuhrman, Fuhrman, Nachman & 

Mosher, 1981; Kim, Nachman, Pavelka, Mosher, Fuhrman & Fuhrman, 1981). It resembles the 

compound (Atlas 609) discussed above from Doris verrucosa. Kitting (1981) studied the feeding 

behavior in relation to chemical defense in considerable detail. The animal eats some detritus, in 

addition to feeding selectively on a variety of chemically-defended sponges. The sponges upon 

which the nudibranch feeds are repugnant to both dorids and dendronotaceans. Bioassays of nudibranchs 

that had been starved showed a decline in pharmacological activity, indicating that the 

metabolite came from the food and was not biosynthesized, unlike the similar compound in D. verrucosa. 

Paradoris indecora was formerly placed in the genus Discodoris. It lives perfectly camouflaged 

on the sponge Ircinia variabilis and also occurs on Ircinia fasciculata (Demospongiae: 

Dictyocerata: Irciniidae). From the sponges it obtains the furanosesterterpenoids fasciculatin 

(Atlas 471), variabilin (Atlas 472) and palinurin (Atlas 473) (Marin, Belluga, Scognamiglio & 

Cimino, 1997). The terpenoids are sequestered by the nudibranch in dorsal tubercles, and released 

as a white secretion when the animals are disturbed. 

Asteronotus and Halgerda are more closely related to each other than either is to any other lin-


eage (Fahey & Gosliner 2001). Specimens of Asteronotus caespitosus (Photo 108) from the western 

Pacific display an illuminating pattern of geographical variation (Fahey & Garson, 2002). The 

metabolites found (Atlas 174-176, 230, 231, 631, 632) were ones characteristic of the sponge 

Dysidea herbacea (Demospongiae: Dictyoceratida: Dysideidae) from the same region (Norton, 

Croft & Wells, 1981; Handayani, Edrada, Proksch, Wray, Witte, Van Soest, Kunzmann & 

Soedarsono, 1997). Metabolites from the digestive system included cytotoxic polybrominated 

diphenyl ethers and a new hexachlorinated alkaloid. These, however, did not occur in the integument. 

Evidently, although tolerated, they are not used defensively. Two sesquiterpenes previously 

unknown from mollusks, dehydroherbadysidolide and spirodysin (Atlas 230-231), were found in 

the integument of specimens from some areas. Because the arrays of metabolites differed among 

specimens, it was concluded that the animals obtained them from their food, and did not biosynthesize 

them de novo. 

For Halgerda, illustrated by two species in Photos 111 and 112, trees based on morphological 

and molecular evidence are available (Fahey & Gosliner, 2001). Seven species have been surveyed 

for secondary metabolites (Fahey & Carroll, 2007). None of them show the kind of metabolites 

noted for Asteronotus, and indeed all but two are well camouflaged and seem to have no defensive 

metabolites. Both Halgerda gunnessi and Halgerda aurantiomaculata on the other hand would 

seem to have warning coloration, and extracts of them are cytotoxic. These two species are not 

closely related, and they have quite different metabolites. Halgerda aurantiomaculata, which has 

been most intensively studied, contains several alkaloids (Atlas 621-625), some of which are 

known from sponges. These are 1) halgerdamine (Atlas 621), a tryptophan derivative, 2) C2-α-Dmannosylpyranosyl-L-tryptophan 

(Atlas 622), 3) trigonellin (Atlas 623), 4) esmodil (Atlas 625), 

and 5) zoanemonin (Atlas 625) (in high concentration, known from sponges). The second of these 

compounds is known from human tryptophan metabolism, but otherwise is known only from tunicates. 

Halgerda gunnessi contains mixtures of acylated tetrasaccharides. The genus is a good 

example of the continued adaptive radiation of tropical dorid nudibranchs. 

By way of summary, let us consider the picture that emerges from an examination of the trees 

presented in this chapter. The relationships shown in the diagrams are those that have been followed 

in the text. However, it should be emphasized that the exact branching sequences are questionable. 

The dorid nudibranchs generally feed upon sponges, and there is good reason to believe 

that their common ancestor was no exception. Shifts away from spongivory have taken place in 

several lineages within the group, all of which branched off before the common ancestor of the 

Cryptobranchia. Bathydoris has evidently expanded its range of food items so as to become a generalist 

scavenger, though it continues to use sponge metabolites as a means of defense. It is an 

inhabitant of deeper and colder waters in which there is a scarcity of food, and such a shift in feeding 

habits is quite common under such circumstances. Hexabranchus, on the other hand, dwells in 

the shallow, tropical waters where predation is a serious problem. It is a common animal and seems 

to flourish partly because it has pressed so many sponge-derived defensive metabolites into service. 

The notion that Phanerobranchia is a paraphyletic grade consisting of three separate branches 

is expressed in the diagram. One might wonder whether, as often happens, the paraphyly is the 

product of an insufficient number of synapomorphies being present to hold a monophyletic group 

together. But taking the branching sequences at face value we get some evident parallelism. In the 

first lineage, Polyceratidae, we have animals that are protected by alkaloids, but these derive, not 

from sponges, but from bryozoans, tunicates and other animals, and in at least one case through de 

novo synthesis. The Aegiridae, which are the next lineage, feed upon sponges, but these are calcareous 

sponges, and they derive alkaloids from them. Finally the Suctoria are known to have ter-



penoids derived from Bryozoa. In an earlier work (Cimino & Ghiselin, 1999) we suggested that the 

phanerobranchs perhaps took to feeding upon calcareous sponges with alkaloids, and then shifted 

to various other animals with alkaloids. This scenario is not clearly supported by the tree that we 

have followed and the sequence proposed earlier would have to involve some reversals or parallelisms. 

We leave this issue open. 

The cryptobranch dorids are sponge feeders, with a few isolated exceptions, and it seems likely 

that the common ancestor derived defensive terpenoids from Demospongiae. The first branch, 

Porostomata, with its peculiar feeding mechanism, shows an interesting divergence. On the one 

hand we have the Dendrodorididae, some of which are rather euryphagous and have been emancipated 

from their original metabolites by the capacity for de novo synthesis of terpenoids. The available 

sample, however, may not be representative of the group. The Phyllidiidae, on the other hand, 

are remarkably adept at utilizing isocyanide terpenoids defensively. 

In the Chromodorididae a definite trend is apparent, such that the animals in each genus tend 

to specialize on a limited range of terpenoids. 

With the exception of the basal branch, Aldisa, the Dorididae that have been studied make use 

of defensive metabolites that are terpenoid glycerides. The majority of the terpenoids are typical 

sponge metabolites. However, it has been proven by synthetic experiments that the mollusks 

biosynthesize both the terpenoid skeleton and the glycerols. This is an evolutionary innovation 

unique among nudibranchs. 

In Discodorididae, which are the remaining dorids, there are quite a variety of sponge-derived 

metabolites. The presence of steroids and acetylenes in the skin of Diaulula and Peltodoris makes 

one wonder if these organisms are quite accurately placed in the tree. 

The dorids are noteworthy for having evolved the capacity for de novo synthesis of metabolites 

upon several occasions. This development has taken place in quite isolated parts of the tree, 

and a wide diversity of metabolites are synthesized. Thus we find Bathydoris perhaps biosynthesizing 

a sesquiterpene known from sponges, Triopha and Polycera biosynthesizing an alkaloid 

characteristic of bryozoans, Acanthodoris biosynthesizing sesquiterpenoids, Dendrodoris and 

Doriopsilla biosynthesizing sesquiterpenoids characteristic of sponges, Cadlina, Archidoris, 

Anisodoris, and Doris making diterpenoic acid diglycerides, and Doris tanya making diterpene and 

sesquiterpene glycerides. Given that only a small proportion of the dorids have been sampled, it is 

obvious that many more examples await discovery. 

CHAPTER XI 

OTHER NUDIBRANCHS 

The relationships among the four major groups of nudibranchs are suggested by the following 

diagram: 

┌ Notaspidea 

─┤┌ Doridacea (Holohepatica) 

└┤┌ Dendronotacea 

└┤┌ Arminacea 

└┤ 

└ Aeolidiacea 

Like the dorids, the remaining nudibranchs constitute a monophyletic group. It was named


Cladohepatica by Thiele (1931) on the basis of the digestive gland being branched rather than existing 

as a single mass as in Holohepatica. It seems likely that any exception to this diagnostic feature 

is due to a reversion to a more ancestral state. The branching correlates with a shift to feeding 

on cnidarians, which are protected largely by their stinging capsules (cnidae or nematocysts) but 

also have chemical defenses. One point of departure for thinking about such matters is the fact that 

in addition to nematocysts, cnidarians of the subclass Octocorallia also have both chemical defense 

and spicules, therefore resembling sponges in some important respects. Sometimes the nematocysts 

of the prey are preempted by the nudibranch and used defensively, suggesting the kind of organelle 

symbiosis that occurs in sacoglossans. A few of the cladohepatic nudibranchs no longer feed upon 

cnidarians, and how they defend themselves provides some very instructive material for evolutionary 

biology. 

Traditionally, Cladohepatica has been subdivided into three groups: Dendronotacea, 

Arminacea, and Aeolidiacea. The names derive from those of three genera: Dendronotus, Armina, 

and Aeolis respectively. At present there is good evidence that Arminacea and Dendronotacea are 

paraphyletic groups, but revising the system is work in progress. 

Part 1. Dendronotacea 

Data on chemical defense in Dendronotacea are limited to two families, one of which is 

thought to be relatively primitive (Tritoniidae) and the other highly modified (Tethyidae). We begin 

with the Tritoniidae. These animals feed upon octocorals. Whether or not this is the original food 

is debatable. Data on secondary metabolites are available for only three species: Tritonia hamnerorum, 

Tochuina tetraquetra, and Tritoniella belli. According to the only available tree, the family is 

paraphyletic and even the genus Tritonia is polyphyletic (Smith, 2005). Although the tree is, as 

usual, somewhat provisional, the first species is very distantly related from the other two, which 

are close relatives. 

Tritonia hamnerorum, shown on a sea-fan in Photo 114, has been found feeding on what 

appear to be more than one species of the sea-fan genus Gorgonia (Gosliner & Ghiselin, 1987; 

Cronin, Hay, Fenical & Lindquist 1995). The animals have a rather camphor-like smell, and contain, 

sequester and concentrate julieannafuran (Atlas 319), a furano germacrene sesquiterpenoid. 

In feeding experiments, fish were found not to attack intact nudibranchs. 

Tochuina tetraquetra (Photo 113) feeds upon, and obtains metabolites from the soft coral 

Alcyonium sp., recorded as Gersemia rubiformis by Williams and Andersen (1987). The slugs and 

the corals from one location were found to contain two new cuparane sesquiterpenoids, tochuinyl 

acetate (Atlas 218) and dihydrotochuinyl acetate (Atlas 219) previously unknown from soft corals. 

The slugs also contained the diterpenoids rubifolide (Atlas 354), pukalide (Atlas 355) and 

ptilosarcenone (Atlas 356). (Pukalide has been mentioned above as a constituent of soft corals). 

Slugs from another location contained ptilosarcenone and an analogue of it. 

Tritoniella belli, from Antarctic waters, mainly feeds on the octocoral Clavularia frankliniana. 

It contains the glyceride ester chimyl alcohol (Atlas 522), which provides protection from sea stars 

(McClintock, Baker, Slattery, Heine, Bryan, Yoshida, Davies-Coleman & Faulkner, 1994). The egg 

masses were found to be eaten by some predators, but not by others (McClintock & Baker, 1997; 

Bryan, McClintock & Baker, 1998). 

In the family Tethyidae the anterior portion of the body has been modified so as to form a kind 

of cowl or net that is spread out and used to catch small crustaceans and perhaps other animals. 

Photo 115 gives the example of Tethys fimbria with its net-like head on the left side of the picture. 

Several of the cerata on the left side of the body have autotomized and some of them are regener-



ating. These animals have shifted to a new food source, one that does not contain defensive 

metabolites. The metabolites that they use defensively are biosynthesized de novo. However, similar 

metabolites do occur in Octocorallia. These are used defensively, so it seems likely that the 

slugs’ ancestors obtained defensive metabolites from food. 

Tethys fimbria has been found to contain prostaglandin lactones (Atlas 15-24) (Cimino, 

Spinella & Sodano, 1989; Di Marzo, Cimino, Sodano, Spinella & Villani, 1990; Di Marzo, Cimino, 

Crispino, Minardi, Sodano & Spinella 1991; Cimino, Crispino, Di Marzo, Sodano, Spinella & 

Villani, 1991; Cimino, Crispino, Di Marzo, Spinella & Sodano, 1991; Marin, Di Marzo & Cimino 

1991). Prostaglandins and other eicosanoids are common components of animal tissues and it is 

hardly surprising that the nudibranchs biosynthesize these compounds de novo. However, 

prostaglandins occur as defensive metabolites in many octocorals. It is likely that Tethys is 

descended from ancestors that fed upon such octocorals and used prostaglandins derived from food 

defensively. When the switch to a different food supply took place, metabolites produced by the 

nudibranch itself provided a substitute. Prostaglandins occur in the cerata of the nudibranch, which 

are readily autotomized. Early naturalists mistook the autotomized cerata for flatworms. The cerata 

regenerate readily, and prostaglandins stimulate the regeneration. 

From Melibe viridis (Photo 116), an anatomically similar nudibranch of the same family but 

a different genus, one of the same eicosanoids, prostaglandin E 2-1,15-lactone (Atlas 17), has 

recently been isolated (Mollo, Gavagnin, Carbone, Castellucio, Pozone, Roussis, Templado, 

Ghiselin & Cimino, 2008). Its distribution in the body suggests de novo synthesis, but this has not 

been confirmed experimentally. In certain other species of the genus Melibe there would seem to 

be no defensive eicosanoids. Instead, there are terpenoids. Melibe fimbriata is said to have a fruity 

smell (Thompson & Crampton 1984), but its chemistry has not been studied. We have good information 

about secondary metabolites in Melibe leonina. The repugnatorial glands of this species 

have also been studied (Bickell-Page, 1991). The defensive compound, which again has a fruity 

odor, is concentrated in these glands. It is a degraded terpenoid, 2,6-dimethyl-5-heptenal (Atlas 

186) (Ayer & Andersen, 1983). There is also the corresponding 2,6-dimethyl-5-heptenoic acid 

(Atlas 187), which lacks the fruity smell. Geographical distribution showed the presence of the terpenoids 

to be invariant, indicating the likelihood of de novo synthesis. Experimental work showed 

that labeled acetate was incorporated into the molecule in a way that is consistent with the mevalonic 

acid pathway (Barsby, Linington & Andersen, 2002). As already noted, terpenoids are often 

defensive metabolites in Octocorallia. In this case the scenario would be much the same as for the 

other genus, but the evolution of the biosynthetic capacity would be somewhat more difficult. 

Part 2. Arminacea 

In the Euarminacea, Armina maculata was found to contain a cembranoid and briarane diterpenoid 

(-)-verecynarmin-A (Atlas 359) (Guerriero, D’Ambrosio & Pietra, 1987, 1988) and similar 

compounds (Atlas 360, 361) supposedly derived from the pennatulacean Veretillum cynomorium 

(Octocorallia) upon which the nudibranchs feed (Guerriero, D’Ambrosio & Pietra, 1990). These 

are quite similar to metabolites that have been recovered from sponges. From Armina babai a 

ceramide (Atlas 612) has been recovered (Ishibashi, Yamaguchi & Hirano, 2006). This metabolite 

had previously been isolated from the gorgonian Acabaria undulata (Shin & Seo, 1995). In a different 

genus but the same family, Dermatobranchus ornatus (Photo 117) contains eunicellin diterpenoids 

that are also found in gorgonians, such as Calicogorgia, Astrogorgia, and Muricella 

(Carbone, 2007). Dermatobranchus otome was found to contain three new sesquiterpenoids (Atlas 

232-234) of unknown origin (Ishibashi, Yamaguchi & Hirano, 2006). In Leminda millecra (Photo


118) four sesquiterpenes (Atlas 220-223) that resemble those of sponges were discovered (Pika & 

Faulkner, 1994). However, the gut contained spicules from the soft corals Alcyonium and Drita. 

Many sesquiterpenoids typical of gorgonians and seven triprenyl quinones and hydroquinones have 

subsequently been found (McPhail, Davies-Coleman & Starmer, 2001). The main metabolites 

occur in the gorgonian Leptogorgia palma, upon which the nudibranch has often been seen feeding. 

Janolus cristatus, which may be closer to the other cladohepatic groups than to Euarminacea, 

feeds upon Bryozoa and contains janolusimide (Atlas 600), a lipotripeptide (Sodano & Spinella, 

1986; Cimino, De Rosa, De Stefano & Sodano, 1986). Photo 119 shows this animal with its pair 

of rhinophores and many dorsal processes that superficially resemble those of our next group 

(Aeolidiacea). When arminaceans of the genus Dirona feed upon bryozoans, the prey respond by 

increasing the production of metabolites (Harvell, 1984). 

Part 3. Aeolidiacea 

The aeolid nudibranchs are the last group to be treated. These animals feed mostly on cnidarians, 

though there are a few scattered exceptions (some eat eggs and some eat bryozoans). The 

characteristic feature of cnidarians is their cnidae, or stinging capsules. These may defend them 

from predators, including aeolid nudibranchs, which are famous for turning the cnidae against their 

own enemies (Edmunds, 1966). Such cleptocnidae, as they are called, may collect in special organs 

at the tips of the cerata. Photo 120 shows a specimen of Flabellina pedata, an aeolid nudibranch 

on a colony of hydrozoans with their tentacles extended. As can be seen from the specimen of 

Flabellina affinis shown in Photo 121, Calorica indica shown in Photo 128, and Godiva quadricolor 

shown in Photo 126, the cerata are positioned in a manner that enhances their effectiveness. 

Often the tip of each ceras is brightly and conspicuously colored. The nudibranch’s behavior may 

also help. The cerata may bristle when the slug is attacked (Millen & Hamann, 1992). The tips may 

converge upon an attacking predator. Cerata are sometimes autotomized, and when they are, they 

may writhe about, providing a distraction. In spite of such evidence it has occasionally been maintained 

that the cnidae do not function defensively and are merely excreted at the tips of the cerata 

(Streble, 1968). This interpretation goes too far. 

Where the cnidae of the prey are large and highly toxic, the cleptocnidae can present a formidable 

defense mechanism, as is the case with the pelagic nudibranch Glaucus (Photo 122), which 

feeds upon the “man of war” jellyfish Physalia (Thompson & Bennett, 1969). However, the cnidae, 

even within a single animal, are not all of the same size and toxicity. In some cnidarians the cnidae 

are small and the animals mainly depend upon chemicals for defense. The aeolid nudibranchs that 

feed upon them likewise have other defense mechanisms. The assumption that the cnidae provide 

adequate defense from predators may be partly responsible for the small number of studies that 

have been carried out on the secondary metabolites of aeolid nudibranchs. It is known, however, 

that cnidarians use a combination of cnidae and secondary metabolites in defending themselves 

from predators (Stachowicz & Lindquist, 2000). 

Secondary metabolites have been found in hydrozoans and in the aeolid nudibranchs that feed 

upon them. The hydroids Eudendrium rameum, Eudendrium racemosum and Eudendrium ramosum 

contain modified steroids (Atlas 570), as do the nudibranchs Hervia peregrina, Flabellina affinis 

(Photos 121), and Flabellina lineata (Photo 125) that feed and lay their eggs upon them 

(Cimino, De Rosa, De Stefano & Sodano, 1980; D’Auria, Minale & Riccio, 1993). In the integument 

of Cratena peregrina (Photo 124) there are prenylphenols (Atlas 163) (Ciavatta, Trivellone, 

Villani & Cimino, 1996). The cnidae of this nudibranch have been studied by means of electron



microscopy and other techniques and it would appear that they are used defensively (Martin, 2003; 

Martin & Walther, 2003). 

Two genera of aeolids that feed upon Anthozoa have been found to use chemical defense. 

Phestilla melanobrachia (Photo 127) contains alkaloids derived from 6-bromoindole (Atlas 603) 

that also occur in the hard coral upon which it feeds, Tubastraea coccinea (Okuda, Klein, Kinnel, 

Li & Scheuer, 1982). The other genus of interest is Phyllodesmium (Rudman, 1981, 1991; 

Burghardt & Wägele, 2004; Burghardt, Evertson, Johnsen & Wägele, 2005). Photo 123 shows two 

specimens of Phyllodesmium magnum, a species currently under investigation. These nudibranchs 

feed upon soft corals (Octocorallia) and appropriate their symbiotic algae for their own use, effectively 

becoming photosynthetic animals. In this case the cnidae are quite small and they are not 

used defensively. The nudibranchs are very well camouflaged on the corals, and look very much 

like their zooids. The cerata, which resemble tentacles, autotomize readily. Phyllodesmium longicirrum 

eats Sarcophyton trocheliophorum and uses its terpenoids in defense (Coll, Bowden, 

Tapiolas, Willis, Djura, Streamer & Trott, 1985). Phyllodesmium guamensis has been found to contain 

a diterpene, 11β-acetoxypukalide (Atlas 362) derived from Sinularia maxima and S. polydactyla 

(Slattery, Avila, Starmer & Paul, 1998). The metabolite, which is deterrent to fish, is most 

abundant in the cerata. 

CHAPTER XII 

MACROEVOLUTION AND MACROECONOMICS 

Our historical narrative provides an example of what has been called an “adaptive radiation.” 

From an initial ancestor the opisthobranchs and pulmonates have diversified and have come to 

flourish in a wide variety of habitats and to exploit a broad range of food items. The idea that chemical 

defense has been the driving force behind the evolution of these animals helps us to make sense 

out of their adaptive radiation. The opisthobranchs have been expanding and diversifying for a long 

period of time, and those processes have been furthered by the diversification of their metaboliterich 

food items. They have tended to track their food along taxonomic or genealogical lines, but 

this is only a tendency. We have seen several examples of opisthobranchs shifting to taxonomically 

quite distant food items that have the same kind of secondary metabolites. We have also seen the 

capacity for de novo biosynthesis emancipating opisthobranchs and pulmonates from dependency 

upon their original food items. In many cases the metabolites thus synthesized are polypropionates. 

When predator and prey evolve together there may be “coevolution,” meaning that the two 

exercise a reciprocal influence upon one another at the populational level. Supposedly, for example, 

the presence of dorid nudibranchs in the environment of sponges would bring about selection 

pressures causing the sponges to evolve the kind of defenses that are effective against the nudibranchs, 

and the nudibranchs would evolve means of coping with such defenses, such as the ability 

to detoxify particular secondary metabolites. However, the defenses of the sponges, whether 

mechanical, chemical, or whatever, would be deployed against a variety of grazers, including fish, 

and generalists as well as the specialist nudibranchs. The sponges, which derive their sustenence 

by filtering small particles out of the water, have occupied a wide range of habitats. The opisthobranchs 

have undergone their adaptive radiation as components of the economy of nature as a 

whole. The phenomena reviewed in the present work suggest ways in which we might explain the 

global patterns of biotic diversity from a causal point of view, thereby contributing to the emerging 

science of bioeconomics (Landa & Ghiselin, 1999).


Adam Smith (1776), in The Wealth of Nations, showed how the division of labor increases the 

output of an enterprise by such advantages as not wasting time by switching from one task to another. 

Darwin (1859), in The Origin of Species, pointed out that such specialization increases the total 

amount of life that the natural economy can support. There is, however, an important difference 

between the cooperative division of labor that occurs within productive units, and the competitive 

division of labor that occurs between them (Ghiselin, 1974, 1978). An organism or a firm is optimized 

so as to maximize the productivity of the organism or the firm as a whole, but this is not the 

case for species or other laissez-faire economic units, whether natural or political, in which the 

components receive no return on doing that what is optimal for the whole. The division of labor 

does indeed tend to contribute to the prosperity of such competitive economies, but only as an incidental 

result of the advantages realized by the competitors of which the economies are composed. 

Likewise Charles Babbage suggested that the division of labor makes it possible to put a wider 

variety of talents to work. It does have that effect, but again, that is not the reason why labor is 

divided in modern industrial society. As Adam Smith emphasized, bakers are not trying to benefit 

anybody but themselves when they act so as to put bread on everybody’s table. Specialists and their 

employers simply take advantage of opportunities that are created as a result of labor being divided. 

Adam Smith made the very important point that the division of labor is limited by the extent of 

the market. In order to function most effectively as a specialist, there must be enough buyers of 

one’s product or one’s service to keep one working full time. For that reason the variety of occupations 

is greater in larger cities, as can be seen from the fact that medical specialists are concentrated 

there. Large universities likewise have a greater variety of courses and a greater diversity of 

professors than small colleges do. For much the same reason, smaller islands, in comparison to 

larger ones, have a lesser diversity of species, accompanied by a lesser diversity of ways of making 

a living. 

One point that Adam Smith and subsequent economists neglected is that there are both advantages 

and disadvantages to dividing labor. Of course it has been widely recognized that when there 

is a recession, some professions are particularly apt to suffer from unemployment. But there are 

distinct advantages to combining labor. Opisthobranchs are simultaneous hermaphrodites. The 

advantage is thought to lie in an ability to reproduce at low effective population densities. One disadvantage 

is that an hermaphrodite must pay the “fixed costs” that are necessary for reproducing 

as a male as well as those that are necessary for reproducing as a female. Whether natural selection 

favors hermaphroditism or separate sexes depends upon the particular conditions under which the 

organisms exist. Among the situations in which combining labor has its advantages are those in 

which putting different things together has a synergistic effect, the outcome being more than that 

which is realized when the parts operate separately (see Corning, 2005). 

The adaptive radiation of the opisthobranchs may be considered an entrepreneurial affair. They 

have specialized because that has allowed them to take advantage of economic opportunities. They 

have not specialized in order to avoid competition with one another, any more than professors of 

zoology teach that subject in order to avoid competition with their colleagues who teach history or 

Greek. It is not difficult to see how this division of labor among opisthobranchs has been accomplished. 

They have been able to exploit quite a variety of food items and of chemicals that they can 

use in their own defense. Their adaptive radiation has often involved innovations — new technologies, 

if you will. The evolution of the capacity for de novo synthesis of secondary metabolites originally 

obtained from food is the most remarkable example, but by no means the only one. That 

capacity had its precursors in the ability to transform secondary metabolites. Much as there are 

places, such as Silicon Valley, where technological innovation flourishes, there are also places in 

the natural economy where something analogous goes on. And much as the greatest amount of spe-



cialization within academic enterprises is to be found in the largest universities, there are places in 

the world where a vast natural economy is exceedingly rich in specialists though it contains a substantial 

number of generalists. 

Opisthobranchs are most diverse — not only in the number of their species and higher taxa, 

but also in the manner in which they make a living — in the Indo-West-Pacific, especially in the 

area around New Guinea and the Philippines. The same is true of many other groups of animals 

and plants, including the ones upon which opisthobranchs feed. The richness of the biota correlates 

with relatively high and stable temperatures as well as the extent of the habitat. The high and stable 

temperatures are the result of the global pattern of water movement. In the Eastern Pacific cool 

water moves from high latitudes toward the equator and then moves westward, accumulating heat 

from the sun on the way. After crossing the Pacific, water is deflected and moves poleward in both 

hemispheres, giving up heat as it goes, and recirculates. 

The Caribbean fauna is considerably less diverse than that of the Indo-West-Pacific. It is generally 

considered to have become depauperate because of extinction, though it contains an unusually 

high number of gorgonians. The Mediterranean is likewise depauperate for historical reasons. 

That it is still economically undersaturated is clear from the phenomenon of “Lessepsian invasions” 

from the Red Sea via the Suez Canal. The migrants include opisthobranchs with patterns of 

chemical defense that facilitate their entering the Mediterranean and getting established there 

(Mollo, Gavagnin, Carbone, Castelluccio, Pozone, Roussis, Templado, Ghiselin & Cimino, 2008). 

Although the global pattern is by no means a simple one, there is a clear tendency for biotic 

diversity within many taxa to decline as one gets away from the faunal peaks, especially with 

increasing latitude. That the over-all pattern for opisthobranchs is a real phenomenon can be seen 

from a comparison of the fauna of various geographically comparable areas, broken down into taxonomic 

subunits. Here we reproduce figures from an earlier study (Ghiselin, 1992). Madang, on 

the northern coast of New Guinea has the longest faunal list, with Guam slightly behind, the isolated 

but well-studied archipelago of Hawaii, much less, and Sagami Bay in Japan, again well studied, 

a distant fourth: 

Madang Guam Hawaii Sagami Bay 

(Total list) 536 410 244 184 

Cephalaspidea 70 93 47 5 

Anaspidea 9 8 11 13 

Sacoglossa 61 86 34 18 

Shelled 11 17 8 2 

Shell-less 50 69 26 16 

Thecosomata 4 11 (0) (0) 

Notaspidea 8 7 12 3 

Nudibranchia 382 205 140 145 

Doridacea 250 155 91 75 

Suctoria 14 2 3 6 

Nonsuctoria 56 23 14 17 

Cryptobranchia 141 96 60 42 

Porostomata 30 24 14 10 

Dendronotacea 24 7 6 19 

Arminacea 9 3 3 20 

Aeolodiacea 99 40 40 31 

(It is worth mentioning that Gosliner and his collaborators now have a list of 640 species from 

Anilao, in the Philippines.)


Trends in biotic diversity have also been extensively documented for the fossil record. The 

approach has generally involved compilations from the paleontological literature and there are serious 

methodological problems with it. For one thing, species are even harder to identify in fossil 

specimens than they are in living ones. Furthermore, although we have a good, objective definition 

for the species category, there are none for higher levels, such as the genus and the family. 

Therefore a family of gastropods is not equivalent to a family of bivalves or crustaceans. 

Nonetheless there does seem to be a general trend toward increasing diversity throughout the fossil 

record, in spite of numerous mass extinctions. At least some groups have tended to expand more 

than others in the long run. Bivalves provide a good example. There has been a considerable 

amount of discussion as to what features of the bivalves might account for their long-term success, 

and for the decline of the brachiopods with their bivalved shells. The results have seemed inconclusive. 

When a group expands it may do so because it is occupying previously unexploited niches 

or it may mean that it is displacing competitors. Their relatively poor fossil record notwithstanding, 

there is reason to think that opisthobranchs are an expanding group of animals. Viewing them 

in their present condition provides us with an opportunity to assess the reasons for their long-term, 

as well as their present, prosperity. 

In addition to trends in the number of taxa, there are trends in the properties of the organisms, 

including the amount of defense, both mechanical and chemical. Comparable trends, corresponding 

with the conditions of existence, can be found in all groups of organisms, both marine and terrestrial. 

The size of the body and the size of societies are both good examples. Reproductive trends 

include the number of eggs laid in a bird’s clutch and the amount of sex (in the sense of genetical 

recombination). From a bioeconomic perspective these patterns can all be treated as variations 

upon a single theme (Ghiselin, 1974). 

As mentioned in a previous chapter, trends in the amount of chemical defense parallel those in 

species diversity. For prosobranch gastropods, Vermeij (1978, 1987) has documented a closelycomparable 

trend in mechanical defense: passing westward across the Pacific there is an increasing 

proportion of snails with heavy shells. He has argued that there has been an “arms-race” 

through geological time between snails and the crabs that feed upon them. Having joined the ranks 

of bioeconomists Vermeij (2004) has attempted to explain the trends through time and across space 

in terms of the amount of energy. The standing crop of animals and plants must have something to 

do with the energy supply, but what is cause and what is effect? It seems unlikely that the absolute 

amount of energy flowing into the habitat will explain things in a straightforward and simple manner. 

Rather it is a matter of how the energy gets utilized by the organisms. And if one looks at 

Vermeij’s raw data, one sees that although it is true that the proportion of heavily-armored gastropods 

increases, this is because the heavily-armored species are added to the fauna, and not 

because they replace the others. The absolute numbers of more lightly armored species remain 

about the same. Areas of low diversity generally contain many organisms of common species, 

whereas those of high diversity generally contain fewer organisms per species because the species 

tend to be rare. Armament is expensive and in some parts of the habitat the costs may not be worth 

the expenditure. An animal may remain under cover, perhaps living beneath rocks and in cavities. 

It may have nocturnal habits. Well-defended gastropods are able to venture forth into the open to 

feed. Nudibranchs of the family Phyllidiidae are able to survive and feed upon sponges out in the 

open in broad daylight because of their highly-developed chemical defense (Brunckhorst, 1991). 

That allows them to exploit a food supply that would otherwise be left largely alone by spongivores. 

Among prosobranchs the life history of cowries provides an instructive example (Ire & 

Iwata, 2005). The young ones have weak shells and remain under cover. Upon reaching a certain 

size, they stop growing and develop much stronger shells. They are then in a much better position



to venture out, forage, and reproduce. Photo 1 shows the cowrie Cyphoma gibbosum in an exposed 

position on a gorgonian. These are adults. The juveniles occur at the base of the branches. 

