FR2861743A1 - Complete, or nearly complete, rpoB genes from Corynebacterium and related bacteria, useful for species-specific identification, also derived oligonucleotides, as probes or primers - Google Patents

Abstract

Complete, or nearly complete, rpoB genes from Corynebacterium or related bacteria, comprising any of: (a) sequences (61)-(116), reproduced; (b) sequences with at least 98% similarity with (a); and (c) their reverse sequences and complements. Complete, or nearly complete, rpoB genes from Corynebacterium or related bacteria, comprising any of: (a) sequences (61)-(116), reproduced; (b) sequences with at least 98% similarity with (a); and (c) their reverse sequences and complements. The genes are from the following species: Corynebacterium accolens; C. afermentans; C. ammoniagenes; C. amycolatum; C. argentoratense; C. auris; C. auriscanis; C. bovis; C. callunae; C. camporealensis; C. capitovis; C. confusum; C. coyleae; C. cystitidis; C. diphtheriae; C. durum; C. falsenii; C. felinum; C. flavescens; C. freneyi; C. glucuronolyticum; C. imitans; C. jeikeium; C. kroppenstedtii; C. kutscheri; C. lipophilumflavum; C. macginleyi; C. mastitidis; C. matruchotii; C. minutissimum; C. mucifaciens; C. mycetoides; C. phocae; C. pilosum; C. propinquam; C. pseudodiphtheriticum; C. pseudotuberculosis; C. renale; C. riegelii; C. seminale; C. simulans; C. singulare; C. striatum; C. sundsvallense; C. terpenotabidum; C. thomsenii; C. ulcerans; C. urealyticum; C. variabilis; C. vitaeruminis; C. xerosis; C. spheniscorum; C. aurimucosum; C. testudinoris; Rhodococcus equi and Turicella otitidis. Independent claims are also included for: (1) fragments of the rpoB gene from the species specified above, or from C. efficiens or C. glutamicum, that comprise any of sequences (3)-(60), reproduced, or sequences at least 98% homologous, or reverse sequences or complements; (2) oligonucleotides (ON1) containing at least 20 consecutive nucleotides (nt) from (3)-(60), their homologs, reverse sequences or complements; (3) oligonucleotides (ON2) containing at least 8, preferably 35, nt of which at least 8, preferably 18, are consecutive within the sequences (1) and (2) 5'-CGWATGAACATYGGBCAGGT (1) 5'-TCCATYTCRCCRAARCGCTG (2) where W = A or T, Y = C or T, B = C, G or T and R = A or G; (4) equimolar mixtures of different ON2 containing at least 12, preferably 18 consecutive nt from (1) or (2), or their reverse sequences or complements; (5) in vitro molecular identification of a species of Corynebacterium or related bacteria; and (6) diagnostic kit for method (5) containing at least one ON1, ON2 or the rpoB fragments.

Description

<Desc / Clms Page number 1>

moléculaire des bactéries du genre Corynebacterium ou bactéries apparentées par les techniques d'amplification et séquençage à l'aide d'amorces oligonucléotidiques appliquées à des souches de ce genre bactérien.

Les bactéries du genre Corynebacieriuna sont des bactéries apparaissant sous forme de bacilles Gram positifs irréguliers, de croissance aérobie, non sporulés et non partiellement acido-alcoolo résistants. On reconnaît actuellement presque 60 espèces et 2 sous espèces. Ces bactéries sont

caractérisées par la présence dans la paroi d'acide meso-diaminopimélique et d'acides mycoliques à courte chaîne (22 à 36 atomes de carbone) [Collins MD, J Gen Microbiol. (1982) 128 :129-149]. Seules 2 espèces, C. amycolatum et C. kroppenstedtii, ne possèdent pas d'acides mycoliques [Collins MD. MOLECULAR IDENTIFICATION OF BACTERIA
GENUS CORYNEBACTERIUM
The present invention relates to the field of diagnosis. More specifically, the invention relates to a method for identifying

of bacteria of the genus Corynebacterium or related bacteria by amplification techniques and sequencing using oligonucleotide primers applied to strains of this bacterial genus.

Bacteria of the genus Corynebacieriuna are bacteria that appear as Gram-positive, aerobic, non-spore-forming, non-partially acid-fast bacilli. At present, there are almost 60 species and 2 subspecies. These bacteria are

characterized by the presence in the wall of mesodiaminopimelic acid and short chain mycolic acids (22 to 36 carbon atoms) [Collins MD, J Gen Microbiol. (1982) 128: 129-149]. Only 2 species, C. amycolatum and C. kroppenstedtii, do not possess mycolic acids [Collins MD.

urealyticum et C. confusum [Bernard KA. J Clin Microbiol (1991) 29 :83-89 ; Funke G, Int J Syst Bacteriol. (1998) 4 :1291-1296]. Le G + C % est compris entre 46% (C. kutsheri) et 76% (C. auris) [Funke GA, Clin Microbiol Rev (1997) 10 :125-159], montrant l'importante diversité génétique du genre. L'étude de la séquence du gène de l'ARN 16S ribosomique a permis d'améliorer la taxonomie et l'identification des corynébactéries qui sont mal identifiées par les techniques phénotypiques usuelles, notamment pour les laboratoires non équipés de chromatographes FEMS Microbiol Let. (1988) 49: 349-352]. The wall of the corynebacteria also contains arabinose and galactose but their detection is not recommended in usual practice for identification. The main fatty acids of Corynebacteria are palmitic acid (C16: 0), oleic acid (C18: 1 # 9c) and stearic acid (C18: 0), which are found in all corynebacteria. In addition, tuberculostearic acid can be observed in some species such as C.

urealyticum and C. confusum [Bernard KA. J Clin Microbiol (1991) 29: 83-89; Funke G, Int J System Bacteriol. (1998) 4: 1291-1296]. G + C% ranges from 46% (C. kutsheri) to 76% (C. auris) [Funke GA, Clin Microbiol Rev (1997) 10: 125-159], showing the high genetic diversity of the genus. The study of the 16S ribosomal RNA gene sequence has improved the taxonomy and the identification of corynebacteria that are poorly identified by the usual phenotypic techniques, especially for laboratories without chromatographs.

<Desc / Clms Page number 2>

 and a comprehensive arsenal of assays [Pascual C, Int J Syst Bacteriol (1995) 45: 724-728; Ruimy R, Int J Syst Bacteriol (1995) 45: 740-746].

 Unfortunately the 16S ribosomal RNA gene has some disadvantages, the main one being its lack of polymorphism. Since the sequences of certain Corynebacteria are very close (see Table 3 and Figure 2 below), it is necessary to determine the complete sequence of the 16S rRNA gene if it is desired to be able to identify a species. This requires sequencing the entire gene that is about 1600 base pairs. The practical consequence is that sequencing must rely on a minimum of 6 sequence reactions in addition to the amplification reaction to obtain an accurate result.

 There is therefore still a demand for a tool for the molecular identification of bacteria of species of the genus Corynebactrium that can be routinely used in the bacteriology laboratory, with in particular a sufficiently polymorphic gene such as the production of a short sequence (less than 500 pairs of bases) with only 1 amplification reaction and 2 sequence reactions either identifying, i.e., amplifiable and sequenceable by the use of a single set of primers.

