Abstract
Free full text
Redefining species limits in the Fusarium fujikuroi species complex
Abstract
The Fusarium fujikuroi species complex (FFSC) includes more than 60 phylogenetic species (phylospecies) with both phytopathological and clinical importance. Because of their economical relevance, a stable taxonomy and nomenclature is crucial for species in the FFSC. To attain this goal, we examined type specimens and representative cultures of several species by employing morphology and phylogenetic analyses based on partial gene fragments of the translation elongation factor 1-alpha (tef1), beta-tubulin (tub2), calmodulin (cmdA), RNA polymerase largest subunit (rpb1) and RNA polymerase II second largest subunit (rpb2). Based on these results three new species were delimited in the FFSC. Two of these phylospecies clustered within the African clade, and one in the American clade. Epitypes were also designated for six previously described FFSC species including F. proliferatum and F. verticillioides, and a neotype designated for F. subglutinans. Furthermore, both F. acutatum and F. ophioides, which were previously invalidly published, are validated.
Citation: Yilmaz N, Sandoval-Denis M, Lombard L, et al. 2021. Redefining species limits in the Fusarium fujikuroi species complex. Persoonia 46: 129–162. https://doi.org/10.3767/persoonia.2021.46.05.
INTRODUCTION
The genus Fusarium is considered one of the most important plant pathogenic genera globally and includes more than 330 species. Fusarium graminearum s.lat. and F. oxysporum s.lat. are regarded as two of the most important fungal pathogens in plant pathology based on a survey done within the international phytopathological community (Dean et al. 2012). Fusarium species cause diseases that universally influence both the agricultural and forestry sectors. In addition, some species produce regulated mycotoxins which are responsible for further devastating losses to agricultural crops worldwide and threaten global food security (Wu 2007). Recently, Fusarium species have also become more prevalent in the clinical setting causing various diseases and infections in humans and animals for which limited clinical treatments are available (Jain et al. 2011).
The Fusarium fujikuroi species complex (FFSC) is one of the larger and best studied species complexes within the genus displaying various ecologies (Sandoval-Denis et al. 2018a, b, Al-Hatmi et al. 2019). The FFSC was first established by Wollenweber et al. (1925) as section Liseola for species that produce sporodochial conidia (macroconidia), microconidia in chains and/or false heads, and do not produce chlamydospores. However, in subsequent years several species were described, namely F. dlamini (Marasas et al. 1985), F. nygamai (Burgess & Trimboli 1986) and F. napiforme (Marasas et al. 1987) that conformed to the characteristics of section Liseola, but notably also produced chlamydospores. To accommodate these species, Kwasna et al. (1991) introduced the section Dlaminia. Subsequent molecular studies nonetheless showed that section Liseola was paraphyletic, with species in section Dlaminia resolving within Liseola (O’Donnell et al. 1998, 2000). This clearly exemplified the complications of using phenotypic characters to predict relatedness and evolutionary histories, where morphology often displayed discord with DNA sequence data. In light of these limitations, the term ‘species complex’ was introduced which essentially served as a way to name phylogenetic clades (O’Donnell & Cigelnik 1997, O’Donnell et al. 1998).
Throughout the years, Fusarium species in the FFSC have been extensively studied due to their ability to cause infections in plants, producing mycotoxins (e.g., beauvericin, fumonisins, moniliformin), and causing opportunistic human infections (Nirenberg & O’Donnell 1998, Munkvold 2017, Al-Hatmi et al. 2019). A biogeographic hypothesis was developed by O’Donnell et al. (1998) for FFSC, which clustered isolates into three relatively well-supported phylogenetic clades named the African, American and Asian clades. Subsequent studies split the African clade into two distinct and highly supported lineages (African Clade A & B; Herron et al. 2015, Sandoval-Denis et al. 2018b). The core African clade (African Clade A) included maize and coffee pathogens such as F. verticillioides and F. xylarioides, whereas the African Clade B included F. fredkrugeri and F. dlaminii (Geiser et al. 2005, O’Donnell et al. 2018, Sandoval-Denis et al. 2018b). The American clade included species like F. circinatum, the causal agent of pitch canker in pine trees, and F. temperatum, a maize pathogen producing several mycotoxins (Aoki et al. 2014, Fumero et al. 2015). The Asian clade included species such as F. mangiferae, a tree pathogen, and F. proliferatum known for its ability to cause significant levels of disease on a wide range of plant hosts (Britz et al. 2002, Leslie & Summerell 2006).
Presently there are more than 60 distinct phylogenetic species recognised in the FFSC. However, several phylogenetically distinct species within this complex have still not been officially named. A well-defined species with a Latin binomial will help end-users to more robustly identify Fusarium strains, better diagnose diseases, help to intimately understand their biology, and ultimately develop better management and quarantine strategies. The purpose of this study was to introduce Latin binomials for unnamed FFSC phylospecies based on a number of strains accessioned within the Westerdijk Fungal Biodiversity Institute (CBS), and the USDA Agricultural Research Service (NRRL) culture collections and correct seven species typifications which have been neglected in the past.
MATERIALS AND METHODS
Isolates
Isolates included in this study were obtained from diverse culture collections, namely the U.S. Agricultural Research Service culture collection (NRRL), the Westerdijk Fungal Biodiversity Institute (WI) collection (CBS), the working collections of FABI (CMW) of the Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, South Africa, Neriman Yilmaz (NY), University of Pretoria, South Africa, the Medical Research Center (MRC) Tygerberg, Cape Town, South Africa, and Mycothèque de l’Université catholique de Louvain (MUCL), Louvain-la-Neuve, Belgium (Table 1).
Table 1
Speciesa | Culture collectionb | GenBank accession numberc | Substrate | Country | Other collection numbers | References | ||||
---|---|---|---|---|---|---|---|---|---|---|
tef1 | tub2 | cmdA | rpb2 | rpb1 | ||||||
F. acutatum | CBS 401.97 | MW402124 | MW402322 | MW402458 | MW402813 | MW402652 | Cajanus cajan | India | BBA 63520; NRRL 25731 | This study |
CBS 402.97T | MW402125 | MW402323 | MW402459 | MW402768 | MW402653 | Environmental | India | BBA 69580; FRC O-1117; NRRL 13309 | This study | |
CBS 739.97 | AF160276 | MW402348 | AF158329 | MN193883 | MW402696 | Environmental | India | BBA 69553; DAOM 225121; FRC O-1116; IMI 375327; NRRL 13308 | Scauflaire et al. (2011), O’Donnell et al. (2000), Laraba et al. (2020) | |
CBS 113964 | MW401971 | MW402172 | – | – | – | Triticum aestivum, grains in silo | Egypt | This study | ||
CBS 131573 | MW402037 | MW402236 | MW402406 | MW402796 | MW402565 | Wheat | Iran | This study | ||
CBS 137545 | MN533987 | MN534062 | MN534147 | MN534228 | MW402587 | Human nail | Qatar | This study | ||
CBS 137634 | MW402061 | MW402260 | MW402415 | – | MW402588 | Human nail | Pakistan | This study | ||
CBS 138572 | MW402062 | MW402261 | – | – | – | Human nail | India | This study | ||
F. agapanthi | CBS 100193 | MW401959 | MW402160 | MW402363 | MW402727 | MW402491 | Agapanthus praecox | New Zealand | This study | |
NRRL 54463T | KU900630 | KU900635 | KU900611 | KU900625 | KU900620 | Agapanthus sp. | Australia | Edwards et al. (2016) | ||
NRRL 54464 | MN193856 | KU900637 | KU900613 | KU900627 | MW402718 | Agapanthus sp. | Australia | Edwards et al. (2016), Laraba et al. (2020), this study | ||
F. ananatum | CBS 118516T | LT996091 | MN534089 | MW402376 | LT996137 | MW402507 | Ananas comosus | South Africa | MRC 8165; FCC 2986; CMW 18685 | Sandoval-Denis et al. (2018a), this study |
CBS 118517 | MN533988 | MN534090 | MN534157 | MN534229 | MW402508 | Ananas comosus | South Africa | MRC 8166; FCC 2988; CMW 18686 | This study | |
CBS 118518 | MW401979 | MW402179 | MW402377 | MW402730 | – | Ananas comosus | South Africa | MRC 8167; FCC 2990; CMW 18687 | This study | |
CBS 118519 | MW401980 | MW402180 | MW402378 | MW402731 | – | Ananas comosus | South Africa | MRC 8168; FCC 2991; CMW 18688 | This study | |
CBS 184.29 | MW402105 | MW402303 | MW402445 | MW402809 | MW402629 | Ananas sativus | England | DAOM 225144; IMI 375350; NRRL 22945 | This study | |
CMW 28597 | MW402155 | MW402356 | MW402483 | MW402822 | – | Ananas comosus | South Africa | FCC 4251 | This study | |
CMW 28598 | MW402156 | MW402357 | MW402484 | – | MW402708 | Ananas comosus | South Africa | FCC 4252 | This study | |
CMW 28599 | MW402157 | MW402358 | MW402485 | MW402775 | – | Ananas comosus | South Africa | FCC 4253 | This study | |
F. andiyazi | CBS 119856 | MN533989 | MN534081 | MN534174 | MN534286 | MW402523 | Sorghum grain | Ethiopia | MRC 8046 | This study |
CBS 119857T | MN193854 | LT996113 | MN534175 | LT996138 | MW402524 | Sorghum bicolor soil debris | South Africa | FRC M-8413; MRC 6122 | Laraba et al. (2020), Sandoval-Denis et al. (2018a), this study | |
F. annulatum | CBS 115.97 | MW401973 | MW402173 | MW402373 | MW402785 | MW402503 | Dianthus caryophyllus | Italy | CECT 20569 | This study |
CBS 133.95 | MW402040 | MW402239 | MW402407 | MW402743 | MW402568 | Dianthus caryophyllus | Netherlands | PD 90/76 | This study | |
CBS 134.95 | MW402042 | MW402241 | – | MW402744 | MW402570 | Dianthus caryophyllus | Netherlands | PD 90/214 | This study | |
CBS 135.95 | MW402043 | MW402242 | MW402408 | MW402745 | MW402571 | Dianthus caryophyllus | Netherlands | PD 90/1262 a | This study | |
CBS 153.27 | MW402100 | MW402299 | – | – | MW402621 | Saccharum officinarum with pokkah boeng | Unknown | This study | ||
CBS 181.30 | MW402102 | MW402301 | MW402443 | – | MW402625 | Zea mays | USA | MUCL 1130 | This study | |
CBS 189.38 | MW402110 | MW402308 | – | – | MW402633 | Unknown | India | IMI 035108; MUCL 1129 | This study | |
CBS 217.76 | AF160280 | U34416 | AF158333 | HM068352 | – | Cattleya pseudobulb, hybrid | Germany | BBA 11341; BBA 63624; DAOM 225133; IMI 202873; IMI 375339; NRRL 22944 | O’Donnell & Cigelnik (1997), O’Donnell et al. (2000), Smith et al. (2011) | |
CBS 226.49 | MW402116 | MW402314 | MW402452 | – | MW402642 | Gossypium seed | Unknown | This study | ||
CBS 258.54T | MT010994 | MT011041 | MT010908 | MT010983 | MT010944 | Oryza sativa | New Caledonia | BBA 63629; IMI 202878; MUCL 8059; NRRL 13619 | Yang et al. 2020 | |
CBS 267.93 | MN534028 | MN534127 | MN534221 | MN534267 | – | Unknown | Indonesia | NRRL 22948 | This study | |
CBS 299.96 | MW402123 | MW402321 | MW402457 | MW402835 | MW402651 | Sunflower oil with garlic cloves | France | IAM 14683 | This study | |
CBS 531.96 | MW402137 | MW402337 | MW402469 | – | MW402684 | soil | Ivory Coast | IAM 14680; NRRL 26424 | This study | |
CBS 533.95 | MW402138 | MW402338 | MW402470 | MW402817 | – | Vanilla | Unknown | This study | ||
CBS 620.80 | MW402144 | MW402344 | – | MW402838 | MW402688 | Sitobion avenae | England | NRRL 25054 | This study | |
CBS 738.97 | MW402147 | MW402347 | – | – | – | Soil in Zea mays field | South Africa | BBA 69859; FRC M-1636; NRRL 13614 | This study | |
CBS 791.91 | MW402152 | MW402353 | MW402480 | MW402839 | MW402705 | Gladiolus | Netherlands | This study | ||
CBS 792.91 | MW402153 | MW402354 | MW402481 | MW402774 | MW402706 | Gladiolus | Netherlands | This study | ||
CBS 116324 | MW401975 | MW402175 | MW402374 | MW402824 | MW402504 | Man, eye, clinical sample | Spain | This study | ||
CBS 119836 | MW401988 | MW402188 | MW402383 | MW402732 | – | Unknown | Unknown | MRC 8550; KSU 4853 | This study | |
CBS 119837 | MW401989 | MW402189 | MW402384 | – | MW402517 | Corn stalk | California | FRC M-1153; MRC 2301 | This study | |
CBS 120996 | MW402000 | MW402200 | MW402391 | – | MW402532 | Corn stalk | California | MRC 8549 | This study | |
CBS 121447 | MW402001 | MW402201 | – | MW402828 | MW402533 | Declined grape vine | Syria | This study | ||
CBS 122158 | MW402004 | MW402204 | – | MW402829 | MW402536 | Pinus radiata/Hylurgops palliatus | Spain | This study | ||
CBS 125014 | MW402013 | MW402213 | MW402393 | – | MW402544 | Human | USA | IHEM 3828 | This study | |
CBS 125179 | MW402014 | MW402214 | MW402394 | – | – | Figs | Iran | Ep17 | This study | |
CBS 125180 | MW402015 | MW402215 | – | – | MW402547 | Figs | Iran | Ep4 | This study | |
CBS 125182 | MW402016 | MW402216 | MW402395 | – | – | Figs | Iran | This study | ||
CBS 125183 | MW402017 | MW402217 | MW402396 | – | MW402549 | Unknown | Iran | This study | ||
CBS 125713 | MW402018 | MW402218 | MW402397 | MW402737 | MW402550 | Unknown | Unknown | This study | ||
CBS 125714 | MW402019 | MW402219 | – | MW402830 | MW402551 | Unknown | Unknown | This study | ||
CBS 125716 | MW402020 | MW402220 | MW402398 | – | MW402552 | Unknown | Unknown | This study | ||
CBS 127316 | MW402021 | MW402221 | MW402399 | MW402738 | – | Unknown | Unknown | This study | ||
CBS 130179 | MW402023 | MW402223 | MW402400 | MW402739 | MW402553 | Human blood | USA | NRRL 43617; UTHSC 03-60 | This study | |
CBS 131191 | MW402026 | MW402225 | – | MW402831 | MW402555 | Unknown | Unknown | This study | ||
CBS 131192 | MW402027 | MW402226 | MW402401 | – | – | Unknown | Unknown | This study | ||
CBS 131256 | MW402028 | MW402227 | MW402402 | MW402741 | MW402556 | Unknown | Unknown | This study | ||
CBS 131259 | MW402029 | MW402228 | MW402403 | MW402742 | MW402557 | Unknown | Unknown | This study | ||
CBS 131574 | MW402038 | MW402237 | – | – | MW402566 | Wheat | Iran | dH 22560; Z36 | This study | |
CBS 131581 | MW402039 | MW402238 | – | MW402832 | MW402567 | Unknown | Unknown | This study | ||
CBS 135783 | MW402052 | MW402251 | MW402410 | – | MW402579 | Wheat | Iran | Z31; dH 23109 | This study | |
CBS 135791 | MW402054 | MW402253 | MW402411 | MW402746 | MW402581 | Unknown | Unknown | This study | ||
CBS 137537 | MW402060 | MW402259 | MW402414 | MW402749 | MW402586 | Human tissue | Pakistan | This study | ||
CBS 139334 | MW402065 | MW402264 | MW402417 | MW402750 | MW402592 | Human wound | Pakistan | This study | ||
CBS 139739 | MW402074 | MW402273 | MW402420 | MW402754 | MW402602 | Xylosandrus amputatas galleries in Cinnamonum camphora branch | USA | C 3445; BPI 893134 | This study | |
CBS 140150 | MW402077 | MW402276 | MW402421 | MW402755 | MW402605 | Unknown | Unknown | This study | ||
CBS 140908 | MN534027 | MN534126 | MN534220 | MN534266 | – | Rice, grain | Kazakhstan | MFG 58255 | This study | |
CBS 140914 | MW402078 | MW402277 | MW402422 | MW402805 | MW402606 | Wheat, grain | Russia | MFG 58489 | This study | |
CBS 140944 | MW402079 | MW402278 | MW402423 | MW402806 | – | Wheat, grain | Russia | MFG 58380 | This study | |
CBS 143085 | MW402084 | MW402283 | MW402428 | – | – | Seed of Asparagus | Netherlands | NFC 1342 | This study | |
CBS 143087 | MW402085 | MW402284 | MW402429 | MW402756 | MW402611 | Seed of Asparagus | Netherlands | NFC 1355 | This study | |
CBS 143256 | MW402086 | MW402285 | MW402430 | MW402757 | – | Unknown | Unknown | This study | ||
CBS 143592 | MW402088 | MW402287 | MW402431 | MW402758 | MW402613 | Stereum hirsutum | Iran | CPC 30839; TuPo1 | This study | |
CBS 143594 | MW402089 | MW402288 | – | – | – | Stereum hirsutum | Iran | CPC 30842; TuPo5 | This study | |
CBS 143599 | MW402090 | MW402289 | – | – | – | Smut | Iran | CPC 30851; MoSm7 | This study | |
CBS 143601 | MW402091 | MW402290 | MW402432 | MW402808 | – | Smut | Iran | CPC 30853; MoSm16-1 | This study | |
CBS 143602 | MW402092 | MW402291 | MW402433 | MW402759 | MW402614 | Smut | Iran | CPC 30854; MoSm16-2 | This study | |
CBS 143604 | MW402093 | MW402292 | MW402434 | MW402833 | – | Smut | Iran | CPC 30856; MoSm18-1 | This study | |
CBS 143605 | MW402094 | MW402293 | MW402435 | MW402760 | MW402615 | Smut | Iran | CPC 30857; MoSm18-2 | This study | |
NRRL 62905 | MN193865 | – | – | MN193893 | MW402722 | Zea mays kernel | USA | Laraba et al. (2020), this study | ||
F. anthophilum | CBS 108.92 | MW401965 | MW402166 | MW402368 | MW402783 | MW402498 | Hippeastrum leaf | Netherlands | NRRL 25062; PD 91/2109 | This study |
CBS 136.95 | MW402058 | MW402257 | – | MW402801 | MW402584 | Amaryllis | Netherlands | PD 91/2109-2 | This study | |
CBS 119858 | MN533990 | MN534091 | MN534158 | MN534232 | MW402525 | Environmental | USA | This study | ||
CBS 119859 | MN533991 | MN534092 | MN534164 | MN534233 | MW402526 | Cymbidium sp. leaf spot | New Zealand | This study | ||
CBS 222.76ET | MW402114 | MW402312 | MW402451 | MW402811 | MW402641 | Euphorbia pulcherrima stem | Germany | BBA 63270; IMI 196084; IMI 202880; NRRL 22943; NRRL 25216 | This study | |
CBS 737.97 | MN533992 | MN534093 | MN534160 | MN534234 | MW402695 | Hippeastrum sp. | Germany | NRRL 13602 | This study | |
NRRL 25214 | MN193857 | – | – | MN193885 | MW402710 | Hippeastrum sp. | Germany | Laraba et al. (2020) | ||
F. awaxy | CBS 119831 | MN534056 | MN534108 | MN534167 | MN534237 | MW402514 | Environmental | New Guinea | This study | |
CBS 119832 | MN534057 | MN534106 | MN534170 | MN534240 | MW402515 | Unknown | Unknown | MRC 8553; KSU 990 | This study | |
CBS 139380 | MN534058 | MN534107 | MN534172 | MN534238 | MW402597 | Corn stalk | USA | ATCC 201270; FGSC 7616 | This study | |
LGMF 1661 | MG838954 | MG839011 | MK766939 | – | – | Rotten stalks of Zea mays | Brazil | CMRP4003 | Crous et al. (2019b) | |