Although it may be tempting, it is misleading to conceptualize an adaptive radiation as if it 

were merely a subdivision of pre-existing niches into increasingly small compartments with an 

inelastic supply of resources available to their occupants. For similar reasons it is misleading to 

conceptualize an “arms race” between predators and prey as if it were a “zero-sum game.” The 

adaptive radiation may have an entrepreneurial character, with the radiating group taking advantage 

of “business opportunities” and expanding by virtue of utilizing previously underexploited 

resources. 

Comparative physiologists have often observed that tropical marine animals tend to live closer 

to their tolerance limits than do their temperate relatives. That translates into the tropical ones 

running a greater risk of mortality through overheating or drying out. From a bioeconomic point of 

view the next question to ask is not what causes them to die under such circumstances but rather 

whether, as a consequence of taking such risks, they are able to occupy an appropriate habitat and 

turn a profit in the form of reproductive success. In the tropics one often finds marine animals, such 

as both anomuran and brachyuran crabs, that have been “displaced” upward toward higher levels, 

so that they become more like terrestrial ones. Such animals are “pushing” against their economic 

limits, as well as their physiological ones. 

Among the various components of an animal’s habitat are its predators. Tropical opisthobranchs 

seem to be living closer to the limits of their capacity to deal with them as well. In such a 

struggle for existence the use of defensive metabolites might well give an animal competitive edge. 

In the literature on chemical ecology the relationships between predation and geographical patterns 

of chemical defense have often discussed (see Hay, 1996; Hay & Steinberg, 1992; Cronin, Paul, 

Hay & Fenical, 1997; Becerro, Turon, Uriz & Paul, 2003). There has been a lot of talk about differences 

in the amount of “predation pressure” from one place to another. This is supposed to translate 

into predators preventing unprotected animals from flourishing in the tropics. This perspective 

confuses cause and effect. Instead of thinking in terms of the predators having the negative effect 

of preventing the growth of undefended prey populations, what we really need to consider is the 

positive effect of defensive adaptations in allowing the prey populations to expand. Selection is not 

a negative force that prevents something from happening, but a mechanism whereby resources are 

allocated one way or another. 

The Indo-West-Pacific diversity peak occurs in a region that is climatically stable and the biota 

is relatively saturated economically. If one looks at higher latitudes one generally finds a lower 

diversity of opisthobranchs, and this trend correlates with seasonality of the environments. The difference 

between tropical and higher-latitude dorid nudibranchs have lately been addressed by 

Andersen, Desjardine, and Woods (2006). They draw attention to the fact that many of the dorids 

of the northern coasts of the Eastern Pacific are able to biosynthesize their own defensive metabolites. 

And yet such animals as Cadlina luteomarginata feed upon quite a variety of sponges and 

may utilize dietary metabolites as well as those that they make themselves. On the other hand tropical 

nudibranchs seem not to do that, but to derive their metabolites from food. They argue 

(pp. 297-298) that there is a high diversity of food items in the tropics and that, therefore, “tropical 

nudibranchs have ready access in their diets to sequesterable defensive chemicals and consequently 

they should have little need to make repugnant chemicals via de novo biosynthesis.” On 

the other hand, the food items in higher latitudes are less diverse and less rich in metabolites. This 

seems not to be quite what is going on. The tropical nudibranchs live in a less seasonal environment. 

Therefore, they are specialized for a way of life in which the larvae home in on a particular 

source of food and metabolites that other animals are ill-adapted to exploit. They spend a consid-


erable amount of time as larvae in the plankton finding the appropriate habitat and are able to do 

so by virtue of the very fact that the environment is not so seasonal. The higher-latitude nudibranchs, 

on the other hand, live in a seasonal environment, where there is little time available for 

homing in on the food supply with its metabolites. Their way of life involves scrambling for food 

and turning it into sperm and eggs as soon as possible. Biosynthesis of defensive metabolites is 

expensive, but it pays in terms of less time and effort expended seeking them out. 

The Antarctic seems to present an exception to the commonly-accepted pattern of chemical 

defense being largely a tropical phenomenon (McClintock & Baker, 1998; Amsler, Iken, 

McClintock & Baker, 2001). The Antarctic plankton is very “productive,” but only in the sense of 

producing a high standing crop of plants and animals, so that it supports a food chain with crustaceans, 

fish, and whales. The growing season is, however, short, and the organisms scramble for 

food. The benthos seems to have quite different conditions of existence. It is dominated by slowgrowing 

and sessile or slow-moving animals. As in the deep sea, from which the biota is partly 

derived, food is scarce. The animals do not experience the kind of seasonal influx of food that 

would allow them to grow and reproduce rapidly and thereby outpace the growth of predator populations. 

Bathydoris, as suggested above, is an animal that has expanded its range of food items so 

as to eat more than just sponges. That allows it to feed under the prevailing conditions of scarcity. 

Evolving the capacity for biosynthesis of defensive metabolites means that it can defend itself 

without being dependent upon a particular kind of food item. 

Being common at higher latitudes, de novo synthesis has sometimes been described as a “cold 

water” phenomenon. Especially if one pays attention only to some dorid nudibranchs, one might 

get the impression that temperature per se has something to do with it. But de novo synthesis occurs 

in Dendrodoris and Doriopsilla of warmer waters as well. Furthermore, it is quite common in 

warm-water representatives of other opisthobranch taxa. We need only consider the family 

Tethyidae, which evidently became emancipated from dependency upon tropical cnidarians. The 

family, which is largely tropical and subtropical, gave rise to some lineages of colder waters, 

including the Oregonian Melibe leonina. 

All that we can infer from the gradients is that, for some reason, it seems advantageous to 

invest relatively more in chemical defense under the conditions that occur in tropical economies. 

That the latitudinal gradients are not necessarily due to the availability of metabolites in the food 

supply is indicated by the occurrence of such gradients in animals that biosynthesize these de novo. 

The gradient discussed above (in Chapter 4) for onchidal in various species of the marine pulmonate 

genus Onchidella makes that quite clear. The tendency of sponges to contain lesser 

amounts of secondary metabolites in higher latitudes and more at lower ones has also been known 

for many years (Green, 1977). Such a tendency might favor de novo synthesis on the part of nudibranchs 

that feed upon them. 

We must also reject as unfounded the frequently-expressed notion that a high level of species 

diversity in a given area is the result of a high rate of speciation. To be sure, there is good reason 

to believe that coexisting and closely related species of opisthobranchs often have different food 

organisms. But this does not mean that speciation events are either the cause or the effect of the 

phenomenon. What really matters is not the origin of species, but rather their ability to get established 

and maintain themselves in the natural economy. Likewise in the political economy, it may 

be easy to set up a business, but what really counts is whether the business, once established, is 

able to return a net profit. 

From what we know of speciation processes in marine animals generally, it is clear that speciation 

is going on all the time. The supposed lack of sufficient geographical isolation to allow for 

species formation reflects nothing more than lack of imagination. New species are coming into the



biota as cryptic ones that soon evolve minor differences in behavior, physiology and way of life. 

Those differences may be sufficient to prevent ecological exclusion, which is the analogue of being 

driven out of business, thereby allowing a particular species to maintain itself once it has become 

established. Among those differences are a diversity of defensive metabolites. We may recollect the 

cryptic species of bryozoans, each with its own symbiotic bacteria, producing different alkaloids. 

Also mentioned was the fact that in marine sponges there are numerous cryptic species and these 

show differences in their autecology. Further diversification is contingent upon additional speciation, 

along with innovations in the way of making a living. Again, speciation rate does not seem to 

constrain the process very much. The rate of innovation is another matter. 

The animals, plants, and microorganisms that synthesize secondary metabolites and use them 

defensively can evolve new metabolites by modifying the biosynthetic pathways. Often this is done 

in a straightforward manner, for example, by adding another acetate unit to a polyketide or another 

isoprenoid unit to a terpene. Such terminal addition leads to longer chains, and it also allows for 

a greater variety of structurally-modified metabolites, such as those that have undergone rearrangement. 

Comparative studies documenting such changes are available for algae (Amico, 1995) and 

sponges (Van Soest, Fusetani & Andersen, 1998). Another way of acquiring new metabolites is by 

entering into symbiotic relationships, something that is well documented for sponges. The acquisition 

of any new metabolite is an example of an evolutionary innovation. It is like the introduction 

of a new drug into the pharmaceutical industry. Evolutionary innovation also may be involved in 

the origin of the capacity to produce some kind of change in a molecule: for example the esterification 

of a terpenoid by a dorid nudibranch or the methylation of polyketides by fungi. Innovation 

has also occurred in acquisition of the capacity for biotransformation. And the abilities to form concentrations 

of metabolites in repugnatorial glands, to store them there, and to release them at the 

appropriate time and place, represent a whole series of innovations. The opisthobranchs have been 

remarkably innovative in their acquisition and use of secondary metabolites. But they are also 

remarkable for some other innovations that affect their prosperity. Two examples of “organelle 

symbiosis” have been mentioned. One is the defensive use of stinging capsules appropriated by 

aeolid nudibranchs from the cnidarians upon which they feed. Another is sacoglossans turning 

themselves into something like motile leaves by farming chloroplasts within their own bodies. In 

the latter case a new kind of enterprise has opened up previously untilled fields for cultivation. 

The opisthobranchs have radiated adaptively on a vast scale. We might well compare their 

adaptive radiation with that of other taxa. The phenomenon has been examined in groups that have 

diversified on isolated archipelagos. A particularly well studied case is “Darwin’s finches” of the 

Galápagos (Grant & Grant, 2008). A more spectacular case is the honeycreeper finches of Hawaii 

(Amadon, 1947). There are also well-studied examples of adaptive radiations that have taken place 

in freshwater lakes, most notably the cichlid fishes of Africa (Fryer & Iles, 1972; Meyer, 1993; 

Salzburger & Meyer, 2004). Some common features of such radiations are noteworthy. In the first 

place, the groups that have diversified so much have filled something of an economic vacuum in 

doing so. Secondly, although island endemics quite generally have become considerably modified 

in adaptation to local circumstances, only a small minority of taxa within a biota have actually 

undergone adaptive radiations. Thus, although the Galápagos birds include flightless cormorants, 

only one group, the Geospizidae, has actually undergone an adaptive radiation. Thirdly, diversification 

seems to take place rather slowly at first, suggesting that it takes a while for the organisms 

to evolve whatever it takes to diversify extensively. And fourth, the lineages that do radiate have 

what has been called “diversification potential” by Grant and Grant (2008). The Galápagos finches 

owe this potential in part to their behavioral flexibility, and in part to the ability of the beak to 

be modified so as to function in different ways, thereby exploiting different kinds of food items.


The Hawaiian honeycreepers have likewise diversified in bill shape and feeding habits. Likewise, 

the functional morphology of the African cichlids allows them to occupy a remarkable range of 

feeding niches (Greenwood, 1981; Liem, 1973). 

The aforementioned vertebrate radiations have taken place within, geologically speaking, a 

relatively short period of time. The adaptive radiation of opisthobranchs is more of a long-term 

affair, but it fits more or less the same pattern. The pulmonates are a peculiar case, for there has 

been only a modest diversification of them in the sea, whereas the Basommatophora have become 

major components of the freshwater biota and Stylommatophora a very successful group of terrestrial 

organisms. The marine pulmonates, with their use of chemical defense, live very much like 

opisthobranchs. The diversification potential of opisthobranchs depends mainly upon their ability 

to utilize the same resource both as nutriment and for provision of defensive metabolites. On the 

other hand, de novo synthesis allows them to emancipate themselves from their original source of 

metabolites. 

The fossil record of opisthobranchs is not complete enough to tell us whether there was an initial 

period of slow evolution, but a comparison of groups that have radiated extensively with their 

more primitive relatives definitely suggests that this is what happened. The cephalaspideans 

include just a few lineages that are rich in species, and these are the most highly modified anatomically. 

Among sacoglossans there are a few shelled forms, some of them remarkable for such peculiarities 

as bivalved shells. But most of the diversification has taken place in lineages that have 

abandoned the shell and switched to different food items and new kinds of chemical defense. The 

notaspideans would seem to have undergone a minor radiation that foreshadows the more extensive 

one in the various lineages of nudibranchs. 

The Galapagos finches have undergone the first adaptive radiation to be recognized as such. 

That happened soon after Darwin returned from his epoch-making journey around the world. In the 

second edition of his Journal of Researches Darwin (1845:380) only alluded to their evolutionary 

significance: “Seeing this gradation and diversity of structure in one small, intimately related group 

of birds, one might really fancy that from an original paucity of birds in this archipelago, one 

species has been taken and modified for different ends.” The finches have been intensively studied 

and have yielded a great deal of insight into the underlying evolutionary processes. We have mentioned 

just a few of the other adaptive radiations that have been studied by biologists. Some of 

these are striking, indeed spectacular, examples of nature’s creativity. 

The radiation of opisthobranchs is not just spectacular; it is downright astounding. The gastropod 

radula might be compared to the avian beak, getting pressed into service in exploiting a variety 

of food items. The opisthobranchs, however, are adept not just in feeding, but in what they do 

with the food and with the metabolites therein contained, once the food has been ingested. The ability 

to accumulate, modify, and deploy secondary metabolites has been the basis for their prosperity. 

But opisthobranchs have been adept, not just at finding ways to put such metabolites to use, but 

at evolving the capacity to produce what previously they merely consumed. And this has been 

accomplished in two different, and equally remarkable, ways. The first has been to evolve a 

biosynthetic pathway that starts with the same pool of primary metabolites and yields essentially 

the same secondary metabolites that occurred in the food supply, perhaps duplicating the intermediate 

steps. The second has been to evolve a biosynthetic pathway that incorporates precursors such 

as propionate, acetate and mevalonate, and yields metabolites that resemble those of other organisms 

both in structure and function, but may differ fundamentally from these in their composition 

as well as their genesis. The narrative account that we have provided for the adaptive radiation of 

opisthobranchs is about the evolution of biosynthetic capacity — like the origin of life itself.



REFERENCES 

Abramson, Stewart N., Zoran Radic, Denise Manker, D. John Faulkner, and Palmer Taylor. 1989. Onchidal: 

a naturally occurring irreversible inhibitor of acetylcholinesterase with a novel mechanism of action. 

Molecular Pharmacology 36:349-354. 

Abrell, Leif M., X. C. Cheng, and Phillip Crews. 1994. New nectriapyrones by salt water culture of a fungus 

separated from an Indo-Pacific sponge. Tetrahedron Letters 35:9159-9160. 

Aguinaldo, Anna Marie A., James McClintock Turbeville, Lawrence S. Linford, Maria C. Rivera, James R. 

Garey, Rudolf A. Raff, and James A. Lake. 1997. Evidence for a clade of nematodes, arthropods and other 

moulting animals. Nature 387:489-493. 

Albizati, Kim F., Joseph R. Pawlik, and D. John Faulkner. 1985. Limatulone, a potent defensive metabolite of 

the intertidal limpet Collisella limatula. Journal of Organic Chemistry 50:3428-3430. 

Alvi, Khisal Ahamad, Phillip Crews, and David G. Loughhead. 1991. Novel marine sponge alkaloids. 2. 

Structures and total synthesis of 2-aminoimadazoles from a Notodoris nudibranch. Journal of Natural 

Products 54:1509-1515. 

Alvi, Khisal Ahmad, Barbara M. Peters, Lisa M. Hunter, and Phillip Crews. 1993. 2-Aminoimidazoles and 

their zinc complexes from Indo-Pacific Leucetta sponges and Notodoris nudibranchs. Tetrahedron 49:329- 

336. 

Amadon, Dean. 1947. Ecology and the evolution of some Hawaiian birds. Evolution 1:63-68. 

Amico, Vincenzo. 1995. Marine brown algae of family Cystoseiraceae: chemistry and chemotaxonomy. 

Phytochemistry 39:1257-1279. 

Amsler, Charles D., Katrin B. Iken, James B. McClintock, and Bill J. Baker. 2001. Secondary metabolites 

from Antarctic marine organisms and their ecological implications. Pages 267-300 in J. B. McClintock and 

B. J. Baker, eds., Marine Chemical Ecology. CRC Press, Boca Raton. 

Andersen, Raymond J., Kelsey Desjardine, and Kate Woods. 2006. Skin chemistry of nudibranchs from the 

West Coast of North America. Pages 277-301 in Guido Cimino and Margherita Gavagnin, eds., Molluscs: 

From Chemo-ecological Study to Biotechnological Application. In W. E. G. Müller, ed., Progress in 

Molecular and Subcellular Biology: Marine Molecular Biotechnology, Volume 43. Springer, New York. 

Andersen, Raymond J., and D. John Faulkner. 1972. Antibiotics from marine organisms of the Gulf of 

California. Abstracts from a conference on Food and Drugs from the Sea, pp. 111-115. 

Andersen, Raymond J., D. John Faulkner, Cun-Hung He, Gregory D. Van Duyne, and Jon Clardy. 1985. 

Metabolites of the marine prosobranch mollusc Lamellaria sp. Journal of the American Chemical Society 

107:5492-5495. 

Andersen, Raymond J., and Fuk Wah Sum. 1980. Farnesic acid glycerides from the nudibranch Archidoris 

odhneri. Tetrahedron Letters 21:797-800. 

Anthoni, Uffe, Per H. Nielsen, M. Pereira, and Carsten Christophersen. 1990. Bryozoan secondary metabolites: 

a chemotaxonomical challenge. Comparative Biochemistry and Physiology 96B:431-437. 

Appleton, David R., Mary A. Sewell, Michael V. Berridge, and Brent R. Copp. 2002. A new biologically 

active malyngamide from a New Zealand collection of the sea hare Bursatella leachii. Journal of Natural 

Products 65:630-631. 

Arimoto, Hirokazu, Rieko Yokoyama, Kazuhiko Nakamura, Yasuaki Okumura, and Daisuke Uemura. 1996. 

Vallartanone B: synthesis and related studies. Tetrahedron 52:13901-13908. 

Ashour, Mohamed, Ru Angelie Edrada, Rainer Ebel, Victor Wray, Wim Wätjen, K. Padmakumar, Werner E. 

G. Müller, Wen Han Lin, and Peter Proksch. 2006. Kahalalide derivatives from the Indian sacoglossan mollusk 

Elysia grandifolia. Journal of Natural Products 69:1547-1553. 

Atema, Jelle, and D. Stenzler. 1977. Alarm substance of the marine mud snail, Nassarius obsoletus: Biological 

function and possible evolution. Journal of Chemical Ecology 3:173-187. 

Atta-ur-Rahman, K. A., Khisal Ahmad Alvi, Sayed Ali Abbas, T. Sultana, Mustafa Shameel, Mohammad Iqbal 

Choudhary, and Jon C. Clardy. 1991. A diterpenoid lactone from Aplysia juliana. Journal of Natural 

Products 54:886-888. 

Avila, Conxita. 1993. Substancias naturales de moluscos Opistobranquios: estudio de su estructura, origen y 

función en ecosistemas bentonicos. Ph.D. Dissertation. Universidad de Barcelona. 546 pp.


Avila, Conxita. 2006. Molluscan natural products as biological models: chemical ecology, histology, and laboratory 

culture. Pages 1-23 in Guido Cimino and Margherita Gavagnin, eds., Molluscs: From Chemo-ecological 

Study to Biotechnological Applications. In W. E. G. Müller, ed., Progress in Molecular and 

Subcellular Biology: Marine Molecular Biotechnology, Volume 43. Springer, Berlin. 

Avila, Conxita, Manuel Ballesteros, Guido Cimino, Antonio Crispino, Margherita Gavagnin, and Guido 

Sodano. 1990. Biosynthetic origin and anatomical distribution of the main secondary metabolites in the 

nudibranch mollusc Doris verrucosa. Comparative Biochemistry and Physiology, ser. B, 97:363-368. 

Avila, Conxita, Guido Cimino, Antonio Crispino, and Aldo Spinella. 1991. Drimane sesquiterpenoids in 

Mediterranean Dendrodoris nudibranchs: anatomical distribution and biological role. Experientia 47:306- 

310. 

Avila, Conxita, Guido Cimino, Angelo Fontana, Margherita Gavagnin, Jesus Ortea, and Enrico Trivellone. 

1991. Defensive strategy of two Hypselodoris nudibranchs from Italian and Spanish coasts. Journal of 

Chemical Ecology 17:625-636. 

Avila, Conxita, and Meré Durfort. 1996. Histology of epithelia and mantle glands of selected species of doridacean 

mollusks with chemical defensive strategies. The Veliger 39:148-163. 

Avila, Conxita, Katrin Iken, Angelo Fontana, and Guido Cimino. 2000. Chemical ecology of the Antarctic 

nudibranch Bathydoris hodgsoni Eliot, 1907: Defensive role and origin of its natural products. Journal of 

Experimental Marine Biology and Ecology 252:27-44. 

Avila, Conxita, and Valerie J. Paul. 1997. Chemical ecology of the nudibranch Glossodoris pallida: is the location 

of diet-derived metabolites important for defense? Marine Ecology Progress Series 150:171-180. 

Ayer, Stephen W., and Raymond J. Andersen. 1982. Steroidal antifeedants from the dorid nudibranch Aldisa 

sanguinea cooperi. Tetrahedron Letters 23:1039-1042. 

Ayer, Stephen W., and Raymond J. Andersen. 1983. Degraded monoterpenes from the opisthobranch mollusc 

Melibe leonina. Experientia 39:255-256. 

Ayer, Stephen W., Raymond J. Andersen, Cun-Heng He, and Jon Clardy. 1984. Acanthodoral and isoacanthodoral, 

two sesquiterpenoids with new carbon skeletons from the dorid nudibranch Acanthodoris 

nanaimoensis. Journal of Organic Chemistry 49:2653-2654. 

Ayer, Stephen W., Jocelyne Hellou, Mark Tischler, and Raymond J. Andersen. 1984. Nanaimoal, a sesquiterpenoid 

aldehyde from the dorid nudibranch Acanthodoris nanaimoensis. Tetrahedron Letters 25:141-144. 

Baba, Kikutarô. 1967. Supplementary notes on the anatomy of Metaruncina setoensis (Baba, 1954), (N.G.) 

(Opisthobranchia — Cephalaspidea). Publications of the Seto Marine Biological Laboratory 15:185-197, 

Pl. I-V. 

Baker, J. T. 1974. Tyrian purple: ancient dye, a modern problem. Endeavour 33:11-17. 

Baker, Raymond, Paul H. Briner, and David A. Evans. 1978. Chemical defence in the termite Ancistrotermes 

cavithorax: ancistrodial and ancistrofuran. Journal of the Chemical Society, Chemical Communications 

1978:410-411. 

Bakus, Gerald J. 1974. Toxicity in holothurians: a geographical pattern. Biotropica 6:229-236. 

Bakus, Gerald J. 1981. Chemical defense mechanisms on the Great Barrier Reef, Australia. Science 211:497- 

499. 

Bandaranayake, Wickramasinghe M. 2006. The nature and role of pigments in marine invertebrates. Natural 

Product Reports 23:223-255. 

Barnes, David K. A., and Luke W. Bullough. 1996. Some observations on the diet and distribution of nudibranchs 

at Signy Island, Antarctica. Journal of Molluscan Studies 62:281-287. 

Barsby, Todd, Roger G. Linington, and Raymond J. Andersen. 2002. De novo terpenoid biosynthesis by the 

dentronotid nudibranch Melibe leonina. Chemoecology 12:199-202. 

Becerro, Mikel A., Gilles Goetz, Valerie J. Paul, and Paul J. Scheuer. 2001. Chemical defenses of the sacoglossan 

mollusk Elysia rufescens and its host alga Bryopsis sp. Journal of Chemical Ecology 27:2287-2299. 

Becerro, Mikel A., John A. Starmer, and Valerie J. Paul. 2006. Chemical defenses of cryptic and aposematic 

gastropterid molluscs feeding on their host sponge Dysidea granulosa. Journal of Chemical Ecology 

32:1491-1500. 

Becerro, Mikel A., Robert W. Thacker, Xavier Turon, Maria J. Uriz, and Valerie J. Paul. 2003. Biogeography 

of sponge chemical ecology: comparisons of tropical and temperate defenses. Oecologia 135:91-101.



Becerro, Mikel A., Xavier Turon, Maria J. Uriz, and José Templado. 2003. Can a sponge feeder be a herbivore? 

Tylodina perversa (Gastropoda) feeding on Aplysina aerophoba. Biological Journal of the Linnean 

Society 78:429-438. 

Benkendorff, Kirsten, John B. Bremner, and Andrew R. Davis. 2000. Tyrian purple precursors in the egg 

masses of the Australian muricid, Dicathais orbita: a possible defensive role. Journal of Chemical Ecology 

26:1037-1050. 

Bernan, Valerie S. 2001. Metabolites of free-living, commensal, and symbiotic benthic marine microorganisms. 

Pages 567-592 in J. B. McClintock and B. J. Baker, eds., Marine Chemical Ecology. CRC Press, 

Boca Raton. 

Bertsch, Hans, and Michael T. Ghiselin. 1985. A bioeconomic scenario for the evolution of nudibranch gastropods. 

The Western Society of Malacologists Annual Report 17:6-7. 

Bewley, Carole A., Nicholas D. Holland, and D. John Faulkner. 1996. Two classes of metabolites from 

Theonella swinhoei are localized in distinct populations of bacterial symbionts. Experientia 52:716-722. 

Bickell-Page, Louise R. 1991. Repugnatorial glands with associated striated muscle and sensory cells in 

Melibe leonina (Mollusca, Nudibranchia). Zoomorphology 110:281-291. 

Biskupiak, Joseph E., and Chris M. Ireland. 1985. Cytotoxic metabolites from the mollusc Peronia peronii. 

Tetrahedron Letters 26:4307-4310. 

Blanquer, Andrea, and María-J. Uriz. 2007. Cryptic speciation in marine sponges evidenced by mitochondrial 

and nuclear genes: a phylogenetic approach. Molecular Phylogenetics and Evolution 45:392-397. 

Blunt, John W., Brent R. Copp, Wan-Ping Hu, Murray H. G. Munro, Peter T. Northcote, and Michèle R. 

Prinsep. 2007. Marine natural products. Natural Product Reports 24:31-86. 





Blunt, John W., Brent R. Copp, Murray H. G. Munro, Peter T. Northcote, and Michèle R. Prinsep. 2004. 

Marine natural products. Natural Product Reports 21:1-49. 





Blunt, John W., and Murray H. G. Munro, eds. 2008. Dictionary of Marine Natural Products with CD-ROM. 

CRC Press, Boca Raton. 2,536 pp. 

Bobzin, Steven C., and D. John Faulkner. 1989. Diterpenes from the marine sponge Aplysilla polyrhaphis and 

the dorid nudibranch Chromodoris norrisi. Journal of Organic Chemistry 54:3902-3907. 

Boettger, Caesar R. 1954. Die Systematik der euthyneuren Schnecken. Verhandlungen Deutschen 

Zoologischen Gesellschaft 17:253-280. 

Bourdron, Julien, Laurent Commeiras, Gérard Audran, Nicolas Vanthuyne, J. C. Hubaud, and Jean-Luc 

Parrain. 2007. First total synthesis and assignment of the stereochemistry of crispatenine. Journal of 

Organic Chemistry 72:3770-3775. 

Boury-Esnault, Nicole, Michelle Klautau, C. Bézac, J. Wulff, and Antonio M. Solé-Cava. 1999. Comparative 

study of putative conspecific sponge populations from both sides of the Isthmus of Panama. Journal of the 

Marine Biological Association of the United Kingdom 79:39-50. 

Breidbach, Olaf, and Michael T. Ghiselin. 2007. Evolution and development: past, present, and future. Theory 

in Biosciences 125:157-171. 

Brunckhorst, David J. 1991. Do phyllidiid nudibranchs demonstrate behaviour consistent with their apparent 

warning coloration? — Some field observations. Journal of Molluscan Studies 57:481-483. 

Brunckhorst, David J. 1993. The systematics and phylogeny of phylidiid nudibranchs (Doridoidea). Records 

of the Australian Museum 1993(Suppl. 16):1-107. 

Bryan, Patrick J., James B. McClintock, and Bill J. Baker. 1998. Population biology and antipredator defenses 

of the shallow-water Antarctic nudibranch Tritoniella belli. Marine Biology 132:259-265. 

Bryan, Patrick J., Wesley Y. Yoshida, James B. McClintock, and Bill J. Baker. 1995. Ecological role for


pteroenone, a novel antifeedant produced by the conspicuous antarctic pteropod Clione antarctica 

(Gymnosomatia: Pteropoda). Marine Biology 122:271-277. 

Burghardt, Ingo, Jussi Evertsen, Geir Johnsen, and Heike Wägele. 2005. Solar powered sea slugs — mutualistic 

symbiosis of aeolid Nudibranchia (Mollusca, Gastropoda, Opisthobranchia) with Symbiodinium. 

Symbiosis 38:227-250. 

Burghardt, Ingo, and Heike Wägele. 2004. A new solar powered species of the genus Phyllodesmium 

Ehrenberg, 1931 (Mollusca: Nudibranchia: Adolidioidea) from Indonesia with analysis of its photosynthetic 

activity and notes on biology. Zootaxa 596:1-18. 

Burgoyne, David L., Eric J. Dumdei, and Raymond J. Andersen. 1993. Acanthenes A to C: a chloro, isothiocyanate, 

formamide sesquiterpene triad isolated from the Northeastern Pacific marine sponge Acanthella 

sp. and the dorid nudibranch Cadlina luteomarginata. Tetrahedron 49:4503-4510. 

Burns, E., and Micah Ilan. 2003. Comparison of anti-predatory defenses of Red Sea and Caribbean sponges. 

II. Physical defense. Marine Ecology Progress Series 252:115-123. 

Burreson, B. Jay, Paul J. Scheuer, Janet Finer, and Jon Clardy. 1975. 9-Isocyanopupukeanane, a marine invertebrate 

allomone with a new sesquiterpene skeleton. Journal of the American Chemical Society 97:4763- 

4764. 

Butler, Mark S., and Robert J. Capon. 1993. Beyond polygodial: new drimane sesquiterpenes from a southern 

Australian marine sponge, Dysidea sp. Australian Journal of Chemistry 46:1255-1267. 

Capon, Robert J., and D. John Faulkner. 1984. Metabolites of the pulmonate Siphonaria lessoni. Journal of 


Capon, Robert J., Emilio L. Ghisalberti, and Phillip R. Jefferies. 1982. New tetrahydropyrans from a marine 

sponge. Tetrahedron 38:1699-1703. 

Capper, Angela, Edwin Cruz-Rivera, Valerie J. Paul, and Ian R. Tibbetts. 2006. Chemical deterrence of a 

marine cyanobacterium against sympatric and non-sympatric consumers. Hydrobiologia 553:319-326. 

Capper, Angela, Ian R. Tibbetts, Judith M. O’Neill, and Glendon R. Shaw. 2005. The fate of Lyngbya majuscula 

toxins in three potential consumers. Journal of Chemical Ecology 31:1595-1606. 

Caprioli, Vincenzo, Guido Cimino, Roberto Colle, Margherita Gavagnin, Guido Sodano, and Aldo Spinella. 

1987. Insect antifeedant activity and hot taste for humans of selected natural and synthetic 1,4-dialdehydes. 

Journal of Natural Products 50:146-151. 

Caprotti, E. 1977. Molluschi e medicina nel I° secolo d. C. (studi di malacologia prerinascimentale, II). 

Conchiglie 13:137-144. 

Carballeira, Néstor M., Emiliano Anastacio, Javier Salva, and Maria Jesús Ortega. 1992. Identification of the 

new 10,15-eicosadienoic acid and related acids in the opisthobranch Haminaea templadoi. Journal of 

Natural Products 55:1783-1786. 

Carbone, Marianna. 2007. I molluschi opistobranchi: uno straordinario modello per selezionare molecole biologiclamente 

attive. Ph.D. Dissertation. Università degli Studi di Salerno. xi + 217 pp. 

Carbone, Marianna, Margherita Gavagnin, Ernesto Mollo, Margherita Bidello, Vassilios Roussis, and Guido 

Cimino. 2008. Further syphonosides from the sea hare Syphonota geographica and the sea-grass 

Halophila stipulacea. Tetrahedron 64:191-196. 

Carefoot, Thomas H. 1987. Aplysia: its biology and ecology. Oceanography and Marine Biology Annual 

Review 25:167-284. 

Carmely, Shmuel, Micha Ilan, and Yoel Kashman. 1989. 2-Amino imidazole alkaloids from the marine sponge 

Leucetta chagosensis. Tetrahedron 45:2193-2200. 

Carroll, Anthony R., Bruce F. Bowden, and John C. Coll. 1993. New imidazole alkaloids from the sponge 

Leucetta sp. and the associated predatory nudibranch Notodoris gardineri. Australian Journal of 

Chemistry 46:1229-1234. 

Carroll, Anthony R., and Paul J. Scheuer. 1990. Kuanoniamines A, B, C, and D: pentacyclic alkaloids from a 

tunicate and its prosobranch mollusk predator Chelynotus semperi. Journal of Organic Chemistry 

55:4426-4431. 

Carté, Brad, and D. John Faulkner. 1983. Defensive metabolites from three nembrothid nudibranchs. Journal 

of Organic Chemistry 48:2314-2318. 