Corynebacterium et, en particulier, les 58 espèces suivantes : Corynebacteriunz accolens, Corynebacterium aferzzzentazas, Corynebacteriuzzz anznaoniagenes, Corynebacteriul1l amycolatum, Corynebacterium argentoratense, Corynebacterium auris, COlynebacteriul1l auriscanis, COlynebacteriul1l bovis, Corynebacterium callunae, Corynebacterium camporealensis, Corynebacterium capitovis, Corynebacterium confusum, Corynebacterium coyleae, Corynebacterium cystitidis, Corynebacterium diphtheriae, Corynebacterium durum, Corynebacterium efficiens, Corynebacterium

falsenii, Corynebacterium felinum, Corynebacterium flavescens, Corynebacteriuma freneyi, Corynebacterium glucurono ly ticum, Coryn ebacterium glu tamicum, Corynebacterium imitans, Corynebacterium jeikeium, Corynebacterium kroppenstedtii, The inventors have demonstrated according to the present invention, that the rpoB gene constitutes a genetic marker allowing the detection and the specific identification of the bacterium of each species of the genus

Corynebacterium and, in particular, the following 58 species: Corynebacteriunz accolens, Corynebacterium aferzzzentazas, Corynebacteriuzzz anznaoniagenes, Corynebacteriul1l amycolatum, Corynebacterium argentoratense, Corynebacterium auris, COlynebacteriul1l auriscanis, COlynebacteriul1l bovis, Corynebacterium callunae, Corynebacterium camporealensis, Corynebacterium capitovis, Corynebacterium confusum, Corynebacterium coyleae, Corynebacterium cystitidis, Corynebacterium diphtheriae, Corynebacterium durum, Corynebacterium efficiens, Corynebacterium

Falsenii, Corynebacterium felinum, Corynebacterium flavescens, Corynebacterium freneyi, Corynebacterium glucurono lyticum, Coryn ebacterium glutamicum, Corynebacterium imitans, Corynebacterium jeikeium, Corynebacterium kroppenstedtii,

<Desc / Clms Page number 3>

Corynebacterium kutscheri, C01ynebacterium lipopbilofiavlim, Corynebacterium naacginleyi, Corynebacterium mastitidis, Corynebacterium matruchotii, Corynebacterium nainutissimuna, COlynebacteriul1l mucifaciens, Corynebacterium mycetoides, COlynebacterium phocae, Corynebacterium pilosum, Corynebacterium propinquum, C01ynebacteriuJJt psetfdodzphtheriticum, Corynebacterium pseudotuberculosis, Corynebacterium rénale, Corynebacterium riegelii,

Corynebacterium séminale, Corynebacterium simulans, Corynebacterium singulare, Corynebacterium striatum, Corynebacterium sundsvallense, Corynebacterium

terpenotabidum, Coiynebacterium thomssenii, Corynebacterium ulcerans, Corynebacterium urealyticum, Corynebacterium variabilis, Corynebacterium vitaeruminis, Corynebacterium xerosis, Corynebacterium spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinoris, Rhodococcus equi, Turicella otitidis, ainsi que deux sous-espèces de C. afermentans et deux souches différentes de Rhodococcus equii.

Corynebacterium kutscheri, C01ynebacterium lipopbilofiavlim, naacginleyi Corynebacterium, Corynebacterium mastitidis, matruchotii Corynebacterium, Corynebacterium nainutissimuna, COlynebacteriul1l mucifaciens, Corynebacterium mycetoides, COlynebacterium phocae, pilosum Corynebacterium, Corynebacterium propinquum, C01ynebacteriuJJt psetfdodzphtheriticum, Corynebacterium pseudotuberculosis, kidney Corynebacterium, Corynebacterium riegelii,

Seminal Corynebacterium, Corynebacterium simulans, Corynebacterium singulare, Corynebacterium striatum, Corynebacterium sundsvallense, Corynebacterium

terpenotabidum, Coiynebacterium thomssenii, Corynebacterium ulcerans, Corynebacterium urealyticum, Corynebacterium variabilis, Corynebacterium vitaeruminis, Corynebacterium xerosis, Corynebacterium spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinoris, Rhodococcus equi, Turicella otitidis, as well as two subspecies of C. afermentans and two different strains of Rhodococcus equii.

 More particularly, the present invention relates to nucleic acid sequences specific for each species of the genus Corynebacterium or related mentioned above whose nucleotide sequence is derived from the rpoB gene of said bacteria.

 According to Lazcano et al. [J. Mol. Evol. (1988) 27: 365-376], RNA polymerases are divided into two groups according to their origin, one consisting of RNA- or DNA-dependent viral RNA polymerases, and the other consisting of DNA-dependent RNA polymerases of eukaryotic origin or prokaryotes (archaebacteria and eubacteria). The eubacterial DNA-dependent RNA polymerases are characterized by a simple and conserved multimeric constitution denoted core enzyme, represented by OC (3 (3 ', or holoenzyme represented by [alpha] ssss' # [Yura and Ishihama, Ann Rev. Genet. (1979) 13: 59-97] Numerous studies have demonstrated the functional role within the multimeric enzyme complex of the eubacterial RNA polymerase subunit 5. The archaebacterial and eukaryotic RNA polymerases exhibit their part, a more complex structure of up to ten or even

<Desc / Clms Page number 4>

 Thirty subunits [Pühlet et al. Proc. Natl. Acad. Sci. USA (1989) 86: 4569-4573].

gènes o4, rpoB, rpoc et rpod, sont classés en différents groupes comprenant les gènes codant pour des protéines constitutives des sousunités ribosomiques ou pour des enzymes impliqués dans la réplication et la réparation du génome [Yura and Yshihma, Ann. Rev. Genet. (1979) 13 : 59-97]. Certains auteurs ont montré que les séquences des gènes rpoB et rpoC pouvaient être utilisées afin de construire des arbres phylogénétiques [Rowland et al. Biochem. Soc. Trans. (1992) 21 : 40S] permettant de séparer les différents embranchements et sous-embranchements parmi les règnes du vivant. The genes that encode the different [alpha] ssss'# subunits of DNA-dependent RNA polymerase in eubacteria, respectively

o4 genes, rpoB, rpoc and rpod, are classified into different groups comprising the genes encoding proteins constituting ribosomal subunits or for enzymes involved in the replication and repair of the genome [Yura and Yshihma, Ann. Rev. Broom. (1979) 13: 59-97]. Some authors have shown that rpoB and rpoC gene sequences can be used to construct phylogenetic trees [Rowland et al. Biochem. Soc. Trans. (1992) 21: 40S] to separate the different branches and sub-branches among the kingdoms of the living.