LGMF 1930T | MG839004 | MG839013 | MK766940 | MK766941 | – | Rotten stalks of Zea mays | Brazil | CMRP4013 | Crous et al. (2019b) | |
NRRL 13827 | MH582309 | – | – | MH582073 | – | Corn cob | South Africa | NRRL 13601; MRC115 | O’Donnell et al. (2018) | |
F. bactridioides | CBS 100057T | MN533993 | MN534112 | MN534173 | MN534235 | MW402490 | Cronartium conigenum on Pinus leiophylla | USA | BBA 4748; BBA 63602; DAOM 225115; IMI 375323; NRRL 22201 | This study |
NRRL 20476 | AF160290 | U34434 | AF158343 | – | – | Cronartium conigenum | USA | O’Donnell & Cigelnik (1997), O’Donnell et al. (2000), Sandoval-Denis et al. (2018a) | ||
F. begoniae | CBS 403.97 | MN193858 | U61543 | MW402460 | MN193886 | MW402654 | Begonia elatior hybrid | Germany | BBA 67781; DAOM 225116; IMI 375315; NRRL 25300 | Laraba et al. (2020), O’Donnell et al. (1998) |
CBS 452.97T | MN533994 | MN534101 | MN534163 | MN534243 | MW402675 | Begonia elatior hybrid | Germany | NRRL 25315; BBA 69131; IMI 376114 | This study | |
CBS 110282 | MW401968 | MW402169 | – | – | – | Begonia elatior hybrid | Netherlands | NRRL 31851; PD 2001/5404 | This study | |
CBS 110283 | MW401969 | MW402170 | MW402370 | MW402784 | MW402500 | Begonia elatior hybrid | Netherlands | NRRL 31848; PD 2001/514 | This study | |
F. brevicatenulatum | CBS 404.97T | MN533995 | MN534063 | – | MN534295 | MW402655 | Striga asiatica | Madagascar | NRRL 25446; BBA 69197; IMI 375329; DAOM 225122 | This study |
CBS 100196 | MN193859 | – | – | MN193887 | MW402492 | Striga asiatica | Madagascar | BBA 69198; NRRL 25447 | Laraba et al. (2020), this study | |
F. bulbicola | CBS 220.76T | KF466415 | KF466437 | MW402450 | MW402767 | – | Nerine bowdenii bulb | Netherlands | BBA 12293; BBA 63628; DAOM 225114; IMI 202877; IMI 375322; NRRL 13618 | Proctor et al. (2013), this study |
F. chinhoyiense | NRRL 25221T | MN534050 | MN534082 | MN534196 | MN534262 | MW402711 | Zea mays | Zimbabwe | BBA 69031 | This study |
NY 001B5 | MN534051 | MN534083 | MN534197 | MN534263 | MW402725 | Soil | South Africa | This study | ||
F. circinatum | CBS 405.97T | MN533997 | MN534097 | MN534199 | MN534252 | MW402656 | Pinus radiata | USA | BBA 69720; DAOM 225113; IMI 375321; MRC 7541; NRRL 25331 | This study |
CBS 100197 | MW401960 | MW402161 | MW402364 | – | MW402493 | Pinus taeda | Georgia | BBA 69721; NRRL 25332 | This study | |
CBS 117843 | MW401978 | MW402178 | – | MW402786 | MW402506 | Pinus radiata | Spain | This study | ||
CBS 119864 | MW401996 | MW402196 | MW402389 | MW402736 | MW402528 | Pinus patula | South Africa | MRC 7488; FGSC 9022 | This study | |
CBS 119865 | MW401997 | MW402197 | – | – | – | Pinus patula | South Africa | MRC 6213; FGSC 9023; KSU 10850 | This study | |
CBS 122161 | MW402005 | MW402205 | – | – | MW402537 | Pinus radiata/Brachyderes incanus | Spain | This study | ||
CBS 122162 | MW402006 | MW402206 | – | – | MW402538 | Pinus radiata/Hylurgops palliatus | Spain | This study | ||
CBS 122163 | MW402007 | MW402207 | – | – | MW402539 | Pinus radiata/Hylurgops palliatus | Spain | This study | ||
CBS 122164 | MW402008 | MW402208 | – | MW402790 | MW402540 | Pinus radiata/Hypothenemus eruditus | Spain | This study | ||
CBS 122165 | MW402009 | MW402209 | – | – | MW402541 | Pinus radiata/Hylastes attenuatus | Spain | MRC 6213; FGSC 9023 | This study | |
CBS 122448 | MW402010 | MW402210 | – | – | – | Pinus radiata/Hylurgops palliatus | Spain | This study | ||
CBS 138821 | MW402063 | MW402262 | – | – | MW402589 | Pinus sp. | USA | CMW 41611; CMWF1954 | This study | |
CBS 138822 | MN533996 | MN534096 | – | MN534251 | MW402590 | Unknown | Unknown | This study | ||
CBS 141668 | MW402081 | MW402280 | MW402425 | – | MW402608 | Unknown | Unknown | This study | ||
CBS 141670 | MW402082 | MW402281 | MW402426 | – | MW402609 | Unknown | Unknown | This study | ||
CBS 141671 | MW402083 | MW402282 | MW402427 | MW402807 | MW402610 | Unknown | Unknown | This study | ||
F. coicis | NRRL 66233T | KP083251 | LT996115 | LT996178 | KP083274 | – | Coix gasteenii | Australia | Laurence et al. (2016), Sandoval-Denis et al. (2018a) | |
F. concentricum | CBS 450.97T | AF160282 | MW402334 | MW402467 | JF741086 | MW402674 | Musa fruit | Costa Rica (bought at Berlin market) | BBA 64354; CBS 833.85; DAOM 225146; IMI 375352; NRRL 25181 | O’Donnell et al. (2000, 2012), this study |
CBS 453.97 | MN533998 | MN534123 | MN534216 | MN534264 | MW402676 | Musa sapientum | Guatemala | BBA 69857; NRRL 25668 | This study | |
CBS 102157 | MW401963 | MW402164 | MW402367 | MW402728 | MW402496 | Macaranga pruinosa stem, colonized by ants | Malaysia | This study | ||
F. denticulatum | CBS 406.97 | MN533999 | MN534067 | MN534185 | MN534273 | MW402657 | Ipomoea batatas | Cuba | NRRL 25189; BBA 65244 | This study |
CBS 407.97T | MN534000 | MN534068 | MN534186 | MN534274 | MW402658 | Ipomoea batatas | USA | NRRL 25311; BBA 67772; CC F89-22; IMI 376115 | This study | |
CBS 735.97 | AF160269 | U61550 | AF158322 | LT996143 | – | Ipomoea batatas | North Carolina | BBA 67769; DAOM 225112; IMI 375320; NRRL 25302 | O’Donnell et al. (1998, 2000), Sandoval-Denis et al. (2018a) | |
F. dlaminii | CBS 175.88 | MN534002 | MN534138 | MN534150 | MN534256 | MW402623 | Zea mays soil | South Africa | NRRL 13164; FRC M-1637; ATCC 58097; BBA 69859; IMI 375348; DAOM 225120 | This study |
CBS 481.94 | MN534003 | MN534139 | MN534151 | MN534257 | MW402679 | Unknown | Unknown | This study | ||
CBS 671.94 | MN534004 | MN534136 | MN534152 | MN534254 | MW402690 | Soil | South Africa | BBA 69046; MRC 3023 | This study | |
CBS 672.94 | MN534005 | MN534137 | MN534153 | MN534255 | MW402691 | Soil | South Africa | BBA 69047; MRC 3024 | This study | |
CBS 119860T | MW401995 | MW402195 | MW402388 | KU171701 | KU171681 | Plant debris in soil | South Africa | BBA 69859; FRC M-1637; MRC 3032; NRRL 13164 | Sandoval-Denis et al. (2018a), this study | |
CBS 119861 | MN534001 | MN534135 | MN534149 | MN534253 | MW402527 | Plant debris in soil | South Africa | BBA 69026; FRC M-1557; MRC 3023; NRRL 25442 | This study | |
F. ficicrescens | CBS 125177 | MN534006 | MN534071 | MN534176 | MN534281 | MW402545 | Environmental | Iran | This study | |
CBS 125178T | KU604452 | KP662896 | KU603958 | KT154002 | MW402546 | Environmental | Iran | Al-Hatmi et al. (2016b, 2019), this study | ||
CBS 125181 | MN534007 | MN534072 | MN534177 | MN534282 | MW402548 | Environmental | Iran | This study | ||
F. fracticaudum | CMW 25245T | PDNT00000000 | PDNT00000000 | PDNT00000000 | PDNT00000000 | PDNT00000000 | Pinus maximinoi | Colombia | Wingfield et al. (2018) | |
F. fractiflexum | NRRL 28852T | AF160288 | AF160315 | AF158341 | LT575064 | – | Cymbidium sp. | Japan | O’Donnell et al. (2000), Sandoval-Denis et al. (2018a) | |
F. fredkrugeri | CBS 408.97 | MW402126 | MW402324 | MW402461 | MW402814 | – | Soil | Maryland | BBA 69727; NRRL 25355 | This study |
CBS 144209T | LT996097 | LT996118 | LT996181 | LT996147 | LT996199 | Melhania acuminata rhizophere | South Africa | CPC 33747 | Sandoval-Denis et al. (2018a) | |
CBS 144495 | LT996096 | LT996117 | LT996180 | LT996146 | LT996198 | Melhania acuminata rhizophere | South Africa | CPC 33746 | Sandoval-Denis et al. (2018a) | |
NRRL 26152 | MW402159 | – | – | MW402778 | MW402714 | Striga hermonthica | Niger | BBA 70170 | This study | |
F. fujikuroi | CBS 186.56 | MW402108 | MW402306 | MW402447 | MW402765 | MW402632 | Unknown | Unknown | ATCC 14164; BBA 11321; IMI 112801; NRRL 2284 | This study |
CBS 195.34 | MW402111 | MW402309 | – | – | MW402634 | Saccharum officinarum | Taiwan | This study | ||
CBS 221.76T | MN534010 | MN534130 | – | KU604255 | MW402640 | Oryza sativa culm | Taiwan | BBA 12428; BBA 63630; IHEM 3821; IMI 196086; IMI 202879; LCP 58.3353; NRRL 13620; NRRL 13998; NRRL 22174 | Al-Hatmi et al. (2016a), this study | |
CBS 240.64 | MW402117 | MW402315 | – | – | MW402643 | Oryza sativa | Japan | This study | ||
CBS 257.52 | MW402119 | MW402317 | MW402454 | MW402812 | MW402645 | Oryza sativa seedling | Japan | This study | ||
CBS 262.54 | MW402120 | MW402318 | – | – | MW402647 | Oryza sativa | India | BRL 1001; IMI 058291 | This study | |
CBS 263.54 | MW402121 | MW402319 | – | – | MW402648 | Avena sativa | India | ATCC 10052; BRL 1004; IFO 6349; IMI 058292; NRRL 2374; QM 1224 | This study | |
CBS 264.54 | MW402122 | MW402320 | MW402456 | – | MW402649 | Oryza sativa | Unknown | ATCC 12617; BRL 1135; IMI 058293 | This study | |
CBS 265.54 | MN534011 | MN534132 | MN534222 | MN534268 | MW402650 | Oryza sativa | Unknown | ATCC 12618; BRL 1139; IMI 058294 | This study | |
CBS 440.64 | MW402132 | MW402331 | – | – | MW402670 | Unknown | Japan | This study | ||
CBS 449.95 | MW402134 | MW402333 | – | – | MW402672 | Environmental | France | This study | ||
CBS 530.95 | MW402135 | MW402335 | – | – | – | Unknown | Unknown | This study | ||
CBS 119854 | MW401993 | MW402193 | – | – | – | Unknown | Unknown | BBA 63873; MRC 1836 | This study | |
CBS 119855 | MW401994 | MW402194 | MW402387 | MW402735 | – | Environmental | Unknown | FRC M-1148; MRC 8532 | This study | |
CBS 121864 | MW402003 | MW402203 | – | – | MW402535 | Environmental | Netherlands | FRC M1150; MRC 8534 | This study | |
CBS 130402 | MW402025 | MN534131 | MN534223 | MN534269 | – | Human skin | USA | This study | ||
NRRL 5538 | MN193860 | – | – | MN193888 | MW402719 | Unknown | Unknown | Laraba et al. (2020), this study | ||
NRRL 13289 | MW402158 | – | – | MW402777 | – | Unknown | Unknown | FRC M-1138; from NRRL 6322 | This study | |
NRRL 13566 | AF160279 | U34415 | AF158332 | JX171570 | – | Oryza sativa | China | O’Donnell & Cigelnik (1997), O’Donnell et al. (2000, 2013) | ||
F. globosum | CBS 428.97T | KF466417 | MN534124 | MN534218 | KF466406 | MW402668 | Zea mays seed | South Africa | NRRL 26131 | Proctor et al. (2013), this study |
CBS 429.97 | MW402130 | MW402329 | – | – | – | Zea mays seed | South Africa | MRC 6648; NRRL 26132 | This study | |
CBS 430.97 | MN534013 | MN534125 | MN534219 | MN534265 | – | Zea mays seed | South Africa | NRRL 26133 | This study | |
CBS 431.97 | MW402131 | MW402330 | MW402465 | MW402816 | MW402669 | Zea mays seed | South Africa | MRC 6660; NRRL 26134 | This study | |
CBS 120992 | MW401998 | MW402198 | MW402390 | MW402788 | MW402529 | Maize kernels | South Africa | FRC M-8014; MRC 6648; NRRL 26132 | This study | |
F. guttiforme | CBS 409.97T | MT010999 | MT011048 | MT010901 | MT010967 | MT010938 | Ananas comosus | Brazil | NRRL 25295; IMI 376113; BBA 69661; S1832 GJS0290 | This study |
NRRL 22945 | AF160297 | U34420 | AF158350 | JX171618 | JX171505 | Ananas comosus | England | O’Donnell & Cigelnik (1997), O’Donnell et al. (2000, 2013) | ||
F. konzum | CBS 119847 | MW401990 | MW402190 | MW402385 | – | MW402518 | Unknown | Unknown | MRC 8545 | This study |
CBS 119848 | MW401991 | MW402191 | – | – | – | Unknown | Unknown | MRC 8544 | This study | |
CBS 119849T | LT996098 | MN534095 | LT996182 | MW402733 | MW402519 | Sorghastrum nuttans | USA | MRC 8427 | Sandoval-Denis et al. (2018a), this study | |
CBS 139382 | MW402071 | MW402270 | MW402418 | MW402804 | MW402598 | Derived from a cross of KSU 11615 and KSU 10653 | Unknown | ATCC MYA-2885; FGSC 8910; KSU 11616 | This study | |
CBS 139383 | MN534014 | MN534094 | MN534200 | MN534244 | MW402599 | Derived from a cross of KSU 10653 and KSU 10595 | Unknown | ATCC MYA-2884; FGSC 8911; KSU 11615 | This study | |
F. lactis | CBS 411.97ET | MN193862 | MN534077 | MN534178 | MN534275 | MW402659 | Ficus carica | USA | NRRL 25200 | Laraba et al. (2020), this study |
CBS 420.97 | MN534015 | MN534078 | MN534181 | MN534296 | MW402667 | Ficus carica | USA | NRRL 25338; TM F13; BBA 68591 | This study | |
F. longicornicola | NRRL 52706T | JF740788 | MW402360 | MW402487 | JF741114 | – | Insect | Ethiopia | CBS 147247; ARSEF 6455 | O’Donnell et al. (2012), this study |
NRRL 52712 | JF740794 | MW402361 | MW402488 | JF741120 | MW402716 | Insect | Ethiopia | CBS 147248; ARSEF 6451 | O’Donnell et al. (2012), this study | |
NRRL 52713 | JF740795 | MW402362 | MW402489 | JF741121 | MW402717 | Insect | Ethiopia | CBS 147249; ARSEF 6446 | O’Donnell et al. (2012), this study | |
F. lumajangense | InaCCF872T | LS479441 | LS479433 | – | LS479850 | – | Musa sp. var. Pisang Raja Nangka | Indonesia | Maryani et al. (2019a) | |
InaCCF993 | LS479442 | LS479434 | – | LS479851 | – | Musa acuminata var. Pisang Mas Kirana | Indonesia | Maryani et al. (2019a) | ||
F. madaense | CBS 146648 | MW402095 | MW402294 | MW402436 | MW402761 | MW402616 | Arachis hypogaea | Nigeria | CPC 38321 | This study |
CBS 146651 | MW402096 | MW402295 | MW402437 | MW402762 | MW402617 | Sorghum | Nigeria | CPC 38324 | This study | |
CBS 146656 | MW402097 | MW402296 | MW402438 | MW402763 | MW402618 | Arachis hypogaea | Nigeria | CPC 38330 | This study | |
CBS 146669T | MW402098 | MW402297 | MW402439 | MW402764 | MW402619 | Arachis hypogaea | Nigeria | CPC 38344 | This study | |
F. mangiferae | CBS 119853 | MN534016 | MN534140 | MN534225 | MN534270 | MW402522 | Mango with malformation disease | South Africa | MRC 2730 | This study |
CBS 120994T | MN534017 | MN534128 | MN534224 | MN534271 | MW402530 | Mango with malformation disease | Israel | MRC 7559; MRC 8432 | This study | |
NRRL 25226 | AF160281 | U61561 | AF158334 | HM068353 | MW402712 | Mangifera indica | Israel | O’Donnell & Cigelnik (1997), O’Donnell et al. (2000), Smith et al. (2011) | ||
F. marasasianum | CMW 25512 | Unpublished | Unpublished | Unpublished | Unpublished | Unpublished | Pinus tecunumanii | Colombia | Unpublished | |
F. mexicanum | NRRL 47473 | GU737416 | GU737308 | GU737389 | LR792615 | LR792579 | Mangifera indica inflorescence | Mexico | Otero-Colina et al. (2010) | |
NRRL 53145 | GU737280 | GU737492 | – | – | – | Unknown | Unknown | Otero-Colina et al. (2010) | ||
NRRL 53147T | GU737282 | GU737494 | – | MN724973 | MG838088 | Mangifera indica | Mexico | Otero-Colina et al. (2010), Santillán-Mendoza et al. (2018) | ||
NRRL 53571 | GU737420 | GU737312 | GU737393 | – | – | Mangifera indica | Mexico | Otero-Colina et al. (2010) | ||
NRRL 53575 | GU737286 | GU737498 | – | – | – | Mangifera indica | Mexico | Otero-Colina et al. (2010) | ||
NRRL 53580 | GU737421 | GU737313 | GU737394 | – | – | Mangifera indica | Mexico | Otero-Colina et al. (2010) | ||
F. mundagurra | RGB5717T | KP083256 | MN534146 | MN534214 | KP083276 | – | Soil | Australia | NRRL 66235 | Laurence et al. (2016), this study |
F. musae | CBS 624.87T | FN552086 | FN545368 | MW402474 | MW402772 | MW402689 | Musa sapientum fruit | Honduras | NRRL 25059 | Van Hove et al. (2011), this study |
CBS 115315 | MW401974 | MW402174 | – | – | – | Man, Tinea corporis | Greece | EMD 13 | This study | |
NRRL 28893 | FN552092 | FN545374 | FN552070 | FN552114 | – | Musa sp. | Mexico | Van Hove et al. (2011) | ||
F. napiforme | CBS 674.94 | MW402145 | MW402345 | MW402475 | – | MW402692 | Unknown | Unknown | BBA 67630 | This study |
CBS 748.97T | MN193863 | MN534085 | MN534192 | MN534291 | MW402701 | Pennisetum typhoides | Namibia | NRRL 13604 | Laraba et al. (2020), this study | |
CBS 135139 | MN534019 | MN534084 | MN534183 | MN534290 | MW402572 | Keratitis (Human) | India | This study | ||
CBS 135140 | MW402044 | MW402243 | – | – | – | Clinical (keratitis) | India | This study | ||
CBS 135141 | MW402045 | MW402244 | – | MW402797 | MW402573 | Clinical | Unknown | This study | ||
NRRL 25196 | MN193863 | – | – | MN193891 | MW402709 | Pennisetum typhoides | South Africa | BBA 67629; FRC M-3560 | Laraba et al. (2020) | |
F. nirenbergiae | CBS 744.97 | AF160312 | U34424 | AF158365 | LT575065 | – | Unknown | Unknown | O’Donnell & Cigelnik (1997), O’Donnell et al. (2000), Sandoval-Denis et al. (2018a) | |
F. nygamai | CBS 140.95 | MW402075 | MW402274 | – | EF470127 | MW402603 | Human, immunocompromised blood | Egypt | NRRL 26421 | O’Donnell et al. (2007), this study |
CBS 413.97 | MW402127 | MW402325 | MW402462 | MW402815 | MW402660 | Oryza sativa | Morocco | BBA 63175; NRRL 25449 | This study | |
CBS 572.94 | MW402141 | MW402341 | MW402473 | MW402819 | – | Cajanus indicus | India | BBA 64375 | This study | |
CBS 749.97T | MW402151 | MW402352 | MW402479 | EF470114 | MW402703 | Sorghum bicolor necrotic root | New South Wales | ATCC 58555; BBA 69862; DAOM 225148; FRC M-1375; IMI 375354; NRRL 13448 | O’Donnell et al. (2007), this study | |
CBS 834.85 | MW402154 | MW402355 | MW402482 | MW402821 | MW402707 | Cajanus cajan | India | BBA 64375; NRRL 22106; NRRL 25312 | This study | |
CBS 119852 | MW401992 | MW402192 | MW402386 | MW402734 | MW402521 | Unknown | Unknown | MRC 8547 | This study | |
CBS 120995 | MW401999 | MW402199 | – | – | MW402531 | Sorghum root | Australia | MRC 8546 | This study | |
CBS 131377 | MW402035 | MW402234 | MW402405 | – | MW402562 | Environmental | Australia | This study | ||
CBS 139386 | MW402072 | MW402271 | – | – | MW402600 | Unknown | Unknown | FGSC 8933; FRC M-7491 | This study | |
CBS 139387 | MW402073 | MW402272 | MW402419 | MW402753 | MW402601 | Unknown | Unknown | FGSC 8934; FRC M-7492 | This study | |
F. ophioides | CBS 118509 | – | MN534116 | MN534207 | MN534297 | – | Phragmites mauritianus | South Africa | CMW 18678; MRC 6748; FCC 1092 | This study |
CBS 118510 | MN534020 | MN534121 | MN534201 | MN534301 | – | Panicum maximum | South Africa | CMW18679; MRC 6747; FCC 1093 | This study | |
CBS 118511 | MN534021 | MN534122 | MN534204 | MN534299 | – | Panicum maximum | South Africa | This study | ||
CBS 118512T | MN534022 | MN534118 | MN534209 | MN534303 | – | Panicum maximum | South Africa | CMW 18681; FCC 2979; FCC 2980; MRC 6744 | This study | |
CBS 118513 | MN534023 | MN534119 | MN534202 | MN534300 | – | Panicum maximum | South Africa | This study | ||