Carté, Brad, and D. John Faulkner. 1986. Role of secondary metabolites in feeding associations between a



predatory nudibranch, two grazing nudibranchs, and a bryozoan. Journal of Chemical Ecology 12:795- 

804. 

Carté, Brad, Michael R. Kernan, Ellen B. Barrabee, and D. John Faulkner. 1986. Metabolites of the nudibranch 

Chromodoris funerea and the singlet oxygen oxidation products of furodysin and furodysinin. 

Journal of Organic Chemistry 51:3528-3532. 

Castiello, Domenico, Guido Cimino, Salvatore De Rosa, Salvatore De Stefano, Giulio Izzo, and Guido 

Sodano. 1979. Studies on the chemistry of the relationship between the opisthobranch Peltodoris atromaculata 

and the sponge Petrosia ficiformis. Pages 413-416 in C. Levi and N. Boury-Esnault, eds., Biologie 

des Spongiaires. Centre Nationale de la Recherche Scientifique, Paris. 

Castiello, D., Guido Cimino, Salvatore De Rosa, Salvatore De Stefano, and Guido Sondo. 1980. High molecular 

weight polyacetylenes from the nudibranch Peltodoris atromaculata and the sponge Petrosia ficiformis. 


Castoe, Todd A., Tricia Stephens, Brice P. Noonan, and Cristina Calestani. 2006. A novel group of type I 

polyketide synthases (PKS) in animals and the complex phylogenomics of PKSs. Gene. 

Cattaneo-Vietti, Riccardo, B. Burlando, and L. Senes. 1993. Life history and diet of Pleurobranchaea meckelii 

(Opisthobranchia: Notaspidea). Journal of Molluscan Studies 59:309-313. 

Cervera, Juan Lucas, Terrence M. Gosliner, Jose Carlos Garcia-Gomez, and Jesus Angel Ortea. 2000. A new 

species of Berthella Balinville, 1824 (Opisthobranchia: Notaspidea) from the Canary Islands (eastern 

Atlantic Ocean), with a re-examination of the phylogenetic relationships of the Notaspidea. Journal of 

Molluscan Studies 66:301-311. 

Chanas, Brian, and Joseph R. Pawlik. 1995. Defenses of Caribbean sponges against predatory reef fish: II. 

Spicules, tissue toughness, and nutritional quality. Marine Ecology Progress Series 127:195-211. 

Chang, Clifford W. J., and Paul J. Scheuer. 1990. Biosynthesis of marine isocyanoterpenoids in sponges. 

Comparative Biochemistry and Physiology 97B:227-233. 

Charupant, Kornvika, Khanit Suwanborirux, Surattana Amnuoypol, Emi Saito, Akinori Kubo, and Naoki 

Saito. 2007. Jorunnamycins A-C, new stabilized renieramycin-type bistetrahydroisoquinolines isolated 

from the Thai nudibranch Jorunna funebris. Chemical and Pharmaceutical Bulletin 55:81-86. 

Chou, Tong, Takeharu Haino, Makato Kuramoto, and Daisuke Uemura. 1996. Isolation and structure of pinnatoxin 

D, a new shellfish poison from the Okinawan bivalve Pinna muricata. Tetrahedron Letters 

37:4027-4030. 

Christophersen, Carsten. 1983. Marine indoles. Pages 259-285 in P. Scheuer, ed., Marine Natural Products, 

vol. 5. Academic Press, New York. 

Christophersen, Carsten. 1985a. Marine alkaloids. Pages 25-111 in A. Brossi, ed., The Alkaloids: Chemistry 

and Pharmacology, vol. 24. Academic Press, New York. 

Christophersen, Carsten. 1985b. Secondary metabolites from marine bryozoans. A review. Acta Chemica 

Scandanavica, ser. B, 39:517-529. 

Ciavatta, M. L., M. Gavagnin, R. Puliti, G. Cimino, E. Martínez, J. Ortea, and C. A. Mattia. 1997. 

Dactylallene: a novel dietary C 5 bromoallene from the Atlantic anaspidean mollusc Aplysia dactylomela. 

Tetrahedron 53:17343-17350. 

Ciavatta, Maria Letizia, Margherita Gavagnin, Raffaella Puliti, Guido Cimino, Eugenia Martinez, Jesus Ortea, 

and Carlo Andrea Mattia. 1996. Dolabriferol: a new polypropionate from the skin of the anaspidean mollusc 

Dolabrifera dolabrifera. Tetrahedron 52:12831-12838. 

Ciavatta, M. Letizia, M. Pilar Lopez Gresa, Margherita Gavagnin, Emiliano Manzo, Ernesto Mollo, Lisette 

D’Souza, and Guido Cimino. 2006. New caulerpenyne-derived metabolites of an Elysia sacoglossan from 

the south Indian coast. Molecules 11:808-816. 

Ciavatta, Maria Letizia, Emiliano Manzo, Genoveffa Nuzzo, Guido Villani, Guido Cimino, Juan Lucas 

Cervera, Manuel Antonio E. Malaquias, and Margherita Gavagnin. 2009. Aplysiopsenes: an additional 

example of marine polyketides with a mixed acetate/propionate pathway. Tetrahedron Letters 50:527-529. 

Ciavatta, M. Letizia, Enrico Trivellone, Guido Villani, and Guido Cimino. 1993. Membrenones: new polypropionates 

from the skin of the Mediterranean mollusc Pleurobranchus membranaceus. Tetrahedron Letters 

34(42):6791-6794. 

Ciavatta, M. Letizia, Enrico Trivellone, Guido Villani, and Guido Cimino. 1996. Prenylphenols from the skin


of the aeolid mollusc Cratena peregrina. Gazzetta Chimica Italiana 126:707-710. 

Ciavatta, M. Letizia, Guido Villani, Enrico Trivellone, and Guido Cimino. 1995. Two new labdane aldehydes 

from the skin of the notaspidean Pleurobranchaea meckelii. Tetrahedron Letters 36(47):8673-8676. 

Cimino, Guido, Antonio Crispino, Salvatore De Stefano, Margherita Gavagnin, and Guido Sodano. 1986. A 

naturally-occurring analog of methylthioadenosine (MTA) from the nudibranch mollusc Doris verrucosa. 

Experientia 42:1301-1302. 

Cimino, Guido, Antonio Crispino, Vincenzo Di Marzo, Margherita Gavagnin, and Joandomenec Ros. 1990. 

Oxytoxins, bioactive molecules produced by the marine opisthobranch mollusc Oxynoe olivacea from a 

diet-derived precursor. Experientia 46:767-770. 

Cimino, Guido, Antonio Crispino, Vincenzo Di Marzo, Guido Sodano, Aldo Spinella, and Guido Villani. 

1991. A marine mollusc provides the first example of in vivo storage of prostaglandins: Prostaglandin- 

1,15-lactones. Experientia 47:56-60. 

Cimino, Guido, Antonio Crispino, Vincenzo Di Marzo, Aldo Spinella, and Guido Sodano. 1991. Prostaglandin 

1,15-lactones of the F series from the nudibranch mollusc Tethys fimbria. Journal of Organic Chemistry 

56:2907-2911. 

Cimino, Guido, Antonio Crispino, Margherita Gavagnin, and Guido Sodano. 1990. Diterpenes from the nudibranch 

Chromodoris luteorosea. Journal of Natural Products 53:102-106. 

Cimino, Guido, Antonio Crispino, Margherita Gavagnin, Enrico Trivellone, Eva Zubía, Eugenia Martínez, and 

Jesus Ortea. 1993. Archidorin: a new ichthyotoxic diacylglycerol from the atlantic dorid nudibranch 

Archidoris tuberculata. Journal of Natural Products 56:1642-1646. 

Cimino, Guido, Antonio Crispino, Aldo Spinella, and Guido Sodano. 1988. Two ichthyotoxic diacylglycerols 

from the opisthobranch mollusc Umbraculum mediterraneum. Tetrahedron Letters 29(29):3613-3616. 

Cimino, Guido, Salvatore De Rosa, and Salvatore De Stefano. 1984. Antiviral agents from a gorgonian, 

Eunicella cavolini. Experientia 40:339-340. 

Cimino, Guido, Salvatore De Rosa, Salvatore De Stefano, Raffaele Morrone, and Guido Sodano. 1985. The 

chemical defense of nudibranch molluscs. Structure, biosynthetic origin and defensive properties of terpenoids 

from the dorid nudibranch Dendrodoris grandiflora. Tetrahedron 41:1093-1100. 

Cimino, Guido, Salvatore De Rosa, Salvatore De Stefano, and Guido Sodano. 1980. Cholest-4-en- 

4,16β,18,22R-tetrol-one-16,18-diacetate a novel polyhydrogenated steroid from the hydroid Eudendrium 

sp. Tetrahedron Letters 21:3303-3304. 

Cimino, Guido, Salvatore De Rosa, Salvatore De Stefano, and Guido Sodano. 1982. The chemical defense of 

four Mediterranean nudibranchs. Comparative Biochemistry and Physiology 73B:471-474. 

Cimino, Guido, Salvatore De Rosa, Salvatore De Stefano, and Guido Sodano. 1986. Marine natural products: 

new results from Mediterranean invertebrates. Pure and Applied Chemistry 58:375-386. 

Cimino, Guido, Salvatore De Rosa, Salvatore De Stefano, Aldo Spinella, and Guido Sodano. 1984. The 

zoochrome of the sponge Verongia aerophoba (“Uranidine”). Tetrahedron Letters 25:2925-2928. 

Cimino, Guido, Salvatore De Stefano, Salvatore De Rosa, Guido Sodano, and Guido Villani. 1980. Novel 

metabolites from some predator-prey pairs. Bulletin de la Société Chimique de Belgique 89:1069-1073. 

Cimino, Guido, Salvatore De Stefano, Antonio Guerriero, and Luigi Minale. 1975a. Furanosesquiterpenoids 

in sponges - III. Pallescensins A-D from Dysidea pallescens: new skeletal types. Tetrahedron Letters 

16:1425-1428. 

Cimino, Guido, Salvatore De Stefano, Antonio Guerriero, and Luigi Minale. 1975b. Furanosesquiterpenoids 

in sponges - IV. Microcionins from Microciona toxystila. Tetrahedron Letters :3723. 

Cimino, Guido, Salvatore De Stefano, and Luigi Minale. 1974. Scalaradial, a third sesterterpene with the 

tetracarbocyclic skeleton of scalarin, from the sponge Cacospongia mollior. Experientia 30:846-847. 

Cimino, Guido, Angelo Fontana, Adele Cutignano, and Margherita Gavagnin. 2004. Biosynthesis in opisthobranch 

molluscs: general outline in the light of recent use of stable isotopes. Phytochemistry Reviews 

3:285-307. 

Cimino, Guido, Angelo Fontana, and Margherita Gavagnin. 1999. Marine opisthobranch molluscs: chemistry 

and ecology in sacoglossans and dorids. Current Organic Chemistry 3:327-372. 

Cimino, Guido, Angelo Fontana, Francisca Giménez, Arnaldo Marin, Ernesto Mollo, Enrico Trivellone, and 

Eva Zubia. 1993. Biotransformation of a dietary sesterterpenoid in the Mediterranean nudibranch



Hypselodoris orsini. Experientia 49:582-586. 

Cimino, Guido, Margherita Gavagnin, Guido Sodano, Raffaela Puliti, Carlo A. Mattia, and Lelio Mazzarella. 

1988. Verrucosin-A and -B, diterpenoic acid glycerides with a new carbon skeleton from the dorid nudibranch 

Doris verrucosa. Tetrahedron 44:2301-2310. 

Cimino, Guido, Margherita Gavagnin, Guido Sodano, Aldo Spinella, Giuseppe Strazzullo, Francis J. Schmitz, 

and Yalamanchili Gopichand. 1987. Revised structure of bursatellin. Journal of Organic Chemistry 

52:2301-2303. 

Cimino, Guido, and Michael T. Ghiselin. 1998. Chemical defense and evolution in the Sacoglossa (Mollusca: 

Gastropoda: Opisthobranchia). Chemoecology 8:51-60. 

Cimino, Guido, and Michael T. Ghiselin. 1999. Chemical defense and evolutionary trends in biosynthetic 

capacity among dorid nudibranchs (Mollusca: Gastropoda: Opisthobranchia). Chemoecology 9:187-207. 

Cimino, Guido, and Michael T. Ghiselin. 2001. Marine natural products chemistry as an evolutionary narrative. 

Pages 115-154 in J. B. McClintock and B. J. Baker, eds., Marine Chemical Ecology. CRC Press, Boca 

Raton. 

Cimino, Guido, Amelia Passeggio, Guido Sodano, Aldo Spinella, and Guido Villani. 1991. Alarm pheromones 

from the Mediterranean opisthobranch Haminoea navicula. Experientia 47:61-63. 

Cimino, Guido, and Guido Sodano. 1994. Transfer of sponge secondary metabolites to predators. Pages 459- 

472 in R. W. M. Van Soest, T. M. G. Van Kempen, and J.-C. Braekman, eds., Sponges in Time and Space: 

Biology, Chemistry, Paleontology. A.A. Balkema, Rotterdam. 

Cimino, Guido, Guido Sodano, and Aldo Spinella. 1987. New propionate-derived metabolites from Aglaja 

depicta and from its prey Bulla striata (opisthobranch molluscs). Journal of Organic Chemistry 52:5326- 

5331. 

Cimino, Guido, Guido Sodano, and Aldo Spinella. 1988. Occurrence of olepupuane in two Mediterranean 

nudibranchs: a protected form of polygodial. Journal of Natural Products 51:1010-1011. 

Cimino, Guido, Guido Sodano, Aldo Spinella, and Enrico Trivellone. 1985. Aglajane-1, a polypropionate 

metabolite from the opisthobranch mollusc Aglaja depicta. Determination of carbon-carbon connectivity 

via long-range 1H- 13C couplings. Tetrahedron Letters 26:3389-3392. 

Cimino, Guido, Aldo Spinella, Antonio Scopa, and Guido Sodano. 1989. Umbraculumin-B, an unusual 3hydroxybutyric 

acid ester from the opisthobranch mollusc Umbraculum mediterraneum. Tetrahedron 

Letters 30(9):1147-1148. 

Cimino, Guido, Aldo Spinella, and Guido Sodano. 1989a. Naturally occurring prostaglandin-1,15-lactones. 

Tetrahedron Letters 30(27):3589-3592. 

Cimino, Guido, Aldo Spinella, and Guido Sodano. 1989b. Potential alarm pheromones from the 

Mediterranean opisthobranch Scaphander lignarius. Tetrahedron Letters 30(37):5003-5004. 

Clark, Kerry B., and Mario Busacca. 1978. Feeding specificity and chloroplast retention in four tropical 

Ascoglossa, with a discussion on the extent of chlorophyll symbiosis and the evolution of the order. 

Journal of Molluscan Studies 44:272-282. 

Clark, Kerry B., Kathe R. Jensen, and Hugh M. Stirts. 1990. Survey for functional kleptoplasty among west 

Atlantic Ascoglossa (=Sacoglossa) (Mollusca, Opisthobranchia). The Veliger 33:339-345. 

Coll, John C., Bruce F. Bowden, Dianne M. Tapiolas, Richard H. Willis, Peter Djura, M. Streamer, and Lamar 

Trott. 1985. Studies of Australian soft corals. XXXV. The terpenoid chemistry of soft corals and its implications. 

Tetrahedron 41:1085-1092. 

Coll, John C., Stephane LaBarre, Paul W. Sammarco, William T. Williams, and Gerald J. Bakus. 1982. 

Chemical defenses in soft corals (Coelenterata: Octocorallia) of the Great Barrier Reef: a study of comparative 

toxicities. Marine Ecology Progress Series 8:271-278. 

Corley, David G., Rolf Herb, Richard E. Moore, Paul J. Scheuer, and Valerie J. Paul. 1988. Laulimalides: new 

potent cytotoxic macrolides from a marine sponge and a nudibranch predator. Journal of Organic 

Chemistry 53:3644-3646. 

Cornforth, J. W. 1993. The trouble with synthesis. Australian Journal of Chemistry 46:157-170. 

Corning, Peter A. 2005. Holistic Darwinism: Synergy, Cybernetics, and the Bioeconomics of Evolution. 

University of Chicago Press, Chicago. viii + 546 pp. 

Coval, Stephen J., and Paul J. Scheuer. 1985. An intriguing C 16-alkadienone-substituted 2-pyridine from a


marine mollusk. Journal of Organic Chemistry 50:3024-3025. 

Coval, Stephen J., Gary R. Schulte, Gayle K. Matsumoto, Deborah M. Roll, and Paul J. Scheuer. 1985. Two 

polypropionate metabolites from the cephalaspidean mollusk Philinopsis speciosa. Tetrahedron Letters 

26:5359-5362. 

Cronin, Greg, Mark E. Hay, William Fenical, and Niels Lindquist. 1995. Distribution, density, and sequestration 

of host chemical defenses by the specialist nudibranch Tritonia hamnerorum found at high densities 

on the sea fan Gorgonia ventalina. Marine Ecology Progress Series 119:177-190. 

Cronin, Greg, Valerie J. Paul, Mark E. Hay, and William Fenical. 1997. Are tropical herbivores more resistant 

than temperate herbivores to seaweed chemical defenses? Diterpenoid metabolites from Dictyota acutiloba 

as feeding deterrents for tropical versus temperate fishes and urchins. Journal of Chemical Ecology 

23:289-302. 

Cueto, Mercedes, Luis D’Croz, Juan L. Maté, Aurelio San-Martin, and José Darias. 2005. Elysiapyrones from 

Elysia diomedea. Do such metabolites evidence an enzymatically assisted electrocyclization cascade for 

the biosynthesis of their biocyclo[4.2.0]octane core? Organic Letters 7:415-418. 

Curini-Galletti, Marco C. 1985. Chromosome morphology of Philinoglossa praelongata (Gastropoda 

Cephalaspidea). Journal of Molluscan Studies 51:220-222. 

Curini-Galletti, Marco C. 1988. Analyse du caryotype de Runcina coronata (Gastropoda Cephalaspidea). 

Cahiers de Biologie Marine 29:313-318. 

Cutignano, Adele, Conxita Avila, Anna Domenech-Coll, Giuliana d’Ippolito, Guido Cimino, and Angelo 

Fontana. 2008. First biosynthetic evidence on the phenyl-containing polyketides of the marine mollusc 

Scaphander lignarius. Organic Letters 10:2963-2966. 

Cutignano, Adele, Daniela Blihoghe, Angelo Fontana, Guido Villani, Giuliana d’Ippolito, and Guido Cimino. 

2007. Fusaripyrones, novel polypropionates from the Mediterranean mollusc Haminoea fusari. 

Tetrahedron 63:12935-12939. 

Cutignano, Adele, Guido Cimino, Antonella Giordano, Giuliana d’Ippolito, and Angelo Fontana. 2004. 

Polyketide origin of 3-alkylpyridines in the marine mollusc Haminoea orbignyana. Tetrahedron Letters 

45:2627-2629. 

Cutignano, Adele, Guido Cimino, Guido Villani, and Angelo Fontana. 2009a. Shaping the polypropionate 

biosynthesis in the solar-powered mollusc Elysia viridis. ChemBioChem 10:315-322. 

Cutignano, Adele, Guido Cimino, Guido Villani, and Angelo Fontana. 2009b. Origin of the C3-unit in 

placidenes: further insights into taxa divergence of polypropionate biosynthesis in marine molluscs and 

fungi. Tetrahedron. [Available online 6 August 2009.] 

Cutignano, Adele, Valentina Notti, Giuliana d’Ippolito, Anna Domenèch Coll, Guido Cimino, and Angelo 

Fontana. 2004. Lipase-mediated production of defensive toxins in the marine mollusc Oxynoe olivacea. 

Organic Biomolecular Chemistry 2:3167-3171. 

Cutignano, Adele, Anabella Tramice, Salvatore De Caro, Guido Villani, Guido Cimino, and Angelo Fontana. 

2003. Biogenesis of 3-alkylpyridine alkaloids in the marine mollusc Haminoea orbignyana. Angewandte 

Chemie, ser. International Edition, 42:2633-2636. 

Dai, Meilleko C., Mary J. Garson, and John C. Coll. 1991. Biosynthetic processes in soft corals. I. A comparison 

of terpene biosynthesis in Alcyonium molle (Alcyoniidae) and Heteroxenia sp. (Xeniidae). 

Comparative Biochemistry and Physiology 99B:775-783. 

Daly, John W. 2004. Marine toxins and nonmarine toxins: convergence or symbiotic organisms? Journal of 


Darias, José, Mercedes Cueto, and Ana R. Díaz-Marrero. 2006. The chemistry of marine pulmonate gastropods. 

Pages 105-131 in Guido Cimino and Margherita Gavagnin, eds., Molluscs: From Chemo-ecological 

Study to Biotechnological Application. In W. E. G. Müller, ed., Progress in Molecular and Subcellular 

Biology: Marine Molecular Biotechnology, Volume 43. Springer, New York. 

Darwin, Charles. 1845. Journal of Researches into the Natural History and Geology of the Countries Visited 

during the Voyage of H.M.S. Beagle round the World, 2nd edition. John Murray, London. 519 pp. 

Darwin, Charles. 1859. On the Origin of Species by Means of Natural Selection, or the Preservation of 

Favoured Races in the Struggle for Life, 1st edition. John Murray, London. ix + 502 pp., 2nd ed 1860, 3rd 

ed 1861, 4th ed 1866, 5th ed 1869, 6th ed 1872.



Darwin, Charles. 1862. On the Various Contrivances by which British and Foreign Orchids are Fertilised by 

Insects, and on the Good Effects of Intercrossing, 1st edition. John Murray, London. vi + 365 pp., Second 

edition 1877. 

D’Auria, Maria Valeria, Luigi Minale, and Raffaele Riccio. 1993. Polyoxygenated steroids of marine origin. 

Chemical Reviews 93:1839-1895. 

Davidson, Seana K., and Margo G. Haygood. 1999. Identification of sibling species of the bryozoan Bugula 

neritina that produce different anticancer bryostatins and harbor distinct strains of the bacterial symbiont 

“Candidatus endobugula sertula”. Biological Bulletin 196:273-280. 

Davies-Coleman, Michael T. 2006. Secondary metabolites from the marine gastropod molluscs of Antarctica, 

Southern Africa and South America. Pages 133-157 in Guido Cimino and Margherita Gavagnin, eds., 

Molluscs: From Chemo-ecological Study to Biotechnological Application. In W. E. G. Müller, ed., 

Progress in Molecular and Subcellular Biology: Marine Molecular Biotechnology, Volume 43. Springer, 

New York. 

Davies-Coleman, Michael T., and D. John Faulkner. 1991. New diterpenoic acid glycerides from the Antarctic 

nudibranch Austrodoris kerguelensis. Tetrahedron 47:9743-9750. 

Dawe, Robert D., and Jeffrey L. C. Wright. 1986. The major polypropionate metabolites from the sacoglossan 

mollusc Elysia chlorotica. Tetrahedron Letters 27:2559-2562. 

Dayrat, Benôit, Annie Tillier, Guillaume Lecointre, and Simon Tillier. 2001. New clades from euthyneuran 

gastropods (Mollusca) from 28S rRNA sequences. Molecular Phylogenetics and Evolution 19:225-235. 

de Jesus, Roman P., and D. John Faulkner. 2003. Chlorinated acetylenes from the San Diego sponge Haliclona 

lunisimilis. Journal of Natural Products 66:671-674. 

Della Sala, Giorgio, Adele Cutignano, Angelo Fontana, Aldo Spinella, Gianpiero Calabrese, Anna Domenech 

Coll, Giuliana d’Ippolito, Carmela Della Monica, and Guido Cimino. 2007. Towards the biosynthesis of 

the aromatic products of the Mediterranean mollusc Scaphander lignarius: isolation and synthesis of analogues 

of lignarenones. Tetrahedron 63:7256-7263. 

De Medeiros, E. F., J. M. Herbert, and Richard J. K. Taylor. 1990. The synthesis and absolute configuration 

of the novel ichthyotoxic diacylglycerol, umbraculumin A. Tetrahedron Letters 31:5843-5844. 

De Nys, Rocky, Peter D. Steinberg, Cary N. Rogers, Timothy S. Charlton, and Mark W. Duncan. 1996. 

Quantitative variation of secondary metabolites in the sea hare Aplysia parvula and its host plant, Delisea 

pulchra. Marine Ecology Progress Series 130:135-146. 

De Petrocellis, Luciano, and Vincenzo Di Marzo. 1994. Aquatic invertebrates open up new perspectives in 

eicosanoid research: biosynthesis and bioactivity. Prostaglandins Leukotrienes and Essential Fatty Acids 

51:215-229. 

De Petrocellis, Luciano, Piero Orlando, Margherita Gavagnin, Maria Carla Ventriglia, Guido Cimino, and 

Vincenzo Di Marzo. 1996. Novel diterpenoid diacylglycerols from marine molluscs: potent morphogens 

and protein kinase C activators. Experientia 52:874-877. 

Derby, Charles D. 2007. Escape by inking and secreting: marine molluscs avoid predators through a rich array 

of chemicals and mechanisms. Biological Bulletin 213:274-289. 

De Silva, E. Dilip, Sandra A. Morris, Shichiang Miao, Eric Dumdei, and Raymond J. Andersen. 1991. 

Terpenoid metabolites from skin extracts of four Sri Lankan nudibranchs in the genus Chromodoris. 


De Silva, E. Dilip, and Paul J. Scheuer. 1982. Furanoditerpenoids from the dorid nudibranch Casella atromarginata. 

Heterocycles 17:167-170. 

De Silva, E. Dilip, Robert E. Schwartz, Paul J. Scheuer, and James N. Shoolery. 1983. Srilankenyne, a new 

metabolite from the sea hare Aplysia oculifera. Journal of Organic Chemistry 48:395-396. 

Dewick, Paul M. 1997. Medicinal Natural Products: a Biosynthetic Approach. John Wiley & Sons, 

Chichester. 

Díaz-Marrero, Ana R., Mercedes Cueto, Luis D’Croz, and José Darias. 2008. Validating and endoperoxide as 

a key intermediate in the biosynthesis of elysiapyrones. Organic Letters 10:3057-3060. 

Díaz-Marrero, Ana R., Enrique Dorta, Mercedes Cueto, Juana Rovirosa, Aurelio San-Martin, Alberto Loyola, 

and José Diaz. 2003. Labdane diterpenes with a new oxidation pattern from the marine pulmonate 

Trimusculus peruvianus. Tetrahedron 59:4805-4809.


Dieter, R. K., Robin Kinnel, Jerrold Meinwald, and Thomas Eisner. 1979. Brasudol and isobrasudol: two bromosesquiterpenes 

from a sea hare (Aplysia brasiliana). Tetrahedron Letters 20:1645-1648. 

Di Marzo, Vincenzo, Guido Cimino, Antonio Crispino, Concetta Minardi, Guido Sodano, and Aldo Spinella. 

1991. A novel multifunctional metabolic pathway in a marine mollusc leads to unprecedented 

prostaglandin derivatives: prostaglandin 1,15-lactones. Biochemical Journal 273:593-600. 

Di Marzo, Vincenzo, Guido Cimino, Guido Sodano, Guido Spinella, and Guido Villani. 1990. A novel 

prostaglandin metabolic pathway from a marine mollusc: prostaglandin-1,15-lactones. Advances in 

Prostaglandin Thromboxane and Leukotriene Research 21:129-132. 

Di Marzo, Vincenzo, Arnaldo Marin, Rosa R. Vardaro, Luciano De Petrocellis, Guido Villani, and Guido 

Cimino. 1993. Histological and biochemical bases of defense mechanisms in four species of 

Polybranchoidea ascoglossan molluscs. Marine Biology 117:367-380. 

Di Marzo, Vincenzo, Rosa R. Vardaro, Luciano De Petrocellis, Guido Villani, R. Minei, and Guido Cimino. 

1991. Cyercenes, novel pyrones from the ascoglossan mollusc Cyerce cristallina. Tissue distribution, 

biosynthesis and possible involvement in defense and regenerative processes. Experientia 47:1221-1227. 

Dinapoli, Angela, Ceyhun Tamer, Susanne Franssen, Lisha Naduvilezhath, and Annette Klussmann-Kolb. 

2007. Utility of H3-gene sequences for phylogenetic reconstruction — a case study of heterobranch 

Gastropoda. Bonner Zoologische Beiträge 55:191-202. 

Dobzhansky, Theodosius, and A. H. Sturtevant. 1938. Inversions in the chromosomes of Drosophila 

pseudoobscura. Genetics 23:28-64. 

Dohrn, Anton. 1875. Der Ursprung der Wirbelthiere und das Princip des Functionswechsels. — 

Genealogische Skizzen von Anton Dohrn. Wilhelm Engelmann, Leipzig. xv + 87 pp. 

Dumdei, Eric J., John W. Blunt, Murray H. G. Munro, Christopher N. Battershill, and Michael J. Page. 1998. 

The whys and whats of sponge chemistry: why chemists extract sponges and what problems does it cause. 

Pages 353-364 in Y. Watanabe and N. Fusetani, eds., Sponge Sciences: Multidisciplinary Perspectives. 

Springer-Verlag, Tokyo. 

Dumdei, Eric J., E. Dilip De Silva, Raymond J. Andersen, M. Iqbal Coudhary, and Jon Clardy. 1989. 

Chromodorolide A, a rearranged diterpene with a new carbon skeleton from the Indian Ocean nudibranch 

Chromodoris cavae. Journal of the American Chemical Society 111:2712-2713. 

Dumdei, Eric J., Andrew E. Flowers, Mary J. Garson, and Christopher J. Moore. 1997. The biosynthesis of 

sesquiterpene isocyanides and isothiocyanates in the marine sponge Acanthella cavernosa (Dendy); evidence 

for dietary tranfer to the dorid nudibranch Phyllidiella pustulosa. Comparative Biochemistry and 

Physiology 113A:1385-1392. 

Dumdei, Eric J., Julia Kubanek, John E. Coleman, Jana Pika, Raymond J. Andersen, Jose Rios Steiner, and 

Jon Clardy. 1997. New terpenoid metabolites from the skin extracts, an egg mass, and dietary sponges of 

the Northeastern Pacific dorid nudibranch Cadlina luteomarginata. Canadian Journal of Chemistry 

75:773-789. 

Eales, Nellie B. 1960. Revision of the world species of Aplysia (Gastropoda, Opisthobranchia). Bulletin of the 

British Museum (Natural History) 5(10):267-404. 

Ebel, Rainer, Arnaldo Marin, and Peter Proksch. 1999. Organ-specific distribution of dietary alkaloids in the 

marine opisthobranch Tylodina perversa. Biochemical Systematics and Ecology 27:769-777. 

Edmonds, Malcolm. 1987. Color in opisthobranchs. American Malacological Bulletin 5:185-196. 

Edmunds, Malcolm. 1966. Protective mechanisms in the Eolidacea (Mollusca, Nudibranchia). Journal of the 

Linnaean Society of London (Zoology) 47:27-71., 4 Plates. 

Edmunds, Malcolm. 1968. On the swimming and defensive response of Hexabranchus marginatus (Mollusca, 

Nudibranchia). Journal of the Linnaean Society of London (Zoology) 47:425-429, Pl. 1. 

Edmunds, Malcolm. 1974. Defense in Animals. A Survey of Antipredator Defences. Longman, Harlow. xvii + 

357 pp. 

Edmunds, Malcolm. 1987. Color in opisthobranchs. American Malacological Bulletin 5:185-196. 

Edmunds, Malcolm. 1991. Does warning coloration occur in nudibranchs? Malacologia 32:241-255. 

Edrada, Ru Angelie, Markus Heubes, Gernot Brauers, Victor Wray, Albrecht Berg, Udo Gräfe, Michael 

Wohlfarth, Jörg Mühlbacher, Karsten Schaumann, Sudarsono, Gerhard Bringmann, and Peter Proksch. 

2002. Online analysis of xestodecalactones A-C, novel bioactive metabolites from the fungus Penicillium



cf. montanense and their subsequent isolation from the sponge Xestospongia exigua. Journal of Natural 

Products 65:1598-1604. 

Engel, Sebastian, Paul R. Jensen, and William Fenical. 2002. Chemical ecology of marine microbial defense. 

Journal of Chemical Ecology 28:1971-1985. 

Erickson, Karen L. 1983. Constituents of Laurencia. Pages 131-257 in P. Scheuer, ed., Marine Natural 

Products, vol. 5. Academic Press, New York. 

Estrada, D. M., José L. Ravelo, Catalina Ruiz-Pérez, Julio D. Martin, and X. Solans. 1989. Dactylomelol, a 

new class of diterpene from the sea hare Aplysia dactylomela. Tetrahedron Letters 30:6219-6220. 

Euichi, Hirose. 2005. Digestive system of the sacoglossan Plakobranchus ocellatus (Gastropoda: 

Opisthobranchia): light- and electron-microscope observations with remarks on chloroplast retention. 

Zoological Science 22:905-916. 