 Before explaining in more detail the invention, various terms used in the description and the claims are defined below: by nucleic acid extracted from bacteria is meant either the total nucleic acid or the genomic DNA, either the messenger RNAs, or else the DNA obtained from the reverse transcription of the messenger RNAs; a nucleotide fragment or an oligonucleotide are two synonymous terms denoting a sequence of nucleotide motifs characterized by an informational sequence of natural (or possibly modified) nucleic acids that are capable of hybridizing, like natural nucleic acids, with a complementary nucleotide fragment or substantially complementary, under predetermined conditions of strict stringency. The sequence may contain nucleotide motifs of structure different from that of natural nucleic acids. A nucleotide fragment (or oligonucleotide) may contain, for example, up to 100 nucleotide motifs. It generally contains at least 10, preferably from 18 to 35, nucleotide units and may be

<Desc / Clms Page number 5>

 obtained from a natural nucleic acid molecule and / or by genetic recombination and / or by chemical synthesis, - a nucleotide motif is derived from a monomer which may be a natural nucleotide nucleic acid whose constituent elements are a sugar, a phosphate group and a nitrogen base chosen from adenine (A), guanine (G), uracil (U), cytosine (C), thymine (T); or the monomer is a nucleotide modified in at least one of the three preceding constitutive elements; for example, the modification can occur either at the base level, with modified bases such as inosine, which can hydride with any base A, T, U, C or G, methyl-5 deoxycytidine, deoxyuridine, dimethylamino-5-deoxyuridine or any other modified base capable of hybridization, either at the sugar level, for example the replacement of at least one deoxyribose with a polyamide [Nielsen PE et al., Science (1991) 254: 1497-1500], or else at the level of the phosphate group, for example by replacement with esters chosen in particular from diphosphates, alkylphosphonates and phosphorothioates, - by hybridization is meant the process in which, under appropriate conditions, two Nucleotide fragments with sufficiently complementary sequences are likely to associate with stable and specific hydrogen bonds to form a double strand. The hybridization conditions are determined by the stringency, ie the rigor of the operating conditions. Hybridization is all the more specific as it is carried out with higher stringency. The stringency is a function in particular of the base composition of a probe / target duplex, as well as the degree of mismatch between two nucleic acids. The stringency may also be a function of the parameters of the hybridization reaction, such as the concentration and type of ionic species present in the hybridization solution, the nature and concentration of denaturing agents and / or the temperature of the hybridization solution. hybridization. The stringency of the conditions under which a hybridization reaction must be carried out depends in particular on the probes used. All this data

<Desc / Clms Page number 6>

 are well known and the appropriate conditions can optionally be determined in each case by routine experiments. In general, depending on the length of the probes used, the temperature for the hybridization reaction is between about 20 and 65 ° C., in particular between 35 and 65 ° C., in a saline solution at a concentration of about 0.8 to 1 M. .

 a probe is a nucleotide fragment having hybridization specificity under determined conditions to form a hybridization complex with a nucleic acid having, in the present case, a nucleotide sequence comprised either in a messenger RNA, or in a DNA obtained by reverse transcription of said messenger RNA, transcription product; a probe can be used for diagnostic purposes (in particular capture or detection probes) or for therapy purposes, a capture probe is a probe immobilized or immobilizable on a solid support by any appropriate means, for example by covalence, by adsorption, or by direct synthesis on a solid. Examples of supports include microtiter plates and DNA chips, - a detection probe is a labeled probe using a marker chosen for example from radioactive isotopes, enzymes, in particular enzymes capable of acting on a chromogenic, fluorogenic or luminescent substrate (in particular a peroxidase or an alkaline phosphatase), chromophoric chemical compounds, chromogenic, fluorogenic or luminescent compounds, nucleotide base analogs and ligands such as biotin, - a species probe is a probe allowing the specific identification of the species of a bacterium, - a primer is a probe comprising for example 10 to 100 nucleotide motifs and having a hybridization specificity under conditions determined for enzymatic amplification reactions,

<Desc / Clms Page number 7>

 by amplification reaction is meant an enzymatic polymerization reaction, for example in an amplification technique such as PCR, initiated by oligonucleotide primers and using a DNA polymerase.

 by sequencing reaction is understood to mean obtaining the sequence of a nucleic acid fragment or of a complete gene by an abortive polymerization process starting from oligonucleotide primers and using said dideoxynucleotides (Sanger F, Coulson AR) (1975), J.Mol.Biol 94: 441) or by multiple hybridizations with multiple probes fixed on solid support as used in DNA chips for example.

bovis, Corynebacterium callunae, Corynebacterium camporealensis, Corynebacterium capitovis, Corynebacterium confusum, Corynebacterium coyleae, Corynebacterium cystitidis, Corynebacterium diphtheriae, Corynebacterium durum, Corynebacterium falsenii, Corynebacterium felinum, Corynebacterium flavescens, Corynebacterium freneyi, Corynebacterium glucuronolyticum, Corynebacterium imitans,

Corynebacterium jeikeium, Corynebacteriul1l kroppenstedtii, Corynebacterium kutscheri, Corynebacterium lipopbilofiavum, Corynebacterium macginleyi, Corynebacterium mastitidis, Corynebacterium matrucbotii, Corynebacterium

minutissimum, Corynebacterium mucifaciens, Co rynebacterium mycetoides, Corynebacterium phocae, Corynebacterium pilosum, Corynebacterium propinquum, Corynebacterium pse u dodiphtheri ticum, Corynebacterium pseudotuberculosis,

COlynebacterium renale, Corynebacterium riegelii, Corynebacterium séminale, C01ynebacterium simulans, Corynebacterium singulare, Corynebacterium striatum, Corynebacterium sundsvallense, Corynebacterium terpenotabidum, Corynebacterium The inventors have determined the complete or quasicomplete sequences of the rpoB genes of 56 species of bacteria of the genus Corynebacterium, a subspecies and 2 closely related phylogenetically related bacteria, one of which for 2 different strains (R. equii) namely the species. Corynebacterium accolens, Corynebacterium afermentans, Corynebacterium ammoniagenes, Corynebacterium amycolatum, Corynebacterium argentoratense, Corynebacterium auris, Corynebacterium auriscanis, Corynebacterium

bovis, Corynebacterium callunae, Corynebacterium camporealensis, capitovis Corynebacterium, Corynebacterium confusum, Corynebacterium coyleae, cystitidis Corynebacterium, Corynebacterium diphtheriae, Corynebacterium durum, Corynebacterium falsenii, FELINUM Corynebacterium, Corynebacterium flavescens, Corynebacterium freneyi, glucuronolyticum Corynebacterium, Corynebacterium imitans,

Corynebacterium jeikeium, Corynebacteriulium kroppenstedtii, Corynebacterium kutscheri, Corynebacterium lipopbilofiavum, Corynebacterium macginleyi, Corynebacterium mastitidis, Corynebacterium matrucbotii, Corynebacterium

minutissimum, Corynebacterium mucifaciens, Co rynebacterium mycetoides, Corynebacterium phocae, Corynebacterium pilosum, Corynebacterium propinquum, Corynebacterium pse u dodiphtheri ticum, Corynebacterium pseudotuberculosis,

Cylnebacterium renale, Corynebacterium riegelii, Corynebacterium seminal, C01ynebacterium simulans, Corynebacterium singulare, Corynebacterium striatum, Corynebacterium sundsvallense, Corynebacterium terpenotabidum, Corynebacterium