CBS 118514 | MN534024 | MN534117 | MN534206 | MN534302 | – | Panicum maximum | South Africa | This study | ||
CBS 118515 | MN534025 | MN534120 | MN534205 | MN534298 | – | Panicum maximum | South Africa | This study | ||
NRRL 26756 | AF160307 | AF160322 | AF158360 | – | – | Ornamental grass | South Africa | O’Donnell et al. (2000) | ||
NRRL 26757 | AF160308 | AF160323 | AF158361 | – | – | Ornamental reed | South Africa | O’Donnell et al. (2000) | ||
F. parvisorum | CMW 25267T | KJ541060 | KJ541055 | – | – | – | Pinus patula | Colombia | CBS 137236; FCC 5407 | Herron et al. (2015) |
F. phyllophilum | CBS 216.76T | MN193864 | KF466443 | KF466333 | KF466410 | MW402637 | Dracaena deremensis leaf | Italy | BBA 11730; BBA 63625; DAOM 225132; IMI 202874; IMI 375338; NRRL 13617 | Laraba et al. (2020), Proctor et al. (2013) |
CBS 246.61 | MW402118 | MW402316 | MW402453 | – | MW402644 | Leaf spot in Sansevieria dooneri | Germany | BBA 7983; NRRL 25053 | This study | |
F. pilosicola | NRRL 29123 | MN534054 | MN534098 | MN534165 | MN534247 | – | Bidens pilosa | USA | This study | |
NRRL 29124T | MN534055 | MN534099 | MN534159 | MN534248 | – | Bidens pilosa | USA | This study | ||
F. pininemorale | CMW 25243 | NFZR00000000 | NFZR00000000 | NFZR00000000 | NFZR00000000 | NFZR00000000 | Pinus tecunumanii | Colombia | Wingfield et al. (2017) | |
F. proliferatum | CBS 480.96ET | MN534059 | MN534129 | MN534217 | MN534272 | – | Tropical rain forest soil | Papua New Guinea | NRRL 26427; IAM 14682; NY007.B6 | This study |
F. pseudoanthophilum | CBS 414.97T | MW402128 | MW402326 | MW402463 | – | MW402661 | Zea mays | Zimbabwe | BBA 69002; IMI 376112; NRRL 25211 | This study |
CBS 415.97 | MW402129 | MW402327 | – | – | MW402662 | Zea mays | Zimbabwe | BBA 69003; NRRL 25209 | This study | |
CBS 745.97 | MW402148 | MW402349 | MW402476 | MW402820 | MW402697 | Zea mays | Zimbabwe | BBA 69030; DAOM 225134; IMI 375340; NRRL 25206 | This study | |
CBS 746.97 | MW402149 | MW402350 | MW402477 | – | MW402698 | Zea mays | Zimbabwe | BBA 70129; IMI 375341; NRRL 26063 | This study | |
F. pseudocircinatum | CBS 449.97T | AF160271 | MN534069 | MN534190 | MN534277 | MW402673 | Solanum sp. | Ghana | NRRL 22946; CBS 126.73; IMI 375316; BBA 69636; DAOM 225117 | O’Donnell et al. (2000), this study |
CBS 455.97 | MN534029 | MN534070 | MN534184 | MN534276 | – | Heteropsylla incisa | Papua New Guinea | NRRL 25034; ARSEF 2301; FRC M-3856; BBA 69598 | This study | |
NRRL 36939 | MN193866 | – | – | MW402779 | MW402715 | Unknown | Unknown | This study | ||
F. pseudonygamai | CBS 416.97 | MN534030 | MN534064 | MN534194 | MN534283 | MW402663 | Pennisetum typhoides | Nigeria | NRRL 6022; BBA 69551; MRC 1412 | This study |
CBS 417.97T | AF160263 | MN534066 | AF158316 | MN534285 | MW402664 | Pennisetum typhoides | Nigeria | NRRL 13592; FRC M-1166; BBA 69552; IMI 375342; DAOM 225136 | O’Donnell et al. (2000), this study | |
CBS 484.94 | MN534031 | MN534065 | MN534195 | MN534284 | MW402681 | Soil | Australia | FRC M-1034 | This study | |
F. ramigenum | CBS 418.97T | KF466423 | MN534145 | MN534187 | KF466412 | MW402665 | Ficus carica | USA | NRRL 25208 | Proctor et al. (2013), this study |
CBS 526.97 | MN534032 | MN534086 | MN534188 | MN534292 | MW402682 | Ficus carica | USA | NRRL 25212; BBA 68593; TM F62 | This study | |
F. sacchari | CBS 134.73 | MW402041 | MW402240 | – | – | MW402569 | Saccharum officinarum | Guyana | ATCC 24390; IMI 165537a; NRRL 25061 | This study |
CBS 147.25 | MW402099 | MW402298 | MW402440 | – | MW402620 | Unknown | Unknown | BBA 69863; DAOM 225140; IMI 375345; NRRL 20471 | This study | |
CBS 183.32 | MW402104 | MW402302 | – | – | MW402628 | Saccharum officinarum | Unknown | This study | ||
CBS 185.33 | MW402106 | MW402304 | – | – | MW402630 | Saccharum officinarum | India | This study | ||
CBS 186.33 | MW402107 | MW402305 | MW402446 | – | MW402631 | Saccharum officinarum with pokkah boeng red stripes | Unknown | This study | ||
CBS 201.37 | MW402112 | MW402310 | – | – | MW402635 | Unknown | Unknown | This study | ||
CBS 223.76ET | MW402115 | MW402313 | AF158331 | JX171580 | – | Saccharum officinarum | India | BBA 63340; DAOM 225138; IMI 202881; NRRL 13999 | O’Donnell et al. (2000, 2013), this study | |
CBS 119828 | MW401984 | MW402184 | – | – | MW402513 | Unknown | Unknown | MRC 8551 | This study | |
CBS 119829 | MW401985 | MW402185 | – | – | – | Unknown | Unknown | FRC M-3127; MRC 8447; NRRL 20957 | This study | |
CBS 119830 | MW401986 | MW402186 | MW402381 | – | – | Unknown | Unknown | MRC 8552 | This study | |
CBS 121683 | MW402002 | MW402202 | – | MW402789 | MW402534 | Man, fungal endophthalmyitis of male patient | India | This study | ||
CBS 131369 | MW402030 | MW402229 | – | MW402792 | – | Oryzae australiensis, stem, first node above soil | Australia | This study | ||
CBS 131370 | MW402031 | MW402230 | MW402404 | MW402793 | MW402558 | Oryzae australiensis, stem, first node above soil | Australia | This study | ||
CBS 131371 | MW402032 | MW402231 | – | – | MW402559 | Oryzae australiensis, stem, first node above soil | Australia | This study | ||
CBS 131372 | MN534033 | MN534134 | MN534226 | MN534293 | MW402560 | Oryzae australiensis, stem, first node above soil | Australia | This study | ||
CBS 131373 | MW402033 | MW402232 | – | MW402794 | MW402561 | Oryzae australiensis, stem, first node above soil | Australia | This study | ||
CBS 131374 | MW402034 | MW402233 | – | MW402795 | – | Oryzae australiensis, stem, first node above soil | Australia | This study | ||
CBS 135142 | MW402046 | MW402245 | – | MW402798 | – | Clinical (corneal ulcer) | India | This study | ||
CBS 135143 | MW402047 | MW402246 | MW402409 | MW402799 | – | Clinical (corneal ulcer) | India | This study | ||
CBS 135144 | MW402048 | MW402247 | – | – | MW402574 | Clinical (corneal ulcer) | India | This study | ||
CBS 135145 | MW402049 | MW402248 | – | – | – | Clinical (corneal ulcer) | India | This study | ||
CBS 139373 | MW402066 | MW402265 | – | MW402751 | MW402593 | Unknown | Unknown | This study | ||
CBS 139376 | MW402069 | MW402268 | – | MW402803 | MW402596 | lab strain: progeny of ATCC 201262 and ATCC 201263 | USA | ATCC 201264; FGSC 7610 | This study | |
CBS 139377 | MW402070 | MW402269 | – | – | – | lab strain: progeny of ATCC 201262 and ATCC 201263 | USA | ATCC 201265; FGSC 7611 | This study | |
InaCC F950 | – | LS479435 | – | LS479852 | – | Musa sp. var. Pisang Kepok | Indonesia | Maryani et al. (2019a) | ||
InaCC F951 | – | LS479437 | – | LS479854 | – | Musa sp. var. Pisang Kepok | Indonesia | Maryani et al. (2019a) | ||
InaCC F952 | – | LS479436 | – | LS479853 | – | Musa sp. var. Pisang Kepok | Indonesia | Maryani et al. (2019a) | ||
NRRL 66326 | MN193868 | – | – | MN193896 | MW402723 | Unknown | Unknown | Laraba et al. (2020), this study | ||
NY 001E9 | MN534034 | MN534133 | MN534227 | MN534294 | MW402726 | Organic banana | South Africa | This study | ||
F. secorum | NRRL 62593T | KJ189225 | – | KJ189235 | – | – | Beta vulgaris | USA | Secor et al. (2014) | |
NRRL 62594 | KJ189228 | – | KJ189238 | – | – | Beta vulgaris | USA | Secor et al. (2014) | ||
F. siculi | CBS 142222T | LT746214 | LT746346 | LT746189 | LT746327 | – | Citrus sinensis | Italy | CPC 27188 | Sandoval-Denis et al. (2018b) |
CPC 27189 | LT746215 | LT746347 | LT746190 | LT746328 | – | Citrus sinensis | Italy | Sandoval-Denis et al. (2018b) | ||
F. sororula | CMW 25513 | Unpublished | Unpublished | Unpublished | Unpublished | Unpublished | Pinus tecunumanii | Colombia | Unpublished | |
F. sterilihyposum | NRRL 25623T | MN193869 | AF160316 | AF158353 | MN193897 | MW402713 | Mango | South Africa | O’Donnell et al. (2000), Laraba et al. (2020) | |
NRRL 53991 | GU737413 | GU737305 | GU737386 | – | – | Mangifera indica | Brazil | CML 282; KSU 16215 | Otero-Colina et al. (2010) | |
NRRL 53997 | GU737414 | GU737306 | GU737387 | – | – | Mangifera indica | Brazil | CML 401; KSU 16240 | Otero-Colina et al. (2010) | |
NRRL 54011 | GU737415 | GU737307 | GU737388 | – | – | Unknown | Unknown | Otero-Colina et al. (2010) | ||
F. subglutinans | CBS 215.76 | MN534061 | MN534109 | MN534171 | MN534241 | MW402636 | Zea mays | Germany | NRRL 20844; BBA 10351; BBA 62621 | This study |
CBS 479.94 | MN534036 | MN534105 | MN534105 | MN534236 | MW402678 | Zea mays kernel | South Africa | MRC 5655 | This study | |
CBS 536.95 | MW402139 | MW402339 | MW402471 | MW402836 | MW402685 | Unknown | Unknown | This study | ||
CBS 747.97NT | MW402150 | MW402351 | MW402478 | MW402773 | MW402700 | Zea mays | Illinois | BBA 62451; DAOM 225141; FRC M-36; MRC 8554; NRRL 22016; NRRL 22114 | This study | |
CBS 136481 | MW402059 | MW402258 | MW402413 | MW402748 | MW402585 | Human blood | Italy | NRRL 54158; IUM 96-4102 | This study | |
NRRL 66333 | MN193870 | – | – | MN193898 | – | Unknown | Unknown | Laraba et al. (2020) | ||
F. succisae | CBS 187.34 | MW402109 | MW402307 | MW402448 | MW402810 | – | Zostera marina | UK | NRRL 22942 | This study |
CBS 219.76ET | AF160291 | U34419 | AF158344 | MW402766 | MW402639 | Succisa pratensis flower | Germany | BBA 12287; BBA 63627; DAOM 225142; IMI 202876; NRRL 13613 | O’Donnell & Cigelnik (1997), O’Donnell et al. (2000), this study | |
F. sudanense | CBS 454.97T | MN534037 | MN534073 | MN534179 | MN534278 | MW402677 | Striga hermonthica | Sudan | NRRL 25451 | This study |
CBS 675.94 | MN534038 | MN534074 | MN534182 | MN534279 | MW402693 | Striga hermonthica | Sudan | BBA 65862 | This study | |
F. temperatum | CBS 135538 | MN534039 | MN534111 | MN534168 | MN534239 | MW402575 | Pulmonary infection (Human) | Mexico | This study | |
CBS 135539 | MN534040 | MN534110 | MN534169 | MN534242 | MW402576 | Pulmonary infection (Human) | Mexico | This study | ||
CBS 135540 | MW402050 | MW402249 | – | – | MW402577 | Human, mycotic keratitis | Mexico | This study | ||
CBS 135541 | MW402051 | MW402250 | – | – | MW402578 | Human, keratitis | Mexico | This study | ||
MUCL 52463T | – | MW402359 | MW402486 | MW402776 | – | Zea mays | Belgium | This study | ||
NRRL 25622 | AF160301 | AF160317 | AF158354 | LT970765 | – | Zea mays | South Africa | NRRL 26616; MUCL 51714 | O’Donnell et al. (2000) | |
F. terricola | CBS 483.94T | MN534042 | MN534076 | MN534189 | LT996156 | MW402680 | Soil | Australia | Sandoval-Denis et al. (2018a), this study | |
CBS 119850 | MN534041 | MN534075 | MN534180 | MN534280 | MW402520 | Soil | Australia | This study | ||
F. thapsinum | CBS 539.79 | MW402140 | MW402340 | MW402472 | MW402818 | MW402686 | Man, white grained mycetoma | Italy | CDC B-2671a | This study |
CBS 733.97 | MN534043 | MN534079 | MN534191 | JX171600 | – | Sorghum bicolor | South Africa | NRRL 22045 | O’Donnell et al. (2013), this study | |
CBS 776.96T | MN534044 | MN534080 | – | MN534289 | MW402704 | Unknown | Unknown | ATCC 200521; BBA 69583; FGSC 7056; FRC M-6563; NRRL 22049 | This study | |
CBS 100312 | MW401961 | MW402162 | MW402365 | MW402780 | MW402494 | Unknown | Unknown | ATCC 16263 | This study | |
CBS 100313 | MW401962 | MW402163 | MW402366 | MW402781 | MW402495 | Contaminant of CBS 100310 | Unknown | This study | ||
CBS 109077 | MW401967 | MW402168 | MW402369 | – | MW402499 | Sorghum seeds | Ethiopia | This study | ||
CBS 113963 | MW401970 | MW402171 | MW402371 | – | MW402501 | Pennisetum | Yemen | This study | ||
CBS 119833 | MW401987 | MW402187 | MW402382 | MW402787 | MW402516 | Environmental | USA | BBA 70187; FRC M-6564; MRC 8558 | This study | |
CBS 130176 | MW402022 | MW402222 | – | – | – | Human mycetoma | Italy | NRRL 25229; IMI 240460 | This study | |
CBS 135920 | MW402056 | MW402255 | – | – | MW402582 | Unknown | Unknown | This study | ||
CBS 135921 | MW402057 | MW402256 | MW402412 | MW402800 | MW402583 | Black biofilm, sink drain | Germany | This study | ||
F. tjaetaba | NRRL 66243T | KP083263 | GU737296 | LT996187 | KP083275 | – | Sorghum interjectum | Australia | Otero-Colina et al. (2010), Laurence et al. (2016), Sandoval-Denis et al. (2018a) | |
F. tupiense | CML345 | DQ452861 | DQ445783 | – | – | – | Mangifera indica | Brazil | KSU 16217; CMM 3656; CMR-UB 22069; BPI 883545 | Lima et al. (2012) |
NRRL 53984T | GU737404 | GU737296 | GU737377 | LR792619 | LR792583 | Mangifera indica | Brazil | CML 262; KSU 16195; CMM 3655 | Otero-Colina et al. (2010) | |
NRRL 53996 | DQ452860 | DQ445782 | – | – | – | Mangifera indica | Brazil | CML 389; KSU 16233; NRRL 53996; CMM 3657; CMR-UB 22070; BPI 883544 | Lima et al. (2012) | |
F. udum | CBS 178.32 | AF160275 | U34433 | MW402442 | LT996172 | MW402624 | Unknown | Netherlands | BBA 1813; DAOM 225111; IMI 375319; NRRL 22949 | O’Donnell & Cigelnik (1997), O’Donnell et al. (2000), Sandoval-Denis et al. (2018a), this study |
CBS 419.97 | – | MW402328 | MW402464 | MW402769 | MW402666 | Crotolaria juncea | India | BBA 65056; NRRL 25192 | This study | |
CBS 747.79 | MN193872 | MN534141 | MN534154 | MN534258 | MW402699 | Cajanus cajan | India | BBA 62451; NRRL 25194 | Laraba et al. (2020), this study | |
NRRL 25199ET | KY498862 | KY498892 | – | KY498875 | – | Cajanus cajan | India | BBA 65058 | Pfenning et al. (2019) | |
F. verticillioides | CBS 117.28 | MW401977 | MW402177 | – | MW402729 | MW402505 | Unknown | France | MUCL 29451; CBS H-9165 | This study |
CBS 125.73 | MW402012 | MW402212 | MW402392 | MW402791 | MW402543 | Trichosanthes dioica | India | ATCC 24378; IMI 158047; NRRL 25057 | This study | |
CBS 139.40 | MW402064 | MW402263 | MW402416 | – | MW402591 | Phyllocactus hybridus | Italy | NRRL 25056 | This study | |
CBS 141.59 | MW402080 | MW402279 | MW402424 | – | MW402607 | Unknown | Unknown | This study | ||
CBS 167.87 | MW402101 | MW402300 | MW402441 | MW402834 | MW402622 | Pinus seed | USA | NRRL 25058 | This study | |
CBS 181.31 | MW402103 | – | MW402444 | – | MW402626 | Musa sapientum | Central America | NRRL 29294 | This study | |
CBS 218.76ET | MW402113 | MW402311 | MW402449 | – | MW402638 | Zea mays stem | Germany | BBA 11782; DSM 62264; IMI 202875; NRRL 13993 | This study | |
CBS 447.95 | MW402133 | MW402332 | MW402466 | MW402770 | MW402671 | Asparagus | Unknown | This study | ||
CBS 531.95 | MW402136 | MW402336 | MW402468 | MW402771 | MW402683 | Zea mays | Unknown | This study | ||
CBS 576.78 | MW402142 | MW402342 | – | – | MW402687 | Mycophilic | USSR | NRRL 22950; VKM F-257 | This study | |
CBS 579.78 | MW402143 | MW402343 | – | MW402837 | – | Human | USA | NRRL 25055 | This study | |
CBS 734.97 | MW402146 | MW402346 | AF158315 | EF470122 | MW402694 | Zea mays | Germany | BBA 62264; IMI 375318; NRRL 22172 | O’Donnell et al. (2000, 2007), this study | |
CBS 102699 | MW401964 | MW402165 | – | MW402782 | MW402497 | Abdominal drain (liver transplant) | Germany | This study | ||
CBS 108922 | MW401966 | MW402167 | – | MW402823 | – | Human, urine | Germany | This study | ||
CBS 114759 | MW401972 | – | MW402372 | – | MW402502 | Unknown | Unknown | This study | ||
CBS 116665 | MW401976 | MW402176 | MW402375 | MW402825 | – | Tomato | Unknown | This study | ||
CBS 119664 | MW401981 | MW402181 | MW402379 | – | MW402509 | Maize/Corn (Baxxita), Husk | Switzerland | This study | ||
CBS 119825 | MW401982 | MW402182 | MW402380 | MW402826 | MW402510 | Maize kernels | South Africa | FRC M-1325; MRC 826; NRRL 20960 | This study | |
CBS 119826 | MW401983 | MW402183 | – | MW402827 | MW402511 | Unknown | Unknown | MRC 8559 | This study | |
CBS 119827 | MN534046 | MN534087 | MN534215 | MN534287 | MW402512 | Unknown | Unknown | MRC 8560 | This study | |
CBS 123670 | MW402011 | MW402211 | – | MN193901 | MW402542 | Zea mays | USA | FRC M-3125; NRRL 20956 | Laraba et al. (2020), this study | |
CBS 130180 | MW402024 | MW402224 | – | MW402740 | MW402554 | Human peritoneal fluid | USA | NRRL 43608; UTHSC 03-2552 | This study | |
CBS 131389 | MN534047 | MN534088 | MN534193 | MN534288 | MW402563 | Environmental | Australia | This study | ||
CBS 131390 | MW402036 | MW402235 | – | – | MW402564 | Wheat root | Australia | This study | ||
CBS 135790 | MW402053 | MW402252 | – | – | MW402580 | Unknown | Unknown | This study | ||
CBS 135792 | MW402055 | MW402254 | – | MW402747 | – | Unknown | Unknown | This study | ||
CBS 139374 | MW402067 | MW402266 | – | MW402752 | MW402594 | Unknown | Unknown | MPMI 8(1) 74-84; FGSC 7600 | This study | |
CBS 139375 | MW402068 | MW402267 | – | MW402802 | MW402595 | Corn stalk | USA | ATCC 201261; FGSC 7603 | This study | |
CBS 140031 | MW402076 | MW402275 | – | – | MW402604 | Unknown | Unknown | This study | ||
CBS 143257 | MW402087 | MW402286 | – | – | MW402612 | Unknown | Unknown | This study | ||
F. volatile | CBS 143874T | LR596007 | LR596008 | MK984595 | LR596006 | – | Human bronchoalveolar lavage fluid | French Guiana | Al-Hatmi et al. (2019) | |
NRRL 25615 | AF160304 | AF160320 | AF158357 | – | – | Oryza sativa seed | Nigeria | O’Donnell et al. (2000) | ||
F. werrikimbe | CBS 125535T | – | MN534104 | MN534203 | MN534304 | – | Sorghum leiocladum | Australia | F19361 | This study |
F. xylarioides | CBS 258.52T | MN193874 | AY707118 | MW402455 | HM068355 | MW402646 | Coffea trunk | Ivory Coast | NRRL 25486 | Geiser et al. (2005), Smith et al. (2011), Laraba et al. (2020) |
CBS 749.79 | MN534049 | MN534143 | AF158326 | MN534259 | MW402702 | Coffea canephora | Guinea | L-102; BBA 62721; NRRL 25804 | O’Donnell et al. (2000), this study | |
F. xyrophilum | NRRL 62710 | MN193875 | – | – | MN193903 | MW402720 | Xyris spp. | Guyana | Laraba et al. (2020), this study | |
NRRL 62721T | MN193877 | – | – | MN193905 | MW402721 | Xyris spp. | Guyana | Laraba et al. (2020), this study | ||
NRRL 66890 | MN193876 | – | – | MN193904 | MW402724 | Xyris spp. | Guyana | Laraba et al. (2020), this study |
a The new species names, described in this study are in bold.