Evans, T. J. 1914. The anatomy of a new species of Bathydoris, and the affinities of the genus. Scottish 

National Antarctic Expedition. Transactions of the Royal Society of Edinburgh 50(6[1 April]):191-209, Pl. 

VII-XVIII. 

Fahey, Shireen, and Anthony R. Carroll. 2007. Natural products isolated from species of Halgerda Bergh, 

1880 (Mollusca: Nudibranchia) and their ecological and evolutionary implications. Journal of Chemical 

Ecology 33:1226-1234. 

Fahey, Shireen J., and Mary J. Garson. 2002. Geographic variation of natural products of tropical nudibranch 

Asteronotus cespitosus. Journal of Chemical Ecology 28:1773-1785. 

Fahey, Shireen J., and Terrence M. Gosliner. 2001. The phylogeny of Halgerda (Opisthobranchia, 

Nudibranchia) with the description of a new species from Okinawa. Zoologica Scripta 30:199-213. 

Fahey, Shireen J., and Terrence M. Gosliner. 2004. A phylogenetic analysis of the Aegiridae Fischer, 1883 

(Mollusca, Nudibranchia, Phanerobranchia) with descriptions of eight new species and a reassessment of 

phanerobranch relationships. Proceedings of the California Academy of Sciences,ser. 4, 55(34[30 

December]):613-689. 

Faircloth, Glynn, and Carmen Cuevas. 2006. Kahalalide F and ES285: potent anticancer agents from marine 

molluscs. Pages 363-379 in Guido Cimino and Margherita Gavagnin, eds., Molluscs: From Chemo-ecological 

Study to Biotechnological Application. In W. E. G. Müller, ed., Progress in Molecular and 

Subcellular Biology: Marine Molecular Biotechnology, Volume 43. Springer, New York. 

Faulkner, D. John. 1984a. Marine natural products: metabolites of marine algae and herbivorous marine molluscs. 

Natural Product Reports 1:251-278. 

Faulkner, D. John. 1984b. Marine natural products: metabolites of marine invertebrates. Natural Product 

Reports 1:551-599. 

Faulkner, D. John. 1986. Marine natural products. Natural Product Reports 3:1-33. 













Faulkner, D. John. 2000a. Highlights of marine natural products chemistry (1972-1999). Natural Product 

Reports 17:1-6. 

Faulkner, D. John. 2000b. Marine natural products. Natural Product Reports 17:7-55. 


Faulkner, D. John, and Michael T. Ghiselin. 1983. Chemical defense and the evolutionary ecology of dorid 

nudibranchs and some other opisthobranch gastropods. Marine Ecology Progress Series 13:295-301.


Faulkner, D. John, Mary Kay Harper, Margo G. Haygood, Christine E. Salomon, and Eric W. Schmidt. 2000. 

Symbiotic bacteria in sponges: sources of bioactive substances. Pages 107-119 in N. Fusetani, ed., Drugs 

from the Sea. Karger, Basel. 

Faulkner, D. John, and Chris Ireland. 1977. The chemistry of some opisthobranch molluscs. Pages 23-34 in 

D. J. Faulkner and W. H. Fenical, eds., Marine Natural Products Chemistry. Nato Conference Series, IV:1. 

Plenum Press, New York. 

Faulkner, D. John, Tadeusz F. Molinski, Raymond J. Andersen, Eric J. Dumdei, and E. Dilip De Silva. 1990. 

Geographical variation in defensive chemicals from Pacific Coast dorid nudibranchs and some related 

marine molluscs. Comparative Biochemistry and Physiology 97C:233-240. 

Faulkner, D. John, and Martha O. Stallard. 1973. 7-chloro-3,7-dimethyl-1,4,6-tribromo-1-octen-3-ol, a novel 

monoterpene alcohol from Aplysia californica. Tetrahedron Letters 14:1171-1174. 

Faulkner, D. John, Martha O. Stallard, Jocé Fayos, and Jon Clardy. 1973. (3R,4S,7S)-trans,trans-3,7dimethyl-1,8,8-tribromo-3,4,7-trichloro-1,5-octadiene, 

a novel monoterpene from the sea hare Aplysia californica. 

Journal of the American Chemical Society 95:3413-3414. 

Fautin, Daphne Gayle, ed. 1988. Biomedical Importance of Marine Organisms. Memoirs of the California 

Academy of Sciences, No. 13. California Academy of Sciences, San Francisco. viii + 159 pp. 

Fenical, William, Howard L. Sleeper, Valerie J. Paul, Martha O. Stallard, and Hao H. Sun. 1979. Defensive 

chemistry of Navanax and related opisthobranch molluscs. Pure and Applied Chemistry 51:1865-1874. 

Fernández, R., J. Rodríguez, E. Quiñoá, R. Riguera, L. Muñoz, M. Fernández-Suárez, and C. Debitus. 1996. 

Onchidin B: a new cyclodepsipeptide from the mollusc Onchidium sp. Journal of the American Chemical 

Society 118:11635-11643. 

Field, Katherine G., Gary J. Olsen, David J. Lane, Stephen Giovannoni, Michael T. Ghiselin, Elizabeth C. 

Raff, Norman R. Pace, and Rudolf A. Raff. 1988. Molecular phylogeny of the animal kingdom. Science 

239:748-753. 

Fischbach, Michael A., and Jon Clardy. 2007. One pathway, many products. Nature Chemical Biology 3:353- 

355. 

Fontana, Angelo. 2006. Biogenetic proposals and biosynthetic studies on secondary metabolites of opisthobranch 

molluscs. Pages 303-332 in Guido Cimino and Margherita Gavagnin, eds., Molluscs: From Chemoecological 

Study to Biotechnological Application. In W. E. G. Müller, ed., Progress in Molecular and 

Subcellular Biology: Marine Molecular Biotechnology, Volume 43. Springer, New York. 

Fontana, Angelo, Conxita Avila, Eugenia Martinez, Jesus Ortea, Enrico Trivellone, and Guido Cimino. 1993. 

Defensive allomones in three species of Hypselodoris (Gastropoda, Nudibranchia), from the Cantabrian 

Sea. Journal of Chemical Ecology 19:339-356. 

Fontana, Angelo, Paolo Cavaliere, Nicon Ungur, Lisette D’Souza, P. S. Parameswaram, and Guido Cimino. 

1999. New scalaranes from the nudibranch Glossodoris atromarginata and its sponge prey. Journal of 


Fontana, Angelo, Paolo Cavaliere, Solimabi Wahidulla, Chandrakant G. Naik, and Guido Cimino. 2000. A new 

antitumor isoquinoline alkaloid from the marine nudibranch Jorunna funebris. Tetrahedron 56:7305-7308. 

Fontana, Angelo, Maria Letizia Ciavatta, Lisette D’Souza, Ernesto Mollo, Chandrakant G. Naik, P. S. 

Parameswaran, Solimabi Wahidula, and Guido Cimino. 2001. Selected chemo-ecological studies of marine 

opisthobranchs from Indian coasts. Journal of the Indian Institute of Science 81:403-415. 

Fontana, Angelo, Maria Letizia Ciavatta, Tomofumi Miyamoto, Aldo Spinella, and Guido Cimino. 1999. 

Biosynthesis of drimane terpenoids in dorid molluscs: pivotal role of 7-deacetoxyolepupuane in two 

species of Dendrodoris nudibranchs. Tetrahedron 55:5937-5946. 

Fontana, Angelo, Maria Letizia Ciavatta, Ernesto Mollo, Chandra D. Naik, Solimabi Wahidulla, Lisette 

D’Souza, and Guido Cimino. 1999. Volvatellin, cauerpenyne-related product from the sacoglossan 

Volvatella sp. Journal of Natural Products 62:931-933. 

Fontana, Angelo, Adele Cutignano, Antonella Giordano, Anna Domenèch Coll, and Guido Cimino. 2004. 

Biosynthesis of aglajanes, propionate allomones of the opisthobranch mollusc Bulla striata. Tetrahedron 

Letters 45:6847-6850. 

Fontana, Angelo, Margherita Gavagnin, Ernesto Mollo, Enrico Trivellone, Jesus Ortea, and Guido Cimino. 

1995. Chemical studies of Cadlina molluscs from the Cantabrian Sea (Atlantic Ocean). Comparative



Biochemistry and Physiology 111B:283-290. 

Fontana, Angelo, F. Giménez, Arnaldo Marin, Ernesto Mollo, and Guido Cimino. 1994. Transfer of secondary 

metabolites from the sponges Dysidea fragilis and Pleraplysilla spinifera to the mantle dermal formations 

(MDFs) of the nudibranch Hypselodoris webbi. Experientia 50:510-516. 

Fontana, Angelo, Ernesto Mollo, Jesus Ortea, Margherita Gavagnin, and Guido Cimino. 2000. Scalarane and 

homoscalarane compounds from the nudibranchs Glossodoris sedna and Glossodoris dalli: chemical and 

biological properties. Journal of Natural Products 63:527-530. 

Fontana, Angelo, Ernesto Mollo, Desiderata Ricciardi, Issa Fakhr, and Guido Cimino. 1997. Chemical studies 

of Egyptian opisthobranchs: spongian diterpenoids from Glossodoris atromarginata. Journal of 


Fontana, Angelo, Claudia Muniaín, and Guido Cimino. 1998. First chemical study of Patagonian nudibranchs: 

a new seco-11,12-spongiane, tyrinnal, from the digestive organs of Tyrinna nobilis. Journal of Natural 

Products 61:1027-1029. 

Fontana, Angelo, Anabella Tramice, Adele Cutignano, Giuliana D’Ippolito, Margherita Gavagnin, and Guido 

Cimino. 2002. Terpene biosynthesis in the nudibranch Doriopsilla areolata. Journal of Organic Chemistry 

68:2405-2409. 

Fontana, Angelo, Anabella Tramice, Adele Cutignano, Giuliana D’Ippolito, Licia Renzulli, and Guido 

Cimino. 2003. Studies of the biogenesis of verrucosins, toxic diterpenoid glycerides of the Mediterranean 

mollusc Doris verrucosa. European Journal of Organic Chemistry 2003:3104-3108. 

Fontana, Angelo, Enrico Trivellone, Ernesto Mollo, Guido Cimino, Conxita Avila, Eugenia Martinez, and 

Jesus Ortea. 1994. Further chemical studies of Mediterranean and Atlantic Hypselodoris nudibranchs: a 

new furanosesquiterpenoid from Hypselodoris webbi. Journal of Natural Products 57:510-513. 

Fontana, Angelo, Guido Villani, and Guido Cimino. 2000. Terpene biosynthesis in marine molluscs: incorporation 

of glucose in drimane esters of Dendrodoris nudibranchs via classical mevalonate pathway. 


Freudenthal, Hugo D., ed. 1968. Drugs from the sea: Transactions of the drugs from the sea symposium 

University of Rhode Island 27-29 August 1967. Marine Technology Society, Washington. x + 297 pp. 

Fryer, Geoffrey, and T. D. Iles. 1972. The Cichlid Fishes of the Great Lakes of Africa: their Biology and 

Evolution. T.F.H. Publications, Hong Kong. xvi + 641 pp. 

Fu, Xiong, Eugene P. Hong, and Francis J. Schmitz. 2000. New polypropionate pyrones from the Philippine 

sacoglossan mollusc Placobranchus ocellatus. Tetrahedron 56:8989-8993. 

Fu, Xiong, Alana J. Palomar, Eugene P. Hong, Francis J. Schmitz, and Frederick A. Valeriote. 2004. Cytotoxic 

lissoclimide-type diterpenes from the molluscs Pleurobranchus albiguttatus and Pleurobranchus forskalii. 


Fuhrman, Frederick A., Geraldine J. Fuhrman, Ronald A. Nachman, and Harry S. Mosher. 1981. 

Isoguanosine: isolation from an animal. Science 212:557-558. 

Furhman, Frederick A., Geraldine J. Fuhrman, Yong H. Kim, LeeA. Pavelka, and Harry S. Mosher. 1980. 

Doridosine, a new hypotensive N-methylpurine riboside from the nudibranch Anisodoris nobilis. Science 

207:193-195. 

Fusetani, Nobuhiro, ed. 2000. Drugs from the Sea. S. Karger, Basel. iv + 158 pp. 

Fusetani, Nobuhiro, Hiroshi Hirota, Tatsufumi Okino, Yasuhiko Tomono, and Erina Yoshimura. 1996. 

Antifouling activity of isocyanoterpenoids and related compounds isolated from a marine sponge and 

nudibranchs. Journal of Natural Toxins 5:249-259. 

Fusetani, Nobuhiro, Heather J. Wolstenholme, and Shigeki Matsunaga. 1990. Bioactive marine metabolites 

series 34. Co-occurence of 9-isocyanopupukeanane and its C-9 epimer in the nudibranch Phyllidia bourguini. 


Fusetani, Nobuhiro, Heather J. Wolstenholme, Shigeki Matsunaga, and Hiroshi Hirota. 1991. Two new 

sesquiterpene isonitriles from the nudibranch Phyllidia pustulosa. Tetrahedron Letters 32:7291-7294. 

Fusetani, Nobuhiro, Heather J. Wolstenholme, Katsumi Shinoda, Naoki Asai, Shikegi Matsunaga, Hiroyuki 

Onuki, and Hiroshi Hirota. 1992. Two sesquiterpene isocyanides and a sesquiterpene thiocyanate from the 

marine sponge Acanthella cf. cavernosa and the nudibranch Phyllidia ocellata. Tetrahedron Letters 

33:6823-6826.


Gabe, Marcel, and Marcel Prenant. 1953. Données morphologiques sur la région antérieure du tube digestif 

d’Acteon tornatilis L. Bulletin de la Société Zoologique de France 78:36-44. 

Gallimore, Winklet A., Daisy L. Galario, Christopher Lacy, Ye Zhu, and Paul J. Scheuer. 2000. Two complex 

proline esters from the sea hare Stylocheilus longicauda. Journal of Natural Products 63:1022-1026. 

Gallimore, Winklet A., and Paul J. Scheuer. 2000. Malyngamides O and P from the sea hare Stylocheilus longicauda. 


Garcia-Gómez, José C., Guido Cimino, and Antonio Medina. 1990. Studies on the defensive behaviour of 

Hypselodoris species (Gastropoda: Nudibranchia): ultrastructure and chemical analysis of mantle dermal 

formations (MDFs). Marine Biology 106:245-250. 

Garcia-Gómez, José, Antonio Medina, and Rafael Coveñas. 1991. Study of the anatomy and histology of the 

mantle dermal formations (MDFs) of Chromodoris and Hypseledoris (Opisthobranchia: 

Chromodorididae). Malacologia 32:233-240. 

Garson, Mary J. 2001. Ecological perspectives on marine natural product biosynthesis. Pages 71-114 in J. B. 

McClintock and B. J. Baker, eds., Marine Chemical Ecology. CRC Press, Boca Raton. 

Garson, Mary J., Annette F. Dexter, Lynette K. Lambert, and Vicky Liokas. 1992. Isolation of the bioactive 

terpene 7-deacetoxyolepupuane from the temperate marine sponge Dysidea sp. Journal of Natural 

Products 55:364-367. 

Gaspar, Helena, Adele Cutignano, T. Ferrieira, G. Calado, Guido Cimino, and Angelo Fontana. 2008. 

Biosynthetic evidence supporting the generation of terpene chemodiversity in marine molluscs of the 

genus Doriopsilla. Journal of Natural Products . 

Gaspar, Helena, Margherita Gavagnin, Gonçalo Calado, Francesco Castelluccio, Ernesto Mollo, and Guido 

Cimino. 2005. Pelseneeriol-1 and -2: new furanosesquiterpene alcohols from porostome nudibranch 

Doriopsilla pelseneeri. Tetrahedron 61:11032-11037. 

Gavagnin, Margherita, Marianna Carbone, Pietro Amodeo, Ernesto Mollo, Rosa Maria Vitale, Vassilios 

Roussis, and Guido Cimino. 2007. Structure and absolute stereochemistry of syphonoside, a unique macrocyclic 

glycoterpenoid from marine organisms. Journal of Organic Chemistry 72:5625-5630. 

Gavagnin, Margherita, Marianna Carbone, Ernesto Mollo, and Guido Cimino. 2003a. Austrodoral and austrodoric 

acid: nor-sesquiterpenes with a new carbon skeleton from the Antarctic nudibranch Austrodoris 

kerguelensis. Tetrahedron Letters 44:1495-1498. 

Gavagnin, Margherita, Marianna Carbone, Ernesto Mollo, and Guido Cimino. 2003b. Further chemical studies 

on the Antarctic nudibranch Austrodoris kerguelensis: new terpenoid acylglycerols and revision of the 

previous stereochemistry. Tetrahedron 59:5579-5583. 

Gavagnin, Margherita, Marianna Carbone, Michela Nappo, Ernesto Mollo, Vassilios Roussis, and Guido 

Cimino. 2005. First chemical study of anaspidean Syphonota geographica: structures of degraded sterols 

aplykurodinone-1 and -2. Tetrahedron 61:617-621. 

Gavagnin, Margherita, and Angelo Fontana. 2000. Diterpenes from marine opisthobranch molluscs. Current 


Gavagnin, Margherita, Angelo Fontana, M. Letezia Ciavatta, and Guido Cimino. 2000. Chemical studies on 

Antarctic nudibranch gastropods. Italian Journal of Zoology 67(Suppl. 1):101-109. 

Gavagnin, Margherita, Arnaldo Marin, Francesco Castelluccio, Guido Villani, and Guido Cimino. 1994. 

Defensive relationships between Caulerpa prolifera and its shelled sacoglossan predators. Journal of 


Gavagnin, Margherita, Arnaldo Marin, Ernesto Mollo, Antonio Crispino, Guido Villani, and Guido Cimino. 

1994. Secondary metabolites from Mediterranean Elysioidea: origin and biological role. Comparative 

Biochemistry and Physiology 108B:107-115. 

Gavagnin, Margherita, Ernesto Mollo, Goncalo Calado, Shireen Fahey, Michael Ghiselin, Jésus Ortea, and 

Guido Cimino. 2001. Chemical studies of porostome nudibranchs: comparative and ecological aspects. 

Chemoecology 11:131-136. 

Gavagnin, Margherita, Ernesto Mollo, Francesco Castelluccio, Domenico Montanaro, Jesus Ortea, and Guido 

Cimino. 1997. A novel dietary sesquiterpene from the marine sacoglossan Tridachia crispata. Natural 

Product Letters 10:151-156. 

Gavagnin, Margherita, Ernesto Mollo, Teresa Docimo, Yu-Wei Guo, and Guido Cimino. 2004. Scalarane



metabolites from the nudibranch Glossodoris rufomarginata and its dietary sponge from the South China 

Sea. Journal of Natural Products 67:2104-2107. 

Gavagnin, Margherita, Ernesto Mollo, Domenico Montanaro, Jesus Ortea, and Guido Cimino. 2000. Chemical 

studies of Caribbean sacoglossans: dietary relationships with green algae and ecological implications. 


Gavagnin, Margherita, Aldo Spinella, Francesco Castelluccio, Guido Cimino, and Arnaldo Marin. 1994. 

Polypropionates from the Mediterranean Mollusk Elysia timida. Journal of Natural Products 57:298-304. 

Gavagnin, Margherita, Aldo Spinella, Guido Cimino, and Guido Sodano. 1990. Stereochemistry of ichthyotoxic 

diacylglycerols from opisthobranch molluscs. Tetrahedron Letters 31(42):6093-6094. 

Gavagnin, Margherita, Aldo Spinella, Antonio Crispino, Rosangela De Almeida Epifanio, Arnaldo Marin, and 

Guido Cimino. 1993. Chemical components of the Mediterranean ascoglossan Thuridilla hopei. Gazzetta 

Chimica Italiana 123:205-208. 

Gavagnin, Margherita, Enrico Trivellone, Francesco Castelluccio, Guido Cimino, and Riccardo Cattaneo- 

Vietti. 1995. Glyceryl ester of a new halimane diterpenoic acid from the skin of the Antarctic nudibranch 

Austrodoris kerguelensis. Tetrahedron Letters 36(40):7319-7322. 

Gavagnin, Margherita, Nicon Ungur, Francesco Castelluccio, and Guido Cimino. 1997. Novel verrucosins 

from the skin of the Mediterranean nudibranch Doris verrucosa. Tetrahedron 53:1491-1504. 

Gavagnin, Margherita, Nicon Ungur, Francesco Castelluccio, Claudia Muniain, and Guido Cimino. 1999. 

New minor diterpenoid diacylglycerols from the skin of the nudibranch Anisodoris fontaini. Journal of 


Gavagnin, Margherita, Nicon Ungur, Ernesto Mollo, José Templado, and Guido Cimino. 2002. Structure and 

synthesis of a progesterone homologue from the skin of the dorid nudibranch Aldisa smaragdina. 

European Journal of Organic Chemistry :1500-1504. 

Gavagnin, Margherita, Rosa Rita Vardaro, Conxita Avila, Guido Cimino, and Jesus Ortea. 1992. Ichthyotoxic 

diterpenoids from the Cantabrian nudibranch Chromodoris luteorosea. Journal of Natural Products 

55:368-371. 

Gemballa, Sven, and Franca Schermutzki. 2004. Cytotoxic haplosclerid sponges preferred: a field study on 

the diet of the dotted sea slug Peltodoris atromaculata (Doridoidea: Nudibranchia). Marine Biology 

144:1213-1222. 

Gerhart, Donald J. 1983. The chemical systematics of colonial marine animals: an estimated phylogeny of the 

order Gorgonacea based on terpenoid characters. Biological Bulletin 164:71-81. 

Gerhart, Donald J. 1984. Prostglandin A 2: an agent of chemical defense in the Caribbean gorgonian Plexaura 

homomalla. Marine Ecology Progress Series 19:181-187. 

Gerhart, Donald J. 1986. Prostaglandin A 2 in the Caribbean gorgonian Plexaura homomalla: evidence against 

allelopathic and antifouling roles. Biochemical Systematics and Ecology 14:417-421. 

Gerhart, Donald J. 1991. Emesis, learned aversion and chemical defense in octocorals: a central role for 

prostaglandins? American Journal of Physiology 260:R839-R843. 

Gerhart, Donald J., and John C. Coll. 1993. Pukalide, a widely distributed octocoral diterpenoid, induces vomiting 

in fish. Journal of Chemical Ecology 19:2697-2704. 

Gerwick, William H., William Fenical, D. Van Eagen, and Jon Clardy. 1979. Stypotriol and stypoldione: 

ichthyotoxins of mixed biogenesis from the marine alga Stypopodium zonale. Tetrahedron Letters 20:145- 

148. 

Gerwick, W. H., and G. Watley. 1989. Aplysia sea hare assimilation of secondary metabolites from brown seaweed 

Stylopodium zonale. Journal of Chemical Ecology 15:677-683. 

Ghiselin, Michael T. 1963. On the functional and comparative anatomy of Runcina setoensis Baba, an opisthobranch 

gastropod. Publications of the Seto Marine Biological Laboratory 11:389-398. 

Ghiselin, Michael T. 1964. Morphological and behavioral concealling adaptations of Lamellaria stearnsii, a 

marine prosobranch gastropod. The Veliger 6:123-124, 1 Plate. 

Ghiselin, Michael T. 1966a. The adaptive significance of gastropod torsion. Evolution 20:337-348. 

Ghiselin, Michael T. 1966b. Reproductive function and the phylogeny of opisthobranch gastropods. 

Malacologia 3:327-378. 

Ghiselin, Michael T. 1974. The Economy of Nature and the Evolution of Sex. University of California Press,


Berkeley. xii + 364 pp. 

Ghiselin, Michael T. 1978. The economy of the body. American Economic Review 68:233-237. 

Ghiselin, Michael T. 1980. The failure of morphology to assimilate Darwinism. Pages 180-193 in Ernst Mayr 

and William B. Provine, eds., The Evolutionary Synthesis. Harvard University Press, Cambridge. 

Ghiselin, Michael T. 1988. The origin of molluscs in the light of molecular evidence. Oxford Surveys in 

Evolutionary Biology 5:66-95. 

Ghiselin, Michael T. 1993. How well known is the opisthobranch gastropod fauna of Madang, Papua New 

Guinea? Pages 697-701 in R. H. Richmond, ed., Proceedings of the Seventh International Coral Reef 

Symposium, vol. 2. University of Guam Press, Mangilao. 

Ghiselin, Michael T. 1994. The Origin of Vertebrates and the Principle of Succession of Functions. 

Genealogical Sketches by Anton Dohrn. 1875. An English translation from the German, introduction and 

bibliography. History and Philosophy of the Life Sciences 16(1):5-98. 

Ghiselin, Michael T. 1997. Metaphysics and the Origin of Species. State University of New York Press, 

Albany. xi + 377 pp. 

Ghiselin, Michael T. 2006. The failure of morphology to contribute to the modern synthesis. Theory in 

Biosciences 124:309-316. 

Ghiselin, Michael T., Egon T. Degens, Derek W. Spencer, and Robert H. Parker. 1967. A phylogenetic survey 

of molluscan shell matrix proteins. Breviora of the Museum of Comparative Zoology Harvard University 

262:1-35. 

Gillette, Rhanor, Mayuko Saeki, and Rong-Chi Huang. 1991. Defensive mechanisms in notaspid snails: acid 

humor and evasiveness. Journal of Experimental Biology 156:335-347. 

Giménez-Casalduero, Francisca, Claudia Muniain, and J. A. Garcia-Charton. 2002. Elysia timida (Risso, 

1818) (Gastropoda, Opisthobranchia): relationship and feeding deterrence to a potential predator on the 

south-western Mediterranean coast. Marine Biology 141:1051-1057. 

Ginsburg, David W., and Valerie J. Paul. 2001. Chemical defenses in the sea hare Aplysia parvula: importance 

of diet and sequestration of algal secondary metabolites. Marine Ecology Progress Series 215:261-274. 

Giordano, Assunta, Giuseppina Andreotti, Ernesto Mollo, and Antonio Trincone. 2004. Transglycosylation 

reactions performed by glycosyl hydrolases from the marine anaspidean mollusc Aplysia fasciata. Journal 

of Molecular Catalysis, ser. B: Enzymatic, 30:51-59. 

Goetz, Gilles, Yoichi Nakao, and Paul J. Scheuer. 1997. Two acyclic kahalalides from the sacoglossan mollusk 

Elysia rufescens. Journal of Natural Products 60:562-567. 

Gonor, Jefferson J. 1961. Observations on the biology of Lobiger serradifialci, a shelled sacoglossan opisthobranch 

from the Mediterranean. Vie et Milieu 12:381-403. 

González, A. G., F. Cataldo, J. Fernández, and M. Norte. 1987. A new trioxygenated diterpene from the mollusk 

Aplysia dactylomela. Journal of Natural Products 50:1158-1159. 

Gopichand, Yalamanchili, and Francis J. Schmitz. 1980. Bursatellin: a new diol nitrile from the sea hare 

Bursatella leachii pleii. Journal of Organic Chemistry 45:5383-5385. 

Gopichand, Yalamanchili, Francis J. Schmitz, Javan Shelly, Asadur Rahman, and Dick Van Der Helm. 1981. 

Marine natural products: halogenated acetylenic ethers from the sea hare Aplysia dactylomela. Journal of 


Gosliner, Terrence M. 1981. Origins and relationships of primitive members of the Opisthobranchia. 

Biological Journal of the Linnean Society 16:197-225. 

Gosliner, Terrence M. 1991. Morphological parallelism in opisthobranch gastropods. Malacologia 32:313- 

327. 

Gosliner, Terrence M. 1995. The genus Thuridilla (Opisthobranchia: Elysiidae) from the tropical Indo-Pacific, 

with a revision of the phylogeny and systematics of the Elysiidae. Proceedings of the California Academy 

of Sciences, ser. 4, 49(1[12 December]):1-54. 

Gosliner, Terrence M. 2001. Aposematic coloration and mimicry in opisthobranch mollusks: new phylogenetic 

and experimental data. Bollettino Malacologico 37:163-170. 

Gosliner, Terrence M., and David W. Behrens. 1990. Special resemblance, aposematic coloration and mimicry 

in opisthobranch gastropods. Pages 127-138 in M. Wicksten, ed., Adaptive Coloration in Invertebrates. 

(Includes Plates 8-11.) Texas A&M University Sea Grant College Program, College Station.



Gosliner, Terrence M., and Michael T. Ghiselin. 1987. A new species of Tritonia from the Caribbean Sea. 

Bulletin of Marine Science 40:428-436. 

Gosliner, Terrence M., and Rebecca F. Johnson. 1999. Phylogeny of Hypselodoris (Nudibranchia: 

Chromodorididae) with a review of the monophyletic clade of Indo-Pacific species, including descriptions 

of twelve new species. Zoological Journal of the Linnean Society 125:1-114. 

Granato, Ana Claudia, Roberto G. S. Berlinck, Alcevér Magalhaes, Alexandre B. Schefer, Antonio G. Ferreira, 

Bianca De Sanctis, José Carlos De Freitas, Eduardo Hajdu, and Alvaro E. Migotto. 2000. Produtos naturais 

das esponjas marinhas Aaptos sp., Hymeniacidon aff. Heliophila, e do nudibranquio Doris aff. 

Verrucosa. Quimica Nova 23:594-599. 

Grande, Cristina, José Templado, J. Lucas Cervera, and Rafael Zardoya. 2002. The complete mitochondrial 

genome of the nudibranch Roboastra europaea (Mollusca: Gastropoda) supports the monophyly of 

opisthobranchs. Molecular Biology and Evolution 19:1672-1685. 

Grande, Cristina, José Templado, J. Lucas Cervera, and Rafael Zardoya. 2004. Molecular phylogeny of 

Euthyneura (Mollusca: Gastropoda). Molecular Biology and Evolution 21:303-313. 

Grant, Peter R., and B. Rosemary Grant. 2008. How and Why Species Multiply: The Radiation of Darwin’s 

Finches. Princeton University Press, Princeton. xix + 218 pp. 

Graziani, Edmund I., Theresa M. Allen, and Raymond J. Andersen. 1995. Lovenone, a cytotoxic degraded terpenoid 

isolated from skin extracts of the North Sea dorid nudibranch Adalaria loveni. Tetrahedron Letters 

36:1763-1766. 

Graziani, Edmund I., and Raymond J. Andersen. 1996a. Investigations of sesquiterpenoid biosynthesis by the 

dorid nudibranch Acanthodoris nanaimoensis. Journal of the American Chemical Society 118:4701-4702. 

Graziani, Edmund I., and Raymond J. Andersen. 1996b. Stable isotope incorporation evidence for a polyacetate 

origin of the acyl residues in triophamine, a diacylguanidine metabolite obtained from the dorid nudibranch 

Triopha catalinae. Journal of the Chemical Society, Chemical Communications 1996:2377-2378. 

Graziani, Edmund I., and Raymond J. Andersen. 1998. Limaciamine, a new diacylguanidine isolated from the 

North Sea nudibranch Limacia clavigera. Journal of Natural Products 61:285-286. 

Graziani, Edmund I., Raymond J. Andersen, Patrick J. Krug, and D. John Faulkner. 1996. Stable isotope incorporation 

evidence for de novo biosynthesis of terpenoic acid glycerides by dorid nudibranchs. Tetrahedron 

52:6869-6878. 

Green, Gerardo. 1977. Ecology of toxicity in marine sponges. Marine Biology 40:207-215. 

Greenwood, P. H. 1981. Species-Flocks and explosive evolution. Pages 61-74 in P. L. Forey, ed., The Evolving 

Biosphere. Cambridge University Press, Cambridge. 

Grkovic, Tanja, David R. Appleton, and Brent R. Copp. 2005. Chemistry and chemical ecology of some common 

opisthobranch molluscs found on the shores of NE New Zealand. Chemistry in New Zealand 69:12- 

15. 

Grode, Stephen H., and John H. Cardellina. 1984. Sesquiterpenes from the sponge Dysidea etheria and the 

nudibranch Hypselodoris zebra. Journal of Natural Products 47:76-83. 

Guerriero, Antonio, Michele D’Ambrosio, and Francesco Pietra. 1987. Varecynarmin A, a novel briarane 

diterpenoid isolated from both the nudibranch mollusc Armina maculata and its prey, the pennatulacean 

octocoral Veretillum-cynomorium. Helvetica Chimica Acta 70:984-991. 

Guerriero, Antonio, Michele D’Ambrosio, and Francesco Pietra. 1988. Slowly interconverting conformers of 

the briarane diterpenoids verecynarmin B, C, and D, isolated from the nudibranch mollusc Armina maculata 

and the octocoral Veretillum-cynomorium of the East Pyrenean waters. Helvetica Chimica Acta 

71:472-485. 

Guerriero, Antonio, Michele D’Ambrosio, and Francesco Pietra. 1990. Isolation of the cembranoid preverecynarmin 

alongside some briaranes, the verecynarmins, from both the nudibranch mollusc Armina maculata 

and the octocoral Veretillum cynomorium of the East Pyrenean Mediterranean Sea. Helvetica Chimica 

Acta 73:277-283. 