<Desc / Clms Page number 8>

thomssenii, COlynebacterium ulcerans, Corynebacterium urealyticum, Corynebacterium variabilis, COlynebacterium vitaerul1linis, Corynebacterium xe rosis, Corynebacteriuna spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinoris, Rhodococcus equi, Turicella otitidis,
Pour arriver à déterminer lesdites séquences complètes, les inventeurs ont pu, après un grand nombre d'essais infructueux, déterminer 47 amorces qui leur ont permis, à partir des seules séquences rpoB de Corynébactéries disponibles sur GENBANK, à savoir C. glutamicum et C. efficiens, d'une part et d'autre part des séquences rpoB de bactéries proches telles que celle de Amycolatopsis mediterranei et Mycobacterium smegmatis, obtenir la séquence rpoB complète ou quasi-complète desdites espèces de bactéries Corynebacterium.

thomssenii, Clynebacterium ulcerans, Corynebacterium urealyticum, Corynebacterium variabilis, Clynebacterium vitaerulinis, Corynebacterium xe rosis, Corynebacterium spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinoris, Rhodococcus equi, Turicella otitidis,
To arrive at determining said complete sequences, the inventors were able, after a large number of unsuccessful attempts, to determine 47 primers which enabled them, from the only rpoB sequences of Corynebacteria available on GENBANK, namely C. glutamicum and C. efficient, on the one hand and on the other hand rpoB sequences of close bacteria such as that of Amycolatopsis mediterranei and Mycobacterium smegmatis, obtain the complete or almost complete rpoB sequence of said species of Corynebacterium bacteria.

Corynebacterium auris, Corynebacterium auriscanis, Corynebacterilim bovis, Corynebacterium callunae, Corynebacterium camporealensis, Co5,nebacterium capitovis, Corynebacterit{11l confusum, Corynebacterium coyleae, COf)lJZebacterium cystitidis, Corynebacterium diphtheriae, Corynebacterium durum, Corynebacterium falsenii, Corynebacterium felinum, Corynebacterium flavescens, COlynebacterium freneyi, Corynebacterium glucuronolyticum, Corynebacterium imitans,

Corynebacteriul1l jeikeium, Corynebacterium kroppenstedtii, Corynebacterium kutscheri, Corynebacterium lipopbiloflavum, Corynebacterium macginleyi, Corynebacterium mastitidis, Corynebacterium matruchotii, Corynebacterium

minutissimum, C oryn ebacteriul1l mucifaciens, C orynebacterium mycetoides, Corynebacterium phocae, Corynebacterium pilosum, COlynebacterium propinquum, Corynebacterium pseudodiphtheriticum, C oryn ebacterium pseud otu berculosis, Corynebacterium rénale, Coiynebacterium riegelii, Corynebacterium séminale, COlynebacterium simulans, Corynebacterium singulare, Corynebacterium striatum, The subject of the present invention is therefore preferably a rpoB complete gene or a rpoB quasi-complete gene fragment which comprises and, more particularly, which consists of a said sequence SEQ ID No. 61 to 116 of a bacterium of the genus Corynebacterium or a related bacterium, selected from the species: Corynebacterium accolens, Corynebacterium afermentans, Corynebacterium ammoniagenes, Corynebacterium amycolatum, Corynebacterium argentoratense,

Corynebacterium auris, Corynebacterium auriscanis, Corynebacterilim bovis, Corynebacterium callunae, Corynebacterium camporealensis, Co5, nebacterium capitovis, Corynebacterit {11l confusum, Corynebacterium coyleae, COF) lJZebacterium cystitidis, Corynebacterium diphtheriae, Corynebacterium durum, Corynebacterium falsenii, Corynebacterium FELINUM, Corynebacterium flavescens, COlynebacterium freneyi , Corynebacterium glucuronolyticum, Corynebacterium imitans,

Corynebacteriulium jeikeium, Corynebacterium kroppenstedtii, Corynebacterium kutscheri, Corynebacterium lipopbiloflavum, Corynebacterium macginleyi, Corynebacterium mastitidis, Corynebacterium matruchotii, Corynebacterium

minutissimum, C Oryn ebacteriul1l mucifaciens, C orynebacterium mycetoides, Corynebacterium phocae, Corynebacterium pilosum, COlynebacterium propinquum, Corynebacterium pseudodiphtheriticum, C Oryn ebacterium pseud otu berculosis, renal Corynebacterium, Coiynebacterium riegelii, seminal Corynebacterium, COlynebacterium simulans, Corynebacterium singulare, Corynebacterium striatum,

<Desc / Clms Page number 9>

Co ryneba cte rium sundsvallense, C orynebacteriu 111 terpenotabiduna, Corynebacterium thomssenii, Corynebacterium ulcerans, Corynebacterium urealyticum, Corraebacterium variabilis, Corynebacterium vitaeruminis, Cor)'6'r/'/.'? xerosis, Corynebacterium spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinoris, Rhodococcus equi, Turicella otitidis.

Co ryneba cte rium sundsvallense, C orynebacteriu 111 terpenotabiduna, Corynebacterium thomssenii, Corynebacterium ulcerans, Corynebacterium urealyticum, Corraebacterium variabilis, Corynebacterium vitaeruminis, Cor) 6'r / '. Xerosis, Corynebacterium spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinoris, Rhodococcus equi, Turicella otitidis.

 The subject of the present invention is also the complete or quasi-complete rpoB gene sequences and fragments of rpoB genes from different strains and / or subspecies of the same species, having similarity rates of at least 98% by compared to those of the sequences SEQ ID No. 61 to 116.

 The complete rpoB gene sequence can be used to identify the bacterium not only as a probe and / or by studying its primary sequence, but also by studying the secondary and tertiary structures of messenger RNA from the transcription of the complete DNA sequence.

 In these rpoB genes of Corynebacterium, the inventors have demonstrated SEQ.ID. n 1 and 2 below, hereinafter referred to as primers C2700F and C3130R, said sequences SEQ ID No. 1 and 2 being consensual sequences between all the bacteria of the genus Corynebacterium, that is to say making it possible to amplify the same portion of the rpoB gene of all said Corynebacterium bacteria.

SEQ ID No. 1 (C2700F): 5'-CGWATGAACATYGGBCAGGT-3 ', and
SEQ ID No. 2 (C3130R): 5'-TCCATYTCRCCRAARCGCTG-3 ', wherein, W is A or T, Y is C or T, B is C, G or T and R is A or G.

 The present invention thus provides oligonucleotides characterized in that they comprise a sequence of at least 8, preferably at least 12, more preferably from 18 to 35 nucleotide units, of which at least 8, preferably at least 12, of still preferably at least 18

<Desc / Clms Page number 10>

 consecutive nucleotide motifs included in one of the following SEQ ID No. 1 and 2 sequences: SEQ ID No. 1: 5'-CGWATGAACATYGGBCAGGT-3 ', and SEQ ID No. 2: 5'-TCCATYTCRCCRAARCGCTG-3'.

 Wherein: W is A or T, Y is C or T, B is C, G or T and R is A or G.