b Abbreviations for the culture collections: the U.S. Agricultural Research Service culture collection (NRRL); the Westerdijk Fungal Biodiversity Institute (WI) collection (CBS); the working collection of FABI (CMW) of the Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, South Africa; the working collection of the author Neriman Yilmaz (NY), University of Pretoria, South Africa; Medical Research Center (MRC) Tygerberg, Cape Town, South Africa; (BBA) Julius Kühn-Institute, Institute for Epidemiology and Pathogen Diagnostics, Berlin & Braunschweig, Germany; F (University of Sydney) Sydney, New South Wales, Australia.
c The sequences deposited to GenBank in this study are in bold.
T Ex-type specimen.
ET Ex-epitype specimen.
NT Ex-neotype specimen.
DNA extraction, PCR and sequencing
Genomic DNA was extracted from 7-d-old fungal cultures, grown on potato dextrose agar (PDA; recipe in Crous et al. 2019a) and incubated at 25 °C, using the Prepman Ultra Sample Preparation Reagent (Thermo Fisher Scientific, Waltham, Massachusetts) following the manufacturer’s instructions. Five loci, namely partial sequences of the translation elongation factor 1-alpha (tef1), beta-tubulin (tub2), calmodulin (cmdA), RNA polymerase largest subunit (rpb1) and RNA polymerase second largest subunit (rpb2) gene regions were amplified and sequenced in both directions using a Bio-Rad iCycler (Bio-Rad, California, USA). Primer pairs and PCR amplification protocols are listed in Table 2. A PCR reaction mixture of 25 μL consisted of 2.5 μL 10× PCR reaction buffer, 2.5 mM MgCl2, 200 μM of each dNTP, 0.8 μM of each primer (forward and reverse), 1 U FastStart Taq DNA Polymerase (Roche, Basel, Switzerland) and 20–50 ng of genomic DNA. Resulting PCR products were separated using 2 % agarose gel electrophoresis, and gels were stained with GelRed (Biotium, Inc., California, USA) and examined under UV light. Amplified fragments were purified using the ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific, Massachusetts, USA). These were sequenced in both directions using the BigDye terminator sequencing kit v. 3.1 (Applied Biosystems, Forster City, California) employing the same primers used for PCR amplification. Reactions were analysed on an ABI PRISM 3100 DNA sequencer (Applied Biosystems). Contigs were assembled and edited in Geneious Prime v. 2019.0.4 (BioMatters Ltd., Auckland, New Zealand). Newly generated sequences were submitted to GenBank, with accession numbers provided in Table 1.
Table 2
Locus | Primer | PCR amplification procedures | References | |
---|---|---|---|---|
Name | Sequence (5′-3′)* | |||
tef1 | EF1 | ATGGGTAAGGARGACAAGAC | 95 °C 5 min; 35 cycles of 95 °C 45 s, 52 °C 45 s, 72 °C 90 s; 72 °C 8 min; 10 °C soak | O’Donnell et al. (1998) |
EF2 | GGARGTACCAGTSATCATG | O’Donnell et al. (1998) | ||
cmdA | CL1 | GARTWCAAGGAGGCCTTCTC | 94 °C 90 s; 35 cycles of 94 °C 45 s, 50 °C 45 s, 72 °C 1 min; 72 °C 10 min; 10 °C soak | O’Donnell et al. (2000) |
CL2A | TTTTTGCATCATGAGTTGGAC | O’Donnell et al. (2000) | ||
rpb1 | Fa | CAYAARGARTCYATGATGGGWC | 94 °C 90 s; 5 cycles of 94 °C 45 s, 54 °C 45 s, 72 °C 2 min; 5 cycles of 94 °C 45 s, 53 °C 45 s, 72 °C 2 min; | Hofstetter et al. (2007) |
R8 | CAATGAGACCTTCTCGACCAGC | 35 cycles of 94 °C 45 s, 52 °C 45s, 72 °C 2 min; 72 °C 10 min; 10 °C soak | O’Donnell et al. (2010) | |
F8 | TTCTTCCACGCCATGGCTGGTCG | 94 °C 90 s; 5 cycles of 94 °C 45 s, 56 °C 45 s, 72 °C 2 min; 5 cycles of 94 °C 45 s, 55 °C 45 s, 72 °C 2 min; | O’Donnell et al. (2010) | |
G2R | GTCATYTGDGTDGCDGGYTCDCC | 35 cycles of 94 °C 45 s, 54 °C 45s, 72 °C 2 min; 72 °C 10 min; 10 °C soak | O’Donnell et al. (2010) | |
rpb2 | 5F2 | GGGGWGAYCAGAAGAAGGC | 95 °C 5 min; 40 cycles of 94 °C 30 s, 51 °C 90 s, 68 °C 2 min; 68 °C 5 min; 10 °C soak | Reeb et al. (2004) |
7Cr | CCCATRGCTTGYTTRCCCAT | Liu et al. (1999) | ||
7Cf | ATGGGYAARCAAGCYATGGG | 95 °C 5 min; 40 cycles of 94 °C 30 s, 51 °C 90 s, 68 °C 2 min; 68 °C 5 min; 10 °C soak | Liu et al. (1999) | |
11ar | GCRTGGATCTTRTCRTCSACC | Liu et al. (1999) | ||
tub2 | T1 | AACATGCGTGAGATTGTAAGT | 95 °C 5 min; 35 cycles of 95 °C 45 s, 52 °C 45 s, 72 °C 90 s; 72 °C 8 min; 10 °C soak | O’Donnell & Cigelnik (1997) |
T2 | TAGTGACCCTTGGCCCAGTTG | O’Donnell & Cigelnik (1997) |
* R = A or G; S = C or G; W = A or T; Y = C or T.
Phylogenetic analyses
Gene sequences of novel species were compared to reference sequences available on the Fusarium-MLST (https://fusarium.mycobank.org), Fusarium-ID (Geiser et al. 2004) and NCBIs GenBank (http://blast.ncbi.nlm.nih.gov/Blast.cgi) databases. Based on these comparisons, sequences of relevant Fusarium species/isolates were retrieved (Table 1), contigs were assembled and edited in Geneious Prime v. 2019.2.1 (BioMatters Ltd., Auckland, New Zealand). All datasets were aligned using MAFFT v. 7.427 (Katoh & Standley 2013) selecting the G-INS-I option and, where needed, manually adjusted in Geneious Prime v. 2019.2.1. Phylogenies were calculated for each gene, followed by a concatenated dataset of the five genes (each gene region was treated as separate partitions) and were subsequently analysed using Maximum Likelihood (ML). ML trees were calculated in IQtree v. 2.1.2 (Nguyen et al. 2015) with the most suitable model for each gene and/or partition calculated using Modelfinder (Kalyaanamoorthy et al. 2017) and ultrafast bootstrapping done using UFBoot2 (Hoang et al. 2018), both integrated into IQtree. Bayesian Inference analyses were performed using MrBayes v. 3.2.7 (Ronquist et al. 2012). The most suitable model for each dataset or partition was selected based on the Akaike information criterion (Akaike 1974) using MrModeltest v. 2.4 (Nylander 2004). Trees were visualized in Figtree v. 1.4.4 (https://github.com/rambaut/figtree/releases) and visually edited in Affinity Publisher v. 1.7.1 (Serif (Europe) Ltd, Nottingham, UK). Furthermore, two node-specific concordance factors, the gene concordance factor (gCF) and the site concordance factor (sCF), were calculated as implemented in IQ-TREE v. 2.1.2 (Nguyen et al. 2015, Minh et al. 2020a, b).
Morphology
Fusarium species were characterised and described using macro- and micromorphological features as defined previously (Leslie & Summerell 2006, Aoki et al. 2013, Sandoval-Denis et al. 2018a, b, 2019). Colony morphology, production of pigments and odours were documented on PDA after incubation for 7 d at 25 °C in darkness, under continuous fluorescent light and using a 12/12 h cool fluorescent light/dark cycle. Colony growth rates were also determined on PDA by inoculating overgrown 5 mm agar blocks, obtained from 7-d-old cultures growing on synthetic nutrient poor agar (SNA; Nirenberg 1976) and incubated at 10–35 °C with 5 °C intervals in darkness. Colonies were measured daily over a 7-d-period in four perpendicular directions. Colony morphologies were captured with a Sony NEX-5N camera. Unless otherwise noted, micromorphological observations were made using water as mounting medium from fungal structures grown on carnation leaf agar (CLA; Fisher et al. 1982), incubated at 25 °C under a 12/12 h near-ultraviolet light (nuv)/dark cycle (Fisher et al. 1982, Leslie & Summerell 2006). Colony colour codes were determined following the protocols of Kornerup & Wanscher (1967). All measurements and images were taken using a Nikon Eclipse Ni compound and SMZ18 dissecting microscopes (Nikon, Japan), equipped with a Nikon DS-Ri camera using the NIS-Elements BR imaging software. Up to 50 measurements were made for the conidia and other morphological structures where these were available and maximum – minimum values with averages were determined. Photographic plates were prepared in Affinity Photo v. 1.7.3 (Serif (Europe) Ltd, Nottingham, UK).
RESULTS
Phylogeny
A multigene phylogeny was used to reveal the identities of the isolates studied (Fig. 1). The alignment contained 364 taxa and was 5 359 bp long including the gaps (tef1: 1–677; rpb2: 678–2 405; rpb1: 2 406–4 015; tub2: 4 016–4 613; cmdA: 4 614–5 359). The most appropriate substitution models for each partition were TIM2e+G4 for tef1, TIM2e+I+G4 for rpb2 and TNe+G4 for rpb1, tub2 and cmdA. All trees were rooted to F. nirenbergiae (CBS 744.97) (Fig. 1, Fig. S1–S5). In addition, individual gene phylogenies were generated to assess genealogical concordance of the novel species of FFSC (Fig. S1–S5). Genealogical concordance analyses subsequently confirmed the distinctiveness of the three novel species described in this study. Similar to the results shown by Sandoval-Denis et al. (2018b), the African clade was resolved as polyphyletic, consisting of two distinct and highly supported lineages. The core African clade (clade A) encompassed 31 phylogenetically distinct species, which also included two novel lineages (Fig. 1c–e). The African Clade B consisted of two species, namely F. dlaminii and the recently described F. fredkrugeri (Sandoval-Denis et al. 2018b) (Fig. 1). The other novel lineage resolved in this study, F. pilosicola sp. nov., clustered in the American (Fig. 1) clade.
Taxonomy
In this section, Latin binomials are provided for the three novel phylospecies resolved in this study, namely F. chinhoyiense, F. longicornicola and F. pilosicola spp. nov. In addition, epitypes are designated for F. anthophilum, F. lactis, F. proliferatum, F. sacchari, F. succisae and F. verticillioides. Fusarium acutatum and F. ophioides are validated. Furthermore, a neotype is designated for F. subglutinans and an emended description provided for F. annulatum.
Fusarium acutatum Nirenberg & O’Donnell, sp. nov. — MycoBank MB 838782
Synonym. Fusarium acutatum Nirenberg & O’Donnell, Mycologia 90: 435. 1998, nom. inval., Art. 40.1.
Etymology. Named for the acute apical cell of the sporodochial conidia produced by this species.
Typus. INDIA, unknown substrate, 1995, S.N. Smith (holotype B 70 0001695, designated here, culture ex-type BBA 69580 = NRRL 13309 = FRC 0-1117 = CBS 402.97 = IMI 376110).
For diagnosis — See Nirenberg & O’Donnell, Mycologia 90: 435. 1998.
Notes — Fusarium acutatum was isolated from Aphididae (Hemiptera) on Triticum sp. (wheat) from Pakistan and Cajanus sp. from India (Nirenberg & O’Donnell 1998, Leslie & Summerell 2006). It is known to produce beauvericin, enniatins and moniliformin (Munkvold 2017). Although this species was introduced by Nirenberg & O’Donnell (1998), it was invalidly described (Index of Fungi 6: 435, 1999). In the protologue for F. acutatum (Nirenberg & O’Donnell 1998) no reference was made to the specimen or gathering (Art. 40.1) for the holotype. Therefore, we validate the species here.
Fusarium annulatum Bugnic., Rev. Gén. Bot. 59: 17. 1952 — Fig. 2
Typus. NEW CALEDONIA, grain of Oryza sativa, F. Bugnicourt (holotype IMI 202878, ex-type culture CBS 258.54 = BBA 63629 = IMI 202878 = MUCL 8059 = NRRL 13619).
Description & Illustrations — (as F. proliferatum) Nirenberg (1976), Gerlach & Nirenberg (1982), Nelson et al. (1983), Nirenberg & O’Donnell (1998), Domsch et al. (2007).
Notes — Fusarium annulatum has been extensively studied in the past under the name F. proliferatum, a segregate of Fusarium moniliforme s.lat. (Seifert et al. 2003). The name Fusarium proliferatum, however, is here assigned to a distinct phylogenetic clade based on an isolate collected from the type location and substrate of that species (see notes under F. proliferatum and in Discussion). Fusarium annulatum is a morphologically and phylogenetically diverse species, common in tropical and temperate zones (Domsch et al. 2007), with more than 200 plant host species reported to date. This species is a well-known pathogen of diverse crops worldwide (as F. proliferatum, Farr & Rossman 2021), and has been implicated in human infections, particularly on immunocompromised patients (Summerbell et al. 1988, O’Donnell et al. 2007). Fusarium annulatum is characterised by sympodially proliferating conidiophores producing mono- and polyphialides, and clavate microconidia with truncate bases grouped in moderately long chains and false heads. Chlamydospores are absent. Sporodochia and sporodochial conidia are typical for this species complex, but are seldom produced or can be poorly developed, thus being easily overlooked. According to Gerlach & Nirenberg (1982), the ex-type strain of F. annulatum (CBS 258.54) failed to produce sporodochia; however, as determined here, this strain will produce typical sporodochia under the culture conditions we employed in this study. Unlike other members of this clade, this strain of F. annulatum is unique by producing strongly curved macroconidia (Fig. 2). Nevertheless, Nelson et al. (1983) showed that straight sporodochial conidia are also produced by this strain, which were also observed in this study. Other strains of F. annulatum studied to date produce predominantly straight macroconidia.
Fusarium anthophilum (A. Braun) Wollenw., Ann. Mycol. 15: 14. 1917
Basionym. Fusisporium anthophilum A. Braun, in Rabenhorst, Fung. Europ. Exs.: no. 1964. 1875.
Synonyms. Fusarium moniliforme var. anthophilum (A. Braun) Wollenw., Fusaria Autogr. Delin. 3: 975. 1930.
Fusarium tricinctum var. anthophilum (A. Braun) Bilaĭ, Fusarii (Biologija I sistematika): 251. 1955.
Fusarium sporotrichiella var. anthophilum (A. Braun) Bilaĭ, Mikrobiol. Zhurn. 49: 7. 1987.
Fusarium sanguineum var. pallidius Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 196. 1915.
Fusarium wollenweberi Raillo, Fungi of the genus Fusarium: 189. 1950.
Typus. GERMANY, Berchtesgaden, from Succisa pratensis, 1 Sept. 1874, A. Braun (lectotype of Fusisporium anthophilum, MBT 10000411, exsiccate Rabenhorst, Fungi europaei nr. 1964 in B, designated here); Berlin, on Euphorbia pulcherrima, 1975, H. Nirenberg (epitype, MBT 10000412, CBS 222.76 (preserved as metabolically inactive culture), designated here, culture ex-epitype CBS 222.76 = BBA 63270 = IMI 196084 = IMI 202880 = NRRL 22943 = NRRL 25216).
Description & Illustrations — See Wollenweber & Reinking (1935), Nirenberg (1976), Gerlach & Nirenberg (1982), Nelson et al. (1983), Leslie & Summerell (2006).
Notes — Nirenberg (1976) studied the type material from Braun (1875) and found that isolate CBS 222.76 agreed with the type collection in its morphology and locality. This was further supported by Gerlach & Nirenberg (1982). Therefore, in this study the illustration by Braun (1875) is designated as lectotype, and CBS 222.76 is designated as epitype for F. anthophilum.
Fusarium chinhoyiense Yilmaz & Crous, sp. nov. — MycoBank MB 838763; Fig. 3
Etymology. Name refers to Chinhoyi, the region, from which the ex-type strain of this fungus was collected.
Typus. ZIMBABWE, Chinhoyi, from Zea mays, unknown date and collector (holotype PREM 63215, designated here, culture ex-type NRRL 25221 = BBA 69031 = IMI 375355 = Frank 5bCn8 = DAOM 225149 = CMWF1187 = NY007.I2).