Guerriero, A., F. Marchetti, M. D’Ambrosio, S. Senesi, F. Dini, and F. Pietra. 1993. New ecotoxicologically 

and biogenetically relevant terpenes of the tropical green seaweed Caulerpa taxifolia which is invading the 

Mediterranean. Helvetica Chimica Acta 76:855-864. 

Gulavita, Nanda K., E. Dilip De Silva, Mark R. Hagadone, Peter Karuso, Paul J. Scheuer, Gregory D. Van


Duyne, and Jon Clardy. 1986. Nitrogenous bisabolene sesquiterpenes from marine invertebrates. Journal 


Guo, Yuwei, Margherita Gavagnin, Ernesto Mollo, Enrico Trivellone, Guido Cimino, and Issa Fakhr. 1998. 

Structure of the pigment of the Red Sea nudibranch Hexabranchus sanguineus. Tetrahedron Letters 

39:2635-2638. 

Guo, Yuwei, Margherita Gavagnin, Enrico Trivellone, and Guido Cimino. 1994. Absolute stereochemistry of 

petroformynes, high molecular polyacetylenes from the marine sponge Petrosia ficiformis. Tetrahedron 

Letters 50:13261-13268. 

Gustafson, Kirk, and Raymond J. Andersen. 1982. Triophamine, a unique diacylguanidine from the dorid 

nudibranch Triopha catalinae (Cooper). Journal of Organic Chemistry 47:2167-2169. 

Gustafson, Kirk, and Raymond J. Andersen. 1985. Chemical studies of British Columbia nudibranchs. 


Gustafson, Kirk, Raymond J. Andersen, Marie H. M. Chen, Jon Clardy, and Jill E. Hochlowski. 1984. 

Terpenoic acid glycerides from the dorid nudibranch Archidoris montereyensis. Tetrahedron Letters 25:11- 

14. 

Gustafson, Kirk, Raymond J. Andersen, Cun-Heng He, and Jon Clardy. 1985. Marginatafuran, a furanoditerpene 

with a new carbon skeleton from the dorid nudibranch Cadlina luteomarginata. Tetrahedron Letters 

26:2521-2524. 

Händeler, Katherina, and Heike Wägele. 2007. Preliminary study on molecular phylogeny of Sacoglossa and 

a compilation of their food organisms. Bonner Zoologische Beiträge 55:231-254. 

Hamann, Mark T., Clifton S. Otto, Paul J. Scheuer, and D. Chuck Dunbar. 1996. Kahalalides: bioactive peptides 

from a marine mollusk Elysia rufescens and its algal diet Bryopsis sp. Journal of Organic Chemistry 

61:6594-6600. 

Hamann, Mark T., and Paul J. Scheuer. 1993. Kahalalide F: a bioactive depsipeptide from the sacoglossan 

mollusk Elysia rufescens and the green alga Bryopsis sp. Journal of the American Chemical Society 

115:5825-5826. 

Handayani, Dian, Ru Angelie Edrada, Peter Proksch, Victor Wray, Ludger Witte, Rob W. M. Van Soest, 

Andreas Kunzmann, and Soedarsono. 1997. Four new bioactive polybrominated diphenyl ethers of the 

sponge Dysidea herbacea from west Sumatra, Indonesia. Journal of Natural Products 60:1313-1316. 

Harvell, C. Drew. 1984. Why nudibranchs are partial predators: intracolonial variation in bryozoan palatability. 

Ecology 65:716-724. 

Harvey, Paul H., James J. Bull, Mike Pemberton, and Robert J. Paxton. 1982. Evolution of aposematic coloration 

in distasteful prey: a family model. American Naturalist 119:710-719. 

Hay, Mark E. 1996. Marine chemical ecology: what is known and what comes next. Journal of Experimental 

Marine Biology and Ecology 200:103-134. 

Hay, Mark E., J. Emmett Duffy, Valerie J. Paul, Paul E. Renaud, and William Fenical. 1990. Specialist herbivores 

reduce their susceptibility to predation by feeding on the chemically defended seaweed Avrainvillea 

longicaulis. Limnology and Oceanography 35:1734-1743. 

Hay, Mark E., and Peter D. Steinberg. 1992. The chemical ecology of plant-herbivore interactions in marine 

versus terrestrial communities. Pages 371-413 in G. A. Rosenthal and M. R. Berenbaum, eds., Herbivores: 

their Interactions with Secondary Plant Metabolites, 2nd edition, vol. 2. Academic Press, New York. 

Heck, Kenneth L., Jr., and Michael P. Weinstein. 1978. Mimetic relationships between tropical burrfishes and 

opisthobranchs. Biotropica 10:78-79. 

Hellou, Jocelyne, Raymond J. Andersen, Shahin Rafii, Edward Arnold, and Jon Clardy. 1981. Luteone, a 

twenty-three carbon terpenoid from the dorid nudibranch Cadlina luteomarginata. Tetrahedron Letters 

22:4173-4176. 

Hellou, Jocelyne, Raymond J. Andersen, and Janet E. Thompson. 1982. Terpenoids from the dorid nudibranch 

Cadlina luteomarginata. Tetrahedron 38:1875-1879. 

Hendrickson, James B. 1965. The Molecules of Nature: a Survey of the Biosynthesis and Chemistry of Natural 

Products. W. A. Benjamin, New York. xiii + 189 pp. 

Higa, Tatsuo, T. Fujiyama, and Paul J. Scheuer. 1980. Halogenated phenol and indole constituents of acorn 

worms. Comparative Biochemistry and Physiology 65B:525-530.



Higa, Tatsuo, Toshio Ichiba, and Roy K. Okuda. 1985. Marine indoles of novel substitution pattern from the 

acorn worm Glossobalanus sp. Experientia 41:1487-1488. 

Higa, Tatsuo, Roy K. Okuda, R. Michael Severns, Paul J. Scheuer, Cun-Heng He, Changfu Xu, and Jon 

Clardy. 1987. Unprecedented constituents of a new species of acorn worm. Tetrahedron 43:1063-1070. 

Higa, Tatsuo, and Paul J. Scheuer. 1974. Thelepin, a new metabolite from the marine annelid Thelepus setosus. 


Higa, Tatsuo, and Paul J. Scheuer. 1975. Constituents of the marine annelid Thelepus setosus. Tetrahedron 

31:2379-2381. 

Hinde, Rosalind, and D. C. Smith. 1974. “Chloroplast symbiosis” and the extent to which it occurs in 

Sacoglossa (Gastropoda: Mollusca). Biological Journal of the Linnean Society 6:349-356. 

Hirota, Hiroshi, Tatsufumi Okino, Erina Yoshimura, and Nobuhiro Fusetani. 1998. Five new antifouling 

sesquiterpenes from two marine sponges of the genus Axinyssa and the nudibranch Phyllidia pustulosa. 

Tetrahedron 54:13971-13980. 

Hochlowski, Jill E., John C. Coll, D. John Faulkner, Joseph E. Biskupiak, Chris M. Ireland, Qui-Tai Zheng, 

Cun-Heng He, and Jon Clardy. 1984. Novel metabolites of four Siphonaria species. Journal of the 

American Chemical Society 106:6748-6750. 

Hochlowski, Jill E., and D. John Faulkner. 1981. Chemical constituents of the nudibranch Chromodoris marislae. 


Hochlowski, Jill E., and D. John Faulkner. 1983. Antibiotics from the marine pulmonate Siphonaria diemenensis. 


Hochlowski, Jill E., and D. John Faulkner. 1984. Metabolites of the marine pulmonate Siphonaria australis. 


Hochlowski, Jill E., D. John Faulkner, Lawrence S. Bass, and Jon Clardy. 1983. Metabolites of the dorid nudibranch 

Chromodoris sedna. Journal of Organic Chemistry 48:1738-1740. 

Hochlowski, Jill E., D. John Faulkner, Gale K. Matsumoto, and Jon Clardy. 1983. The denticulatins, two propionate 

metabolites from the pulmonate Siphonaria denticulata. Journal of the American Chemical Society 

105:7413-7415. 

Hochlowski, Jill E., D. John Faulkner, Gayle K. Matsumoto, and Jon Clardy. 1983. Norrisolide, a novel diterpene 

from the dorid nudibranch Chromodoris norrisi. Journal of Organic Chemistry 48:1141-1142. 

Hochlowski, Jill E., Roger P. Walker, Chris Ireland, and D. John Faulkner. 1982. Metabolites of four nudibranchs 

of the genus Hypselodoris. Journal of Organic Chemistry 47:88-91. 

Hodgson, Alan H. 1999. The biology of siphonariid limpets (Gastropoda: Pulmonata). Oceanography and 

Marine Biology Annual Review 37:245-314. 

Högberg, H.-E., R. H. Thompson, and T. J. King. 1976. The cymopols, a group of prenylated bromohydroquinones 

from the green calcareous alga Cymopolia barbata. Journal of the Chemical Society, Perkin 

Transactions, ser. 1, :1696-1701. 

Hoffmann, Hans. 1932-1940. Mollusca: Gastropoda: Opisthobranchia. Pages 1-1337 in H. G. Bronn, ed., 

Klassen und Ordnungen des Tierreichs, vol. 3:2:3:1,2. Akademische Verlagsgesellschaft, Leipzig. 

Hooper, John N. A., and Rob W. M. Van Soest, eds. 2002. Systema Porifera: a Guide to the Classification of 

Sponges. Kluwer Academic and Plenum, New York. xx + xix + 1708 pp. 

Horgen, F. David, Derrick B. delos Santos, Gilles Goetz, Bryan Sakamoto, Yukiko Kan, Hiroshi Nagai, and 

Paul J. Scheuer. 2000. A new depsipeptide from the sacoglossan mollusk Elysia ornata and the green alga 

Bryopsis species. Journal of Natural Products 63:152-154. 

Horowitz, Norman H. 1945. On the evolution of biochemical syntheses. Proceedings of the National Academy 

of Sciences USA 31:153-157. 

Horowitz, Norman H. 1965. The evolution of biochemical synthesis: retrospect and prospect. Pages 15-23 in 

V. Bryson and H. J. Vogel, eds., Evolving Genes and Proteins. Academic Press, New York. 

Huysecom, Joelle, Gyselle Van de Vyver, Jean-Claude Braekman, and Désiré Daloze. 1990. Chemical defense 

in sponges from North Brittany. Pages 115-118 in K. Rützler, ed., New Perspectives in Sponge Biology. 

Smithsonian Institution Press, Washington. 

Ichiba, Toshio, and Tatsuo Higa. 1986. New cuparene-derived sesquiterpenes with unprecedented oxygenation 

patterns from the sea hare Aplysia dactylomela. Journal of Organic Chemistry 51:3364-3366.


Iken, Katrin, Conxita Avila, Maria Letizia Ciavatta, Angelo Fontana, and Guido Cimino. 1998. Hodgsonal, a 

new drimane sesquiterpene from the mantle of the Antarctic nudibranch Bathydoris hodgsoni. Tetrahedron 

Letters 39:5635-5638. 

Iken, Katrin, Conxita Avila, Angelo Fontana, and Margherita Gavagnin. 2002. Chemical ecology and origin 

of defensive compounds in the Antarctic nudibranch Austrodoris kerguelensis (Opisthobranchia: 

Gastropoda). Marine Biology 141:101-109. 

Imperato, F., Luigi Minale, and Raffaele Riccio. 1977. Constituents of the digestive gland of molluscs of the 

genus Aplysia. II. Halogenated monoterpenes from Aplysia limacina. Experientia 33:1273-1274. 

Inaba, Akihito. 1961. Cytotaxonomy of the euthyneuran gastropods. Venus 21:402-413, In Japanese. 

Inouye, Yoshinobu, Hideaki Uchida, Takenori Kusumi, and Hiroshi Kakisawa. 1987. Structure and absolute 

configuration of aplysiapyranoid B, a new polyhalogenated pyranoid monoterpene from Aplysia kurodai. 

Journal of the Chemical Society, Chemical Communications 1987(5):346-347. 

Ireland, Chris M., Joseph E. Biskupiak, Gilbert J. Hite, Michael Rapposch, Paul J. Scheuer, and John R. 

Ruble. 1984. Ilikonapyrone esters, likely defense allomones of the mollusc Onchidium verruculatum. 


Ireland, Chris, and D. John Faulkner. 1977. Diterpenes from Dolabella californica. Journal of Organic 

Chemistry 42:3157-3162. 

Ireland, Chris, and D. John Faulkner. 1978. The defensive secretion of the opisthobranch mollusc Onchidella 

binneyi. Bioorganic Chemistry 7:125-131. 

Ireland, Chris, and D. John Faulkner. 1981. The metabolites of the marine molluscs Tridachiella diomedea 

and Tridachia crispata. Tetrahedron 37(Suppl. 1):233-240. 

Ireland, Chris, D. John Faulkner, D. J. Finer, and Jon Clardy. 1976. A novel diterpene from Dolabella californica. 


Ireland, Chris, D. John Faulkner, B. A. Solheim, and J. Clardy. 1978. Tridachione, a propionate-derived 

metabolite of the opisthobranch mollusc Tridachiella diomedea. Journal of the American Chemical Society 

100:1002-1003. 

Ireland, Chris M., Deborah M. Roll, Tadeusz F. Molinski, Tawnya McKee, T. Mark Zabriskie, and J. 

Christopher Swersey. 1988. Uniqueness of the marine chemical environment: categories of marine natural 

products from invertebrates. Pages 41-57 in Daphne G. Fautin, ed., Biomedical Importance of Marine 

Organisms. Memoirs of the California Academy of Sciences, No. 13. California Academy of Sciences, San 

Francisco. 

Ireland, Chris, and Paul J. Scheuer. 1979. Photosynthetic marine mollusks: in vivo 14C incorporation into 

metabolites of the sacoglossan Placobranchus ocellatus. Science 205:922-923. 

Irie, Takahiro, and Yoh Iwasa. 2005. Optimal growth pattern of defensive organs: the diversity of shell growth 

among mollusks. American Naturalist 165:238-249. 

Ishibashi, Masami, Yoshihiro Yamaguchi, and Yoshiaki J. Hirano. 2006. Bioactive natural products from nudibranchs. 

Pages 513-535 in Milton Fingerman and Rachakonda Nagabhushanam, eds., Biomaterials from 

Aquatic and Terrestrial Organisms. Science Publishers, Enfield, New Hampshire. 

Jensen, Kathe R. 1980. A review of sacoglossan diets, with comparative notes on radular and buccal anatomy. 

Malacological Review 13:55-77. 

Jensen, Kathe R. 1984. Defensive behavior and toxicity of the ascoglossan opisthobranch Mourgona germaineae 

Marcus. Journal of Chemical Ecology 10:475-486. 

Jensen, Kathe R. 1989. A new species of Cylindrobulla from Phuket, Thailand, with a discussion of the systematic 

affiliation of the genus. Phuket Marine Biological Center Research Bulletin, vol. No. 52. Phuket 

Marine Biological Center, Phuket. 11 pp. 

Jensen, Kathe R. 1992. Anatomy of some Indo-Pacific Elysiidae (Opisthobranchia, Sacoglossa 

(=Ascoglossa)), with a discussion of the generic division and phylogeny. Journal of Molluscan Studies 

58:257-296. 

Jensen, Kathe R. 1993a. Evolution of buccal apparatus and diet radiation in the Sacoglossa (Opisthobranchia). 

Bollettino Malacologico 29:147-172. 

Jensen, Kathe R. 1993b. Morphological adaptations and plasticity of radular teeth of the Sacoglossa 

(=Ascoglossa)(Mollusca, Opisthobranchia) in relation to their food plants. Biological Journal of the



Linnean Society 48:135-155. 

Jensen, Kathe R. 1993c. Sacoglossa (Mollusca: Opisthobranchia) — Specialist herbivores and partial predators: 

integrating ecological, physiological and morphological data. Pages 437-458 in Brian Morton, ed., 

The Marine Biology of the South China Sea. Hong Kong University Press, Hong Kong. 

Jensen, Kathe R. 1996a. The Diaphanidae as a possible sister group of the Sacoglossa (Gastropoda, 

Opisthobranchia). Pages 231-247 in J. D. Taylor, ed., Origin and Evolutionary Radiation of the Mollusca. 

Oxford University Press, New York. 

Jensen, Kathe R. 1996b. Phylogenetic systematics and classification of the Sacoglossa (Mollusca, Gastropoda, 

Opisthobranchia). Philosophical Transactions of the Royal Society of London, ser. B, 351:91-122. 

Jensen, Kathe R. 1997a. Evolution of the Sacoglossa (Mollusca, Opisthobranchia) and the ecological associations 

with their food plants. Evolutionary Ecology 11:301-335. 

Jensen, Kathe R. 1997b. Systematics, phylogeny and evolution of the Sacoglossa (Mollusca, 

Opisthobranchia). Ph.D. Dissertation. Zoologisk Museum, Kobenhavn. 94 pp. 

Jiménez, Carlos, Emilio Quiñoa, Luis Castedo, and Ricardo Riguera. 1986. Epidioxy sterols from the tunicates 

Dendrodoa grossularia and Ascidiella aspersa and the gastropoda Aplysia depilans and Aplysia 

punctata. Journal of Natural Products 49:905-909. 

Jonassohn, Mikael. 1996. Sesquiterpenoid Unsaturated Dialdehydes: Structural Properties that Affect 

Reactivity and Bioactivity. Ph.D. Dissertation. Lund. xii + 80 pp. 

Jones, David A. 1979. Chemical defense: primary or secondary function? American Naturalist 113:445-451. 

Jung, Verena, and Georg Pohnert. 2001. Rapid wound-activated transformation of the green algal defensive 

metabolite caulerpenyne. Tetrahedron 57:7169-7172. 

Kaiser, Carlos R., Liane F. Pitombo, and Angelo C. Pinto. 1998. C-13 and H-1 NMR assignments of the 

chamigrenes prepacifenol and dehydroxyprepacifenol epoxides. Spectroscopy Letters 31:573-585. 

Kakou, Yao, Phillip Crews, and Gerald J. Bakus. 1987. Dendrolasin and latrunculin A from the Fijian sponge 

Spongia mycofijiensis and an associated nudibranch, Chromodoris lochi. Journal of Natural Products 

50:482-484. 

Kalinin, Vladimir I., V. S. Levin, and Valentin A. Stonik. 1994. Chemical Morphology: Triterpene Glycosides 

of Sea Cucumbers (Holothuroidea, Echinodermata). Dalnayka, Vladivostock. 284 pp., In Russian. 

Kamiya, Hisao, Koji Muramoto, Rina Goto, Masahiro Sakai, Yoshio Endo, and Masatoshi Yamazaki. 1989. 

Purification and characterization of an antibacterial and antineoplastic protein secretion of a sea hare, 

Aplysia juliana. Toxicon 27:1269-1277. 

Kamiya, Hisao, Ryuichi Sakai, and Mitsuru Jimbo. 2006. Bioactive molecules from sea hares. Pages 214-239 

in Guido Cimino and Margherita Gavagnin, eds., Molluscs: From Chemo-ecological Study to 

Biotechnological Application. In W. E. G. Müller, ed., Progress in Molecular and Subcellular Biology: 

Marine Molecular Biotechnology, Volume 43. Springer, New York. 

Kandel, Eric R. 1979. Behavioral Biology of Aplysia: a Contribution to the Comparative Study of 

Opisthobranch Molluscs. W. H. Freeman and Company, San Francisco. xiii + 463 pp. 

Kang, Heonjoong, Paul R. Jensen, and William Fenical. 1996. Isolation of microbial antibiotics from a marine 

ascidian of the genus Didemnum. Journal of Organic Chemistry 61:1543-1546. 

Karuso, Peter, and Paul J. Scheuer. 2002. Natural products from three nudibranchs: Nembrotha kubaryana, 

Hypselodoris infucata and Chromodoris petechialis. Molecules 7:1-6. 

Kassühlke, Katharina E., Barbara C. M. Potts, and D. John Faulkner. 1991. New nitrogenous sesquiterpenes 

from two Philippine nudibranchs, Phyllidia pustulosa and P. varicosa, and from a Palauan sponge, 

Halichondria cf. lendenfeldi. Journal of Organic Chemistry 56:3747-3750. 

Katayama, Akira, Kazuo Ina, H. Hiroshi Nozaki, and Mitsuru Nakayama. 1982. Structure elucidation of kurodainol, 

a novel halogenated monoterpene from sea hare (Aplysia kurodai). Agricultural and Biological 

Chemistry 46:859-860. 

Kato, Yoshinori, and Paul J. Scheuer. 1974. Aplysiatoxin and debromoaplysiatoxin, constituents of the marine 

mollusk Stylocheilus longicauda (Quoy and Gaimard, 1824). Journal of the American Chemical Society 

96:2245-2246. 

Kato, Yoshinori, and Paul J. Scheuer. 1975. The aplysiatoxins. Pure and Applied Chemistry 41:1-14. 

Kazlauskas, Rimantos, P. T. Murphy, R. J. Wells, and J. J. Daly. 1979. A new diterpene from the sponge


Aplysilla rosea. Tetrahedron Letters 20:903-906. 

Kernan, Michael R., Ellen B. Barrabee, and D. John Faulkner. 1988. Variation of the metabolites of 

Chromodoris funerea: comparison of specimens from a Palauan marine lake with those from adjacent 

waters. Comparative Biochemistry and Physiology 89B:275-278. 

Kernan, Michael R., Tadeusz F. Molinski, and D. John Faulkner. 1988. Macrocyclic antifungal metabolites 

from the Spanish dancer nudibranch Hexabranchus sanguineus and sponges of the genus Halichondria. 


Kicklighter, Cynthia E., Shkelzen Shabani, Paul M. Johnson, and Charles D. Derby. 2005. Sea hares use novel 

antipredatory chemical defenses. Current Biology 15:549-554. 

Kigoshi, Hideo, Yoshifumi Imamura, Kohji Yoshikawa, and Kiyoyuki Yamada. 1990. Three new cytotoxic 

alkaloids, aplaminone, neoaplaminone and neoaplaminone sulphate from the marine mollusc Aplysia kurodai. 


Kim, Yong Hae, Ronald J. Nachman, Lee Pavelka, Harry S. Mosher, Frederick A. Fuhrman, and Geraldine J. 

Fuhrman. 1981. Doridosine (1-methylisoguanosine) from Anisodoris nobilis: structure, pharmacological 

properties and synthesis. Journal of Natural Products 44:206-214. 

King, Gary M. 1986. Inhibition of microbial activity in marine sediments by a bromophenol from a hemichordate. 

Nature 323:257-259. 

Kinnel, Robin, R. K. Dieter, Jerrold Meinwald, D. Van Engen, Jon Clardy, Thomas Eisner, Martha O. Stallard, 

and William Fenical. 1979. Brasilenyne and cis-dihydrorhodophytin: antifeedant medium-ring haloethers 

from a sea hare (Aplysia brasiliana). Proceedings of the National Academy of Sciences USA 76:3576-3579. 

Kinnel, Robin, Angelina J. Duggan, Thomas Eisner, and Jerrold Meinwald. 1977. Panacene: an aromatic bromoallaene 

from a sea hare (Aplysia brasiliana). Tetrahedron Letters 18:3913-3916. 

Kircher, Athanasius. 1665. Mundus Subterraneus. Jansson & Wayerstraten, Amsterdam. xxxii + 354 + xii + 

496 pp. 

Kisugi, Jun, Hisao Kamiya, and Masatoshi Yamazaki. 1989. Purification of dolabellanin-C, an antineoplastic 

glycoprotein in the body fluid of a sea hare, Dolabella auricula. Developmental and Comparative 

Immunology 13:3-8. 

Kisugi, Jun, H. Ohye, Hidemi Kamiya, and Masatoshi Yamazaki. 1992. Biopolymers from marine invertebrates 

XIII. Characterization of an antibacterial protein, dolabellanin A, from the albumen gland of the sea 

hare, Dolabella auricularia. Chemical and Pharmaceutical Bulletin 40:1537-1539. 

Kitahara, Yoshiyasu, Shinsuke Nakahara, Takanobu Yonezawa, Masanori Nagatsu, Yoshikazu Shibano, and 

Akinori Kubo. 1997. Synthetic studies on pentacyclic aromatic alkaloids, kanoniamine A, 11-hydroxyascididemnin, 

and neocalliactine acetate. Tetrahedron 53:17029-17038. 

Kitting, Christopher L. 1981. Feeding and pharmacological properties of Anisodoris nobilis individuals 

(Mollusca: Nudibranchia) selecting different noxious sponges plus detritus. Biological Bulletin 161:126- 

140. 

Kittredge, J. S., Francis T. Takahashi, James Linsley, and Ruben Lasker. 1974. Chemical signals in the sea: 

marine allelochemics and evolution. Fishery Bulletin 72:1-11. 

Klautau, Michelle, Antonio M. Solé-Cava, and Radovan Borojevic. 1994. Biochemical systematics of sibling 

sympatric species of Clathrina (Porifera: Calcarea). Biochemical Systematics and Ecology 22:367-375. 

Klussmann-Kolb, Annette. 2004. A phylogeny of the Aplysiidae (Gastropoda, Opisthobranchia) with new 

aspects of the evolution of seahares. Zoologica Scripta 33:439-462. 

Klussmann-Kolb, Annette, and Angela Dinapoli. 2006. Systematic position of the pelagic Thecosomata and 

Gymnosomata within Opisthobranchia (Mollusca, Gastropoda) — revival of the Pteropoda. Journal of 

Zoological Systematics and Evolutionary Research 44:118-129. 

Knowlton, Nancy. 1993. Sibling species in the sea. Annual Review of Ecology and Systematics 24:189-216. 

Kobayashi, Motomasa, F. Kanda, and Hisao Kamiya. 1991. Occurrence of pyropheophorbides a and b in the 

viscera of the sea hare Aplysia juliana. Nippon Suisan Gakkaishi 57:1983. 

Krug, Patrick J., Kenneth G. Boyd, and D. John Faulkner. 1995. Isolation and synthesis of Tanyolides A and 

B, metabolites of the nudibranch Sclerodoris tanya. Tetrahedron 51:11063-11074. 

Ksebati, Mohamad B., and Francis J. Schmitz. 1987. New spongiane diterpenes from an Australian nudibranch. 

Journal of Organic Chemistry 52:3766-3773.



Ksebati, Mohamad B., and Francis J. Schmitz. 1988. Sesquiterpene furans and thiosesquiterpenes from the 

nudibranch Ceratosoma brevicaudatum. Journal of Natural Products 51:857-861. 

Kubanek, Julia, and Raymond J. Andersen. 1997. Evidence for the incorporation of intact butyrate units in the 

biosynthesis of triophamine. Tetrahedron Letters 38:6327-6330. 

Kubanek, Julia, and Raymond J. Andersen. 1999. Evidence for de novo biosynthesis of the polyketide fragment 

of diaulusterol A by the northeastern Pacific dorid nudibranch Diaulula sandiegensis. Journal of 


Kubanek, Julia, D. John Faulkner, and Raymond J. Andersen. 2000. Geographic variation and tissue distribution 

of endogenous terpenoids in the Northeastern Pacific dorid nudibranch Cadlina marginata: implications 

for the regulation of de novo biosynthesis. Journal of Chemical Ecology 26:377-389. 

Kubanek, Julia, Edmund I. Graziani, and Raymond J. Andersen. 1997. Investigations of terpenoid biosynthesis 

by the dorid nudibranch Cadlina luteomarginata. Journal of Organic Chemistry 62:7239-7246. 

Kubo, Akinoro, Yoshiyasu Kitahara, and Shinsuke Nakahara. 1989. Synthesis of new isoquinolinequinone 

metabolites of a marine sponge, Xestospongia sp., and the nudibranch Jorunna funebris. Chemical and 

Pharmaceutical Bulletin 37:1384-1386. 

Kuniyoshi, M., K. Yamada, and T. Higa. 1985. A biologically active diphenyl ether from the green alga 

Cladophora fascicularis. Experientia 41:523-524. 

Kurabayashi, Atshushi, and Rei Ueshima. 2000. Complete sequence of the mitochondrial DNA of the primitive 

opisthobranch gastropod Pupa strigosa: systematic implication of the genome organization. 

Molecular Biology and Evolution 17:266-277. 

Kusumi, Takenori, Hideaki Uchida, Yoshinobu Inouye, Midori Ishitsuka, Hiroshi Yamamoto, and Hiroshi 

Kakisawa. 1987. Novel cytotoxic monoterpenes having a halogenated tetrahydropyran from Aplysia kurodai. 


Lahav, Noam. 1999. Biogenesis: Theories of Life’s Origin. Oxford University Press, New York. xi + 349 pp. 

Landa, Janet Tai, and Michael T. Ghiselin. 1999. The emerging discipline of bioeconomics: aims and scope 

of the Journal of Bioeconomics. Journal of Bioeconomics 1:5-12. 

Leete, E. 1983. Biosynthesis of alkaloids. Pages 102-131 in R. B. Herbert and T. J. Simpson, eds., 

Biosynthesis, vol. 7. The Royal Society of Chemistry, London. 

Lepenies, Wolf. 1976. Das Ende der Naturgeschichte: Wandel kultureller Selbstverständlichkeiten in den 

Wissenschaften des 18. und 19. Jahrhunderts. Hanser Verlag, München. 277 pp. 

Lévi, Claude, and Pierette Lévi. 1976. Embryogenèse de Chondrosia reniformis (Nardo), démosponge ovipaire, 

et transmission des bactéries symbiotiques. Annales des Sciences Naturelles, Zoologie, ser. 12, 18:367- 

380. 

Lewin, Ralph A. 1970. Toxic secretion and tail autotomy by irritated Oxynoe panamensis (Opisthobranchiata: 

Sacoglossa). Pacific Science 24:356-358. 

Li, Jesse W.-H., and John C. Vederas. 2009. Drug discovery and natural products: end of an era or an endless 

frontier. Science 325:161-165. 

Liem, Karel F. 1973. Evolutionary strategies and morphological innovations: cichlid pharyngeal jaws. 

Systematic Zoology 22:425-441. 

Lin, Hou Wen, Hai Feng Tang, G. L. Liu, C. Zhang, Y. Shen, Y. Y. Hua, and H. M. Wu. 2002. Studies on antineoplastic 

constituents from chinese marine mollusc sea hare (II). Chinese Journal of Marine Drugs . 

Lin, Houwen, Chun Zhang, Yanghua Yi, Yang Shen, Cheng Guo, and Yuanfu Shao. 2001. Studies on antineoplastic 

constituents from Chinese marine mollusc sea hare (I). Chinese Journal of Marine Drugs 20:3-6. 

Lindberg, David R., and Michael T. Ghiselin. 2003. Fact, theory and tradition in the study of molluscan origins. 

Proceedings of the California Academy of Sciences, ser. 4, 54:663-686. 

Lindquist, Niels, and William Fenical. 1989. Ascidiatrienolides A-C, novel lactonized eicosanoids from the 

marine ascidian Didemnum candidum. Tetrahedron Letters 30:2735-2738. 

Lindquist, Niels, and William Fenical. 1991. New tambjamine class alkaloids from the marine ascidian 

Atapozoa sp. and its nudibranch predators. Origin of the tambjamines in Atapozoa. Experientia 47:504- 

506. 

Liu, Hsing-Jang, Gerardo Ulibarri, and Lloyd A. K. Nelson. 1990. The total synthesis of racemic isoacanthodoral. 

Journal of the Chemical Society, Chemical Communications 1990:1419-1421.


Long, Jeremy D., and Mark E. Hay. 2006. Fishes learn aversion to a nudibranch’s chemical defense. Marine 

Ecology Progress Series 307:199-208. 

Lupo di Prisco, C., and F. Dessi Fulgheri. 1973. Identification and biosynthesis of steroids in the marine mollusc 

Aplysia depilans. Comparative Biochemistry and Physiology 45B:303-310. 

Malaquias, Manuel, Jacqueline Mackenzie-Dodds, Terrence M. Gosliner, Philippe Bouchet, and David G. 

Reid. 2009. A molecular phylogeny of the Cephalaspidea sensu lato (Gastropoda: Euthyneura): 

Architectibranchia redefined and Runcinacea reinstated. Zoologica Scripta 38:23-31. 

Manker, Denise C., and D. John Faulkner. 1986. Metabolites of Siphonaria maura from Costa Rica. Journal 


Manker, Denise C., and D. John Faulkner. 1987. Diterpenes from the marine pulmonate Trimusculus reticulatus. 


Manker, Denise C., and D. John Faulkner. 1989a. The baconipyrones: novel polypropionates from the pulmonate 

Siphonaria baconi. Journal of Organic Chemistry 54:5371-5374. 

Manker, Denise C., and D. John Faulkner. 1989b. Vallartanones A and B, polypropionate metabolites of 

Siphonaria maura from Mexico. Journal of Organic Chemistry 54:5374-5377. 

Manker, Denise C., and D. John Faulkner. 1996. Investigation of the role of diterpenes produced by marine 

pulmonates Trimusculus reticulatus and T. conica. Journal of Chemical Ecology 22:23-35. 

Mann, John. 1994. Chemical Aspects of Biosynthesis. Oxford University Press, Oxford. v + 92 pp. 

Manzo, Emiliano, M. Letizia Ciavatta, Margherita Gavagnin, Ernesto Mollo, Yu-Wei Guo, and Guido Cimino. 