 To be used as consensus primers, these oligonucleotides of SEQ ID Nos. 1 and 2 are in fact used in the form of equimolar mixtures of oligonucleotides of different sequences and, more particularly, respectively of 12 (22 × 3) or (24) said oligonucleotides of different sequences of at least 8, preferably at least 12, more preferably at least 18 consecutive nucleotides included in the sequences respectively SEQ ID No. 1 and SEQ ID No. 2.

 These equimolar mixtures of oligonucleotides are obtained by using equimolar mixtures of the different nucleotides concerned respectively A and T for W, C and T for Y, C, G and T for B and A and G for R, during the synthesis. oligonucleotide.

 At the position corresponding to a nucleotide W, Y, B or R in the sequences SEQ ID Nos. 1 and 2, there are in the complementary target sequences variable nucleotides as a function of the species of the bacterium considered, but all the other nucleotides Corynebacterium bacteria are preserved in all species. The oligonucleotide mixtures, responding to the nucleotides defining the sequences SEQ ID Nos. 1 and 2, can therefore hybridize with the various complementary target sequences included in the rpoB genes of all the species of bacteria of the genus Corynebacterium and, more particularly, the 58 species mentioned above. The ability of these primers to amplify the rpoB gene of phylogenetically close bacteria suggests that these

<Desc / Clms Page number 11>

 Primers will be effective for the identification of Corynebacteria species that will be described in the future.

 The present invention therefore also relates to a mixture of oligonucleotides characterized in that it comprises an equimolar mixture of oligonucleotides, of different sequences comprising at least 12, preferably at least 18 consecutive nucleotide motifs included in one of the sequences SEQ.ID. n 1 and 2, or oligonucleotides of reverse sequences or complementary sequences.

 More particularly, the subject of the present invention is a mixture of oligonucleotides, characterized in that it comprises an equimolar mixture of 12 oligonucleotides of different sequences consisting of the sequence SEQ.ID. n 1 or oligonucleotides of inverse sequences or complementary sequences.

 Likewise, more particularly, the subject of the present invention is a mixture of oligonucleotides, characterized in that it consists of an equimolar mixture of 16 oligonucleotides of different sequences consisting of the sequence SEQ.ID. n 2 or oligonucleotides of inverse sequences or complementary sequences.

C O1ynebacterium. In addition, the consensus sequences SEQ ID No. 1 and SEQ ID No. 2, thus defined, frame highly variable sequences whose sequence is specific for each species of bacteria of the genus Corynebacterium. The oligonucleotides of sequences flanked by SEQ ID Nos. 1 and 2 can therefore be used as a species probe of bacteria of the genus

C, Ynebacterium.

 In addition, said specific hyper-variable sequences flanked by the sequences SEQ ID Nos. 1 and 2, represent a fragment of the rpoB gene of a length of approximately 400 bp with less than 96% of similarity between the different species (see Table 3 below). -after), so that they constitute the shortest specific target sequence, at least known, to specifically identify each species of the bacterium of the genus

<Desc / Clms Page number 12>

COlJ'nebacteriu111, plus précisément pour les 60 espèces mentionnées ci- dessus.

This is precisely the case for the 60 species mentioned above.

 The inventors have thus been able to demonstrate species-specific sequences for each of the 58 species of bacteria mentioned above, corresponding to the sequences SEQ ID Nos. 3 to 60, flanked by the consensus sequences SEQ ID Nos. 1 and 2.

gène rpoB d'une bactérie du genre COf)'nebacteriu111 choisie parmi les 58 espèces : Corynebacterium accolens, Corynebacterium afermentans, Corynebacteriuna ammoniagenes, COlynebacterium amycolatum, Corynebacteriuna argentoratense, Corynebacteriuna auris, Corynebacterium auriscanis, Corynebacterium bovis,
Corynebacterium callunae, Corynebacterium camporealensis, Corynebacterium capitovis, Corynebacterium confusum, Corynebacterium coyleae, Corynebacterium cystitidis, Corynebacterium diphtheriae, Corynebacterium durum, Corynebacterium efficiens, Corynebacterium falsenii, Corynebacterium felinum, Corynebacterium flavescens, Corynebacterium freneyi, Corynebacterium glucuronolyticum,
Corynebacterium glutamicum, Corynebacterium imitans, Corynebacterium jeikeium,
Corynebacterium kroppenstedtii, Corynebacterium kutscheri, Corynebacterium

lipophiloflavuna, Corynebacterium macginleyi, Corynebacterium mastitidis, Corynebacterium matruchotii, Corynebacterium minutissimum, Corynebacterium

mucifaciens, COlynebacterium mycetoides, Corynebacterium phocae, Corynebacterium pilosum, Corynebacterium propinquum, Corynebacterium pseudodiphtheriticum, Corynebacterium pseudotuberculosis, Corynebacterium rénale, Corynebacterium

riegelii, COf)lJ1ebacterium seminale, Corynebacterium simulans, Corynebacterium singulare, Corynebacterium striatum, Corynebacterium sundsvallense, Corynebacterium terpenotabidum, Corynebacterium thomssenii, Corynebacterium ulcerans, Corynebacterium urealyticum, Corynebacterium variabilis, Corynebacterium vitaeruminis, Corynebacterium xerosis, Corynebacterium spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinoris, Rbodococcus equi, Turicella otitidis, caractérisé en ce que sa séquence comprend ou, plus particulièrement consiste en une séquence choisie parmi les séquences Another object of the present invention is therefore a fragment of

rpoB gene of a bacterium of the genus Cfn) nebacterium selected from 58 species: Corynebacterium accolens, Corynebacterium afermentans, Corynebacteriuna ammoniagenes, Clynebacterium amycolatum, Corynebacteriuna argentoratense, Corynebacterium auris, Corynebacterium auriscanis, Corynebacterium bovis,
Callunae Corynebacterium, Corynebacterium camporealensis, capitovis Corynebacterium, Corynebacterium confusum, coyleae Corynebacterium, Corynebacterium cystitidis, Corynebacterium diphtheria, Corynebacterium durum efficiens Corynebacterium, Corynebacterium falsenii, FELINUM Corynebacterium, Corynebacterium flavescens, Corynebacterium freneyi, Corynebacterium glucuronolyticum,
Corynebacterium glutamicum, Corynebacterium imitans, Corynebacterium jeikeium,
Corynebacterium kroppenstedtii, Corynebacterium kutscheri, Corynebacterium

Lipophiloflavuna, Corynebacterium macginleyi, Corynebacterium mastitidis, Corynebacterium matruchotii, Corynebacterium minutissimum, Corynebacterium

Mucifaciens, Clynebacterium mycetoides, Corynebacterium phocae, Corynebacterium pilosum, Corynebacterium propinquum, Corynebacterium pseudodiphtheriticum, Corynebacterium pseudotuberculosis, Renal Corynebacterium, Corynebacterium

riegelii, COF) lJ1ebacterium seminal, Corynebacterium simulans, Corynebacterium singulare, Corynebacterium striatum, Corynebacterium sundsvallense, Corynebacterium terpenotabidum, Corynebacterium thomssenii, Corynebacterium ulcerans, Corynebacterium urealyticum, Corynebacterium variabilis, Corynebacterium vitaeruminis, Corynebacterium xerosis, Corynebacterium spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinoris, Rbodococcus equi, Turicella otitidis, characterized in that its sequence comprises or, more particularly, consists of a sequence selected from the sequences

<Desc / Clms Page number 13>

 as described in SED ID Nos. 3 to 60, reverse sequences, complementary sequences.