Conidiophores on CLA borne on the aerial mycelium straight or flexuous, erect or prostrate, smooth- and thin-walled; conidiogenous cells mono- and polyphialidic, subcylindrical, smooth- and thin-walled, 11–25 × 2–3.5 μm, without periclinal thickening; microconidia formed on aerial conidiophores, hyaline, oval to ellipsoidal, smooth- and thin-walled, aseptate, (4.5–)5–9(–11) × 2.5–3.5 μm (av. 7 × 3 μm), clustering in discrete false heads at the phialide tips. Sporodochia white to pale yellow, often somewhat translucent, formed abundantly on the surface of carnation leaves and on the agar surface, often covered with aerial mycelium. Sporodochial conidiophores densely aggregated, irregularly and verticillately branched, typically producing dense whorls of terminal phialides; sporodochial conidiogenous cells doliiform to subcylindrical, (8–)10–14(–18) × 2.5–4 μm (av. 12 × 3 μm), smooth- and thin-walled, with periclinal thickening and an inconspicuous apical collarette. Sporodochial conidia straight to falcate, tapering toward the basal part, robust, moderately curved and slender; apical cell more or less equally sized as the adjacent cell, blunt to slightly papillate; basal cell distinctly foot-shaped or barely notched, 2–5-septate, hyaline, thin- and smooth-walled, 2-septate conidia: (20–)22–27(–31) × 2–4 μm (av. 35 × 3 μm; n = 3); 3-septate conidia: (23–)27–38(–42) × 3–4 μm (av. 34 × 4 μm); 4-septate conidia: 40.5 × 3 μm (n = 1). Chlamydospores absent.
Culture characteristics — Colonies on PDA growing in the dark with an average radial growth rate of 5.8–7.3(–7.7–8.5) mm/d and reaching 50–60 mm diam at 25 °C, optimal 25–30 °C (after 7 d). Surface white, flat with abundant aerial mycelia on PDA incubated in dark. Reverse pale yellow (1A2), becoming dark blue at the centre with age. Odour absent. Sporodochia abundant on PDA incubated on constant nuv light.
Additional material examined. SOUTH AFRICA, from soil, Feb. 2018, C.M. Visagie, NY 001.B5.
Notes — This species is phylogenetically closely related to F. mundagurra isolated from soil in Australia (Laurence et al. 2016) and the recently described F. caapi isolated from Brachiaria brizantha from Brazil (Costa et al. 2021). Fusarium mundagurra has 1-septate microconidia and both F. mundagurra and F. caapi abundantly produce chlamydospores in culture, whereas F. chinhoyiense has aseptate microconidia and lacks chlamydospores. Fusarium chinhoyiense shares the common morphological features of those in FFSC, such as lack of chlamydospores, and oval to clavate microconidia. Moreover, microconidia are produced in relatively short chains from phialides forming false heads, somewhat resembling those produced by F. oxysporum rather than most members of the FFSC (Leslie & Summerell 2006). However, F. chinhoyiense is distinguished from F. oxysporum by the absence of chlamydospores. Although F. chinhoyiense also resembles F. subglutinans, the latter species is distinct in producing sterile, coiled hyphae.
Fusarium lactis Pirotta, Arch. Lab. Bot. Crittog. Univ. Pavia 2 & 3: 316. 1879 — Fig. 4
Synonyms. ?Fusarium pyrinum Schwein., Trans. Amer. Philos. Soc., n.s. 4: 302. 1834.
?Fusarium apiogenum Sacc., Syll. Fung. 4: 717. 1886.
Fusarium rubrum Parav., Ann. Mycol. 16: 311. 1918.
Typus. ITALY, Pavia, on clotted milk, 1879, R. Pirotta & G. Riboni (lectotype, MBT 10000413, Arch. Lab. Bot. Crittog. Univ. Pavia 2 & 3, t. 21, f. 1–6, designated here). – USA, California, on Ficus carica, 1994, T. Michailides (epitype, MBT 10000414, B 70 0001686, designated here, culture ex-epitype BBA 68590 = NRRL 25200 = CBS 411.97 = IMI 375351).
Description & Illustrations — See Nirenberg & O‘Donnell (1998), Leslie & Summerell (2006).
Notes — As the type specimen of F. lactis could not be located in PAV or PAD (Herbarium Saccardo), Nirenberg & O’Donnell (1998) neotypified the species based on NRRL 25200 (= BBA 68590 = CBS 411.97 = IMI 375351 = DAOM 225145) which was isolated from Ficus carica in the USA. However, the neotypification of F. lactis by Nirenberg & O’Donnell (1998) was not Code compliant (ICN; Art. 9.13) as an illustration was provided along with the original protologue. Therefore, the original illustration is designated as the lectotype and the neotype of Nirenberg & O‘Donnell (1998) is designated as an epitype.
Fusarium longicornicola Sand.-Den., Yilmaz & Crous, sp. nov. — MycoBank MB 838764; Fig. 5
Etymology. Name refers to the substrate, Aiolopus longicornis, from which the ex-type strain of this fungus was isolated.
Typus. ETHIOPIA, Kobo, Welo, from a grasshopper (Aiolopus longicornis), unknown date and collector (holotype CBS H-24661, designated here, culture ex-type CBS 147247 = NRRL 52706 = ARSEF 6455).
Conidiophores on CLA produced laterally and abundantly on aerial and substrate mycelium, straight or flexuous, smooth- and thin-walled, simple or loosely irregularly and verticillately branched, up to 95 μm tall, copiously proliferating percurrently, or reduced to conidiogenous cells borne laterally on hyphae; conidiogenous cells mono- and polyphialidic, subulate to subcylindrical, smooth- and thin-walled, 11–22.5 μm long, 2.5–4.5 μm at the widest point, periclinal thickening inconspicuous or absent; microconidia formed sparsely, hyaline, ellipsoidal, reniform to subclavate, smooth- and thin-walled, 0(–1)-septate, 5–9.5(–14) × 2–3.5 μm (av. 7.5 × 2.5 μm), clustering in discrete false heads at the phialide tips. Sporodochia pale to bright orange, formed on the surface of carnation leaves. Sporodochial conidiophores densely aggregated, irregularly and verticillately branched, bearing single terminal phialides or groups of 2–3 phialides; sporodochial conidiogenous cells monophialidic, subulate to subcylindrical, 10–16 × 2.5–4 μm, smooth- and thin-walled, with conspicuous periclinal thickening and often with a short apical collarette. Sporodochial conidia falcate, almost straight to moderately dorsiventrally curved, tapering toward the basal part; apical cell blunt to hooked; basal cell barely to distinctly notched, 1–3-septate, hyaline, thin- and smooth-walled, 1-septate conidia: (14.5–)16–21(–23) × 2.5–4 μm (av. 18.7 × 3.2 μm); 2-septate conidia: (18.5–)20–25.5(–28) × 3–4 μm (av. 22.7 × 3.4 μm); 3-septate conidia: (16.5–)21.5–29.5 × 3–5 μm (av. 25.3 × 3.7 μm). Chlamydospores absent.
Culture characteristics — Colonies on PDA growing in the dark with an average radial growth rate of 3–5.7 mm/d and reaching 42–80 mm diam at 25 °C, optimal 20–30 °C after 7 d. Surface velvety to floccose, grey-magenta (13E6–14D4) to red-grey (9B2) towards margin, flat, filamentous to rhizoid with filiform margin. Reverse red-brown (9D6) to red-grey (12E2). Odour absent to mouldy.
Additional isolates examined. ETHIOPIA, Kobo, Welo, from Aiolopus longicornis, unknown date and collector, CBS 147248 = NRRL 52712 = ARSEF 6451; CBS 147249 = NRRL 52713 = ARSEF 6446.
Notes — Pfenning et al. (2019) recently redefined and fixed the typification of F. udum to a well-delimited phylogenetic clade and distinct mating population in the FFSC. Additional isolates previously assigned to F. udum were found not to belong to the current phylogenetic and biological circumscription of the species, most likely representing distinct species. Our phylogenetic and morphological results confirm those observations. The three insecticolous isolates here ascribed to F. longicornicola cluster in a well-differentiated and supported phylogenetic lineage. Apart from its different host association, F. longicornicola differs morphologically from F. udum. The latter species produces only monophialides on its aerial conidiophores, cream coloured sporodochial conidial masses bearing longer and more regularly septate sporodochial conidia, and abundant chlamydospores. The two closest phylogenetic relatives of F. longicornicola, F. phyllophilum and F. xylarioides, are both morphologically distinguishable from the former species. Fusarium phyllophilum mainly differs by lacking sporodochia, although, 5-septate sporodochial conidia are rarely observed in the latter species. Additionally, F. longicornicola differs from F. phyllophilum by its ellipsoidal and reniform microconidia (vs clavate in F. phyllophilum) and ecological traits (insecticolous vs foliicolous in F. phyllophilum; Nirenberg & O’Donnell (1998), Leslie & Summerell (2006)). Differences between F. longicornicola and F. xylarioides are more striking, as the latter species, which is a vascular pathogen of Coffea sp., produces aseptate, allantoid microconidia formed on monophialides only, strongly curved sporodochial conidia and chlamydospores (Gerlach & Nirenberg 1982).
Fusarium ophioides A. Jacobs, T.A. Cout. & Marasas, sp. nov. — MycoBank MB 838783; Fig. 6
Synonym. Fusarium ophioides (as ‘ophiodes’) A. Jacobs, T.A. Cout. & Marasas, Taxonomy of species within the Gibberella fujikuroi complex: 83. 2010, nom. inval. Art 30.9.
Etymology. The specific epithet is from the Greek ophis that means snake and refers to the serpentine hyphae produced by this species in culture.
Typus. SOUTH AFRICA, Mpumulanga, Ngodwana, from Panicum maximum, G. Kemp (holotype CBS H-24659, designated here, culture ex-type CBS 118512 = CMW 18681 = FCC 2979 = FCC 2980 = MRC 6744).
Conidiophores on CLA produced prostrate on substrate mycelium and laterally on aerial mycelium, straight or flexuous, smooth- and thin-walled, rarely simple, commonly sympodially to irregularly branched, up to 190 μm tall, proliferating percurrently; phialides mono- and polyphialidic, subulate to cylindrical, smooth- and thin-walled, 6.5–22.5 μm long, 2.5–4 μm at the widest point, periclinal thickening and collarettes inconspicuous to absent; microconidia hyaline, obovate, ellipsoidal to short falcate, smooth- and thin-walled, 0(–1)-septate, (5–)6.5–15(–20.5) × 2–4.5(–5.5) μm (av. 11 × 3.3 μm), clustering in false heads at the tip of phialides. Mesoconidia falcate, almost straight to moderately dorsiventrally curved, tapering toward the apical part; apical cell pyramidal to slightly hooked; basal cell rounded to barely notched 2–5-septate, hyaline, thin- and smooth-walled, 2-septate conidia: (19.5–)20–27(–28) × 3.5–4.5(–5.5) μm (av. 23.9 × 4.3 μm); 3-septate conidia: (29–)33.5–47(–60) × 3–4.5(–5.5) μm (av. 40.4 × 3.9 μm); 4-septate conidia: (45–)47.5–59.5 × 3–4.5 μm (av. 53.2 × 3.8 μm); 5-septate conidia: (56–)58–66.5 × 3–4.5 μm (av. 62.3 × 3.4 μm), formed abundantly on polyblastic conidiogenous cells on aerial mycelium and conidiophores. Sporodochia luteous to orange, formed on the surface of carnation leaves. Sporodochial conidiophores densely aggregated, irregularly and verticillately branched, bearing single terminal phialides or groups of up to four phialides; sporodochial conidiogenous cells monophialidic, subulate to subcylindrical, 10.5–21 × 2.5–4 μm, smooth- and thin-walled periclinal thickening and collarettes inconspicuous to absent. Sporodochial conidia falcate, almost straight to moderately dorsiventrally curved tapering toward the basal part; apical cell elongated to hooked; basal cell barely to distinctly notched, 2–5-septate, hyaline, thin- and smooth-walled, 2-septate conidia: 23–25 × 3.5–4 μm (av. 24.1 × 3.9 μm); 3-septate conidia: (30.5–)37–54(–60.5) × 3–5 μm (av. 45.3 × 4.1 μm); 4-septate conidia: (49–)53.5–65(–69.5) × 3.5–5 μm (av. 59.2 × 4.3 μm); 5-septate conidia: (53.5–)57–70(–75.5) × 3.5–5.5 μm (av. 63.5 × 4.4 μm). Chlamydospores absent. Sterile, curved hyphae with alternating curvature direction (serpentine hyphae) abundantly formed on the surface of CLA and SNA.
Culture characteristics — Colonies on PDA growing in the dark with an average radial growth rate of 3–5.4 mm/d and reaching 42–76 mm diam at 25 °C, optimal 25–30 °C after 7 d. Surface brown-red (10D8) to violet brown (11E5), velvety to wholly, flat with filiform margin. Reverse grey-ruby (12D4–12E6). Odour absent.
Additional isolates examined. SOUTH AFRICA, Mpumulanga, Ngodwana, from Phragmites mauritianus, G. Kemp, CBS 118509 = CMW 18678 = MRC 6748 = FCC 1092; from Panicum maximum, G. Kemp, CBS 118510 = CMW 18679 = MRC 6747 = FCC 1093, CBS 118511 = CMW 18679 = MRC 6747 = FCC 1093, CBS 118513 = CMW 18682 = MRC 6745 = FCC 2997, CBS 118514 = CMW 18683 = MRC 6750 = FCC 2972, CBS 118515 = CMW 18684 = MRC 6754 = FCC 2974.
Notes — Strains assigned to F. ophioides were isolated during a survey of South African grasses. The species was invalidly described in a doctoral thesis lacking an ISSN number (Art. 30.9). Here, we validate the name based on its original material deposited at the CBS (Jacobs 2010). Moreover, a morphological description is included to account for previously undocumented features, i.e., sporodochia and sporodochial conidia, and the nature of the aerial falcate, multiseptate conidia, here found to emerge singly from well-developed, predominately polyblastic and commonly sympodially proliferating conidiogenous cells, conforming to the description of mesoconidia sensu Pascoe (1990). For additional images and discussions about pathogenicity, mating behaviour and closely related taxa see Jacobs (2010).
Fusarium pilosicola Yilmaz, B.D. Wingf. & Crous, sp. nov. — MycoBank MB 838766; Fig. 7
Etymology. Referring to the substrate, Bidens pilosa, from which the ex-type strain of this fungus was collected.
Typus. USA, Florida, from Bidens pilosa, unknown date and collector (holotype PREM 63216, designated here, culture ex-type NRRL 29124 = CMWF 1183 = NY007.H7).
Conidiophores on CLA sparse on aerial mycelium, straight or flexuous, erect or prostrate, smooth- and thin-walled, commonly unbranched, up to 90 μm tall or reduced to conidiogenous cells borne laterally on hyphae; conidiogenous cells mono- and polyphialidic, subcylindrical, smooth- and thin-walled, 8.5–24 × 2–3.5 μm, without periclinal thickening; microconidia formed on aerial conidiophores, hyaline, oval to ellipsoidal to ovoid, smooth- and thin-walled, mostly aseptate, (5.5–)7–12 × 2–4 μm (av. 9 × 3 μm), rarely 1-septate, 16–19 × 3–4 μm (av. 18 × 4 μm; n = 2), clustering in discrete false heads at the phialide tips. Sporodochia orange or sometimes pale yellow, often somewhat translucent, formed abundantly on the surface of carnation leaves. Sporodochial conidiophores densely aggregated, irregularly and verticillately branched, typically producing dense whorls of 2–4 phialides; sporodochial conidiogenous cells elongated subulate to subcylindrical, 11–24 × 3–4 μm, smooth- and thin-walled, with periclinal thickening and an inconspicuous apical collarette. Sporodochial conidia straight to falcate, tapering toward the basal part, robust, slightly curved and slender or sometimes strongly curved; apical cell papillate; basal cell foot-shaped, (3–)4(–5)-septate, hyaline, thin- and smooth-walled, 3-septate conidia: (33–)44–56 × 4.5–5.5 μm (av. 48.6 × 5 μm; n = 4); 4-septate conidia: (48–)50–70(–75) × 4–6.5 μm (av. 59 × 5 μm); 5-septate conidia: 55–70(–80) × 4–5(–6) μm (av. 66.5 × 5 μm; n = 2). Chlamydospores absent.
Culture characteristics — Colonies on PDA growing in the dark with an average radial growth rate of (6.2–)7.2–7.8 mm/d and reaching 45–55 mm diam at 25 °C, optimal 25 °C after 7 d. Surface floccose, abundantly sporulating on PDA, white interspersed with purple mycelia at 25 °C (orange-pink under light and nuv light). Reverse with dark blue (20F4) centre fading into yellow-white (4A2) to orange-white (5A2) in dark. Odour absent.
Additional isolate examined. USA, Florida, from Bidens pilosa, unknown date and collector, NRRL 29123 = CMWF 1189= NY 007.I4.
Notes — Fusarium pilosicola is a relatively slow-growing species. This species is phylogenetically closely related to F. circinatum and also resembles F. circinatum and F. subglutinans by producing microconidia in false heads. However, F. circinatum is characterised by the formation of sterile, coiled hyphae on SNA and sometimes on CLA, whereas this was not observed for F. pilosicola. On PDA F. subglutinans produces shades of purple pigment ranging from a dark purple to nearly black, whereas F. pilosicola lacks purple pigmentation.
Fusarium proliferatum (Matsush.) Nirenberg ex Gerlach & Nirenberg, Mitt. Biol. Bundesanst. Land-Forstw. 209: 309. 1982 — Fig. 8, ,99
Basionym. Cephalosporium proliferatum Matsush., Microfungi of the Solomon Islands and Papua-New Guinea: 11. 1971.
Synonyms. Fusarium proliferatum (Matsush.) Nirenberg, Mitt. Biol. Bundesanst. Land-Forstw. 169: 38. 1976, nom. inval., Art. 41.3.
Fusarium proliferatum var. minus Nirenberg, Mitt. Biol. Bundesanst. Land-Forstw. 169: 43. 1976, nom. inval., Art. 41.3.
Typus. PAPUA NEW GUINEA, forest soil, Matsushima (lectotype of Cephalosporium proliferatum, MBT 10000437, Matsushima T. 1971. Microfungi of the Solomon Islands and Papua New Guinea: 11, f. 121.2, designated here); Papua New Guinea, Morobe province, Bulolo, forest soil, Nov. 1995, collected by A. Aptroot and isolated by A. van Iperen (epitype, MBT 10000438, CBS 480.96 (metabolically inactive) designated here; cultures ex-epitype CBS 480.96 = IAM 14682 = NRRL 26427 = NY007.B6).
Conidiophores on CLA difficult to locate, sparse on the aerial mycelium, straight or flexuous, erect, smooth- and thin-walled, commonly unbranched or irregularly branched, up to 85 μm tall or reduced to conidiogenous cells borne laterally on hyphae; conidiogenous cells mono- and polyphialidic, subulate, to subcylindrical, smooth- and thin-walled, 7.5–18 × 2–3 μm, without periclinal thickening; microconidia formed sparsely, hyaline, ovoid to pear-shaped, smooth- and thin-walled, aseptate, (5–)6–11(–13) × 2–3(–4) μm (av. 8.5 × 3 μm), rarely 1-septate (11.5–)13–14(–17.5) × 2.5–3.5 μm (av. 14 × 3 μm; n = 3), clustering in discrete false heads at the tip of phialides. Sporodochia white to pale yellow, often somewhat translucent, formed on the surface of carnation leaves. Sporodochial conidiophores densely aggregated, irregularly and verticillately branched, typically producing dense whorls of 2–4 phialides; sporodochial conidiogenous cells monophialidic and polyphialidic, subulate to doliiform, 5.5–18 × 2.5–5 μm, smooth- and thin-walled, with periclinal thickening and an inconspicuous apical collarette. Sporodochial conidia straight to falcate, tapering toward the basal part, robust, moderately curved and slender and sometimes strongly curved; apical cell papillate; basal cell foot-shaped to barely notched, (1–)3(–4)-septate, hyaline, thin- and smooth-walled, 1-septate conidia: (16.5–)20–30(–36.5) × (1.5–)2–3(–4) μm (av. 24 × 3 μm; n = 7); 2-septate conidia: 26–28 × 2–4 μm (n = 1); 3-septate conidia: (28–)30–50(–56) × 2.5–4.5 μm (av. 42.3 × 3.3 μm); 4-septate conidia: 46.5–60.5 × 3–4 μm (n = 2). Chlamydospores absent.