2004. Isocyanide terpene metabolites of Phyllidiella pustulosa, a nudibranch from the South China Sea. 


Manzo, Emiliano, Maria Letizia Ciavatta, Margherita Gavagnin, Ernesto Mollo, Solimabi Wahidulla, and 

Guido Cimino. 2005. New γ-pyrone propionates from the Indian Ocean sacoglossan Placobranchus ocellatus. 


Manzo, Emiliano, Maria Letizia Ciavatta, Margherita Gavagnin, Raffaella Puliti, Ernesto Mollo, Yu-Wei Guo, 

Carlo Andrea Mattia, Lelio Mazzarella, and Guido Cimino. 2005. Structure and absolute stereochemistry 

of novel C 15-halogenated acetogenins from anaspidean mollusc Aplysia dactylomela. Tetrahedron 

51:7456-7460. 

Manzo, Emiliano, Margherita Gavagnin, Giuseppe Bifulco, Paula Cimino, Simone Di Micco, M. Letizia 

Ciavatta, and Yu-Wei Guo. 2007. Aplysiols A and B, squalene-derived polyethers from the mantle of the 

sea hare Aplysia dactylomela. Tetrahedron 63:9970-9978. 

Manzo, Emiliano, Margherita Gavagnin, Michael J. Somerville, Shui-Chun Mao, M. Letezia Ciavatta, Ernesto 

Mollo, Peter J. Schupp, Mary J. Garson, Yu-Wei Guo, and Guido Cimino. 2007. Chemistry of Glossodoris 

nudibranchs: specific occurrence of 12-keto scalaranes. Journal of Chemical Ecology 33:2325-2336. 

Marin, Arnaldo, Luis A. Alvarez, Guido Cimino, and Aldo Spinella. 1999. Chemical defence in 

Cephalaspidean gastropods: origin, anatomical location and ecological roles. Journal of Molluscan Studies 

65:121-131. 

Marin, Arnaldo, M. D. L. Belluga, Gennaro Scognamiglio, and Guido Cimino. 1997. Morphological and 

chemical camouflage of the Mediterranean nudibranch Discodoris indecora on the sponges Ircinia variabilis 

and Ircinia fasciculata. Journal of Molluscan Studies 63:431-439. 

Marin, Arnaldo, Vincenzo Di Marzo, and Guido Cimino. 1991. A histological and chemical study of the cerata 

of the opisthobranch mollusc Tethys fimbria. Marine Biology 111:353-358. 

Marin, Arnaldo, and Joandomenec Ros. 2004. Chemical defenses in Sacoglossan opisthobranchs: taxonomic 

trends and evolutive implications. Scientia Marina 68:227-241. 

Marples, Nicola M., David J. Kelley, and Robert J. Thomas. 2005. Perspective: The evolution of warning coloration 

is not paradoxical. Evolution 59:933-940. 

Martin, Rainer. 2003. Management of nematocysts in the alimentary tract and cnidosacs of the aeolid nudibranch 

gastropod Cratena peregrina. Marine Biology 143:533-541. 

Martin, Rainer, and Paul Walther. 2003. Protective mechanisms against the action of nematocysts in the epidermis 

of Cratena peregrina and Flabellina affinis. Zoomorphology 122:25-32. 

Martínez, Eugenia María. 1995. El orden Anaspidea (Mollusca: Opisthobranchia) en el Atlántico y 

Mediterráneo próximo. Revisión taxonómica y estudio de los metabolitos secundarios presentes en algu-



nas especies. Ph.D. Dissertation. Universidad de Ovideo. 381 pp. 

Matsunaga, Shigeki. 2006. Trisoxazole macrolides from Hexabranchus nudibranchs and other marine invertebrates. 

Pages 241-260 in Guido Cimino and Margherita Gavagnin, eds., Molluscs: From Chemo-ecological 

Study to Biotechnological Application. In W. E. G. Müller, ed., Progress in Molecular and Subcellular 

Biology: Marine Molecular Biotechnology, Volume 43. Springer, New York. 

Matsunaga, Shigeki, Nobuhiro Fusetani, Kanahisa Hashimoto, Koshi Koseki, Masana Noma, Hiroshi 

Noguchi, and Ushio Sankawa. 1989. Bioactive marine metabolites. 25. Further kabiramides and halichondramides, 

cytotoxic macrolides embracing trisoxazole, from the Hexabranchus egg masses. Journal of 


Mazzarelli, Giuseppe. 1893. Monografia delle Aplysiidae del Golfo di Napoli. Memorie della Società Italiana 

di Scienze Naturali e del Museo Civico di Storia Naturale di Milano, ser. 3, 9(4):1-222, Tav. I-XIII. 

McClintock, James B., and Bill J. Baker. 1997a. Palatability and chemical defense in the eggs, embryos and 

larvae of shallow-water Antarctic marine invertebrates. Marine Ecology Progress Series 154:121-131. 

McClintock, James B., and Bill J. Baker. 1997b. A review of the chemical ecology of antarctic marine invertebrates. 

American Zoologist 37:329-342. 

McClintock, James B., and Bill J. Baker. 1998. Chemical ecology in Antarctic seas. American Scientist 

86:254-263. 

McClintock, James B., Bill J. Baker, Mark T. Hamann, Wesley Yoshida, Marc Slattery, John N. Heine, Patrkc 

Bryan J, G. S. Jayatilake, and B. H. Moon. 1994. Homarine as a feeding deterrent in common shallowwater 

Antarctic lamellarian gastropod Marseniopsis mollis: a rare example of chemical defense in a marine 

prosobranch. Journal of Chemical Ecology 20:2539-2549. 

McClintock, James B., Bill J. Baker, Marc Slattery, John Heine, Patrick J. Bryan, Wesley Yoshida, Michael T. 

Davies-Coleman, and D. John Faulkner. 1994. Chemical defense of common Antarctic shallow-water 

nudibranch Tritoniella belli Eliot (Mollusca: Tritonidae) and its prey, Clavularia frankliniana Rouel 

(Cnidaria: Octocorallia). Journal of Chemical Ecology 20:3361-3372. 

McClintock, James B., and John Janssen. 1990. Pteropod abduction as a chemical defence in a pelagic antarctic 

amphipod. Nature 346:462-464. 

McDonald, Francis J., D. C. Campbell, David J. Vanderah, Francis J. Schmitz, D. M. Washecheck, J. E. Burks, 

and Dick Van Der Helm. 1975. Marine natural products. Dactylyne, an acetylenic dibromochloro ether 

from the sea hare Aplysia dactylomela. Journal of Organic Chemistry 40:665-666. 

McPhail, Kerry L., and Michael T. Davies-Coleman. 1997. New spongiane diterpenes from the east African 

nudibranch Chromodoris hamiltoni. Tetrahedron 53:4655-4660. 

McPhail, Kerry L., and Michael T. Davies-Coleman. 2005. (3Z)-bromofucin from a South African sea hare. 

Natural Product Research 19:449-452. 

McPhail, Kerry L., Michael T. Davies-Coleman, and Philip Coetzee. 1998. A new furanosesterterpene from 

the South African nudibranch Hypselodoris capensis and a Dictyoceratida sponge. Journal of Natural 

Products 61:961-964. 

McPhail, Kerry L., Michael T. Davies-Coleman, Royston C. B. Copeley, and Drake S. Eggleston. 1999. New 

halogenated sesquiterpenes from South African specimens of the circumtropical sea hare Aplysia dactylomela. 


McPhail, Kerry L., Michael T. Davies-Coleman, and John Starmer. 2001. Sequestered chemistry of the arminacean 

nudibranch Leminda millecra in Algoa Bay, South Africa. Journal of Natural Products 64:1183- 

1190. 

Mebs, Dietrich. 1985. Chemical defense of a dorid nudibranch, Glossodoris quadricolor, from the Red Sea. 


Medina, Mónica, Timothy M. Collins, and Patrick J. Walsh. 2001. MtDNA ribosomal gene phylogeny of sea 

hares in the genus Aplysia (Gastropoda, Opisthobranchia, Anaspidea): implications for comparative neurobiology. 

Systematic Biology 50:676-688. 

Medina, Mónica, and Patrick J. Walsh. 2000. Molecular systematics of the order Anaspidea based on mitochondrial 

DNA sequence (12S, 16S, and COI). Molecular Phylogenetics and Evolution 15:41-58. 

Meyer, Axel. 1993. Phylogenetic relationships and evolutionary processes in East African cichlid fishes. 

Trends in Ecology and Evolution 8:267-305.


Midland, Sharon J., Richard M. Wing, and James J. Sims. 1983. New crenulides from the sea hare Aplysia 

vaccaria. Journal of Organic Chemistry 48:1906-1909. 

Mikkelsen, Paula M. 1996. The evolutionary relationships of Cephalaspidea s.l. (Gastropoda: 

Opisthobranchia): a phylogenetic analysis. Malacologia 37:375-442. 

Mikkelsen, Paula M. 2002. Shelled opisthobranchs. Advances in Marine Biology 42:67-136. 

Millen, Sandra V., and Jeffrey C. Hamann. 1992. A new genus and species of Facelinidae (Opisthobranchia; 

Aeolidacea) from the Caribbean Sea. The Veliger 35:205-214. 

Minale, Luigi, and Raffaele Riccio. 1976. Constituents of the digestive gland of the molluscs of the genus 

Aplysia. I. Novel diterpenes from Aplysia depilans. Tetrahedron Letters 17:2711-2714. 

Minichev, Yu S. 1969. The Organization of Bathydoris vitjazi sp. n. and the question of the origin of nakedgilled 

mollusks (Opisthobranchia Nudibranchia). Vestnik Lenningradskogo Universiteta 21:51-58, In 

Russian. 

Misra, Neelam, Rajesh Luthra, Kiran L. Sing, and Kumar Sushil. 1999. Recent advances in the biosynthesis 

of alkaloids. Pages 25-59 in Jeffrey W. Kelly, ed., Amino Acids, Peptides, Porphyrins, and Alkaloids, vol. 

4. In D. Barton and K. Nakanishi, eds., Comprehensive Natural Products Chemistry, Volume 4. Elsevier, 

Amsterdam. 

Miyamoto, Tomofumi. 2006. Selected bioactive compounds from Japanese anaspideans and nudibranchs. 

Pages 199-214 in Guido Cimino and Margherita Gavagnin, eds., Molluscs: From Chemo-ecological Study 

to Biotechnological Application. In W. E. G. Müller, ed., Progress in Molecular and Subcellular Biology: 

Marine Molecular Biotechnology, Volume 43. Springer, New York. 

Miyamoto, Tomofumi, Yutaka Ebisawa, and Ryuichi Higuchi. 1995. Aplyparvunin, a bioactive acetogenin 

from the sea hare Aplysia parvula. Tetrahedron Letters 36:6073-6074. 

Miyamoto, Tomofumi, Ryuchi Higuchi, Tetsuya Komori, T. Fujioka, and K. Mihashi. 1986. Isolation and 

structures of aplykurodins A and B, two new isoprenoids from the marine mollusk Aplysia kurodai. 


Miyamoto, Tomofumi, Ryuichi Higuchi, Nobuhiro Marubayashi, and Tetsuya Komori. 1988. Two new polyhalogenated 

monoterpenes from the sea hare Aplysia kurodai. Liebigs Annalen der Chemie 12:1191-1193. 

Miyamoto, Tomofumi, Kenichiro Sakamoto, Hiroko Amano, Ryuichi Higuchi, Tetsuya Komori, and Takuma 

Sasaki. 1992. Three new cytotoxic sesterterpenoids, inorolide A, B, and C from the nudibranch 

Chromodoris inornata. Tetrahedron Letters 33:5811-5814. 

Miyamoto, Tomofumi, Kenichiro Sakamoto, Kazuyoshi Arao, Tetsuya Komori, Ryuichi Higuchi, and Takuma 

Sasaki. 1996. Dorisenones, cytotoxic spongian diterpenoids, from the nudibranch Chromodoris obsoleta. 


Molinski, Tadeusz F., Doralyn S. Dalisay, Sarah L. Lievens, and Joel P. Saludes. 2009. Drug development 

from natural products. Nature Reviews 8:69-85. 

Molinski, Tadeusz F., and D. John Faulkner. 1986. Aromatic norditerpenes from the nudibranch Chromodoris 

macfarlandi. Journal of Organic Chemistry 51:2601-2603. 

Molinski, Tadeusz F., D. John Faulkner, Cun-Heng He, Gregory D. Van Duyne, and Jon Clardy. 1986. Three 

new rearranged spongian diterpenes from Chromodoris macfarlandi: reappraisal of the structures of dendrillolides 

A and B. Journal of Organic Chemistry 51:4564-4567. 

Molinski, Tadeusz F., D. John Faulkner, Gregory D. Van Duyne, and Jon Clardy. 1987. Three new diterpene 

isonitriles from a Palauan sponge of the genus Halichondria. Journal of Organic Chemistry 52:3334-3337. 

Mollo, Ernesto, Margherita Gavagnin, Marianna Carbone, Francesco Castelluccio, Ferdinando Pozone, 

Vassilios Roussis, José Templado, Michael T. Ghiselin, and Gido Cimino. 2008. Factors promoting marine 

invasions: a chemoecological approach. Proceedings of the National Academy of Sciences USA 105:4582- 

4586. 

Mollo, Ernesto, Margherita Gavagnin, Marianna Carbone, Yue-Wei Guo, and Guido Cimino. 2005. Chemical 

studies on Indopacific Ceratosoma nudibranchs illuminate the protective role of their dorsal horn. 

Chemoecology 15:31-36. 

Moore, Richard E., and Michael Entzeroth. 1988. Majusculamide D and deoxymajusculamide D, two cytotoxins 

from Lyngbya majuscula. Phytochemistry 27:3101-3103. 

Mori, Kenji, Hirosato Takikawa, Masaru Kido, Kim F. Albizati, and D. John Faulkner. 1992. Synthesis of



(-)- and meso-Limatulone, defensive triterpene metabolites of the limpet Collisella limatula. Natural 

Product Letters 11:59-64. 

Morowitz, Harold J. 1992. Beginnings of Cellular Life: Metabolism Recapitulates Biogenesis. Yale University 

Press, New Haven. x + 194 pp. 

Morris, Sandra A., E. Dilip De Silva, and Raymond J. Andersen. 1991. Chromodorane diterpenes from the 

tropical dorid nudibranch Chromodoris cavae. Canadian Journal of Chemistry 69:768-771. 

Morse, M. Patricia. 1984. Functional adaptations of the digestive system of the carnivorous mollusc 

Pleurobranchaea californica. Journal of Morphology 180:253-269. 

Müller, Fritz. 1864. Für Darwin. Verlag von Wilhelm Engelmann, Leipzig. iii + 91 pp. 

Muricy, Guilherme, Nicole Boury-Esnault, Chantal Bézac, and Jean Vacelet. 1996. Cytological evidence for 

cryptic speciation in Mediterranean Oscarella species (Porifera, Homoscleromorpha). Canadian Journal 

of Zoology 74:881-896. 

Muricy, Guilherme, Antonio M. Solé-Cava, John P. Thorpe, and Nicole Boury-Esnault. 1996. Genetic evidence 

for extensive cryptic speciation in the subtidal sponge Plakina trilopha (Porifera: Demospongiae: 

Homoscleromorpha) from the Western Mediterranean. Marine Ecology Progress Series 138:181-187. 

Muscatine, Leonard, and Richard W. Greene. 1973. Chloroplasts and algae as symbionts in molluscs. 

International Review of Cytology 36:137-169. 

Mutou, Tsuyoshi, Takashi Kondo, Makoto Ojika, and Kiyoyuki Yamada. 1996. Isolation and stereostructures 

of dolastatin G and nordolastatin G, cytotoxic 35-membered cyclodepsipeptides from the Japanese sea hare 

Dolabella auricularia. Journal of Organic Chemistry 61:6340-6345. 

Nadeau, L., J. A. Paige, V. Starczak, T. Capo, J. Lafler, and J. P. Bidwell. 1989. Metamorphic competence in 

Aplysia californica Cooper. Journal of Experimental Marine Biology and Ecology 131:171-193. 

Nagai, Hiroshi, Takeshi Yasumoto, and Yoshtsugi Hokama. 1997. Manauealides, some of the causative agents 

of a red alga Gracilaria coronopifolia poisoning in Hawaiii. Journal of Natural Products 60:925-928. 

Nagle, Dale G., F. T. Camacho, and Valerie J. Paul. 1998. Dietary preferences of the opisthobranch mollusc 

Stylocheilus longicauda for secondary metabolites produced by the tropical cyanobacterium Lyngbya 

majuscula. Marine Biology 132:267-273. 

Nakao, Yoichi, Wesley Yoshida, and Paul J. Scheuer. 1996. Pupukeamide, a linear tetrapeptide from a cephalaspidean 

mollusk Philinopsis speciosa. Tetrahedron Letters 37:8993-8996. 

Nakao, Yoichi, Wesley Y. Yoshida, Christina M. Szabo, Bill J. Baker, and Paul J. Scheuer. 1998. More peptides 

and other diverse constituents of the marine mollusk Philinopsis speciosa. Journal of Organic 

Chemistry 63:3272-3280. 

Napolitano, José G., Maria L. Souto, José J. Fernández, and Manuel Norte. 2008. Micromelones A and B: two 

new non-contiguous polypropionates from Micromelo undata. Journal of Natural Products 71:281-284. 

Newman, David J. 2005. The bryostatins. Pages 137-150 in G. M. Cragg, D. G. I. Kingston, and D. J. Newman, 

eds., Anticancer Agents from Natural Products. Taylor and Francis, Boca Raton. 

Newman, David J., and Gordon M. Cragg. 2004. Marine natural products and related compounds in clinical 

and advanced clinical trials. Journal of Natural Products 67:1216-1238. 

Newman, David J., Gordon M. Cragg, and Kenneth M. Snader. 2000. The influence of natural products upon 

drug discovery. Natural Product Reports 17:215-234. 

Newman, David J., Gordon M. Cragg, and Kenneth M. Snader. 2003. Natural products as sources of new 

drugs over the period 1981-2002. Journal of Natural Products 66:1022-1037. 

Nichols, Scott A., and Penelope A. G. Barnes. 2005. A molecular phylogeny and historical biogeography of 

the marine sponge genus Placospongia (Phylum Porifera) indicate low dispersal capabilities and widespread 

crypsis. Journal of Experimental Marine Biology and Ecology 323:1-15. 

Niwa, Haruku, Hideaki Inagaki, and Kiyoyuki Yamada. 1991. Didemnilactone and neodidemnilactone, two 

new fatty acid metabolites possessing a 10-membered lactone from the tunicate Didemnum mosleyi 

(Herdman). Tetrahedron Letters 32:5127-5128. 

Nolen, Thomas G., and P. M. Johnson. 2001. Defensive inking in Aplysia spp.: multiple episodes of ink secretion 

and the adaptive use of a limited chemical resource. Journal of Experimental Biology 204:1257-1268. 

Norte, Manuel, Fernando Cataldo, and Antonio G. González. 1988. Siphonarienedione and siphonarienolone, 

two new metabloites from Siphonaria grisea having a polypropionate skeleton. Tetrahedron Letters


29:2879-2880. 

Norton, Raymond S., Kevin D. Croft, and Robert J. Wells. 1981. Polybrominated oxydiphenol derivatives 

from the sponge Dysidea herbacea. Tetrahedron 37:2341-2349. 

Odhner, Nils Hjalmar. 1939. Opisthobranchiate Mollusca from the western and northern coasts of Norway. 

Det Kongelige Norske Videnskabers Selskabs Skrifter 1939(1):1-93. 

Ojika, Makoto, Tomohiro Nagoya, and Kiyoyuki Yamada. 1995. Dolabellides A and B, cytotoxic 22-membered 

macrolides isolated from the sea hare Dolabella auricularia. Tetrahedron Letters 36:7491-7494. 

Ojika, Makoto, Takayuki Nemoto, and Kiyoyuki Yamada. 1993. Doliculols A and B, non-halogenated C 15 acetogenins 

with cyclic ether from the sea hare Dolabella auricularia. Tetrahedron Letters 34:3461-3462. 

Ojika, Makoto, Tomoo Yoshida, and Kiyoyuki Yamada. 1993. Aplysepine, a novel 1,4-benzodiazepine alkaloid 

from the sea hare Aplysia kurodai. Tetrahedron Letters 34:5307-5308. 

Ojika, Makoto, Yoshifuma Yoshida, M. Okumura, and S. Ieda. 1991. Aplysiadiol, a new brominated diterpene 

from the marine mollusc Aplysia kurodai. Journal of Natural Products 53:1619-1622. 

Ojika, Makoto, Yoshifumi Yoshida, Yoshisuke Nakayama, and Kiyoyuki Yamada. 1990. Aplydilactone, a 

novel fatty acid metabolite from the marine mollusc Aplysia kurodai. Tetrahedron Letters 34:4907-4910. 

Ojika, Makoto, Yoshifuma Yoshida, M. Okumura, S. Ieda, and Kiyoyuki Yamada. 1990. Aplysiadiol, a new 

brominated diterpene from the marine mollusc Aplysia kurodai. Journal of Natural Products 53:1619- 

1622. 

Okino, Tatsufumi, Erina Yoshimura, Hiroshi Hirota, and Nobuhiro Fusetani. 1996. New antifouling sesquiterpenes 

from four nudibranchs of the family Phyllidiidae. Tetrahedron 52:9447-9454. 

Okuda, Roy K., David Klein, Robin B. Kinnel, Michael Li, and Paul J. Scheuer. 1982. Marine natural products. 

The past twenty years and beyond. Pure and Applied Chemistry 54:1907-1914. 

Okuda, Roy K., and Paul J. Scheuer. 1985. Latrunculin-A, ichthyotoxic constituent of the nudibranch 

Chromodoris elisabethina. Experientia 41:1355-1356. 

Okuda, Roy K., Paul J. Scheuer, Jill E. Hochlowski, Roger P. Walker, and D. John Faulkner. 1983. 

Sesquiterpenoid constituents of eight porostome nudibranchs. Journal of Organic Chemistry 48:1866- 

1869. 

Ortega, Maria J., Eva Zubía, and Javier Salvà. 1997a. 3-epi-aplykurodinone B, a new degraded sterol from 

Aplysia fasciata. Journal of Natural Products 60:488-489. 

Ortega, Maria J., Eva Zubía, and Javier Salvà. 1997b. New polyhalogenated monoterpenes from the sea hare 

Aplysia punctata. Journal of Natural Products 60:482-484. 

Panceri, Paolo. 1869. Gli organi e la secrezione dell’acido solforico nei gasteropodi, con un’appendice relativa 

ad altri glandolari dei medisimi. Atti della Reale Accademia delle Scienze Fisiche e Matematiche di 

Napoli 4(10):1-56. 

Patterson, C. M. 1969. Chromosomes of molluscs. Pages 635-686 in Anonymous, ed., Proceedings of the 

Symposium on Mollusca held at Cochin from January 12 to 16, 1968, vol. 2. Bangalore Press, Bangalore. 

Paterson, E. A., and E. Anderson. 2005. The renaissance of natural products as drug candidates. Science 

310:451-453. 

Paul, Valerie J., and William Fenical. 1983. Isolation of Halimedatrial: chemical defense adaptation in the calcareous 

reef-building alga Halimeda. Science 221:747-749. 

Paul, Valerie J., and William Fenical. 1984. Bioactive terpenoids from Caribbean marine algae of the genera 

Penicillus and Udotea (Chlorophyta). Tetrahedron 40:2913-2918. 

Paul, Valerie J., Niels Lindquist, and William Fenical. 1990. Chemical defenses of the tropical ascidian 

Atapozoa sp. and its nudibranch predators Nembrotha spp. Marine Ecology Progress Series 59:109-118. 

Paul, Valerie J., and Steven C. Pennings. 1991. Diet-derived chemical defenses in the sea hare Stylocheilus 

longicauda (Quoy et Gaimard 1824). Journal of Experimental Marine Biology and Ecology 151:227-243. 

Paul, Valerie J., Hao H. Sun, and William Fenical. 1982. Udoteal, a linear diterpenoid feeding deterrent from 

the tropical green alga Udotea flabellum. Phytochemistry 21:468-469. 

Paul, Valerie J., and Kathryn L. Van Alstyne. 1988a. Chemical defense and chemical variation in some tropical 

Pacific species of Halimeda (Halimedaceae; Chlorophyta). Coral Reefs 6:263-269. 

Paul, Valerie J., and Kathryn L. Van Alstyne. 1988b. Use of ingested algal diterpenoids by Elysia halimedae 

Macnae (Opisthobranchia: Ascoglossa) as antipredator defenses. Journal of Experimental Marine Biology



and Ecology 119:15-29. 

Paul, Valerie J., and Kathryn L. Van Alstyne. 1992. Activation of chemical defenses in the tropical green algae 

Halimeda spp. Journal of Experimental Marine Biology and Ecology 160:191-203. 

Pawlik, Joseph R. 1989. Larvae of the sea hare Aplysia californica settle and metamorphose on an assortment 

of macroalgal species. Marine Ecology Progress Series 51:195-199. 

Pawlik, Joseph R., Kim F. Albizati, and D. John Faulkner. 1986. Evidence of a defensive role for limatulone, 

a novel triterpene from the limpet Collisella limatula. Marine Ecology Progress Series 30:251-260. 

Pawlik, Joseph R., Michael R. Kernan, Tadeusz F. Molinski, Mary Kay Harper, and D. John Faulkner. 1988. 

Defensive chemicals of the Spanish dancer nudibranch Hexabranchus sanguineus and its egg ribbons: 

macrolides derived from a sponge diet. Journal of Experimental Marine Biology and Ecology 119:99-109. 

Pedras, M. Soledade C., and Paulos B. Chumala. 2005. Phomapyrones from blackleg causing phytopathogenic 

fungi: isolation, structure determination, biosyntheses and biological activity. Phytochemistry 66:81-87. 

Pelseneer, Paul. 1889. Sur le pied et la position systématique des Ptéropodes. Annales de la Société Royale 

Malacologique de la Belgique 23:344-350, Pl. 1-3. 

Pelseneer, Paul. 1906. Mollusca. Pages 1-354 in E. R. Lankester, ed., A Treatse on Zoology, vol. 5. Adam & 

Charles Black, London. 

Penney, Brian K. 2004. Individual selection and the evolution of chemical defense in nudibranchs: experiments 

with whole Cadlina luteomarginata (Nudibranchia: Doridina). Journal of Molluscan Studies 

70:399-400. 

Pennings, Steven C. 1990a. Multiple factors promoting narrow host range in the sea hare, Aplysia californica. 

Oecologia 82:192-200. 

Pennings, Steven C. 1990b. Size-related shifts in herbivory: specialization in the sea hare Aplysia californica 

Cooper. Journal of Experimental Marine Biology and Ecology 142:43-61. 

Pennings, Steven C. 1994. Interspecific variation in chemical defenses in the sea hares (Opisthobranchia: 

Anaspidea). Journal of Experimental Marine Biology and Ecology 180:203-219. 

Pennings, Steven C., and Thomas H. Carefoot. 1995. Post-ingestive consequences of consuming secondary 

metabolites in sea hares (Gastropoda: Opisthobranchia). Comparative Biochemistry and Physiology 

111C:249-256. 

Pennings, Steven C., Sumner Nastich, and Valerie J. Paul. 2001. Vulnerability of sea hares to fish predators: 

importance of diet and fish species. Coral Reefs 20:320-324. 

Pennings, Steven C., Sonia R. Pablo, Valerie J. Paul, and J. Emmett Duffy. 1994. Effects of sponge secondary 

metabolites in different diets on feeding by three groups of consumers. Journal of Experimental 

Marine Biology and Ecology 180:137-149. 

Pennings, Steven C., and Valerie J. Paul. 1992. Effect of plant toughness, calcification, and chemistry of herbivory 

by Dolabella auricularia. Ecology 73:1606-1619. 

Pennings, Steven C., and Valerie J. Paul. 1993a. Secondary chemistry does not limit dietary range of the specialist 

sea hare Stylocheilus longicauda (Quoy et Gaimard 1824). Journal of Experimental Marine Biology 

and Ecology 174:97-113. 

Pennings, Steven C., and Valerie J. Paul. 1993b. Sequestration of dietary secondary metabolites by three 

species of sea hares: location, specificity and dynamics. Marine Biology 117:535-546. 

Pennings, Steven C., A. M. Weiss, and Valerie J. Paul. 1996. Secondary metabolites of the cyanobacterium 

Microcoleus lyngbyaceus and the sea hare Stylocheilus longicauda: palatability and toxicity. Marine 

Biology 126:735-743. 

Pennings, Steven C., Valerie J. Paul, D. Chuck Dunbar, Mark T. Hamann, Wilfred A. Lumbang, Brandie 

Novack, and Robert S. Jacobs. 1999. Unpalatable compounds in the marine gastropod Dolabela auricularia: 

distribution and effect of diet. Journal of Chemical Ecology 25:735-755. 

Perkins, Michael V., and Rebecca A. Sampson. 2001. Stereoselective synthesis of dihydropyrone-containing 

marine natural products. Total synthesis and structural elucidation of (-)-membrenone-C. Organic Letters 

3:123-126. 

Perrier, Rémy, and Henri Fischer. 1908. Les glandes palléales de défense chez le Scaphander lignarius L. 

Comptes Rendus de l’Académie des Sciences de Paris 146:1163-1166. 

Perrier, Rémy, and Henri Fischer. 1911. Recherches anatomiques et histologiques sur la cavité palléale et ses


dépendances chez les Bulléens. Annales des Sciences Naturelles, Zoologie, ser. 9, 14:1-190, Pl. I-IX. 

Pettit, George R. 1997. The dolastatins. Fortschritte der Chemie Organischer Naturstoffe 70:1-79. 

Pettit, George R., Cherry L. Herald, Malcolm S. Allen, Robert B. von Dreele, Lawrence D. Vanell, Joseph P. 

Y. Kao, and William Blake. 1977. Isolation and structure of aplysistatin. Journal of the American Chemical 

Society 99:262-263. 

Pettit, George R., Cherry L. Herald, R. H. Ode, P. Brown, D. J. Gust, and Claude Michel. 1980. The isolation 

of loliolide from an Indian Ocean opisthobranch mollusc. Journal of Natural Products 43:752-755. 

Pettit, George R., Y. Kamano, P. Brown, D. Gust, M. Inoue, and Cherry L. Herald. 1982. Structure of the cyclic 

peptide dolastatin 3 from Dolabella auricula. Journal of the American Chemical Society 104:905-907. 

Pettit, George R., Y. Kamano, Cherry L. Herald, Claude Dufresne, R. L. Cerny, Delbert L. Herald, Jean M. 

Schmidt, and H. Kizu. 1989. Isolation and structure of the cytostatic depsipeptide dolastin-13 from the sea 

hare Dolabella auricula. Journal of the American Chemical Society 111:5015-5017. 

Pettit, George R., Yoshiaki Kamano, Cherry L. Herald, Youichi Fujii, Haruhisa Kizu, Michael R. Boyd, Fred 

E. Boettner, Dennis L. Doubek, Jean M. Schmidt, Jean-Charles Chapuis, and Claude Michel. 1993. 

Isolation of dolastatins 10-15 from the marine mollusc Dolabella auricularia. Tetrahedron 49:9151-9170. 

Pettit, George R., D. Kantoci, Dennis L. Doubek, B. E. Tucker, W. Pettit, and R. M. Schroll. 1993. Isolation 

of the nickel-chlorin chelate Tunichlorin from the South Pacific Ocean sea hare Dolabella auricularia. 


Pettit, George R., R. H. Ode, Cherry L. Herald, Robert B. von Dreele, and Claude Michel. 1976. The isolation 

and structure of dolatriol. Journal of the American Chemical Society 98:4677-4678. 

Pettit, George R., Jun-Ping Xu, Dennis L. Doubek, Jean-Charles Chapuis, and Jean M. Schmidt. 2004. 

Antineoplastic agents. 510. Isolation and structure of Dolastatin 19 from the Gulf of California sea hare 

Dolabella auricularia. Journal of Natural Products 67:1252-1255. 

Pettit, George R., Jun-Ping Xu, Michael D. Williams, F. Hogan, and Jean M. Schmidt. 1997. Antineoplastic 

agents 370. Isolation and structure of dolastatin 18. Bioorganic and Medicinal Chemistry Letters 7:827- 

832. 

Pierce, Sidney K., Nicholas E. Curtis, Jeffrey J. Hanten, Susan L. Boerner, and Julie A. Schwartz. 2007. 

Transfer, integration and expression of functional nuclear genes between multicellular species. Symbiosis 

43:57-64. 

Pierce, Sidney K., Steven E. Massey, Jeffrey J. Hanten, and Nicholas E. Curtis. 2003. Horizontal transfer of 

functional nuclear genes between multicellular organisms. Biological Bulletin 204:237-240. 

Pierce, Sidney, K, Nicholas E. Curtis, Steven E. Massey, Anna L. Bass, Stephen A. Kari, and Colin M. Finney. 