 The subject of the present invention is also rpoB gene fragments originating from different strains and / or different species of the same species as that of the sequences SEQ ID Nos. 3 to 60 but having similarity rates of at least 98% with said sequences SEQ ID Nos. 3 to 60, and reverse sequences and complementary sequences.

Corynebacterium ou apparentée, de préférence d'au moins 20, de préférence au moins 50, plus particulièrement de 50 à 60 nucléotides consécutifs inclus dans l'une des séquences SEQ ID n 3 à 60, les séquences présentant un taux de similitude d'au moins 98% de similitude avec lesdites séquences SEQ ID n 3 à 60, et les séquences inverses et séquences complémentaires. The subject of the present invention is also oligonucleotides comprising a specific sequence of a bacterium of the genus

Corynebacterium or related, preferably at least 20, preferably at least 50, more particularly from 50 to 60 consecutive nucleotides included in one of the sequences SEQ ID No. 3 to 60, the sequences having a similarity rate of at least at least 98% of similarity with said sequences SEQ ID Nos. 3 to 60, and the inverse sequences and complementary sequences.

procédés de détection de bactérie du genre Corynebacterium par identification moléculaire. The consensus sequences SEQ ID No. 1 and 2 can be used as amplification or sequencing reaction primers in

methods for detecting bacterium of the genus Corynebacterium by molecular identification.

 More specifically, the present invention provides a method of detection by molecular identification of a bacterium of one of the species of the genus Corynebacterium or related characterized in that it uses: the complete or almost complete rpoB gene of said bacterium according to the invention, comprising a said sequence SEQ ID No. 61 to 116, or preferably consisting of a said sequence SEQ ID No. 61 to 116, the sequences having at least 98% similarity with the sequences SEQ ID No. 3 to 60, the inverse sequences or complementary sequences, useful in particular as a species probe of a said bacterium, and / or an rpoB gene fragment of a said bacterium according to the invention, comprising a said sequence SEQ ID No. 3 to 60, the sequences presenting

<Desc / Clms Page number 14>

 at least 98% of similarity with the sequences SEQ ID Nos. 3 to 60, the inverse sequences or the complementary sequences or, preferably, consisting of a said sequence SEQ ID No. 3 to 60, useful in particular as a species probe a said bacterium, and / or an oligonucleotide of sequence specific for a species of said sequence bacterium included in one of the sequences SEQ ID Nos. 3 to 60, the sequences having at least 98% similarity with said SEQ sequences ID No. 3 to 60 and the reverse sequences and complementary sequences, useful in particular as a species probe of a said bacterium, and / or an oligonucleotide or equimolar mixture of oligonucleotides according to the invention, comprising a sequence of at least 12, preferably 18 to 35 nucleotide units, of which at least 12, preferably 18, consecutive nucleotides included in one of the sequences SEQ ID Nos. 1 and 2 or the reverse sequences or complementary sequences, or preferably No. consisting of one of said sequences SEQ ID NO 1 and 2, particularly useful as an amplification primer of a rpoB gene fragment of said bacterium.

In one embodiment of a method for detecting a bacterium of the genus Corynebacterium or related of a specific species, the steps are carried out in which:
Amplification primers comprising said mixtures of oligonucleotides according to the invention are brought into contact with a sample containing or likely to contain nucleic acids of at least one such bacterium of the genus Corynebacterium or related, and with: 5 'primer, a mixture of oligonucleotides selected from oligonucleotides comprising a sequence included in the sequence SEQ. ID. n 1, preferably consisting of said complete sequence SEQ ID No. 1 or complementary sequences, and

<Desc / Clms Page number 15>

 as the 3 'primer, a mixture of oligonucleotides comprising one of the sequences included in one of the sequence SEQ.ID. n 2, preferably consisting of said complete SED ID n 2 sequence or a complementary sequence, respectively.

 2- an amplification of nucleic acids is carried out by enzymatic polymerization reaction and the appearance or absence of an amplification product is determined, and the presence of the absence of said bacterium in the sample is thus determined; an amplification product did not appear.

 Preferably, in a process according to the invention, use is made of: - as a 5 'primer: an equimolar mixture of 12 oligonucleotides of different sequences SEQ ID No. 1 or of complementary sequences, and - as 3' primer: equimolar mixture of 16 oligonucleotides different sequences SEQ ID No. 2 or complementary sequences respectively.

Corynebacterium accolens, Corynebacterium afermentans, Corynebacterium ammoniagenes, Coynebacterium amycolatum, Corynebacterium argentoratense, Corynebacterium auris, Corynebacterium auriscanis, Corynebacterium bovis, Corynebacterium callunae, Corynebacterium camporealensis, Corynebacterium

capitovis, COl)'nebacterium confusum, Corynebacterium coyleae, Corynebacterium cystitidis, Corynebacterium diphtheriae, Corynebacterium durum, Corynebacterium efficiens, Corynebacterium falsenii, Corynebacterium felinum, Corynebacterium

flavescens, Corynebacterium freneyi, Corynebacterium glucuronolyticum, Corynebacteriuna glutamicum, Corynebacterium imitans, Corynebacterium jeikeium, Corynebacterium kroppenstedtii, COf)lJ1ebacterium kutscheri, Coiynebacteriunï lipophiloflavum, Coiynebacterium macginleyi, Corynebacterium mastitidis, Corynebacteriarm matruchotii, Corynebacterium minutissimum, COlynebacterium mucifaciens, COlynebacterium mycetoides, Cor)inebacterium phocae, Corynebacterium Advantageously, it is sought to specifically detect a given species of a bacterium of the Corynebacterium group selected from the species:

Corynebacterium accolens, Corynebacterium afermentans, Corynebacterium ammoniagenes, Coynebacterium amycolatum, Corynebacterium argentoratense, Corynebacterium auris, Corynebacterium auriscanis, Corynebacterium bovis, Corynebacterium callunae, Corynebacterium camporealensis, Corynebacterium

capitovis, COl) 'nebacterium confusum, Corynebacterium coyleae, Corynebacterium cystitidis, Corynebacterium diphtheriae, Corynebacterium durum, Corynebacterium efficiens, Corynebacterium falsenii, Corynebacterium felinum, Corynebacterium

flavescens, Corynebacterium freneyi, Corynebacterium glucuronolyticum, Corynebacteriuna glutamicum, Corynebacterium imitans, Corynebacterium jeikeium, Corynebacterium kroppenstedtii, COF) lJ1ebacterium kutscheri, Coiynebacteriunï lipophiloflavum, Coiynebacterium macginleyi, Corynebacterium mastitidis, Corynebacteriarm matruchotii, Corynebacterium minutissimum, COlynebacterium mucifaciens, COlynebacterium mycetoides, horn) inebacterium phocae , Corynebacterium