Culture characteristics — Colonies on PDA growing in the dark with an average radial growth rate of 10.3–10.7 mm/d and reaching 69–71 mm diam at 25 °C, optimal 25–30 °C after 7 d. Surface floccose, white to pale pink, abundantly sporulating on PDA incubated in the dark. Reverse with pale greyish ruby (12C7) centre fading into greyish rose (11B3), becoming dark violet to blue at centre with age. Odour absent.
Notes — For original descriptions and illustrations, see Matsushima (1971), Nirenberg (1976) and Gerlach & Nirenberg (1982). Fusarium proliferatum was originally described as Cephalosporium proliferatum by Matsushima and isolated from soil from Papua New Guinea (Matsushima 1971). When Matsushima described the species, it was based on pear-shaped (pyriform) microconidia and striking polyphialides (Fig. 8). The culture (MFC-2683) did not produce any sporodochial conidia. Gams & Lacey (1972) made the assumption that C. proliferatum probably belonged to Fusarium sect. Liseola. In 1976, Nirenberg had the opportunity to examine the ex-type specimen of F. proliferatum (Nirenberg 1976), but also failed to observe any sporodochial conidia. Although isolate NRRL 13289 was preserved in the NRRL collection as ‘type’ of F. proliferatum, it was derived from NRRL 6322 (MRC 1784 = ATCC 76097 = FRC M-1138) which was originally isolated from cotton collected in North Carolina (Marasas et al. 1988). As shown in our results, NRRL 13289 belongs to the F. fujikuroi clade. As there is no living ex-type strain available to serve as phylogenetic anchor for F. proliferatum, we designate the original illustration as lectotype, and CBS 480.96 (same substrate, location and morphology, and deposited in 1995 as F. proliferatum) as epitype for F. proliferatum.
Fusarium sacchari (E.J. Butler) W. Gams, Cephalosporium-artige Schimmelpilze: 218. 1971 — Fig. 10
Basionym. Cephalosporium sacchari E.J. Butler, Mem. Dept. Agric. India, Bot. Ser. 6: 185. 1913.
Synonyms. Fusarium neoceras Wollenw. & Reinking, Phytopathology 15: 164. 1925.
Gibberella sacchari Summerell & J.F. Leslie, Mycologia 97: 719. 2005, nom. illeg., Art. 53.1, non Gibberella sacchari Speg. 1896.
Fusarium desaboruense N. Maryani et al., Persoonia 43: 59. 2019.
Typus. INDIA, from culms of Saccharum officinarum, E.J. Butler (lectotype of Cephalosporium sacchari, MBT 10000416, Mem. Dept. Agric. India, Bot. Ser. 6: 185, pl. II, f. 1–13 (1913), designated here); from Saccharum officinarum, 1975, Schaft (epitype, MBT 10000417, CBS 223.76 (preserved as metabolically inactive culture), designated here, culture ex-epitype CBS 223.76 = BBA 63340 = DAOM 225138 = IMI 202881 = NRRL 13999).
Description & Illustrations — See Gams (1971), Gerlach & Nirenberg (1982), Leslie et al. (2005), Leslie & Summerell (2006).
Notes — Because the original type specimen is no longer available, Leslie et al. (2005) neotypified F. sacchari based on isolate KSU B-03852 (ATCC 201264 = FGSC 7610 = FRC M6865). However, in the protologue of F. sacchari, Butler & Khan (1913) did include an illustration which is designated here as lectotype. This supersedes the neotype (Art. 9.13) designation by Leslie et al. (2005). Therefore, CBS 223.76, isolated from Saccharum officinarum collected in India, is designated here as epitype. Additionally, this ex-epitype isolate has been used as the representative isolate of F. sacchari in recent phylogenetic studies on the F. fujikuroi species complex (O’Donnell et al. 1998, 2013, Herron et al. 2015). The inclusion of a larger sampling of F. sacchari isolates for the multigene phylogenies in this study clearly resolved F. desaboruense (Maryani et al. 2019b), isolated from banana collected in Indonesia, within the F. sacchari clade. Therefore, we consider F. desaboruense as a synonym of F. sacchari. The molecular data also showed that F. sacchari and F. neoceras are conspecific, therefore we synonymize F. neoceras with F. sacchari.
Fusarium subglutinans (Wollenw. & Reinking) P.E. Nelson et al., Fusarium species: An illustrated manual for identification: 135. 1983 — Fig. 11
Basionym. Fusarium moniliforme var. subglutinans Wollenw. & Reinking, Phytopathology 15: 163. 1925.
Synonyms. Gibberella fujikuroi var. subglutinans (Wollenw. & Reinking) E.T. Edwards, Agric. Gaz. New South Wales 44: 895. 1933, Art. F.8.1, Note 2, Exs. 2.
Fusarium moniliforme f. subglutinans (Wollenw. & Reinking) C. Moreau, Rev. Mycol. (Paris) 17: 23. 1952.
Fusarium sacchari var. subglutinans (Wollenw. & Reinking) Nirenberg, Mitt. Biol. Bundesanst. Land-Forstw. 169: 53. 1976.
Gibberella subglutinans (Wollenw. & Reinking) P.E. Nelson et al., Fusarium species: An illustrated manual for identification: 135. 1983.
Typus. USA, Illinois, St. Elmo, from Zea mays, date unknown, J.F. Leslie (neotype of Fusarium moniliforme var. subglutinans MBT 10000418, CBS 747.97 (preserved as metabolically inactive culture), designated here, culture ex-neotype CBS 747.97 = BBA 62451 = DAOM 225141 = FRC M-36 = MRC 8554 = NRRL 22016 = NRRL 22114).
Description & Illustrations — See Booth (1971), Nirenberg (1976, 1981), Nelson et al. (1983), Pascoe (1990), Leslie & Summerell (2006).
Notes — No living type material or holotype specimen is available for F. subglutinans. Therefore, CBS 747.97 (= NRRL 22016) isolated from corn in the USA, is designated as the neotype for this species. Historically, this strain has been used as representative of F. subglutinans in various phylogenetic studies (Zeller et al. 2003, O’Donnell et al. 2013, Herron et al. 2015), and thus we conserve the modern interpretation of this species.
Fusarium succisae J. Schröt. ex Sacc., Syll. Fung. 10: 724. 1892
Synonym. Fusisporium succisae J. Schröt., Hedwigia 13: 180. 1874, nom. inval., Art. 36.1(a).
Typus. GERMANY, Bavaria, Borussia, from Succisa pratensis, 1875, de Thuemen (lectotype, MBT 10000419, ILL00076313 (Thuemen, Mycoth. Univ. nr. 675) designated here); from flower of Succisa pratensis, 1973, H. Nirenberg (epitype, MBT 10000420, IMI 202876, designated here, culture ex-epitype BBA 12287 = BBA 63627 = CBS 219.76 = DAOM 225142 = IMI 202876 = NRRL 13613).
Description & Illustrations — See Nirenberg (1976), Gerlach & Nirenberg (1982).
Notes — This taxon was first described as a species of Fusisporium by Schröter in 1874 and then as a species of Fusarium in 1892 by Saccardo. Although Wollenweber & Reinking (1935) considered this species as a synonym of F. anthophilum (as F. moniliforme var. anthophilum), both Nirenberg (1976) and Gerlach & Nirenberg (1982) recognised this species, indicating CBS 219.76 (= NRRL 13613 = IMI 202876) as a representative isolate of F. succisae. Therefore, this specimen is designated as epitype for this species.
Fusarium verticillioides (Sacc.) Nirenberg, Mitt. Biol. Bundesanst. Land-Forstw. 169: 26. 1976 — Fig. 12, ,1313
Basionym. Oospora verticillioides Sacc., Fung. Ital., Fasc. 17–28: pl. 879. 1881.
Synonyms. Alysidium verticillioides (Sacc.) Kuntze, Revis. Gen. Pl. 3: 442. 1898.
Fusarium moniliforme J. Sheld., Annual Rep. Nebraska Agric. Exp. Sta. 17: 23. 1904.
Gibberella moniliformis Wineland, J. Agric. Res. 28: 909. 1924.
Typus. ITALY, Zea mays, 1877, unknown collector (lectotype of Oospora verticillioides, MBT 10000421, pl. 879 in Saccardo, Fung. Ital. (1881), designated here); GERMANY, on stem of Zea mays, 1968, H. Nirenberg (epitype, MBT 10000422, CBS 218.76 (preserved as metabolically inactive culture), designated here, culture ex-epitype CBS 218.76 = BBA 11782 = DSM 62264 = IMI 202875 = NRRL 13993).
Description & Illustrations — See Nirenberg (1976, 1981), Gerlach & Nirenberg (1982), Leslie & Summerell (2006).
Notes — Fusarium verticillioides was first isolated from maize in Italy in 1877 as Oospora verticillioides (Saccardo 1886) and became known as F. moniliforme after it was associated with animal toxicoses (Sheldon 1904). Nirenberg (1976) synonymised O. verticillioides under F. moniliforme, associated with the sexual morph Gibberella moniliformis (Wineland 1924). Previously, the name F. moniliforme was applied in a broad sense to include at least six, and probably more, reproductively isolated mating populations. Therefore, Seifert et al. (2003) restricted the application of the name F. verticillioides to what is presently known as the mating population A and the main fumonisin producing species. Other mating populations known within the collective ‘F. moniliforme’ group have now been resolved to species level, e.g., F. thapsinum from sorghum, F. sacchari from sugar cane, F. mangiferae from mango and F. fujikuroi from rice (Leslie & Summerell 2006). No type material could be located for the true F. verticillioides as reported by Nirenberg (1976), but the original plate published in Saccardo (1881) is selected as lectotype here. Gerlach & Nirenberg (1982) considered CBS 218.76 an authentic strain of F. verticillioides. Therefore, this metabolically inactive culture is designated as an epitype for F. verticillioides.
DISCUSSION
Fusarium was first described by Link (1809) based on the presence of its distinctive banana- or canoe-shaped conidia as its primary character. From recent taxonomic revisions based on molecular work, we now know that this character does not only apply to Fusarium s.lat., but several other genera (Gräfenhan et al. 2011, Schroers et al. 2011, Lombard et al. 2015, Sandoval-Denis et al. 2019). Throughout history, Fusarium species delineation was based on three main species concepts, namely morphological, biological, and phylogenetic species concepts (Leslie et al. 2001). Today, however, the general consensus is to apply a polyphasic or consilient approach which takes into account as many characters as possible, noting a bias towards phylogenetic data. The biological species concept was widely employed within the FFSC, with at least 11 mating populations identified (Martin et al. 2011). However, several of these mating populations have now been described as new species (Britz et al. 2002, Leslie et al. 2005). A major drawback of this approach is the fact that many Fusarium species have no known sexual morph/cycle and the limited number of isolates that do have a sexual morph/cycle, make crosses cumbersome. Although mycologists try to collect as many strains as possible of a proposed new species, in many cases it is not possible. Indeed, several recently described Fusarium species have been based on one or a few isolates, especially when strains are sequenced for re-identification purposes from culture collections (Nirenberg & O’Donnell 1998, Sandoval-Denis et al. 2018a, b, Al-Hatmi et al. 2019, Lombard et al. 2019a, b). Notably, in a number of cases where descriptions were based on too few strains, or the species were presumed unimportant due to their original ecological niches, these taxa have turned out to be more widely distributed and more economically important than earlier perceived. An example is F. pseudonygamai which was described based on two strains found from Pennisetum typhoides in Africa (Nirenberg & O’Donnell 1998). Since its formal description, this species has been recovered from a much wider range of substrates and locations. These include rice affected by bakanae disease in India, and sugarcane affected by pokkah boeng disease and stalk borer (Eldana saccharina) (McFarlane et al. 2009, Bashyal et al. 2016, Summerell 2019). This shows the importance of introducing names for unique phylogenetic lineages when supported by conclusive genetic and phenotypic evidence. Therefore, in this study, Latin binomials are provided for three phylospecies that have been resolved in previous studies, but remained unnamed (Herron et al. 2015, Laurence et al. 2016, Pfenning et al. 2019).
The FFSC contains 65 accepted species, which include a large number of cryptic species only identifiable based on phylogenetic inference. The purpose of this study was to characterise and describe a large collection of FFSC strains accessioned in the CBS, CMW and NRRL culture collections using a polyphasic approach. Phylogenetic analyses of a five-gene dataset strongly supported the novelty of the three Fusarium phylospecies previously identified, with strong monophyletic statistical support values (Fig. 1).
O’Donnell et al. (1998) concluded that the FFSC includes three main clades classified as the Asian, American and African clades at that time. In this study, we found that the African clade is not monophyletic, and that F. dlaminii and F. fredkrugeri form a separate group (the African clade B), making the use of this informal classification system for the FFSC redundant and confusing. Similar results were also observed in previous studies (Herron et al. 2015, O’Donnell et al. 2000, Sandoval-Denis et al. 2018b). Furthermore, for several species, the relationship between the geographical origin and the proposed informal clade classification is not compatible.
Two of the newly named species in this study, F. chinhoyiense sp. nov. and F. pilosicola sp. nov., were resolved in the core African clade. Two strains of F. chinhoyiense used in this study (NRRL 25221T and NY 001B5) were isolated from Zea mays in Zimbabwe and soil from Limpopo, South Africa, respectively. The closest relative to F. chinhoyiense is F. mundagurra and the recently described species F. caapi (Laurence et al. 2016, Costa et al. 2021). Fusarium chinhoyiense is distinguished from the latter species by the lack of chlamydospores. Additionally, microconidia are produced in sliding chains by F. mundagurra, whereas those of F. chinhoyiense are borne in false heads. Although F. subglutinans also produces microconidia from false heads, its ability to produce distinctive sterile coiled hyphae can easily distinguish it from F. chinhoyiense. Two strains of F. pilosicola were obtained from the NRRL collection (NRRL 29123 and NRRL 29124T) and isolated from Bidens pilosa collected in the USA. Based on phylogenetic inference, F. pilosicola is closely related to F. circinatum, the causal agent of the devastating Pitch canker disease of several Pinus species. This species readily produces orange sporodochia with abundant sporodochial conidia, whereas F. circinatum does not readily produce sporodochia and produces sterile hyphal coils which were not observed in this study for F. pilosicola (Leslie & Summerell 2006). Additionally, the basal cells of sporodochial conidia in F. pilosicola are well-developed in contrast to those of F. circinatum. There are a number of species that are morphologically similar to F. pilosicola due to the production of microconidia in false heads, including F. bulbicola, F. circinatum, F. guttiforme, F. mangiferae, F. pseudocircinatum, F. sacchari, F. subglutinans and F. sterilihyphosum (Leslie & Summerell 2006). Many of these species are quite difficult to differentiate from one another unless molecular markers are used.
Fusarium longicornicola sp. nov. was resolved in the African core clade in this study (Fig. 1). The species was isolated from the tef grasshopper (Aiolopus longicornis) from Ethiopia. The isolates were originally identified as F. udum by O’Donnell et al. (2012). However, Pfenning et al. (2019) illustrated that they do not cluster with other F. udum s.str. strains and suggested that they may represent a distinct species. Unfortunately, no morphological data are available for these isolates at present, and therefore in this study we described the species as F. longicornicola.
Fusarium is regarded as one of the most important fungal genera known and therefore in much need of a stable and concise taxonomy. Especially as it is now recognised that species of this genus can adjust rapidly to climate change, have the ability to move into new ecosystems and cause diseases on new crops, highlighting the importance of accurate species identification (Maryani et al. 2019a). The newly described Fusarium species in this study have not been linked to any pathogenicity on their hosts. However, they should not be ignored as the host range of several species in the FFSC have not yet been determined. For some researchers it may be irrelevant to describe species without information pertaining to its pathogenic and/or mycotoxigenic potential. Regardless, it is still of utmost importance to better understanding the biodiversity and phylogeographical range of a specific Fusarium species. Even though some of the newly proposed species constitute a single lineage in this study, providing Latin binomials for these will allow the opportunity to more easily find additional isolates of these species in future studies.
One of the most important concepts and cornerstone of a stable fungal taxonomy system is the correct application of types. These specimens and living ex-type strains play a fundamental role to provide anchorage for species names in especially taxonomic phylogenetic studies of a particular fungal group that suffers from an inconsistent taxonomic system. In practical terms, it also serves as the foundation to make informed morphological or phylogenetic comparisons. Ideally, having a living ex-type strain with all associated metadata including high quality DNA sequences along with multiple strains of the same species would provide essential information on the infra-species variation found in a certain species.
A perturbing issue for several older Fusarium species/names is the lack of nomenclatural types that are either not available or have been lost. The International Code of Nomenclature for algae, fungi, and plants allows for re-typification in these cases, when material from the original protologue (like a drawing or exsiccate) can be applied as lectotype (Art. 9.3) and a new specimen/strain can then be designated as epitype/ex-epitype. Therefore, in this study, lectotypes could be designated for F. anthophilum, F. lactis, F. proliferatum, F. sacchari, F. succisae and F. verticillioides to provide taxonomic stability for these established species. Furthermore, a neotype is designated for F. subglutinans, as no authentic material linked to the original protologue, could be located.
Fusarium anthophilum is a cosmopolitan fungus and found on various plant species in temperate regions (Leslie & Summerell 2006). It is known to produce beauvericin, fumonisins, fusaproliferin and moniliformin (Munkvold 2017). The type specimen from the original description by Braun (1875) was not available. Therefore, the original protologue’s illustration is designated as the lectotype and CBS 222.76 isolated from a stem of Euphorbia pulcherrima collected in Germany designated as an epitype.
Fusarium lactis was described by two Italian mycologists, Pirotta and Riboni, on clotted milk from Pavia, Italy (Pirotta & Riboni 1879). It produces beauvericin, and some of the isolates produce moniliformin and fumonisin B1 (Yang et al. 2011, Munkvold 2017). This species is also a known pathogen of fig (Ficus carica; Nirenberg & O’Donnell 1998) and sweet pepper (Capsicum annuum; Yang et al. 2009). As no living type material for F. lactis was available, Nirenberg & O’Donnell (1998) neotypified the species. However, a drawing as part of the original protologue (Fig. 4) is available, and therefore is designated as the lectotype here, and the neotype of Nirenberg & O‘Donnell (1998) is designated as an epitype.
Fusarium sacchari is the causal agent for pokkah boeng of sugarcane and also causes mycotic keratitis among the sugarcane farmers in North India (Bansal et al. 2016, Costa et al. 2019, Viswanathan 2020). Fusarium sacchari was first described as Cephalosporium sacchari from sugarcane in India (Butler & Khan 1913). The protologue of the species did not include any mention of sporodochial conidia. Later, Wollenweber & Reinking (1925) described several cultures that produced sporodochial conidia as Fusarium neoceras (CBS 147.25, the ex-holotype of F. neoceras). However, Gams (1971) synonymised the two names, which is further supported by the molecular data in O’Donnell et al. (1998) and this study. Since the original type specimen is not available, Leslie et al. (2005) neotypified F. sacchari. However, the original illustration by Butler & Khan (1913; Fig. 10) designated here as lectotype, invalidates the neotype of Leslie et al. (2005). Therefore, in this study, CBS 223.76 isolated from Saccharum officinarum in India is designated as epitype for this species. In addition, the multigene phylogeny resolved the recently described F. desaboruense (Maryani et al. 2019b) within the F. sacchari clade and therefore, the later species is synonymised under F. sacchari.
Fusarium succisae was first described as a species of Fusisporium by Schröter in 1874 and subsequently transferred to the genus Fusarium in 1892 by Saccardo. It was originally isolated from Succisa pratensis in Germany. It is not known to produce mycotoxins and limited information is available on the ecology and biology of this species (Leslie & Summerell 2006). No living ex-type strain exists for this species although an illustration accompanying the original protologue is available, which is designated as the lectotype. This, in turn, allows for CBS 219.76 to be designated as epitype here, which shares the same substrate and the locality as indicated in the original protologue.
Fusarium verticillioides is the most common pathogen on maize and found throughout the world wherever maize is cultivated (Leslie & Summerell 2006). It causes Fusarium ear rot on maize and results in significant yield losses and reduction of grain quality (Leslie & Summerell 2006). It is also known to be isolated from different grains including millet, sorghum and sunflower (Leslie & Summerell 2006). Fusarium verticillioides is known to produce fumonisins which cause fatal livestock diseases and are considered potentially carcinogenic mycotoxins for humans, especially in China and Southern Africa. It is also known to produce beauvericin, fusaric acid and fusarisins (Munkvold 2017). Fusarium verticillioides was traditionally known as the A-mating population of F. moniliforme s.lat. Even though the key characters of F. verticillioides were illustrated by Leslie & Summerell (2006), we provided a photographic plate illustrating F. verticillioides based on the epitype (CBS 218.76; Fig. 13).