2006. A morphological and molecular comparison between Elysia crispata and a new species of kleptoplastic 

sacoglossan sea slug (Gastropoda: Opisthobranchia) from the Florida Keys, USA. Molluscan 

Research 26:23-38. 

Pietra, Francesco. 1997. Secondary metabolites from marine microorganisms: bacteria, protozoa, algae and 

fungi. Achievements and prospects. Natural Product Reports 14(5[October]):453-464. 

Pika, Jana, and D. John Faulkner. 1994. Four sesquiterpenes from the South African nudibranch Leminda millecra. 


Pika, Jana, and D. John Faulkner. 1995. Unusual chlorinated homo-diterpenes from the South African nudibranch 

Chromodoris hamiltoni. Tetrahedron 51:8189-8198. 

Poiner, Anthony, Valerie J. Paul, and Paul J. Scheuer. 1989. Kumepaloxane, a rearranged trisnor sesquiterpene 

from the bubble shell Haminoea cymbalum. Tetrahedron 45:617-622. 

Pola, Marta, J. Lucas Cervera, and Terrence M. Gosliner. 2007. Phylogenetic relationships of Nembrothinae 

(Mollusca: Doridacea: Polyceridae) inferred from morphology and mitochondrial DNA. Molecular 

Phylogenetics and Evolution 43:726-742. 

Ponder, Winston F., and David R. Lindberg. 1997. Towards a phylogeny of gastropod molluscs: an analysis 

using morphological characters. Zoological Journal of the Linnean Society 119:83-265. 

Porcelli, Marina, Giovanna Cacciapuoti, Guido Cimino, Margherita Gavagnin, Guido Sodano, and Vincenzo 

Zappia. 1988. Characterization and biogenesis of 5’-methylthioxylofuranosyl adenine, a new natural analog 

of 5’-methylthioadenosine. Pages 219-228 in V. Zappia and A. E. Pegg, eds., Progress in Polyamine 

Research. Plenum, New York.



Porcelli, Marina, Giovanna Cacciapuoti, Guido Cimino, Margherita Gavagnin, Guido Sodano, and Vincenzo 

Zappia. 1989. Biosynthesis of 9-[5’-deoxy-5’-(methylthio)-β-D-xylofuranosyl]adenine, a novel natural 

analogue of methylthioadenosine. Biochemical Journal 263:635-640. 

Poulicek, Mathieu, Marie-Françoise Voss-Foucart, and Charles Jeuniaux. 1991. Regressive shell evolution 

among opisthobranch gastropods. Malacologia 32:223-232. 

Quiñoa, Emilio, Luis Castedo, and Ricardo Riguera. 1989. The halogenated monoterpenes of Aplysia punctata, 

a comparative study. Comparative Biochemistry and Physiology 92B:99-101. 

Reese, Michael T., Nanda K. Gulavita, Yoichi Nakao, Mark T. Hamann, Wesley Y. Yoshida, Stephen J. Coval, 

and Paul J. Scheuer. 1996. Kuolide: a cytotoxic depsipeptide from a cephalaspidean mollusk, Philinopsis 

speciosa. Journal of the American Chemical Society 118:11081-11804. 

Rice, Sean H. 1985. An anti-predator chemical defense of the marine pulmonate gastropod Trimusculus reticulatus 

(Sowerby). Journal of Experimental Marine Biology and Ecology 93:83-89. 

Roddick, J. G. 1980. Isoprenoid alkaloids. Pages 167-184 in E. A. Bell and B. V. Charlwood, eds., Secondary 

Plant Products. In A. Pirson and M. H. Zimmermann, eds., Encyclopedia of Plant Physiology, New Series 

Volume 8. Springer-Verlag, Berlin. 

Rodíguez, Jaime, Rogelio Fernández, Emilio Quiñoá, Ricardo Riguera, Cécile Debitus, and Philippe Pouchet. 

1994. Onchidin: a cytotoxic depsipeptide with C2 symmetry from a marine mollusc. Tetrahedron Letters 

35:9239-9242. 

Rodíguez, Jaime, Ricardo Riguera, and Cécile Debitus. 1992. The natural polypropionate-derived esters of the 

mollusc Onchidium sp. Journal of Organic Chemistry 57:4624-4632. 

Roesener, Jeffrey A., and Paul J. Scheuer. 1986. Ulapualide A and B, extraordinary antitumor macrolides from 

nudibranch egg masses. Journal of the American Chemical Society 108:846-847. 

Rogers, Cary N., Rocky De Nys, Timothy S. Charlton, and Paul D. Steinberg. 2000. Dynamics of algal secondary 

metabolites in two species of sea hare. Journal of Chemical Ecology 26:721-744. 

Rogers, Cary N., Peter D. Steinberg, and Rocky De Nys. 1995. Factors associated with oligophagy in two 

speces of sea-hares (Mollusca: Anaspidea). Journal of Experimental Marine Biology and Ecology 192:47- 

73. 

Rogers, Shelly D., and Valerie J. Paul. 1991. Chemical defenses of three Glossodoris nudibranchs and their 

dietary Hyrtios sponges. Marine Ecology Progress Series 77:221-232. 

Ros, Joandomènec. 1976. Sistemas de defensa en los Opistobranquios. Oecologia Aquatica 2:41-77. 

Ros, Joandomènic, and Arnaldo Marín. 1991. Adaptive advantages of the “symbiosis” between algal chloroplasts 

and sacoglossan molluscs. Oecologia Aquatica 10:271-298. 

Rose, Allan F., Paul J. Scheuer, James P. Springer, and Jon Clardy. 1978. Stylocheilamide, an unusual constituent 

of the sea hare Stylocheilus longicauda. Journal of the American Chemical Society 100:7665-7670. 

Rosenberg, Gary. 1989. Aposematism evolves by individual selection: evidence from marine gastropods with 

pelagic larvae. Evolution 43:1811-1813. 

Rosenberg, Gary. 1991. Aposematism and synergistic selection in marine gastropods. Evolution 45:451-454. 

Roussis, Vassilios, Joseph R. Pawlik, Mark E. Hay, and William Fenical. 1990. Secondary metabolites of the 

chemically rich ascoglossan Cyerce nigricans. Experientia 46:327-329. 

Rudman, William B. 1981. The anatomy and biology of alcyonarian-feeding aeolid opisthobranch molluscs 

and their development of symbiosis with zooxanthellae. Zoological Journal of the Linnean Society 72:219- 

262. 

Rudman, William B. 1984. The Chromodorididae (Opisthobranchia: Mollusca) of the Indo-West Pacific: a 

review of the genera. Zoological Journal of the Linnean Society 81:115-273. 

Rudman, William B. 1985. The Chromodorididae (Opisthobranchia: Mollusca) of the Indo-West Pacific: 

Chromodoris aureomarginata, C. verrieri and C. fidelis colour groups. Zoological Journal of the Linnean 

Society 83:241-299. 

Rudman, William B. 1991. Further studies on the taxonomy and biology of the octocoral-feeding genus 

Phyllodesmium Ehernberg, 1831 (Nudibranchia: Aeolidoidea). Journal of Molluscan Studies 57:167-203. 

Rudman, William B., and Patricia R. Bergquist. 2007. A review of feeding specificity in the sponge-feeding 

Chromodorididae (Nudibranchia: Mollusca). Molluscan Research 27:60-88. 

Rumpho, Mary E., Elizabeth J. Sumner, and James R. Manhart. 2000. Solar-powered sea slugs. Mollusc/algal


chloroplast symbiosis. Plant Physiology 123:29-38. 

Rumpho, Mary E., Jared M. Worful, Jungho Lee, Krishna Kannan, Mary S. Tyler, Debashish Bhattacharya, 

Ahmed Moustafa, and James R. Manhart. 2008. Horizontal gene transfer of the algal nuclear gene psbO 

to the photosynthetic sea slug Elysia chlorotica. Proceedings of the National Academy of Sciences USA . 

Russell, Lillian. 1929. The comparative morphology of the elysioid and aeolidioid types of the molluscan 

nervous system, and its bearing on the relationships of the ascoglossan nudibranchs. Proceedings of the 

Zoological Society of London 1929:197-233. 

Ruthensteiner, Bernhard. 1997. Homology of the pallial and pulmonary cavity of gastropods. Journal of 


Sakamoto, Kenichiro, T. Nakajima, S. Misawa, H. Ishikawa, Y. Itoh, T. Nakashima, T. Okanoue, K. Kashima, 

and T. Tsuji. 1998. Acute liver damage with characteristic apoptotic hepatocytes by ingestion of Aplysia 

kurodai, a sea hare. Internal Medicine 37:927-929. 

Sakio, Yukako, Yoshiaki J. Hirano, Masahiko Hayashi, Kanki Komiyama, and Masami Ishibashi. 2001. 

Dendrocarbins A-N, new drimane sesquiterpenes from the nudibranch Dendrodoris carbunculosa. Journal 

of Natural Products 64:726-731. 

Salomon, Christine E., T. Deerinck, M. H. Ellisman, and D. John Faulkner. 2001. The cellular localization of 

dercitamide in the Palauan sponge Oceanapia sagittaria. Marine Biology 139:313-319. 

Salzburger, Walter, and Axel Meyer. 2004. The species flocks of East African cichlid fishes: recent advances 

in molecular phylogenetics and population genetics. Die Naturwissenschaften 91:277-290. 

Schmekel, Luise. 1985. Aspects of evolution within the opisthobranchs. Pages 221-267 in E. R. Trueman and 

M. R. Clarke, eds., Evolution. In K. M. Wilbur, ed., The Mollusca, Volume 10. Academic Press, New York. 

Schmitz, Francis J., Sarath P. Gunaserka, Yalamanchili Gopichand, M. Bilayet Hossain, and Dick Van Der 

Helm. 1984. Tedanolide: a potent cytotoxic macrolide from the Caribbean sponge Tedania ignis. Journal 

of the American Chemical Society 106:7251-7252. 

Schmitz, Francis J., Keith H. Hollenbeak, D. Carter, M. Bilayet Hossian, and Dick Van Der Helm. 1979. 

Marine natural products: 14-bromoobtus-1-ene-3,11-diol, a new diterpenoid from the sea hare Aplysia 

dactylomela. Journal of Organic Chemistry 44:2445-2447. 

Schmitz, Francis J., and Francis J. McDonald. 1974. Marine natural products: dactyloxene-B, a sesquiterpene 

ether from the sea hare Aplysia dactylomela. Tetrahedron Letters 29:2541-2544. 

Schmitz, Francis J., Francis J. MacDonald, and David J. Vanderah. 1978. Marine natural products: dactylone- 

B, sesquiterpene alcohols and ethers from the sea hare Aplysia dactylomela. Journal of Organic Chemistry 

43:4220-4225. 

Schmitz, Francis J., Dennis P. Michaud, and Keith H. Hollenbeak. 1980. Marine natural products: dihydroxydeodactol 

monoacetate, a halogenated sesquiterpene ether from the sea hare Aplysia dactylomela. Journal 


Schmitz, Francis J., Dennis P. Michaud, and P. G. Schmidt. 1982. Marine natural products: parguerol, deoxyparguerol, 

and isopaguerol. New brominated diterpenes with modified primarane skeletons from the sea 

hare Aplysia dactylomela. Journal of the American Chemical Society 104:6415-6423. 

Scholtz, Gerhard. 2004. Coelenterata versus Acrosomata — zur Position der Rippenquallen (Ctenophora) im 

phylogenetischen System der Metazoa. In S. Richter and W. Sudhaus, eds., Kontroversen in der 

Phylogenetischen Systematik der Metazoa. Sitzungsberichte der Gesellschaft Naturforschender Freunde 

zu Berlin, ser. NF, 43:15-33. 

Schulte, Gary R., Melvin C. H. Chung, and Paul J. Scheuer. 1981. Two bicyclic C 15 enynes from the sea hare 

Aplysia oculifera. Journal of Organic Chemistry 45:3870-3873. 

Schulte, Gary R., and Paul J. Scheuer. 1982. Defense allomones of some marine mollusks. Tetrahedron 

38:1857-1863. 

Schulte, Gary, Paul J. Scheuer, and Oliver J. McConnell. 1980. Two furanosesquiterpene marine metabolites 

with anti-feedant properties. Helvetica Chimica Acta 63:2159-2167. 

Sciscioli, M., E. Lepore, M. Gherardi, and L. Scalera-Liaci. 1995. Tranfer of symbiotic bacteria in the mature 

oocyte of Geodia cydonium (Porifera, Demospongiae): an ultrastructural study. Cahiers de Biologie 

Marine 35:471-478. 

Seigler, David S. 1977. Primary roles for secondary compounds. Biochemical Systematics and Ecology 5:195- 

199.



Sewertzoff, Alexy Nikolaievich. 1931. Morphologische Gesetzmässigkeiten der Evolution. Verlag von Gustav 

Fischer, Jena. xiv + 371 pp. 

Sharp, Jasmine H., Michael K. Winson, and Joanne S. Porter. 2007. Bryozoan metabolites: an ecological perspective. 

Natural Product Reports 24:659-673. 

Sheikh, Younis M., and Carl Djerassi. 1975. 2,6-Dibromophenol and 2,4,6-tribromophenol - antiseptic secondary 

metabolites of Phoronopsis viridis. Experientia 31:265-266. 

Sheumack, D. D., M. E. H. Howden, I. Spence, and R. J. Quinn. 1978. Maculotoxin: a neurotoxin from the 

venom gland of the octopus Hapalochlaena maculosa identified as tetrodotoxin. Science 199:188-199. 

Shin, Jongheon, and Youngwan Seo. 1995. Isolation of new ceramides from the gorgonian Acabaria undulata. 

Journal of Natural Products 58(6):948-953. 

Slattery, Marc, Conxita Avila, John Starmer, and Valerie J. Paul. 1998. A sequestered soft coral diterpene in 

the aeolid nudibranch Phyllodesmium guamensis Avila, Ballesteros, Slattery, Starmer and Paul. Journal of 


Sleeper, Howard L., and William Fenical. 1977. Navenones A-C: trail-breaking alarm pheromones from the 

marine opisthobranch Navanax inermis. Journal of the American Chemical Society 99:2367-2368. 

Sleeper, Howard L., Valerie J. Paul, and William Fenical. 1980. Alarm pheromones from the marine opisthobranch 

Navanax inermis. Journal of Chemical Ecology 6:57-70. 

Smith, Adam. 1776. An Inquiry into the Nature and Causes of the Wealth of Nations. W. Strahan and T. Cadell, 

London. xii + 510 + iv + 587 pp. 

Smith, Cameron J., Darren Abbanat, Valerie S. Bernan, William M. Maiese, Michael Greenstein, Jamaluddin 

Jompa, Akbar Thair, and Chris M. Ireland. 2000. Novel polyketide metabolites from a species of marine 

fungi. Journal of Natural Products 63:142-145. 

Smith, Victor G. 2005. Morphology, anatomy, trophic relationships and systematics of two families of dendronotoid 

nudibranchs. M.S. Thesis. San Francisco State University, San Francisco. 260 pp. 

Sodano, Guido, and Aldo Spinella. 1986. Janolusimide, a lipophilic tripeptide toxin from the nudibranch mollusc 

Janolus cristatus. Tetrahedron Letters 27:2505-2508. 

Solé-Cava, Antonio M., Michelle Klautau, Nicole Boury-Esnault, Radovan Borojevic, and John P. Thorpe. 

1991. Genetic evidence for cryptic speciation in allopatric populations of two cosmopolitan species of the 

calcareous sponge genus Clathrina. Marine Biology 111:381-386. 

Solé-Cava, Antonio M., and John P. Thorpe. 1986. Genetic differentiation between morphotypes of the marine 

sponge Suberites ficus (Demospongiae: Hadromerida). Marine Biology 93:247-253. 

Somerville, Michael J., Ernesto Mollo, Guido Cimino, Wimolpun Rungprom, and Mary J. Garson. 2006. 

Spongian diterpenes from Australian nudibranchs: an anatomically guided chemical study of Glossodoris 

atromarginata. Journal of Natural Products 69:1086-1088. 

Sone, Hiroki, Hideo Kigoshi, and Kiyoyuki Yamada. 1996. Aurisides A and B, cytotoxic glycosides from the 

Japanese sea hare Dolabella auricularia. Journal of Organic Chemistry 61:8956-8960. 

Sone, Hiroki, Takayuki Nemoto, Hiroyuki Ishiwata, Makoto Ojika, and Kiyoyuki Yamada. 1993. Isolation, 

structure and synthesis of Dolastatin D, a cytotoxic cyclic depsipeptide from the sea hare Dolabella auriculata. 


Sone, Hiroki., T. Shibata, T. Fujita, J. Ojika, and K. Yamada. 1996. Dolastatin H and isodolastatin H, potent 

cytotoxic peptides from the sea hare Dolabella auricularia: isolation, streostructures, and synthesis. 


Soriente, Annunziata, Guido Sodano, K. Chase Reed, and Christopher Todd. 1993. A new ichthyotoxic diacylglycerol 

from the nudibranch Archidoris pseudoargus. Natural Product Letters 3:31-35. 

Sorokin, M. 1988. Human poisoning by ingestion of a sea hare (Dolabella auricularia). Toxicon 26:1095- 

2097. 

Spinella, Aldo, Luis A. Alvarez, Conxita Avila, and Guido Cimino. 1994. New acetoxy-ent-pallescensin-A 

sesquiterpenoids from the skin of the porostome nudibranch Doriopsilla areolata. Tetrahedron Letters 

35:8665-8666. 

Spinella, Aldo, Luis A. Alvarez, and Guido Cimino. 1993. Predator-prey relationship between Navanax inermis 

and Bulla gouldiana: a chemical approach. Tetrahedron 49:3203-3210. 

Spinella, Aldo, Luis A. Alvarez, and Guido Cimino. 1998. Alklphenols from the cephalaspidean mollusc


Haminoea callidegenita. Tetrahedron Letters 39:2005-2008. 

Spinella, Aldo, Margherita Gavagnin, Antonio Crispino, Guido Cimino, Eugenia Martinez, Jesus Ortea, and 

Guido Sodano. 1992. 4-Acetylaplykurodin B and Aplykurodinone B, two ichthyotoxic degraded sterols 

from the Mediterranean mollusk Aplysia fasciata. Journal of Natural Products 55:989-993. 

Spinella, Aldo, Ernesto Mollo, Enrico Trivellone, and Guido Cimino. 1997. Testudinariol A and B, two unusual 

triterpenoids from the skin and mucus of the marine mollusc Pleurobranchus testudinarius. Tetrahedron 

53:16891-16896. 

Spinella, Aldo, Eva Zubia, Eugenia Martînez, Jesus Ortea, and Guido Cimino. 1997. Structure and stereochemistry 

of aplyolides A-E, lactonized dihydoxy fatty acids from the skin of the marine mollusk Aplysia 

depilans. Journal of Organic Chemistry 62:5471-5475. 

Stachowicz, John J., and Niels Lindquist. 2000. Hydroid defenses against predators: the importance of secondary 

metabolites versus nematocysts. Oecologia 124:280-288. 

Stallard, Martha O., William Fenical, and J. S. Kittredge. 1978. The brasilenols, rearranged sesquiterpene 

alcohols isolated from the marine opisthobranch Aplysia brasiliana. Tetrahedron 34:2077-2081. 

Stallard, Martha O., and D. John Faulkner. 1974. Chemical constituents of the digestive gland of the sea hare 

Aplysia californica. I. Importance of diet. Comparative Biochemistry and Physiology 49B:25-35. 

Stallard, Martha O., and D. John Faulkner. 1974. Chemical constituents of the digestive gland of the sea hare 

Aplysia californica. II. Chemical transformations. Comparative Biochemistry and Physiology 49B:37- 

41. 

Stamm, Roger Alfred. 1968. Zur Abwehr von Raubfeinden durch Lobiger serradifalci (Calcara), 1840 und 

Oxynoe olivacea Rafinesque 1819 (Gastropoda, Opisthobranchia). Revue Suisse de Zoologie 75:661-665. 

Staunton, James, and Kira J. Weissman. 2001. Polyketide biosynthesis: a millenium review. Natural Product 

Reports 18:380-416. 

Stoecker, Diane. 1980a. Chemical defenses of ascidians against predators. Ecology 61:1327-1334. 

Stoecker, Diane. 1980b. Distribution of acid and vanadium in Rhopalaea birkelandi Tokioka. Journal of 


Stoecker, Diane. 1980c. Relationship between chemical defenses and ecology in benthic ascidians. Marine 

Ecology Progress Series 3:257-265. 

Streble, Heinz. 1968. Bau und Bedeutug der Nessensäcke von Aeolidia papillosa L., der breitwarzigen 

Fadenschnecke (Gastropoda, Opisthobranchia). Zoologischer Anzeiger 180:356-372. 

Suenaga, Kiyotake, Hideo Kigoshi, and Kiyoyuki Yamada. 1996. Auripyrones A and B, cytotoxic polypropionates 

from the sea hare Dolabella auricularia: isolation and structures. Tetrahedron Letters 39:5151-5154. 

Suenaga, Kiyotake, Tsuyoshi Mutou, Takunobu Shibata, Takashi Itoh, Tatsuya Fujita, Noburu Takada, Kozue 

Hayamizu, Masaki Takagi, Taiji Irifune, Hideo Kigoshi, and Kiyoyuki Yamada. 2004. Aurilide, a cytotoxic 

depsipeptide from the sea hare Dolabella auricularia: isolation, structural determination, synthesis, and 

biological activity. Tetrahedron 60:8509-8527. 

Suenaga, Kiyotake, Tsuyoshi Mutou, Takunobu Shibata, Takashi Itoh, Hideo Kigoshi, and Kiyoyuki Yamada. 

1996. Isolation and stereostructure of Aurilide, a novel cyclodepsipeptide from the Japanese sea hare 

Dolabella auricularia. Tetrahedron Letters 37:6771-6774. 

Suenaga, Kiyotake, Tomohiro Nagoya, Takanobu Shibata, Hideo Kigoshi, and Kiyoyuki Yamada. 1997. 

Dolabellides C and D, cytotoxic macrolides isolated from the sea hare Dolabella auricularia. Journal of 


Suenaga, Kiyotake, Takanobu Shibata, N. Takada, Hideo Kigoshi, and Kiyoyuki Yamada. 1998. Aurilol, a 

cytotoxic bromotriterpene isolated from the sea hare Dolabella auricularia. Journal of Natural Products 

61:515-518. 

Sun, Hao H., Frank J. McEnroe, and William Fenical. 1983. Acetoxycrenulide, a new bicyclic cyclopropanecontaining 

diterpenoid from the brown seaweed Dictyota crenulata. Journal of Organic Chemistry 

48:1903-1906. 

Suntornchashwei, Suchada, Narongsak Chaichit, Minoru Isobe, and Khanit Suwanboriux. 2005. Hectochlorin 

and morpholine derivatives from the Thai sea hare, Bursatella leachii. Journal of Natural Products 

68:951-955. 

Szabo, Christina M., Yoichi Nakao, Wesley Y. Yoshida, and Paul J. Scheuer. 1996. Two diverse constituents



of the cephalaspidean mollusk Smaragdinella calyculata. Tetrahedron 52:9681-9686. 

Tanaka, Junichi, and Tatsuo Higa. 1999. Two new cytotoxic carbonimidic dichlorides from the nudibranch 

Reticulidia fungia. Journal of Natural Products 62:1339-1340. 

Tax, Sol. 1960. Evolution after Darwin. University of Chicago Press, Chicago. 

Teeyapant, R., P. Kreis, Victor Wray, Ludger Witte, and Peter Proksch. 1993. Brominated secondary compounds 

from the marine sponge Verongia aerophoba and the sponge feeding gastropod Tylodina perversa. 

Zeitschrift für Naturforschung 48C:630-644. 

Terem, Bülent, and Paul J. Scheuer. 1986. Scalaradial derivatives from the nudibranch Chromodoris youngbleuthi 

and the sponge Spongia oceanica. Tetrahedron 42:4409-4412. 

Thiele, Johannes. 1931. Handbuch der systematischen Weichtierkunde, vol. 1. Verlag von Gustav Fischer, 

Jena. vi + 778 pp. 

Thiele, Johannes. 1935. Handbuch der systematischen Weichtierkunde, vol. 2. Verlag von Gustav Fischer, 

Jena. iv + 779-1154 pp. 

Thollesson, Mikael. 1999. Phylogenetic analysis of Euthyneura (Gastropoda) by means of the 16S rRNA 

gene: use of a ‘fast’ gene for ‘higher-level’ phylogenies. Proceedings of the Royal Society of London, ser. 

B, 266:75-83. 

Thompson, Janice E., Roger P. Walker, Stephen J. Wratten, and D. John Faulkner. 1982. A chemical defense 

mechanism for the nudibranch Cadlina luteomarginata. Tetrahedron Letters 23:1865-1873. 

Thompson, T. E. 1960. Defensive acid-secretion in marine gastropods. Journal of the Marine Biological 

Association of the United Kingdom 39:115-122. 

Thompson, T. E. 1973. Euthyneuran and other molluscan spermatozoa. Malacologia 14:167-206. 

Thompson, T. E. 1986. Investigation of the acidic allomone of the gastropod mollusc Philine aperta by means 

of ion chromatography and histochemical localisation of sulphate and chloride ions. Journal of Molluscan 

Studies 52:38-44. 

Thompson, T. E., and Isobel Bennett. 1969. Physalia nematocysts: utilized by mollusks for defense. Science 

166:1532-1533. 

Thompson, T. E., and D. M. Crampton. 1984. Biology of Melibe fimbriata, a conspicuous opisthobranch mollusc 

of the Indian Ocean, which has now invaded the Mediterranean Sea. Journal of Molluscan Studies 

50:113-121. 

Thompson, T. E., and G. M. Jarman. 1989. Nutrition of Tridachia crispata (Mörch)(Sacoglossa). Journal of 


Thompson, T. E., and D. R. Seward. 1989. Ecology and taxonomic status of the aplysiomorph Akera bullata 

in the British Isles. Journal of Molluscan Studies 55:489-496. 

Thompson, T. E., and D. J. Slinn. 1959. On the biology of the opisthobranch Pleurobranchus membranaceus. 

Journal of the Marine Biological Association of the United Kingdom 38:507-524. 

Thoms, Carsten, Rainer Ebel, and Peter Proksch. 2006. Sequestration and possible role of dietary alkaloids in 

the sponge-feeding mollusk Tylodina perversa. Pages 261-275 in Guido Cimino and Margherita Gavagnin, 

eds., Molluscs: From Chemo-ecological Study to Biotechnological Application. In W. E. G. Müller, ed., 

Progress in Molecular and Subcellular Biology: Marine Molecular Biotechnology, Volume 43. Springer, 

New York. 

Thoms, Carsten, Matthias Wolff, K. Padmakumar, Rainer Ebel, and Peter Proksch. 2004. Chemical defense of 

Mediterranean sponges Aplysina cavernicola and Aplysina aerophoba. Zeitschrift für Naturforschung, ser. 

C, 59:113-122. 

Tilvi, Supriya, and Chandrakant G. Naik. 2007. Tandem mass spectrometry of kahalalides: identification of 

two new cyclic depsipeptides, kahalalide R and S from Elysia grandifolia. Journal of Mass Spectrometry 

42:70-80. 

Tischler, Mark, and Raymond J. Andersen. 1989. Glaciolide, a degraded diterpenoid with a new carbon skeleton 

from the nudibranch Cadlina luteomarginata and the sponge Aplysilla glacialis. Tetrahedron Letters 

30:5717-5720. 

Tishler, Mark, Raymond J. Andersen, M. Iqbal Choudhary, and Jon Clardy. 1991. Terpenoids from the sponge 

Aplysilla glacialis and specimens of the nudibranch Cadlina luteomarginata found on the sponge. Journal 

of Organic Chemistry 56:42-47.


Todd, James S., and William H. Gerwick. 1995. Malyngamide I from the tropical marine cyanobacterium 

Lyngbya majuscula and the probable structure revision of stylocheilamide. Tetrahedron Letters 36:7837- 

7840. 

Trincone, Antonio, ed. 2002. Dal Laboratorio per la Chimica e Fisica di Molecole di Interesse Biologico all’ 

Istituto di Chimica Biomolecolare: I 30 Anni dell’Istituto per la Chimica di Molecole di Interesse 

Biologico. Consiglio Nazionale delle Ricerche, Napoli. 168 pp. 

Tringali, Corrado, A. Parisi, Mario Piattelli, and G. Magnano di San Lio. 1993. Phomenins A and B, bioactive 

polypropionate pyrones from culture fluids of Phoma tracheiphila. Natural Product Letters 3:101-106. 

Trowbridge, Cynthia D. 1991. Diet specialization limits herbivorous sea slug’s capacity to switch among food 

species. Ecology 72:1880-1888. 

Tullrot, Anita, and Per Sundberg. 1991. The conspicuous nudibranch Polycera quadrilineata: aposematic coloration 

and individual selection. Animal Behaviour 41:175-176. 

Turner, T., W. J. Jackson, George R. Pettit, A. Wells, and A. S. Kraft. 1998. Treatment of human prostate cancer 

cells with dolastatin-10, a peptide isolated from a marine shell-less mollusc. Prostate 34:175-181. 

Turon, Xavier, Mikel A. Becerro, and Maria J. Uriz. 1996. Seasonal patterns of toxicity in benthic invertebrates: 

the encrusting sponge Crambe crambe (Poecilosclerida). Oikos 75:33-40. 

Unson, Mia D., and D. John Faulkner. 1993. Cyanobacterial symbiont biosynthesis of chlorinated metabolites 

from Dysidea herbacea. Experientia 49:349-353. 

Valdés, Ángel. 2001. Depth-related adaptations, speciation processes and evolution of color in the genus 

Phyllidiopsis (Mollusca: Nudibranchia). Marine Biology 139:485-496. 

Valdés, Ángel. 2002a. A phylogenetic analysis and systematic revision of the cryptobranch dorids (Mollusca, 

Nudibranchia, Anthobranchia). Zoological Journal of the Linnean Society 136:535-636. 

Valdés, Ángel. 2002b. Phylogenetic systematics of “Bathydoris” s.l. Bergh, 1884 (Mollusca, Nudibranchia), 

with the description of a new species from New Caledonian deep waters. Canadian Journal of Zoology 

80:1084-1099. 

Valdés, Ángel. 2003. Preliminary molecular phylogeny of the radula-less dorids (Gastropoda: 

Opisthobranchia), based on 16s mtDNA sequence data. Journal of Molluscan Studies 69:75-80. 

Valdés, Ángel. 2004. Phylogeography and phyloecology of dorid nudibranchs (Mollusca, Gastropoda). 

Biological Journal of the Linnean Society 83:551-559. 

Valdés, Ángel, and Terrence M. Gosliner. 1999. Phylogeny of the radula-less dorids (Mollusca, 

Nudibranchia), with the description of a new genus and a new family. Zoologica Scripta 28:315-360. 

Valdés, Ángel, and Terrence M. Gosliner. 2001. Systematics and phylogeny of the caryophyllidia-bearing 

dorids (Mollusca, Nudibranchia), with descriptions of a new genus and four new species from Indo-Pacific 

deep waters. Zoological Journal of the Linnean Society 133:103-198. 

Valdés, Ángel, and Pierre Lozouet. 2000. Opisthobranch molluscs from the Tertiary of the Aquitaine Basin 

(south-western France), with descriptions of seven new species and a new genus. Palaeontology 43:457- 

479. 

Van Den Biggelaar, Jo A. M., and Gerhard Haszprunar. 1996. Cleavage patterns and mesentoblast formation 

in the Gastropoda: an evolutionary perspective. Evolution 50:1520-1540. 

Vanderah, David J., and Francis J. Schmitz. 1976. Marine natural products: isodactylyne, a halogenated 

acetylenic ether from the sea hare Aplysia dactylomela. Journal of Organic Chemistry 41:3480-3481. 

Van Soest, Rob W. M. 1991. Demosponge higher taxa classification re-examined. Pages 54-71 in J. Reitner 

and H. Keupp, eds., Fossil and Recent Sponges. Springer-Verlag, Berlin. 

Van Soest, Rob W. M., Nobuhiro Fusetani, and Raymond J. Andersen. 1998. Straight-chain acetylenes as 

chemotaxonomic markers of the marine Haplosclerida. Pages 3-30 in Y. Watanabe and N. Fusetani, eds., 

Sponge Sciences: Multidisciplinary Perspectives. Springer-Verlag, Tokyo. 

Van Wyk, Albert W. W., P. William Froneman, Kim S. Bernard, and Michael T. Davies-Coleman. 2007. New 

isocopalane diterpene diester from a sub-Antarctic marine nudibranch. ARKIVOC (9):121-128. 

Van Wyk, Albert W. W., Christopher A. Gray, Catherine E. Whibley, Omolaja Osoniyi, Denver T. Hendricks, 

R. Caira Mino, and Michael T. Davies Coleman. 2008. Bioactive metabolites from the South African 

marine mollusk Trimusculus costatus. Journal of Natural Products 71:420-425. 