<Desc / Clms Page number 16>

pilosum, Corynebacteriuna proPinqtlum, COlynebacterium pseudodiphtheriticul1l, COlynebacteriul1l pseudotuberculosis, COf)'nebacterium rénale, Corynebacterium riegelii, Corynebacterium seminale, Coyyiîebacterium simulans, COf)'nebacterium singulare, Corynebacterium striatum, Corynebacterium sundsvallense,

Corynebacterium terpenotabidum, Corynebacteriu111 thomssenii, Corynebacterium ulcerans, Corynebacterium urealyticum, Corynebacteriuna variabilis, Corynebacterium vitaeruminis, Corynebacterium xerosis, Corynebacterium spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinoris, Khodococcus equi, Turicella otitidis, et à l'étape 2, on détecte la présence d'une dite espèce par hybridation d'une sonde d'espèce comprenant un fragment de gène rpoB ou oligonucléotide spécifique d'une dite espèce selon l'invention.

pilosum, Corynebacteriuna proPinqtlum, Clynebacterium pseudodiphtheritol1l, Clynebacteriuli pseudotuberculosis, Cff) renal nebacterium, Corynebacterium riegelii, Corynebacterium seminal, Coyyiibacterium simulans, Cff) nebacterium singulare, Corynebacterium striatum, Corynebacterium sundsvallense,

Corynebacterium terpenotabidum, Corynebacterium thomssenii, Corynebacterium ulcerans, Corynebacterium urealyticum, Corynebacteriuna variabilis, Corynebacterium vitaeruminis, Corynebacterium xerosis, Corynebacterium spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinori, Khodococcus equi, Turicella otitidis, and in Step 2, the presence of a said species by hybridization of a species probe comprising a rpoB gene fragment or oligonucleotide specific for a said species according to the invention.

donnée d'une bactérie du groupe COlynebacterium ou apparentée, choisie parmi les 58 espèces : Corynebacteriul1l accolens, COf)'nebacteriul1l afermentans, Corynebacterium ammoniagenes, Corynebacteriull1 amycolatum, Corynebacterium argentoratense, Corynebacterium auris, CorynebacterÍt(m auriscanis, Corynebacterium bovis, Corynebacterium callunae, Corynebacterium camporealensis, Corynebacterium capitovis, Corynebacterium confusum, Corynebacterium coyleae, Corynebacterium cystitidis, Corynebacterium diphtheriae, Corynebacterium durum, Corynebacterium efficiens, Corynebacterium falsenii, Corynebacterium felinum, Corynebacterium flavescens, Corynebacterium freneyi, Corynebacterium glucuronolyticum,
Corynebacterium glutamicum, Corynebacterium imitans, Corynebacterium jeikeium, Corynebacterium kroppenstedtii, Corynebacterium kutscberi, Corynebacterium lipopbiloflavum, Corynebacterium macginleyi, Corynebacterium mastitidis, Corynebacterium matruchotii, Corynebacterium minutissimum, Corynebacterium mucifaciens, Corynebacterium m y cetoides, Corynebacterium phocae, Corynebacterium

pilosum, COlynebacterium propinquum, Corynebacterium pseudodiphtheriticuna, Corynebacterium pseudotuberculosis, Corynebacterirum renale, Corynebacterium riegelii, Corynebacterium séminale, Corynebacterium simulans, Corynebacterium singulare, Corynebacterium striatum, Corynebacterium sundsvallense,

Corynebacterium terpenotabidum, Corynebacterium thomssenii, Corynebacterium In another embodiment of a method for detecting a bacterium according to the invention, it is sought to specifically detect a species

given a bacterium belonging to the group Cilynebacterium or related, selected from the 58 species: Corynebacteriul1l accolens, Cf) 'nebacteriul1lfermentans, Corynebacterium ammoniagenes, Corynebacteriulli amycolatum, Corynebacterium argentoratense, Corynebacterium auris, Corynebacterite (m auriscanis, Corynebacterium bovis, Corynebacterium callunae, Corynebacterium Camporealensis, Corynebacterium capitovis, Corynebacterium confusum, Corynebacterium coyleae, Corynebacterium cystitidis, Corynebacterium diphtheriae, Corynebacterium durum, Corynebacterium efficiens, Corynebacterium falsenii, Corynebacterium felinum, Corynebacterium flavescens, Corynebacterium freneyi, Corynebacterium glucuronolyticum,
Corynebacterium glutamicum, Corynebacterium imitans, jeikeium Corynebacterium, Corynebacterium kroppenstedtii, kutscberi Corynebacterium, Corynebacterium lipopbiloflavum, macginleyi Corynebacterium, Corynebacterium mastitidis, matruchotii Corynebacterium, Corynebacterium minutissimum, mucifaciens Corynebacterium, Corynebacterium my cetoides, phocae Corynebacterium, Corynebacterium

pilosum, Clynebacterium propinquum, Corynebacterium pseudodiphtheriticuna, Corynebacterium pseudotuberculosis, Corynebacterirum renale, Corynebacterium riegelii, Corynebacterium seminal, Corynebacterium simulans, Corynebacterium singulare, Corynebacterium striatum, Corynebacterium sundsvallense,

Corynebacterium terpenotabidum, Corynebacterium thomssenii, Corynebacterium

<Desc / Clms Page number 17>

ulcerans, Corynebacteriu!Jl urealyticum, Corynebacterium variabilis, Corynebacterium vitaeruminis, Corynebacterium xerosis, Corynebacterium spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinoris, Rhodococcus equi, Turicella otitidis, et on réalise les étapes dans lesquelles :
1- on met en contact un échantillon contenant ou susceptible de contenir des acides nucléiques d'au moins une telle bactérie, avec au moins une sonde d'espèce consistant dans un fragment de gène rpoB ou oligonucléotide spécifique d'une espèce de ladite bactérie selon l'invention, de préférence un fragment consistant respectivement dans l'une desdites séquences SEQ.ID. n 3 à 60, les séquences inverses et séquences complémentaires, et
2- on détermine la formation ou l'absence d'un complexe d'hybridation entre ladite sonde et les acides nucléiques de l'échantillon, et on détermine ainsi la présence de ladite espèce de bactérie Corynebacterium ou apparentée dans l'échantillon s'il y a formation d'un complexe d'hybridation.

ulcerans, Corynebacteriu! urealyticum, Corynebacterium variabilis, Corynebacterium vitaeruminis, Corynebacterium xerosis, Corynebacterium spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinoris, Rhodococcus equi, Turicella otitidis, and the steps are carried out in which:
A sample containing or likely to contain nucleic acids of at least one such bacterium is brought into contact with at least one species probe consisting in a rpoB gene fragment or oligonucleotide specific for a species of said bacterium according to the invention, preferably a fragment respectively consisting in one of said SEQ.ID. n 3 to 60, reverse sequences and complementary sequences, and
2- determining the formation or absence of a hybridization complex between said probe and the nucleic acids of the sample, and thus determining the presence of said species of Corynebacterium or related bacteria in the sample if There is formation of a hybridization complex.