Fusarium subglutinans is an important cosmopolitan maize pathogen which causes seedling disease, stalk and ear rot (Moretti et al. 1995, Steenkamp et al. 2002). The production of mycotoxins might differ from strain to strain but little to no fumonisins are generally produced by this species (Desjardins et al. 2000, Proctor et al. 2004, Fumero et al. 2015, 2020). However, F. subglutinans is known to produce beauvericin, fusaric acid, moniliformin, and high levels of fusaproliferin which are known to be emerging mycotoxins (Fumero et al. 2015, 2020). Even though it is a very well-known and used species name, no living type material or holotype specimen are available for this important cereal pathogen and mycotoxin producer. Therefore, CBS 747.97 is designated as neotype to facilitate a stable taxonomy for this species. Both F. acutatum and F. ophioides were invalidly published, and are therefore validated in this study.
Fusarium marasasianum, F. parvisorum, F. pininemorale and F. sororula were originally described by Herron et al. (2015) from diseased Pinus species collected in Colombian plantations and nurseries. Ex-type cultures for these taxa were subsequently deposited in the CBS culture collection. DNA sequences generated from the ex-type cultures of F. marasasianum, F. parvisorum and F. sororula resolved these taxa within the F. circinatum clade. While some isolates for F. marasasianum, F. pininemorale and F. sororula correspond with the placement obtained by Herron et al. (2015), all F. parvisorum isolates deposited at the CMW and CBS collection resolved as F. circinatum. Therefore, in our study we used the tef1 and tub2 sequences that were submitted to GenBank by Herron et al. (2015) (Fig. 1). Wingfield et al. (2017) released the full genome sequence for F. pininemorale (CMW 25243), while unpublished whole genome sequences for F. marasasianum (CMW 25512) and F. sororula (CMW 25513) were recently generated (De Vos et al. pers. comm.). Gene regions of phylogenetic interest were extracted from these genomes and the resulting multigene phylogeny suggest that F. pininemorale and F. marasasianum are conspecific, with F. pininemorale resolving as close relative to F. sororula (Fig. 1). Considering the significant uncertainty and confusion related to the ex-type cultures available for these taxa, a future study will be required to generate sequence data from the dried holotype specimens deposited at PREM (fungarium of the National Collections of Fungi hosted at the Agricultural Research Council, Roodeplaat, South Africa) in order to resolve their phylogeny.
Fusarium proliferatum isolates are known to cause diseases in maize, sorghum, mango and asparagus (Leslie & Summerell 2006). They are also known to produce beauvericin, enniatins, fumonisins, fusaproliferin, fusaric acid, fusarins and moniliformin (Munkvold 2017). Even though F. proliferatum is a well-studied species, from the taxonomic point of view the name remains phylogenetically unresolved. Fusarium proliferatum was first described as Cephalosporium proliferatum by Matsushima (1971) and renamed as a Fusarium species by Nirenberg (1976). Unfortunately, the ex-type culture of F. proliferatum has not been preserved. Therefore, the identification of F. proliferatum isolates has mostly been based on the morphological concept derived by Nirenberg (1976). During our survey, we included a representative reference strain in the WI collection (CBS 480.96), which was isolated from the same substrate (forest soil) and location (Papua New Guinea) as the original Cephalosporium proliferatum. Morphological characters of this strain also match both the original description of Matsushima (1971) and Nirenberg (1976), with the addition of sporodochial formation. In the multi-gene phylogenies, however, CBS 480.96 resolved on a distinct branch to isolates which were traditionally identified as F. annulatum/proliferatum (Fig. 1). To bring taxonomic stability to F. proliferatum, the original line drawing in Matsushima (1971) is designated as lectotype, and CBS 480.96 as epitype of F. proliferatum. O’Donnell et al. (1998) demonstrated that the ex-type of F. annulatum (CBS 258.54) groups together with other isolates previously identified as ‘F. proliferatum’, which is confirmed here in our phylogenetic analysis. Fusarium annulatum is a species described by Bugnicourt (1952), based on a single isolate from Oryza sativa, New Caledonia. According to the original description by Bugnicourt (1952), F. annulatum produces microconidia in chains from false heads on abundant mono- and polyphialides. Sporodochial conidia are thin-walled, strongly curved and almost ring-shaped, with the basal cell distinctly foot-shaped, and chlamydospores are absent. Nelson et al. (1983) mentioned that F. annulatum is essentially a F. proliferatum with strongly curved sporodochial conidia. The resulting confusion in literature is largely based on the fact that the ex-type strain of F. annulatum is atypical for the species, as most isolates of F. annulatum actually only produce straight macroconidia (see Fig. 2). To further understand variation within this complex, whole-genome sequences of the ex-epitype of F. proliferatum and ex-type of F. annulatum will be generated as a follow-up study. A stable and robust taxonomy is anchored by the availability of ex-type material which acts as the reference point and anchor for phylogenetic analyses. Therefore epi- and/or neotypification plays a very important and crucial role in the classification of Fusarium species, especially those that produce mycotoxins and cause diseases of animals, humans and plants.
Acknowledgments
Jenna-Lee Price and Nicole van Vuuren are thanked for their assistance with PCR amplifications. We also thank Jane Baile Ramaswe for her assistance in receiving the NRRL cultures sent to the CMWF collection. We acknowledge Konstanze Bensch (MycoBank curator) and Uwe Braun (Geobotanik und Botanischer Garten, Martin-Luther-Universität Halle-Wittenberg, Halle, Germany) for their help regarding Latin names. Members of the Tree Protection Co-Operative Programme (TPCP), the Department of Science and Technology (DST) and the National Research Foundation (NRF) are acknowledged for financial support. We are very grateful to the reviewers whose suggestions helped to improve this manuscript.
Supplementary material
Phylogeny of the tub2 gene region of species from Fusarium fujikuroi species complex. Fusarium nirenbergiae (CBS 744.97) was selected as out-group. Strains belonging to new species are indicated in bold. Bootstrap values (≥ 80 %) are indicated above branches. T = Ex-type, NT = neotype, ET = epitype. aEx-type of F. neoceras (CBS 147.25), bIsolates previously described as F. desaboruense (Maryani et al. 2019b).
Phylogeny of the cmdA gene region of species from Fusarium fujikuroi species complex. Fusarium nirenbergiae (CBS 744.97) was selected as out-group. Strains belonging to new species are indicated in bold. Bootstrap values (≥ 80 %) are indicated above branches. T = Ex-type, NT = neotype, ET = epitype. aEx-type of F. neoceras (CBS 147.25).
Phylogeny of the rpb1 gene region of species from Fusarium fujikuroi species complex. Fusarium nirenbergiae (CBS 744.97) was selected as out-group. Strains belonging to new species are indicated in bold. Bootstrap values (≥ 80 %) are indicated above branches. T = Ex-type, NT = neotype, ET = epitype. aEx-type of F. neoceras (CBS 147.25).
Phylogeny of the rpb2 gene region of species from Fusarium fujikuroi species complex. Fusarium nirenbergiae (CBS 744.97) was selected as out-group. Strains belonging to new species are indicated in bold. Bootstrap values (≥ 80 %) are indicated above branches. T = Ex-type, NT = neotype, ET = epitype. apreviously described as F. desaboruense (Maryani et al. 2019b).
Phylogeny of the tef1 gene region of species from Fusarium fujikuroi species complex. Fusarium nirenbergiae (CBS 744.97) was selected as out-group. Strains belonging to new species are indicated in bold. Bootstrap values (≥ 80 %) are indicated above branches. T = Ex-type, NT = neotype, ET = epitype. aEx-type of F. neoceras (CBS 147.25).
REFERENCES
- Akaike H. 1974. A new look at the statistical model identification. IEEE Transations on Automatic Control 19: 716–723. [Google Scholar]
- Al-Hatmi AMS, Hagen F, Menken SBJ, et al. . 2016a. Global molecular epidemiology and genetic diversity of Fusarium, a significant emerging group of human opportunists from 1958 to 2015. Emerging Microbes & Infections 5: e124. [Europe PMC free article] [Abstract] [Google Scholar]
- Al-Hatmi AMS, Mirabolfathy M, Hagen F, et al. . 2016b. DNA barcoding, MALDI-TOF, and AFLP data support Fusarium ficicrescens as a distinct species within the Fusarium fujikuroi species complex. Fungal Biology 120: 265–278. [Abstract] [Google Scholar]
- Al-Hatmi AMS, Sandoval-Denis M, Nabet C, et al. . 2019. Fusarium volatile a new potential pathogen from a human respiratory sample. Fungal Systematics and Evolution 4: 171–181. [Europe PMC free article] [Abstract] [Google Scholar]
- Aoki T, O’Donnell K, Geiser DM. 2014. Systematics of key phytopathogenic Fusarium species: current status and future challenges. Journal of General Plant Pathology 80: 189–201. [Google Scholar]
- Aoki T, Smith JA, Mount LL, et al. . 2013. Fusarium torreyae sp. nov., a pathogen causing canker disease of Florida torreya (Torreya taxifolia), a critically endangered conifer restricted to northern Florida and southwestern Georgia. Mycologia 105: 312–319. [Abstract] [Google Scholar]
- Bansal Y, Chander J, Kaistha N, et al. . 2016. Fusarium sacchari, a cause of mycotic keratitis among sugarcane farmers – a series of four cases from North India. Mycoses 59: 705–709. [Abstract] [Google Scholar]
- Bashyal BM, Aggarwal R, Sharma S, et al. . 2016. Single and combined effects of three Fusarium species associated with rice seeds on the severity of bakanae disease of rice. The Journal of Plant Pathology 98: 405–415. [Google Scholar]
- Booth C. 1971. The genus Fusarium. International Mycological Institute, Kew: 1–234. [Google Scholar]
- Braun A. 1875. Rabenhorstii Fungi europaei exsiccati no: 1964. [Google Scholar]
- Britz H, Steenkamp ET, Coutinho TA, et al. . 2002. Two new species of Fusarium section Liseola associated with mango malformation. Mycologia 94: 722–730. [Abstract] [Google Scholar]
- Bugnicourt F. 1952. Une espèce fusarienne nouvelle, parasite du riz. Revue Génerale de Botanique 59: 13–18. [Google Scholar]
- Burgess LW, Trimboli D. 1986. Characterization and distribution of Fusarium nygamai, sp. nov. Mycologia 78: 223–229. [Google Scholar]
- Butler EJ, Khan AH. 1913. Some new sugarcane diseases. Memoirs of the Department of Agriculture in India, Botanical Series 6: 185–190. [Google Scholar]
- Costa MM, Melo MP, Carmo FS, et al. . 2021. Fusarium species from tropical grasses in Brazil and description of two new taxa. Mycological Progress 20: 61–72. [Google Scholar]
- Costa MM, Melo MP, Guimarães EA, et al. . 2019. Identification and pathogenicity of Fusarium species associated with pokkah boeng of sugarcane in Brazil. Plant Pathology 68: 1350–1360. [Google Scholar]
- Crous PW, Verkley GJM, Groenewald JZ, et al., editors. . (eds). 2019a. Fungal Biodiversity. Westerdijk Laboratory Manual Series 1: 1–425. Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands. [Google Scholar]
- Crous PW, Wingfield MJ, Lombard L, et al. . 2019b. Fungal Planet description sheets: 951–1041. Persoonia 43: 223–425. [Europe PMC free article] [Abstract] [Google Scholar]
- Dean R, Van Kan JAL, Pretorius ZA, et al. . 2012. The top 10 fungal pathogens in molecular plant pathology. Molecular Plant Pathology 13: 414–430. [Europe PMC free article] [Abstract] [Google Scholar]
- Desjardins AE, Plattner RD, Gordon TR. 2000. Gibberella fujikuroi mating population A and Fusarium subglutinans from teosinte species and maize from Mexico and Central America. Mycological Research 104: 865–872. [Google Scholar]
- Domsch KH, Gams W, Anderson TH. 2007. Compendium of soil fungi ed. 2. Eching, IHW Verlag. [Google Scholar]
- Edwards J, Auer D, De Alwis SK, et al. . 2016. Fusarium agapanthi sp. nov., a novel bikaverin and fusarubin-producing leaf and stem spot pathogen of Agapanthus praecox (African lily) from Australia and Italy. Mycologia 108: 981–992. [Abstract] [Google Scholar]
- Farr DF, Rossman AY. 2021. Fungal Databases, U.S. National Fungus Collections, ARS, USDA. Retrieved March 11. [Google Scholar]
- Fisher NL, Burguess LW, Toussoun TA, et al. . 1982. Carnation leaves as a substrate and for preserving cultures of Fusarium species. Phytopathology 72: 151–153. [Google Scholar]
- Fumero MV, Reynoso MM, Chulze S. 2015. Fusarium temperatum and Fusarium subglutinans isolated from maize in Argentina. International Journal of Food Microbiology 199: 86–92. [Abstract] [Google Scholar]
- Fumero MV, Villani A, Susca A, et al. . 2020. Fumonisin and beauvericin chemotypes and genotypes of the sister species Fusarium subglutinans and Fusarium temperatum. Applied and Environmental Microbiology 86: e00133-20. [Europe PMC free article] [Abstract] [Google Scholar]
- Gams W. 1971. Cephalosporium artige Schimmelpilze (Hyphomycetes). Gustav Fischer Verlag, Stuttgart, Germany. [Google Scholar]
- Gams W, Lacey J. 1972. Cephalosporium-like hyphomycetes. Two species of Acremonium from heated substrates. Transactions of the British Mycological Society 59: 519–522. [Google Scholar]
- Geiser DM, Ivey MLL, Hakiza G, et al. . 2005. Gibberella xylarioides (anamorph: Fusarium xylarioides), a causative agent of coffee wilt disease in Africa, is a previously unrecognized member of the G. fujikuroi species complex. Mycologia 97: 191–201. [Abstract] [Google Scholar]
- Geiser DM, Jiménez-Gasco MdM, Kang S, et al. . 2004. FUSARIUM-ID v. 1.0: a DNA sequence database for identifying Fusarium. European Journal of Plant Pathology 110: 473–479. [Google Scholar]
- Gerlach W, Nirenberg HI. 1982. The genus Fusarium – a pictorial atlas. Mitteilungen der Biologischen Bundesanstalt für Land- und Forstwirtschaft Berlin-Dahlem 209: 1–406. [Google Scholar]
- Gräfenhan T, Schroers H-J, Nirenberg HI, et al. . 2011. An overview of the taxonomy, phylogeny and typification of nectriaceous fungi in Cosmospora, Acremonium, Fusarium, Stilbella and Volutella. Studies in Mycology 68: 79–113. [Europe PMC free article] [Abstract] [Google Scholar]
- Herron DA, Wingfield MJ, Wingfield BD, et al. . 2015. Novel taxa in the Fusarium fujikuroi species complex from Pinus spp. Studies in Mycology 80: 131–150. [Europe PMC free article] [Abstract] [Google Scholar]
- Hoang DT, Chernomor O, von Haeseler A, et al. . 2018. UFBoot2: improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 35: 518–522. [Europe PMC free article] [Abstract] [Google Scholar]
- Hofstetter V, Miadlikowska J, Kauff F, et al. . 2007. Phylogenetic comparison of protein-coding versus ribosomal RNA-coding sequence data: a case study of the Lecanoromycetes (Ascomycota). Molecular Phylogenetics and Evolution 44: 412–426. [Abstract] [Google Scholar]
- Jacobs A. 2010. Taxonomy of species within Gibberella fujikuroi complex. Doctoral thesis, University of Pretoria, Pretoria, South Africa. http://hdl.handle.net/2263/30857. [Google Scholar]
- Jain PK, Gupta VK, Misra AK, et al. . 2011. Current status of Fusarium infection in human and animal. Asian Journal of Animal and Veterinary Advances 6: 201–227. [Google Scholar]
- Kalyaanamoorthy S, Minh BQ, Wong TKF, et al. . 2017. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. [Europe PMC free article] [Abstract] [Google Scholar]
- Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. [Europe PMC free article] [Abstract] [Google Scholar]
- Kornerup A, Wanscher JH. 1967. Methuen Handbook of Colour. 2nd edn. Methuen & Co Ltd, London, England. [Google Scholar]
- Kwasna H, Chelkowski J, Zajkowski P. 1991. Grzyby (Mycota) tom XXII. Sierpik (Fusarium). Polska Akademia Nauk, Flora Polska, Warsaw, Poland. [Google Scholar]
- Laraba I, Kim HS, Proctor RH, et al. . 2020. Fusarium xyrophilum, sp. nov., a member of the Fusarium fujikuroi species complex recovered from pseudoflowers on yellow-eyed grass (Xyris spp.) from Guyana. Mycologia 112: 39–51. [Abstract] [Google Scholar]
- Laurence MH, Walsh JL, Shuttleworth LA, et al. . 2016. Six novel species of Fusarium from natural ecosystems in Australia. Fungal Diversity 77: 349–366. [Google Scholar]
- Leslie JF, Summerell BA. 2006. The Fusarium laboratory manual. Blackwell Publishing, Ames. [Google Scholar]
- Leslie JF, Summerell BA, Bullock S, et al. . 2005. Description of Gibberella sacchari and neotypification of its anamorph Fusarium sacchari. Mycologia 97: 718–724. [Abstract] [Google Scholar]
- Leslie JF, Zeller KA, Summerell BA. 2001. Icebergs and species in populations of Fusarium. Physiological and Molecular Plant Pathology 59: 107–117. [Google Scholar]
- Lima CS, Pfenning LH, Costa SS, et al. . 2012. Fusarium tupiense sp. nov., a member of the Gibberella fujikuroi complex that causes mango malformation in Brazil. Mycologia 104: 1408–1419. [Abstract] [Google Scholar]
- Link HF. 1809. Observationes in ordines plantarum naturales. Dissertatio I. Magazin der Gesellschaft Naturforschenden Freunde Berlin 3: 3–42. [Google Scholar]
- Liu YJ, Whelen S, Hall BD. 1999. Phylogenetic relationships among ascomycetes: evidence from an RNA polymerase II subunit. Molecular Phylogenetics and Evolution 16: 1799–1808. [Abstract] [Google Scholar]
- Lombard L, Sandoval-Denis M, Lamprecht SC, et al. . 2019a. Epitypification of Fusarium oxysporum – clearing the taxonomic chaos. Persoonia 43: 1–47. [Europe PMC free article] [Abstract] [Google Scholar]
- Lombard L, Van der Merwe NA, Groenewald JZ, et al. . 2015. Generic concepts in Nectriaceae. Studies in Mycology 80: 189–245. [Europe PMC free article] [Abstract] [Google Scholar]
- Lombard L, Van Doorn R, Crous PW. 2019b. Neotypification of Fusarium chlamydosporum – a reappraisal of a clinically important species complex. Fungal Systematics and Evolution 5: 183–200. [Europe PMC free article] [Abstract] [Google Scholar]
- Marasas WFO, Nelson PE, Toussoun TA. 1985. Fusarium dlamini, a new species of Fusarium from southern Africa. Mycologia 77: 971–975. [Google Scholar]
- Marasas WFO, Nelson PE, Toussoun TA. 1988. Reclassification of two important moniliformin-producing strains of Fusarium, NRRL 6022 and NRRL 6322. Mycologia 80: 407–410. [Google Scholar]
- Marasas WFO, Rabie CJ, Lübben A, et al. . 1987. Fusarium napiforme, a new species from millet and sorghum in southern Africa. Mycologia 79: 910–914. [Google Scholar]