Vardaro, Rosa Rita, Vincenzo Di Marzo, and Guido Cimino. 1992. Placidenes: cyercene-like polypropionate



γ-pyrones from the Mediterranean ascoglossan mollusc Placidia dendritica. Tetrahedron Letters 33:2875- 

2878. 

Vardaro, Rosa Rita, Vincenzo Di Marzo, Antonio Crispino, and Guido Cimino. 1991. Cyercenes, novel 

polypropionate pyrones from the autotomizing Mediterranean mollusc Cyerce cristallina. Tetrahedron 

47:5569-5576. 

Vardaro, Rosa Rita, Vincenzo Di Marzo, Arnaldo Marin, and Guido Cimino. 1992. α and 

γ-pyrone-polypropionates from the Mediterranean ascoglossan mollusc Ercolania funerea. Tetrahedron 

48(43):9561-9566. 

Vayssière, Albert. 1885. Recherches zoologiques et anatomiques sur les Mollusques opisthobranches du Golfe 

de Marseille. Première Partie. Tectibranches. Annales du Musée D’Histoire Naturelle de Marseille 2:1- 

181, Pl. 1-6. 

Vermeij, Geerat J. 1978. Biogeography and Adaptation: Patterns of Marine Life. Harvard University Press, 

Cambridge. xiii + 332 pp. 

Vermeij, Geerat J. 1987. Evolution and Escalation: an Ecological History of Life. Princeton University Press, 

Princeton. xv + 527 pp. 

Vermeij, Geerat J. 2004. Nature: An Economic History. Princeton University Press, Princeton. viii + 445 pp. 

Vitturi, Roberto, Maria Berica Rasotto, N. Parrinello, and E. Catalano. 1982. Spermatocyte chromosomes in 

some species of the family Aplysiidae (Gastropoda, Opisthobranchia). Caryologia 35:327-333. 

Vonnemann, Verena, Michael Schrödl, Annette Klussmann-Kolb, and Heike Wägele. 2005. Reconstruction of 

the phylogeny of the Opisthobranchia (Mollusca: Gastropoda) by means of 18S and 28S rRNA gene 

sequences. Journal of Molluscan Studies 71:113-125. 

Voogt, P. A., and J. W. A. Van Rheenen. 1973. Sterols and sterol biosynthesis in the slug Aplysia depilans. 

Experientia 29:1070-1071. 

Wägele, Heike. 1989a. Diet of some Antarctic nudibranchs (Gastropoda, Opisthobranchia, Nudibranchia). 

Marine Biology 100:439-441. 

Wägele, Heike. 1989b. Die Gattung Bathydoris Bergh 1884, (Gnathodoridacea) im phylogeneschen System 

der Nudibranchia (Opisthobranchia, Gastropoda). Zeitschrift für zoologische Systematik und Evolutions- 

Forschung 27:273-281. 

Wägele, Heike, Manuel Ballesteros, and Conxita Avila. 2006. Defensive glandular structures in opisthobranch 

molluscs — from histology to ecology. Oceanography and Marine Biology Annual Review 44:197-276. 

Wägele, Heike, and Geir Johnsen. 2001. Observations on the histology and photosynthetic performance of 

“solar-powered” opisthobranchs (Mollusca, Gastropoda, Opisthobranchia) containing symbiotic chloroplasts 

or zooxanthellae. Organisms, Diversity and Evolution 1:193-210. 

Wägele, Heike, and G. Stanjek. 1996. Spermatocyte chromosomes of six species of opisthobranchs (Mollusca, 

Gastropoda). Ophelia 45:191-198. 

Wägele, Heike, Verena Vonnemann, and Wolfgang Wägele. 2003. Toward a Phylogeny of the 

Opisthobranchia. Pages 185-288 in Molecular Systematics and Phylogeography of Molluscs. Smithsonian 

Institution, Washington. 

Wahidullah, Solimabi, Yue-Wei Guo, Issa Fakhr, and Ernesto Mollo. 2006. Chemical diversity in opisthobranch 

molluscs from scarcely investigated Indo-Pacific areas. Pages 175-198 in Guido Cimino and 

Margherita Gavagnin, eds., Molluscs: From Chemo-ecological Study to Biotechnological Application. In 

W. E. G. Müller, ed., Progress in Molecular and Subcellular Biology: Marine Molecular Biotechnology, 

Volume 43. Springer, New York. 

Walker, Roger P., and D. John Faulkner. 1981. Chlorinated acetylenes from the nudibranch Diaulula 

sandiegensis. Journal of Organic Chemistry 46:1475-1478. 

Warmke, Germaine L., and Luis R. Almodóvar. 1972. Observations on the life cycle and regeneration in 

Oxynoe antillarum Mörch, an ascoglossan opisthobranch from the Caribbean. Bulletin of Marine Science 

22:67-74. 

Wessels, Matthias, Gabriele M. König, and Anthony D. Wright. 2000. New natural product isolation and comparison 

of secondary metabolite content of three distinct samples of the sea hare Aplysia dactylomela from 

Tenerife. Journal of Natural Products 63:920-928. 

Wesson, Keena J., and Mark T. Hamann. 1996. Keenamide A, a bioactive cyclic peptide from the marine mol-


lusk Pleurobranchus forskalii. Journal of Natural Products 59:629-631. 

Willan, Richard C. 1982. New Zealand side-gilled slugs (Opisthobranchia: Notaspidea: Pleurobranchidae). 


Willan, Richard C. 1984. A review of the diets in the Notaspidea (Mollusca: Opisthobranchia). Journal of the 

Malacological Society of Australia 6:125-142. 

Willan, Richard C. 1987. Phylogenetic systematics of the Notaspidea (Opisthobranchia) with reappraisal of 

families and genera. American Malacological Bulletin 5:215-241. 

Williams, David E., and Raymond J. Andersen. 1987. Terpenoid metabolites from skin extracts of the dendronotid 

nudibranch Tochuina tetraquetra. Canadian Journal of Chemistry 65:2244-2247. 

Williams, David E., Stephen W. Ayer, and Raymond J. Andersen. 1986. Diaulusterols A and B from the skin 

extracts of the dorid nudibranch Diaulula sandiegensis. Canadian Journal of Chemistry 64:1527-1529. 

Wilson, Nerida G. 2002. Egg masses of chromodorid nudibranchs (Mollusca: Gastropoda: Opisthobranchia). 


Wilson, Nerida G., and Michael S. Y. Lee. 2005. Molecular phylogeny of Chromodoris (Mollusca, 

Nudibranchia) and the identification of a planar spawning clade. Molecular Phylogenetics and Evolution 

36:722-727. 

Winkler, Lindsay R. 1961. Preliminary tests of the toxin extracted from California sea hares of the genus 

Aplysia. Pacific Science 15:211-214. 

Winkler, Lindsay R., and B. E. Tilton. 1962. Predation on the California sea hare, Aplysia californica Cooper, 

by the solitary great green sea anemone, Anthopleura xanthogrammica (Brandt), and the effect of sea hare 

toxin and acetylcholine on anemone muscle. Pacific Science 16:286-290. 

Wolinsky, L. E., and D. Faulkner John. 1976. A biomimetic approach to the synthesis of Laurencia metabolites. 

Synthesis of 10-bromo-[alpha]-camigrene. Journal of Organic Chemistry 41:597-600. 

Woollacott, Robert M. 1981. Association of bacteria with bryozoan larvae. Marine Biology 65:155-158. 

Wratten, Stephen J., William Fenical, D. John Faulkner, and J. C. Wekell. 1977. Ptilosarcone, the toxin from 

the sea pen Ptilosarcus gurneyi. Tetrahedron Letters 18:1559-1562. 

Wright, Anthony D. 2003. GC-MS and NMR analysis of Phyllidiella pustulosa and one of its dietary sources, 

the sponge Phakellia carduus. Comparative Biochemistry and Physiology, ser. A, 134:307-313. 

Wulff, Janet L. 2006. Sponge systematics by starfish: predators distinguish cryptic sympatric species of 

Caribbean fire sponges Tedania ignis and Tedania klausi n.sp. (Demospongiae, Poecilosclerida). 

Biological Bulletin 211:83-94. 

Yamada, Kiyoyuki, and H. Kigoshi. 1997. Bioactive compounds from the sea hares of two genera: Aplysia 

and Dolabella. Bulletin of the Chemical Society of Japan 70:1479-1489. 

Yamada, Kiyoyuki, Makoto Ojiki, Takeshi Ishigaki, and Yoshifumi Yoshida. 1993. Aplyronine A, a potent 

antitumor substance, and the congeners aplyronines B and C isolated from the sea hare Aplysia kurodai. 


Yamamura, Shosuku, and Yoshimasa Hirata. 1963. Structures of aplysin and aplysinol, naturally occurring 

bromo-compounds. Tetrahedron 19:1485-1496. 

Yamamura, Shosuku, and Yoshimasa Hirata. 1971. A naturally-occurring bromo-compound, aplysin-20 from 

Aplysia kurodai. Bulletin of the Chemical Society of Japan 25:2171-2172. 

Yamamura, Shosuku, and Yukimasa Terada. 1977. Isoaplysin-20, a natural bromine-containing diterpene from 

Aplysia kurodai. Tetrahedron Letters 18:2171-2172. 

Yamazaki, Masatoshi, S. Tansho, Jun Kisugi, Koji Muramoto, and Hisao Kamiya. 1989. Purification and characterization 

of a cytolytic protein from purple fluid of the sea hare, Dollabella auricularia. Chemical and 

Pharmaceutical Bulletin 37:2179-2182. 

Yasman, Ru Angelie Edrada, Victor Wray, and Peter Proksch. 2003. New 9-thiocyanatopupukeanane 

sesquiterpenes from the nudibranch Phyllidia varicosa and its sponge prey Axinyssa aculeata. Journal of 


Yoshida, Wesley Y., Bryan, Patrick J., Baker, Bill J., and McClintock, James B., 1995. Pteroenone: a defensive 

metabolite of the abducted Antarctic pteropod Clione antarctica. Journal of Organic Chemistry 

60:780-782. 

Young, Craig M., Greenwood, Paul G., and Powell, Cynthia J., 1986. The ecological role of defensive secre-



tions in the intertidal pulmonate Onchidella borealis. Biological Bulletin 171:391-404. 

Zhang, Wen, Gavagnin, Margherita, Guo, Yu-Wei, Mollo, Ernesto, Ghiselin, Michael T., and Cimino, Guido, 

2007. Terpenoid metabolites of the nudibranch Hexabranchus sanguineus from the South China Sea. 


Zubia, Eva, Gavagnin, Margherita, Crispino, Antonio, Martínez, Eva, Ortea, Jesus, and Cimino, Guido, 1993. 

Diastereoisomeric ichthyotoxic acylglycerols from the dorsum of two geographically distinct populations 

of Archidoris nudibranchs. Experientia 49:268-271. 

Zuidema, Daniel R., and Jones, Paul B., 2005. Photochemical relationships in sacoglossan polypropionates. 


Zuidema, Daniel R., and Jones, Paul B., 2006. Triplet photosensitization in cyercene A and related pyrones. 

Journal of Photochemistry and Photobiology, B, 83:137-145. 

Copyright © 2009 by the California Academy of Sciences 

San Francisco, California, U.S.A.


APPENDIX I 

An Atlas of Metabolite Structure 

For list of organisms as sources of the metabolies 

and literature references see 

Appendix II


Series 4, Volume 60, No. 10

CIMINO & GHISELIN: CHEMICAL DEFENSE AND EVOLUTION OF GASTROPODS 359



















173 2-(2',4'-dibromophenoxy)- 

4,6-dibromoanisole
































































Compound Source Reference 

Polyacetates 

Fatty acids 

1 Stylocheilus longicauda Rose et al., 1978 

2 Haminaea templadoi Carballeira et al., 1992 

Polyacetylenes 

3-11 Diaulula sandiegensis Walker and Faulkner, 1981 

12 Discodoris atromaculata Castiello et al., 1980 

13 Discodoris atromaculata Guo et al., 1994 

Prostaglandin lactones 

14 Tritonia sp. Baker and Scheuer, 1994 

15-24 Tethys fimbria Cimino et al., 1989, 1991 

Di Marzo et al., 1991 

Cyclic acetogenins 

25 Aplysia dactylomela McDonald et al., 1975 

26-27 Aplysia brasiliana Kinnel et al., 1979 

28 Aplysia parvula McPhail and Davies-Coleman, 2005 

29-34 Aplysia dactylomela Manzo et al., 2005 

35 Aplysia oculifera de Silva et al., 1983 

36-37 Aplysia oculifera Schulte et al., 1981 

38 Aplysia parvula Miyamoto et al., 1995 

39 Aplysia dactylomela Ciavatta et al., 1997 

40 Cadlina luteomarginata Burgoyne et al., 1993 

41-42 Dolabella auricularia Ojika et al., 1993 

Macrocyclic fatty acid lactones 

43 Aplysia kurodai Ojika et al., 1990 

44-48 Aplysia depilans Spinella et al., 1997 

49-50 Chromodoris lochi Corley et al., 1988 

51-54 Dolabella auricularia Ojika et al., 1995; 

Suenaga et al., 1997 

55-56 Dolabella auricularia Sone et al., 1996 

Polyethers 

Appendix II 

Index to metabolite structures shown in Appendix I arranged by compound reference number, 

metabolite and organism in which the metabolite has been found, and reference to the literature. 

57-58 Dolabella auricularia Suenaga et al., 1998 

59-60 Stylocheilus longicauda Kato and Scheuer, 1974, 1975 

61 Dolabella auricularia Pettit et al., 2004




62 Pinna muricata Chou et al., 1996 

63-64 Aplysia dactylomela Manzo et al., 2007 

Aromatic Polyketides 

65-67 Navanax inermis Sleeper and Fenical, 1977 

68 Navanax inermis Sleeper et al., 1980 

69 Philinopsis speciosa Coval and Scheuer, 1985 

70 Bulla gouldiana Spinella et al., 1993 

71-72 Scaphander lignarius Cimino et al., 1989 

73-78 Scaphander lignarius Della Sala et al., 2007 

79-80 Haminoea (H. navicula, Cimino et al., 1991; Marin et al., 1999 

H. fusari, H. orteai, 

H. orbignyana) 

81 Haminoea callidegenita Spinella et al., 1998 

82 Smaragdinella calyculata Szabo et al., 1996 

Polypropionates 

83 Clione antarctica Yoshida et al., 1995 

84 Siphonaria maura Manker and Faulkner, 1989 

85 Pleurobranchus membranaceus Ciavatta et al., 1993 

86-87 Cyerce nigricans Roussis et al., 1990 

88-94 Cyerce cristallina Di Marzo et al., 1991 

Vardaro et al., 1991 

95-97 Ercolania funerea Vardaro et al., 1992 

98-99 Ercolania funerea Vardaro et al., 1992 

100-103 Placida dendritica Vardaro et al., 1992 

104-107 Placida dendritica Cutignano et al., 2003 

108-111 Aplysiopsis formosa Ciavatta et al., 2009 

112-113 Philinopsis speciosa Coval et al., 1985 

114-116 Philinopsis depicta Cimino et al., 1985, 1987 

117 Navanax inermis and Spinella et al., 1993 

Bulla gouldiana 

118 Smaragdinella calyculata Szabo et al., 1996 

119 Dolabrifera dolabrifera Ciavatta et al., 1996 

120 Dolabella auricularia Suenaga et al., 1996 

122 Elysia timida Gavagnin et al., 1994 

123 Elysia timida Gavagnin et al., 1994 

124 Elysia crispata Gavagnin et al., 1996, 1997 

125-126 Elysia diomedea Ireland et al., 1978 

Elysia diomedea Ireland and Faulkner, 1981 

Placobranchus ocellatus Ireland et al., 1979 

127-128 Elysia diomedea Kay et al., 1984 

129-130 Elysia chlorotica Dawe and Wright, 1986 

131 Placobranchus ocellatus Ireland et al., 1979



Elysia timida Gavagnin et al., 1994 

132-133 Elysia crispata Ireland and Faulkner, 1981 

134-141 Elysia crispata Ksebati et al., 1985 

141-143 Placobranchus ocellatus Manzo et al., 2005 

144-145 Elysia diomedea Cueto et al., 2005 

146-150 Placobranchus ocellatus Fu et al., 2000 

151 Onchidium verruculatum Ireland et al., 1984 

152-153 Micromelo undata Napolitano et al., 2008 

154-157 Haminoea fusari Cutignano et al., 2007 

158 Peronia peronii Biskupak and Ireland, 1985 

159 Siphonaria serrata Brecknell et al., 2000 

160 Siphonaria zelandica Hochlowski et al., 1984 

Siphonaria denticulata 

161 Siphonaria grisea Norte et al., 1988 

Phenols and Quinines 

162 Tylodina perversa Cimino et al., 1984 

163 Cratena peregrina Ciavatta et al., 1996 

164 Dendrodoris grandiflora Cimino et al., 1985 

165 Doris verrucosa Avila et al., 1990 

166-168 Aplysia kurodai Kigoshi et al., 1990 

169 Mourgona germaineae Jensen., 1984 

170 Costasiella ocellifera Hay et al., 1990 

171-172 Aplysia dactylomela Gerwick and Whatley, 1989 

173 Aplysia dactylomela Kuniyoshi et al., 1985 

174-176 Asteronotus cespitosus Fahey and Garson, 2002 

177 Sagaminopteron nigropunctatum Becerro et al., 2006 

Sagaminopteron psychedelicum 

178-184 Leminda millecra McPhail et al., 2001 

185 Aplysia dactylomela Gerwick and Whatley, 1989 

Monoterpenoids 

186-187 Melibe leonina Ayer and Andersen, 1983 

188-189 Aplysia californica Faulkner et al., 1973 

190-191 Aplysia parvula Ginsbury and Paul, 2001 

192-193 Aplysia kurodai Miyamoto et al., 1988 

194-199 Aplysia punctata Ortega et al., 1997 

200-201 unidentifield sea hare Lin et al., 2001 

202 Aplysia parvula Grkovic et al., 2005 

203 Aplysia kurodai Katayama et al., 1982 

Sesquiterpenoids 

204 Haminoea cymbalum Poiner et al., 1989




205 Haminoea cyanomarginata Mollo et al., 2008 

206-208 Oxynoe olivacea Cimino et al., 1990; Gavagnin et al., 1994 

Lobiger serradifalci 

Ascobulla sp. 

Lobiger souverbiei Gavagnin et al., 2000 

Oxynoe antillarium 

209-210 Ascobulla ulla Gavagnin et al., 2000 

211-212 Volvatella sp. Fontana et al., 1999 

213-214 Elysia expansa Ciavatta et al., 2006 

215-216 Elysia crispata Gavagnin et al., 1997 

217 Onchidella binneyi Ireland and Faulkner, 1978 

218-219 Tochuina tetraquetra Williams and Andersen, 1987 

220-223 Leminda millecra Pika and Faulkner, 1994 

224 Aplysia dactylomela Schmitz and McDonald, 1974 

225 Aplysia brasiliana Stallard et al., 1978 

226 Dolabella ecaudata Pettit et al., 1980 

227-228 Acanthodoris nanaimoensis Ayer et al., 1984 

229 Acanthodoris brunnea Faulkner et al., 1990 

230-231 Asteronotus cespitosus Fahey and Garson, 2002 

232-234 Dermatobranchus otome Ishibashi et. al., 2006 

235 Dendrodoris tuberculosa Okuda et al., 1983 

Dendrodoris krebsii 

Dendrodoris nigra 

236-237 Dendrodoris limbata Cimino et al., 1982, 1985 

Dendrodoris grandiflora 

238 Dendrodoris grandiflora Cimino et al., 1985 

239 Dendrodoris limbata Avila et al., 1991 

Dendrodoris grandiflora 

240 Dendrodoris denisoni Grkovic et al., 2005 

241 Dendrodoris arborescens Fontana et al., 1999 

242 Dendrodoris albopunctata Okuda et al., 1983 

243 Bathydoris hodgsoni Iken et al., 1998 

244 Cadlina luteomarginata Dumdei et al., 1997 

245-246 Cadlina luteomarginata Hellou et al., 1981 

Gustafson et al., 1985 

247 Chromodoris molluscs Schulte et al., 1982 

248-249 Austrodoris kerguelenensis Gavagnin et al., 2003 

250-251 Leminda millecra McPhail et al., 2001 

252-265 Dendrodoris carbunculosa Sakio et al., 2001 

Halogenated sesquiterpenoids 

266 Aplysia angasi Pettit et al., 1977 

267-272 Aplysia dactylomela McPhail et al., 1999 

273 Aplysia kurodai Yamamura and Hirata, 1963



274 Aplysia dactylomela Ichiba and Higa, 1986 

275-276 Aplysia dactylomela Baker et al., 1988 

277-278 Aplysia dactylomela Kaiser et al., 1998 

279 Aplysia dactylomela Schmitz et al., 1980 

280-281 Aplysia brasiliana Dieter et al., 1979 

282 Aplysia parvula Grkovic et. al., 2005 

Isocyanosesquiterpenoids 

283-284 Phyllidia varicosa Burreson et al., 1975 

Hagadone et al., 1979 

285-289 Phyllidia pustulosa Fusetani et al., 1991 

290-294 Phyllidia varicosa Kassühlke et al., 1991 

Phyllidia pustulosa 

295-298 Phyllidia ocellata Fusetani et al., 1992 

299-302 P hyllidia ocellata Okino et al., 1996 

Phyllidia varicosa 

Phyllidia pustulosa 

Phillidiopsis krempfi 

303-305 Phyllidiella pustulosa Manzo et al., 2004 

306 Phyllidia pustulosa Hirota et al., 1998 

307-312 Cadlina luteomarginata Burgoyne et al., 1993 

313-314 Phyllidia varicosa Yasman et al., 2003 

315-316 Hexabranchus sanguineus Zhang et al., 2007 

Furanosesquiterpenoids 

317-318 Doriopsilla pelseneeri Gaspar et al., 2005 

319 Tritonia hamnerorum Cronin et al., 1995 

320-325 Chromodoris epicuria Ksebati and Schmitz, 1988 

Ceratosoma brevicaudatum 

326 Tyrinna nobilis Fontana et al., 1998 

327-330 Hypselodoris villafranca Fontana et al., 1993 

Hypselodoris cantabrica 

Hypselodoris tricolor 

331-332 Hypselodoris tricolor Fontana et al., 1994 

333-337 Hypselodoris picta Fontana et al., 1994 

338 Hypselodoris capensis McPhail et al., 1998 

339-342 Doriopsilla areolata Spinella et al., 1994 

343-344 Cadlina luteomarginata Thompson et al., 1982 

345-346 Cadlina laevis Fontana et al., 1995 

347-349 Cadlina pellucida Fontana et al., 1995 

350 Dendrodoris krebsii Gavagnin et al., 2001 

Doriopsilla albopunctata 

Doriopsilla areolata




Diterpenoids 

351-352 Pleurobranchaea meckelii Ciavatta et al., 1995 

353 Trimusculus reticulatus Manker and Faulkner, 1987 

354-357 Tochuina tetraquetra Williams and Andersen, 1987 

358 Tochuina tetraquetra Wratten et al., 1977 

359-361 Armina maculata Guerriero et al. 1987 

362 Phyllodesmium guamensis Slattery et al., 1998 

363 Phyllodesmium longicirra Coll et al., 1985 

364 Aplysia kurodai Yamamura and Hirata, 1971 


366-367 Aplysia dactyomela Schmitz et al., 1979 

368 Aplysia dactyomela Gonzalez et al., 1987 

369 Dolabella and Aplysia Estrada et al., 1989 

370 Aplysia depilans Minale and Riccio, 1976 

371 Aplysia vaccaria Midland et al., 1983 

372 Aplysia juliana Atta-ur Rahman et al., 1991 

373 Dolabella californica Ireland et al., 1976 

Ireland and Faulkner, 1977 

374 Dolabella auricularia Pettit et al., 1976 

375 Elysia translucens Gavagnin et al., 1994 

376-377 Bosellia mimetica Gavagnin et al., 1994 

378-380 Thuridilla hopei Gavagnin et al., 1993 

381 Pseudochlorodesmis furcellata Paul et al., 1988 

382 Elysia halimedae Paul and Van Alstyne, 1988 

383 Cyerce nigricans Roussis et al., 1990 

384 Chromodoris norrisi Hochlowski et al., 1983 

385 Chromodoris sedna Hochlowski et al., 1983 

386-389 Cadlina luteomarginata Tischler et al., 1989 

Tischler and Andersen, 1991 

390-393 Cadlina luteomarginata Dumdei et al., 1997 

394-395 Chromodoris cavae Dumdei et al., 1989 

Morris et al., 1991 

396-405 Chromodoris gleniei de Silva et al., 1991 

Chromodoris geminus 

Chromodoris annulata 

Chromodoris inopinata 

406 Chromodoris ghiselini Hochlowski et al., 1982 

407-416 Chromodoris obsoleta Miyamoto et al., 1996 

417 Chromodoris macfarlandi Molinski et al., 1986 

418-422 Chromodoris luteorosa Cimino et al., 1990 

Gavagnin et al., 1992 

423-428 Chromodoris hamiltoni Pika and Faulkner, 1995 

McPhail et al., 1997 

429-437 Glossodoris atromarginata Fontana et al., 1997



438-439 Glossodoris atromarginata Somerville et al., 2006 

440-448 Chromodoris epicuria Ksebati et al., 1988 

449 Tyrinna nobilis Fontana et al., 1998 

450-453 Syphonota geographica Carbone et al., 2008 

454-457 Phyllidia pustulosa Manzo et al., 2004 

458 unidentified nudibranch Van Wyk et al., 2007 

459 Hexabranchus sanguineus Zhang et al., 2007 

460-463 Trimusculus peruvianus Diaz-Marrero et al., 2003 

464 Trimusculus reticulatus Manker and Faulkner, 1987 

Sesterterpenoids 

Degraded furanosesterterpenoids 

464-466 Cadlina pellucida Fontana et al., 1995 

467-470 Dendrodoris grandiflora Cimino et al., 1985 

Furanosesterterpenoids 

471-473 Discodoris indecora Marin et al., 1997 

474 Cadlina luteomarginata Thompson et al., 1982 

475-476 Hypselodoris capensis McPhail et al., 1998 

Cyclic sesterterpenoids 

477-478 Chromodoris funerea Kernan et al., 1988 

479 Cadlina luteomarginata Dumdei et al., 1997 

480 Cadlina molluscs Hellou et al., 1981, 1982 

481 Cadlina pellucida Fontana et al., 1995 

482-484 Chromodoris funerea Kernan et al., 1988 

485 Chromodoris inornata Miyamoto et al., 1992 

486 Glossodoris pallida Avila and Paul, 1977 

487-488 Glossodori cincta Rogers and Paul, 1991 

Glossodoris hikeurensis 

Glossodoris pallida 

489-490 Hypselodoris orsini Cimino et al., 1993 

Glossodoris rufomarginata Gavagnin et al., 2004 

491-498 Glossodoris spp. Manzo et al., 2007 

499-500 Chromodoris inornata Miyamoto et al., 1992 

501 Glossodoris sedna Hochlowski et al., 1983 

502 Chromodoris hamiltoni Pika and Faulkner, 1995 

McPhail et al., 1997 

503-508 Glossodoris dalli Fontana et al., 2000 

Glossodoris sedna 

509-512 Glossodoris sedna Hochlowski et al., 1983 

Triterpenoids 

513-514 Hexabranchus sanguineus Guo et al., 1998




515-516 Pleurobranchus testudinarius Spinella et al., 1997 

517 Lottia limatula Albizati et al., 1985 

518 Adalaria loveni Graziani et al., 1995 

Glyceride Esters 

Fatty acid esters 

519-521 Umbraculum umbraculum Cimino et al., 1988 

522 Tritoniella belli McClintock et al., 1994 

Sesquiterpenoid esters 

523-526 Doris odhneri 

Doris montereyensis Andersen et al., 1980 

Gustafson et al., 1985 

527-528 Doris tanya Krug et al., 1995 

Diterpenoid esters 

529-530 Doris verrucosa Cimino et al., 1988 

Gavagnin et al., 1997 

531 Archidoris pseudoargus Soriente et al., 1993 

532 Archidoris tuberculata Cimino et al., 1993 

533-534 Anisodoris fontaini Zubia et al., 1993 

Doris verrucosa Gavagnin et al., 1997 

535-537 Doris odhneri Andersen et al., 1980 

Doris montereyensis Gustafson et al., 1985 

538-546 Doris verrucosa Gavagnin et al., 1997 

547-551 Anisodoris fontaini Gavagnin et al., 1999 

552-557 Austrodoris kerguelensis Davies-Coleman et al., 1991 

558 Austrodoris kerguelensis Gavagnin et al., 1995 

559-560 Austrodoris kerguelensis Gavagnin et al., 2003 

Steroids 

561-562 Aplysia kurodai Miyamoto et al., 1986 

563-564 Aplysia fasciata Spinella et al., 1992 

565 Aplysia fasciata Ortega et al., 1997 

566-567 Syphonota geographica Gavagnin et al., 2005 

568 Adalaria sp. Stonard et al., 1980; 

569 Peltodoris atromaculata Castiello et al.,1978 

570 Hervia peregrina, Cimino et al., 1980 

Flabellina affinis, 

Coryphella lineata, 

Eudendrium ramosum 

571-573 Aldisa sanguinea Ayer et al., 1982 

574 Aldisa smaragdina Gavagnin et al., 2002 

575-576 Trimusculus peruvianus Diaz-Marrero et al., 2003



577-578 Diaulula sandiegensis Williams et al., 1986 

Nitrogenous compounds 

579-580 Tylodina perversa Teeyapant et al., 1993 

581 Triopha catalinae and Gustafson and Andersen, 1982, 1985 

Polycera tricolor 

582 Limacia clavigera Graziani and Andersen, 1998 

583-586 Tambjia abdere and Carté and Faulkner, 1983, 1986 

Tambjia. eliora 

587-588 Nembrotha cristata Lindquist and Fenical, 1991 

Nembrotha kubaryana 

589 Nembrotha spp. Paul et al., 1990 

590-592 Aegires (=Notodoris) gardineri Alvi et al., 1991 

593-594 Bursatella leachii Suntornchashwej et al., 2005 

595 Aegires (=Notodoris) gardineri Carroll et al., 1993 

596-598 Aegires (=Notodoris) gardineri Alvi et al., 1993 


600 Janolus cristatus Sodano and Spinella, 1986 

601-602 Aplysia dactylomela Grkovic et al., 2005 

603 Phestilla melanobrachia Okuda et al., 1982 

604-605 Stylocheilus longicauda Todd and Gerwick, 1995 

Rose et al., 1978 


607 Stylocheilus longicauda Paul and Pennings, 1991 

608 Lobiger souverbie Gavagnin et al., 2000 

Oxynoe antillarium 

609 Doris verrucosa Cimino et al., 1986 

610-611 Stylocheilus longicauda Paul and Pennings, 1991 

612 Armina babai Ishibashi et al., 2006 

613 Doris verrucosa Cimino et al., 1986 

614 Diaulula sandiegensis Fuhrman et al., 1981 

615 Peltodoris nobilis Kim et al., 1981 

616 Jorunna funebris de Silva et al., 1988 

617 Chromodoris elisabethina Okuda and Scheuer, 1985 

618 Glossodoris quadricolor Mebs et al., 1985 

619 Bursatella leachii leachii Cimino et al., 1987 

Bursatella leachii savignyana 


621-625 Halgerda aurantiomaculata Fahey et al., 2007 

626-628 Pleurobranchus forskalii Fu et al., 2004 

Pleurobranchus albiguttatus 

629 Jorunna funebris Fontana et al., 2000 

630 Jorunna funebris Charupant et al., 2007 

631-632 Asteronotus cespitosus Fahey and Garson, 2002




Peptides 

633 Philinopsis speciosa Reese et al., 1996 

634 Philinopsis speciosa Nakao et al., 1996 


636-637 Lyngbya majuscula Moore and Entzeroth, 1988 

638 Pleurobranchus forskalii Wesson and Hamann., 1996 

639-640 Dolabella auricularia Pettit et al., 1993 

641 Dolabella auricularia Suenaga et al., 1996 

642-643 Stylocheilus longicauda Pennings et al., 1996 

644-645 Dolabella auricularia Sone et al., 1996 


647-654 Elysia rufescens Hamann et al., 1993 

Goetz et al., 1997 

655-656 Elysia grandifolia Ashour et al., 2006 

657 Elysia ornata Horgen et al., 2000 

658-659 Elysia grandifolia Tilvi and Naik, 2007 


661 Philinopsis speciosa Kimura et al., 2002 

Macrolides 


663-665 Aplysia kurodai Yamada et al., 1993 

666-667 Hexabranchus sanguineus Roesener et al., 1986 

668-674 Hexabranchus sanguineus Kernan and Faulkner, 1988 

Matsunaga et al., 1989 

675 Onchidium sp. Rodriguez et al., 1994 

Copyright © 2009 by the California Academy of Sciences 

San Francisco, California, U.S.A.

Cimino&Ghiselin-tmpZXYZ:Template Proceedings_1.qxd.qxd

Create successful ePaper yourself

Delete template?

Save as template?