- Martin SH, Wingfield BD, Wingfield MJ, et al. . 2011. Structure and evolution of the Fusarium mating type locus: new insights from the Gibberella fujikuroi complex. Fungal Genetics and Biology 48: 731–740. [Abstract] [Google Scholar]
- Maryani N, Lombard L, Poerba Y, et al. . 2019a. Phylogeny and genetic diversity of the banana Fusarium wilt pathogen Fusarium oxysporum f. sp. cubense in the Indonesian centre of origin. Studies in Mycology 92: 155–194. [Europe PMC free article] [Abstract] [Google Scholar]
- Maryani N, Sandoval-Denis M, Lombard L, et al. . 2019b. New endemic Fusarium species hitch-hiking with pathogenic Fusarium strains causing Panama disease in small-holder banana plots in Indonesia. Persoonia 43: 48–69. [Europe PMC free article] [Abstract] [Google Scholar]
- Matsushima T. 1971. Microfungi of the Solomon Islands and Papua-New Guinea. Nippon Printing Publ. Co., Kobe. [Google Scholar]
- McFarlane SA, Govender P, Rutherford RS. 2009. Interactions between Fusarium species from sugarcane and the stalk borer, Eldana saccharina (Lepidoptera: Pyralidae). Annals of Applied Biology 155: 349–359. [Google Scholar]
- Minh BQ, Hahn MW, Lanfear R. 2020a. New methods to calculate concordance factors for phylogenomic datasets. Molecular Biology and Evolution 37: 2727–2733. [Europe PMC free article] [Abstract] [Google Scholar]
- Minh BQ, Schmidt HA, Chernomor O, et al. . 2020b. IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Molecular Biology and Evolution. 37: 1530–1534. [Europe PMC free article] [Abstract] [Google Scholar]
- Moretti A, Logerico A, Bottalico A, et al. . 1995. Beauvericin production by Fusarium subglutinans from different geographical areas. Mycological Research 99: 282–286. [Google Scholar]
- Munkvold GP. 2017. Fusarium species and their associated mycotoxins. In: Moretti A, Susca A, editors. (eds), Mycotoxigenic fungi: methods and protocols: 51–106. Humana Press, Totowa, NJ, USA. [Abstract] [Google Scholar]
- Nelson PE, Toussoun TA, Marasas WFO. 1983. Fusarium species: An illustrated manual for identification. Pennsylvania State University Press, University Park, PA. [Google Scholar]
- Nguyen LT, Schmidt HA, Von Haeseler A, et al. . 2015. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32: 268–274. [Europe PMC free article] [Abstract] [Google Scholar]
- Nirenberg HI. 1976. Untersuchungen über die morphologische und biologische Differenzierung in der Fusarium-Sektion Liseola. Mitteilungen der Biologischen Bundesanstalt für Land- und Forstwirtschaft Berlin-Dahlem 169: 1–117. [Google Scholar]
- Nirenberg HI. 1981. A simplified method for identifying Fusarium spp. occurring on wheat. Canadian Journal of Botany 59: 1599–1609. [Google Scholar]
- Nirenberg HI, O’Donnell K. 1998. New Fusarium species and combinations with in the Gibberella fujikuroi species complex. Mycologia 90: 434–458. [Google Scholar]
- Nylander AJJ. 2004. MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University. [Google Scholar]
- O’Donnell K, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics and Evolution 7: 103–116. [Abstract] [Google Scholar]
- O’Donnell K, Cigelnik E, Nirenberg HI. 1998. Molecular systematics and phylogeography of the Gibberella fujikuroi species complex. Mycologia 90: 465–493. [Google Scholar]
- O’Donnell K, Humber RA, Geiser DM, et al. . 2012. Phylogenetic diversity of insecticolous fusaria inferred from multilocus DNA sequence data and their molecular identification via FUSARIUM-ID and Fusarium MLST. Mycologia 104: 427–445. [Abstract] [Google Scholar]
- O’Donnell K, McCormick SP, Busman M, et al. . 2018. Marasas et al. 1984 ‘Toxigenic Fusarium Species: Identity and Mycotoxicology’ revisited. Mycologia 110: 1058–1080. [Abstract] [Google Scholar]
- O’Donnell K, Nirenberg HI, Aoki T, et al. . 2000. A multigene phylogeny of the Gibberella fujikuroi species complex: Detection of additionally phylogenetically distinct species. Mycoscience 41: 61–78. [Google Scholar]
- O’Donnell K, Rooney AP, Proctor RH, et al. . 2013. Phylogenetic analyses of RPB1 and RPB2 support a middle Cretaceous origin for a clade comprising all agriculturally and medically important fusaria. Fungal Genetics and Biology 52: 20–31. [Abstract] [Google Scholar]
- O’Donnell K, Sarver BA, Brandt M, et al. . 2007. Phylogenetic diversity and microsphere array-based genotyping of human pathogenic Fusaria, including isolates from the multistate contact lens-associated U.S. keratitis outbreaks of 2005 and 2006. Journal of Clinical Microbiology 45: 2235–2248. [Europe PMC free article] [Abstract] [Google Scholar]
- O’Donnell K, Sutton DA, Rinaldi MG, et al. . 2010. Internet-accessible DNA sequence database for identifying fusaria from human and animal infections. Journal of Clinical Microbiology 48: 3708–3718. [Europe PMC free article] [Abstract] [Google Scholar]
- Otero-Colina G, Rodriguez-Alvarado G, Fernandez-Pavia S, et al. . 2010. Identification and characterization of a novel etiological agent of mango malformation disease in Mexico, Fusarium mexicanum sp. nov. Phytopathology 100: 1176–1184. [Abstract] [Google Scholar]
- Pascoe IG. 1990. Fusarium morphology I. Identification and characterization of a third conidial type, the mesoconidium. Mycotaxon 37: 121–160. [Google Scholar]
- Pfenning LH, De Melo MP, Costa MM, et al. . 2019. Fusarium udum revisited: a common, but poorly understood member of the Fusarium fujikuroi species complex. Mycological Progress 18: 107–117. [Google Scholar]
- Pirotta R, Riboni G. 1879. Studii sul latte. Archivio del Laboratorio Botanico Crittogamico dell Ùniversità di Pavia 2: 316–317. [Google Scholar]
- Proctor RH, Plattner RD, Brown DW, et al. . 2004. Discontinuous distribution of fumonisin biosynthetic genes in the Gibberella fujikuroi species complex. Mycological Research 108: 815–822. [Abstract] [Google Scholar]
- Proctor RH, Van Hove F, Susca A, et al. . 2013. Birth, death and horizontal transfer of the fumonisin biosynthetic gene cluster during the evolutionary diversification of Fusarium. Molecular Microbiology 90: 290–306. [Abstract] [Google Scholar]
- Reeb V, Lutzoni F, Roux C. 2004. Contribution of RPB2 to multilocus phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming Acarosporaceae and evolution of polyspory. Molecular Phylogenetics and Evolution 32: 1036–1060. [Abstract] [Google Scholar]
- Ronquist F, Teslenko M, Van der Mark P, et al. . 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. [Europe PMC free article] [Abstract] [Google Scholar]
- Saccardo PA. 1881. Fungi italici atographice delinati. Patavii. [Google Scholar]
- Saccardo PA. 1886. Sylloge Hyphomycetum. Sylloge Fungorum IV. [Google Scholar]
- Saccardo PA. 1892. Sylloge Fungorum Omnium Hucusque Cognitorum 10: 724. [Google Scholar]
- Sandoval-Denis M, Guarnaccia V, Polizzi G, et al. . 2018a. Symptomatic Citrus trees reveal a new pathogenic lineage in Fusarium and two new Neocosmospora species. Persoonia 40: 1–25. [Europe PMC free article] [Abstract] [Google Scholar]
- Sandoval-Denis M, Lombard L, Crous PW. 2019. Back to the roots: a reappraisal of Neocosmospora. Persoonia 43: 90–185. [Europe PMC free article] [Abstract] [Google Scholar]
- Sandoval-Denis M, Swart WJ, Crous PW. 2018b. New Fusarium species from the Kruger National Park, South Africa. MycoKeys 34: 63–92. [Europe PMC free article] [Abstract] [Google Scholar]
- Santillán-Mendoza R, Fernández-Pavía SP, O’Donnell K, et al. . 2018. A novel disease of big-leaf mahogany caused by two Fusarium species in Mexico. Plant Disease 102: 1965–1972. [Abstract] [Google Scholar]
- Scauflaire J, Gourgue M, Munaut F. 2011. Fusarium temperatum sp. nov. from maize, an emergent species closely related to Fusarium subglutinans. Mycologia 103: 586–597. [Abstract] [Google Scholar]
- Schroers H-J, Gräfenhan T, Nirenberg HI, et al. . 2011. A revision of Cyanonectria and Geejayessia gen. nov. and related species with Fusarium-like anamorphs. Studies in Mycology 68: 115–138. [Europe PMC free article] [Abstract] [Google Scholar]
- Schröter J. 1874. Über Peronospora violacea Berkeley und einige verwandte Peronospora-Arten. Hedwigia 12: 180. [Google Scholar]
- Secor GA, Rivera-Varas V, Christ DS, et al. . 2014. Characterization of Fusarium secorum, a new species causing Fusarium yellowing decline of sugar beet in north central USA. Fungal Biology 118: 764–775. [Abstract] [Google Scholar]
- Seifert KA, Aoki T, Baayen RP, et al. . 2003. The name Fusarium moniliforme should no longer be used. Mycological Research 107: 643–644. [Google Scholar]
- Sheldon JL. 1904. A corn mold (Fusarium moniliforme n. sp.). In: Agricultural experiment station of Nebraska: 17th annual report. [Google Scholar]
- Smith JA, O’Donnell K, Mount LL, et al. . 2011. A novel Fusarium species causes a canker disease of the critically endangered conifer, Torreya taxifolia. Plant Disease 95: 633–639. [Abstract] [Google Scholar]
- Steenkamp ET, Wingfield BD, Desjardins AE, et al. . 2002. Cryptic speciation in Fusarium subglutinans. Mycologia 94: 1032–1043. [Abstract] [Google Scholar]
- Summerbell RC, Richardson SE, Kane J. 1988. Fusarium proliferatum as an agent of disseminated infection in an immunosuppressed patient. Journal of Clinical Microbiology 26: 82–87. [Europe PMC free article] [Abstract] [Google Scholar]
- Summerell B. 2019. Resolving Fusarium: Current status of the genus. Annual Review of Phytopathology 57: 323–339. [Abstract] [Google Scholar]
- Van Hove F, Waalwijk C, Logrieco A, et al. . 2011. Gibberella musae (Fusarium musae) sp. nov., a recently discovered species from banana is sister to F. verticillioides. Mycologia 103: 570–585. [Abstract] [Google Scholar]
- Viswanathan R. 2020. Fusarium diseases affecting sugarcane production in India. Indian Phytopathology 73: 415–424. [Google Scholar]
- Wineland GO. 1924. An ascigerous stage and synonomy for Fusarium moniliforme. Journal of Agricultural Research 28: 909–922. [Google Scholar]
- Wingfield BD, Berger DK, Steenkamp ET, et al. . 2017. Draft genome of Cercospora zeina, Fusarium pininemorale, Hawksworthiomyces lignivorus, Huntiella decipiens and Ophiostoma ips. IMA Fungus 8: 385–396. [Europe PMC free article] [Abstract] [Google Scholar]
- Wingfield BD, Bills GF, Dong Y, et al. . 2018. Draft genome sequence of Annulohypoxylon stygium, Aspergillus mulundensis, Berkeleyomyces basicola (syn. Thielaviopsis basicola), Ceratocystis smalleyi, two Cercospora beticola strains, Coleophoma cylindrospora, Fusarium fracticaudum, Phialophora cf. hyalina, and Morchella septimelata. IMA Fungus 9: 199–223. [Europe PMC free article] [Abstract] [Google Scholar]
- Wollenweber HW, Reinking OA. 1925. Aliquot Fusaria tropicalia, nova vel revisa. Phytopathology 15: 155–169. [Google Scholar]
- Wollenweber HW, Reinking OA. 1935. Die Fusarien, ihre Beschreibung, Schadwirkung und Bekampfung. Verlag Paul Parey, Berlin, Germany. [Google Scholar]
- Wollenweber HW, Sherbakoff CD, Reinking OA, et al. . 1925. Fundamentals for taxonomic studies of Fusarium. Journal of Agricultural Research 30: 833–843. [Google Scholar]
- Wu F. 2007. Measuring the economic impacts of Fusarium toxins in animal feeds. Animal Feed Science and Technology 137: 363–374. [Google Scholar]
- Yang J, Kharbanda PD, Howard RJ, et al. . 2009. Identification and pathogenicity of Fusarium lactis, causal agent of internal fruit rot of greenhouse sweet pepper in Alberta. Canadian Journal of Plant Pathology 31: 47–56. [Google Scholar]
- Yang M, Zhang H, Van der Lee TAJ, et al. . 2020. Population genomic analysis reveals a highly conserved mitochondrial genome in Fusarium asiaticum. Frontiers in Microbiology 11: 839. [Europe PMC free article] [Abstract] [Google Scholar]
- Yang Y, Bouras N, Yang J, et al. . 2011. Mycotoxin production by isolates of Fusarium lactis from greenhouse sweet pepper (Capsicum annuum). International Journal of Food Microbiology 151: 150–156. [Abstract] [Google Scholar]
- Zeller KA, Summerell BA, Bullock S, et al. . 2003. Gibberella konza (Fusarium konzum) sp. nov. from prairie grasses, a new species in the Gibberella fujikuroi species complex. Mycologia 95: 943–954. [Abstract] [Google Scholar]
Articles from Persoonia : Molecular Phylogeny and Evolution of Fungi are provided here courtesy of Naturalis Biodiversity Center & Centraalbureau voor Schimmelcultures
Citations & impact
Impact metrics
Citations of article over time
Alternative metrics
Discover the attention surrounding your research
https://www.altmetric.com/details/103002600
Article citations
Incorporation of the histone variant H2A.Z counteracts gene silencing mediated by H3K27 trimethylation in Fusarium fujikuroi.
Epigenetics Chromatin, 17(1):7, 20 Mar 2024
Cited by: 0 articles | PMID: 38509556 | PMCID: PMC10953111
Identification and pathogenicity of Fusarium spp. associated with tea wilt in Zhejiang Province, China.
BMC Microbiol, 24(1):38, 27 Jan 2024
Cited by: 0 articles | PMID: 38281024 | PMCID: PMC10821546
Diversity and Pathogenicity of Fusarium Species Associated with Stalk and Crown Rot in Maize in Northern Italy.
Plants (Basel), 12(22):3857, 15 Nov 2023
Cited by: 0 articles | PMID: 38005754 | PMCID: PMC10674493
Microbial diversity in soils suppressive to Fusarium diseases.
Front Plant Sci, 14:1228749, 04 Dec 2023
Cited by: 1 article | PMID: 38111879 | PMCID: PMC10726057
Review Free full text in Europe PMC
Fully resolved assembly of Fusarium proliferatum DSM106835 genome.
Sci Data, 10(1):705, 16 Oct 2023
Cited by: 2 articles | PMID: 37845258 | PMCID: PMC10579329
Go to all (26) article citations
Data
Data behind the article
This data has been text mined from the article, or deposited into data resources.
Nucleotide Sequences (Showing 135 of 135)
- (1 citation) ENA - KU900635
- (1 citation) ENA - MW402408
- (1 citation) ENA - MW401959
- (1 citation) ENA - KU900637
- (1 citation) ENA - MW402809
- (1 citation) ENA - MN534147
- (1 citation) ENA - KU900630
- (1 citation) ENA - MW402483
- (1 citation) ENA - MW402241
- (1 citation) ENA - MW402363
- (1 citation) ENA - MW402484
- (1 citation) ENA - MW402242
- (1 citation) ENA - MW402485
- (1 citation) ENA - MW402124
- (1 citation) ENA - MW402125
- (1 citation) ENA - MW402642
- (1 citation) ENA - MW402523
- (1 citation) ENA - MW402524
- (1 citation) ENA - MW402768
- (1 citation) ENA - MW402406
- (1 citation) ENA - LT996091
- (1 citation) ENA - MW402407
- (1 citation) ENA - LT996113
- (1 citation) ENA - KU900625
- (1 citation) ENA - KU900627
- (1 citation) ENA - MN534090
- (1 citation) ENA - KU900620
- (1 citation) ENA - MW402110
- (1 citation) ENA - MW402356
- (1 citation) ENA - MW402236
- (1 citation) ENA - MW402357
- (1 citation) ENA - MW402358
- (1 citation) ENA - MW402633
- (1 citation) ENA - MW402116
- (1 citation) ENA - MT010994
- (1 citation) ENA - MW402239
- (1 citation) ENA - MT011041
- (1 citation) ENA - KU900613
- (1 citation) ENA - MW402507
- (1 citation) ENA - MW402508
- (1 citation) ENA - MW402629
- (1 citation) ENA - MN534286
- (1 citation) ENA - AF160280
- (1 citation) ENA - KU900611
- (1 citation) ENA - MT010908
- (1 citation) ENA - MW402062
- (1 citation) ENA - MW402100
- (1 citation) ENA - MW402102
- (1 citation) ENA - MW402587
- (1 citation) ENA - MW402588
- (1 citation) ENA - MW402621
- (1 citation) ENA - MW402105
- (1 citation) ENA - MW402743
- (1 citation) ENA - MW402348
- (1 citation) ENA - MW402744
- (1 citation) ENA - MT010983
- (1 citation) ENA - MN533987
- (1 citation) ENA - MW402503
- (1 citation) ENA - MW402745
- (1 citation) ENA - MN533988
- (1 citation) ENA - MW402625
- (1 citation) ENA - MN533989
- (1 citation) ENA - MN534157
- (1 citation) ENA - MW402180
- (1 citation) ENA - MW402061
- (1 citation) ENA - MW402172
- (1 citation) ENA - MW402173
- (1 citation) ENA - MW402570
- (1 citation) ENA - MW402571
- (1 citation) ENA - MN193854
- (1 citation) ENA - MW402452
- (1 citation) ENA - MN193856
- (1 citation) ENA - MW402299
- (1 citation) ENA - MW402696
- (1 citation) ENA - MW402179
- (1 citation) ENA - MW402730
- (1 citation) ENA - MW402731
- (1 citation) ENA - MW402458
- (1 citation) ENA - MW402459
- (1 citation) ENA - MW402727
- (1 citation) ENA - MN534062
- (1 citation) ENA - MN193883
- (1 citation) ENA - MW402040
- (1 citation) ENA - MW402042
- (1 citation) ENA - MW402043
- (1 citation) ENA - MW402322
- (1 citation) ENA - MW402443
- (1 citation) ENA - MW402323
- (1 citation) ENA - MW402565
- (1 citation) ENA - MW402445
- (1 citation) ENA - MW402568
- (1 citation) ENA - MN534174
- (1 citation) ENA - MW402718
- (1 citation) ENA - MN534175
- (1 citation) ENA - AF160276
- (1 citation) ENA - MW402160
- (1 citation) ENA - HM068352
- (1 citation) ENA - MW402155
- (1 citation) ENA - MW401980
- (1 citation) ENA - MW402156
- (1 citation) ENA - MW402157
- (1 citation) ENA - MW402037
- (1 citation) ENA - MW402796
- (1 citation) ENA - MW402314
- (1 citation) ENA - MW401979
- (1 citation) ENA - MW402708
- (1 citation) ENA - MN534089
- (1 citation) ENA - MT010944
- (1 citation) ENA - AF158329
- (1 citation) ENA - MN534081
- (1 citation) ENA - MW402260
- (1 citation) ENA - U34416
- (1 citation) ENA - MW402261
- (1 citation) ENA - MW401971
- (1 citation) ENA - MW402785
- (1 citation) ENA - MW402301
- (1 citation) ENA - MW402303
- (1 citation) ENA - MW401973
- (1 citation) ENA - MW402822
- (1 citation) ENA - MW402308
- (1 citation) ENA - LT996137
- (1 citation) ENA - AF158333
- (1 citation) ENA - LT996138
- (1 citation) ENA - MW402491
- (1 citation) ENA - MW402373
- (1 citation) ENA - MW402376
- (1 citation) ENA - MW402652
- (1 citation) ENA - MW402377
- (1 citation) ENA - MW402653
- (1 citation) ENA - MW402378
- (1 citation) ENA - MW402775
- (1 citation) ENA - MN534228
- (1 citation) ENA - MW402415
- (1 citation) ENA - MN534229
- (1 citation) ENA - MW402813
Show less
Similar Articles
To arrive at the top five similar articles we use a word-weighted algorithm to compare words from the Title and Abstract of each citation.
Fusarium and allied genera from China: species diversity and distribution.
Persoonia, 48:1-53, 21 Feb 2022
Cited by: 5 articles | PMID: 38234691 | PMCID: PMC10792286
Species composition of and fumonisin production by the Fusarium fujikuroi species complex isolated from Korean cereals.
Int J Food Microbiol, 267:62-69, 13 Dec 2017
Cited by: 14 articles | PMID: 29291460
Fusarium volatile, a new potential pathogen from a human respiratory sample.
Fungal Syst Evol, 4:171-181, 25 Jun 2019
Cited by: 4 articles | PMID: 32467910 | PMCID: PMC7241678
Identification of Rice Seed-Derived Fusarium Spp. and Development of LAMP Assay against Fusarium Fujikuroi.
Pathogens, 10(1):1, 22 Dec 2020
Cited by: 4 articles | PMID: 33374990 | PMCID: PMC7822049
Fusarium amaranthuense sp. nov. from amaranth is an emergent species closely related to Fusarium circinatum.
Plant Dis, 27 Mar 2024
Cited by: 0 articles | PMID: 38537143