capitovis, Corynebacteriul1l confusum, Corynebacterium coyleae, C01)'nebacteriuJJt cystitidis, Corynebacterium diphtheriae, Coiyiiebacterium durum, Corynebacteriuna efficiens, Corynebacterium faisenii, Corynebacterium felinum, Corynebacterium flavescens, Corynebacterium freneyi, Corynebacterium glucuronolyticum,
Corynebacterium glutamicum, Corynebacterium imitans, Corynebacterium jeikeium, Corynebacterium kroppenstedtii, Corynebacterium kutscheri, Corynebacterium

lipophiloflavuna, COlynebacterium macginleyi, Corynebacterium mastitidis, Co IY n e ba cteriu m matruchotii, Co ryn e b acte riu 111 min u tissim u m, Corynebacterium In an alternative embodiment of a method for detecting a Corynebacterium bacterium according to the invention, it is sought to detect a given species of a bacterium of the genus Corynebacterium or related, selected from the 58 species: Corynebacterium accolens, Corynebacterium afermentans, Corynebacterium ammoniagenes, Corynebacterium amycolatum, Corynebacterium argentoratense, Corynebacterium auris, Corynebacterium auriscanis, Corynebacterium bovis, Corynebacterium callunae, Corynebacterium camporealensis, Corynebacterium

capitovis, Corynebacteriulum confusum, Corynebacterium coyleae, C01) nebacterium cystitidis, Corynebacterium diphtheriae, Coiyiiebacterium durum, Corynebacteriuna efficiens, Corynebacterium faisenii, Corynebacterium felinum, Corynebacterium flavescens, Corynebacterium freneyi, Corynebacterium glucuronolyticum,
Corynebacterium glutamicum, Corynebacterium imitans, Corynebacterium jeikeium, Corynebacterium kroppenstedtii, Corynebacterium kutscheri, Corynebacterium

Lipophiloflavuna, Clynebacterium macginleyi, Corynebacterium mastitidis, Co IY ne bere m matruchotii, Co ryn eb act riu 111 min u tissim um, Corynebacterium

<Desc / Clms Page number 18>

mucifaciens, Co 1)111 e bacteriuJl1 mycetoides, COl)l11ebacteriuJJt phocae, Corynebacteriuna pilosum, Corynebacterium propinquum, Corynebacterium pseudodiphtheriticum, Corynebacterium pseudotuberculosis, Corynebacterium renale, Corynebacterium riegelii, Corynebacterizrna séminale, Corynebacterium simulans, Corynebacterium singulare, Corysaebacteriuna striatum, Corynebacterium sundsvallense, Cor)raebacterium terpenotabidum, Corynebacteriuna thomssenii, Corynebacterium ulcerans, Corynebacterium urealyticurn, Corynebacterium variabilis, Corynebacterium vitaeruminis, C01)'nebacterium xerosis, Coryr7ebacterium spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinoris, Rhodococcus equi, Turicella otitidis, et, dans un échantillon contenant ou susceptible de contenir des acides nucléiques d'au moins une telle bactérie du genre Corynebacterium,: on réalise les étapes dans lesquelles : a) on réalise une réaction de séquençage d'un fragment du gène rpoB amplifié d'une dite bactérie donnée à l'aide des amorces nucléotidiques consistant dans desdits mélanges d'oligonucléotides selon l'invention, comprenant des séquences incluses dans les séquences SEQ.ID. n 1 comme amorce 5' et SEQ.ID.n 2 comme amorce 3', ou de préférence des oligonucléotides consistant dans lesdites séquences SEQ.ID. n 1 et 2, ou lesdites séquences complémentaires, et b) on détermine la présence ou l'absence de l'espèce donnée de ladite bactérie en comparant la séquence dudit fragment obtenu avec la séquence du gène complet rpoB de ladite bactérie ou la séquence d'un fragment du gène rpoB de ladite bactérie comprenant respectivement lesdites séquences n 3 à 60 et séquences complémentaires, et on détermine ainsi la présence de ladite bactérie dans l'échantillon si la séquence du fragment obtenue est identique à la séquence connue du gène ou du fragment de gène rpoB de ladite bactérie.

mucifaciens, Co 1) 111th bacteriuJl1 mycetoides, lOC) l11ebacteriuJJt phocae, Corynebacteriuna pilosum, Corynebacterium propinquum, Corynebacterium pseudodiphtheriticum, Corynebacterium pseudotuberculosis, Corynebacterium renale, Corynebacterium riegelii, Corynebacterizrna seminal, Corynebacterium simulans, Corynebacterium singulare, Corysaebacteriuna striatum, Corynebacterium sundsvallense, horn) raebacterium terpenotabidum, Corynebacteriuna thomssenii, Corynebacterium ulcerans, Corynebacterium urealyticum, Corynebacterium variabilis, Corynebacterium vitaeruminis, C01) 'nebacterium xerosis, Coryr7ebacterium spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinoris, Rhodococcus equi, Turicella otitidis, and in a sample containing or likely to contain nucleic acids of at least one such bacterium of the genus Corynebacterium, the steps are carried out in which: a) a sequencing reaction of a fragment of the amplified rpoB gene of a d said bacterium given using nucleotide primers consisting in said mixtures of oligonucleotides according to the invention, comprising sequences included in SEQ.ID. n 1 as 5 'primer and SEQ.ID.n 2 as 3' primer, or preferably oligonucleotides consisting in said SEQ.ID. n 1 and 2, or said complementary sequences, and b) determining the presence or absence of the given species of said bacterium by comparing the sequence of said fragment obtained with the sequence of the complete rpoB gene of said bacterium or the sequence of a fragment of the rpoB gene of said bacterium comprising respectively said sequences n 3 to 60 and complementary sequences, and the presence of said bacterium in the sample is thus determined if the sequence of the fragment obtained is identical to the known sequence of the gene or the rpoB gene fragment of said bacterium.

 Preferably, in this embodiment of the detection method according to the invention: in step a) the steps comprising:

<Desc / Clms Page number 19>

A first amplification of the nucleic acid of said sample with a pair of 5 'and 3' primers selected from said oligonucleotide mixtures according to the invention, respectively comprising sequences included in the sequences SEQ.ID. n 1 and SEQ.ID. n 2, or preferably consisting of said SEQ.ID. n 1 and 2, or the complementary sequences, and determining the appearance or absence of an amplification product, and
2- a sequencing reaction of the amplifiers determined in step 1 with the primers 5 'and 3' consisting of said oligonucleotide mixtures comprising sequences included in the sequences SEQ. ID. n 1 and respectively SEQ.ID. n 2, or their complementary sequences, or preferably oligonucleotides consisting in said SEQ.ID. n 1 and 2 or their complementary sequences, and in step b), the sequences obtained are compared with respectively one of the SEQ.ID. n 3 to 60 or their complementary sequences
The sequences SEQ ID Nos. 1 to 60 may be prepared by genetic engineering and / or by automatic synthesis or chemical synthesis using the techniques well known to those skilled in the art.

 The probes according to the invention can be used, for diagnostic purposes, as mentioned above, by determining the formation or the absence of formation of a hybridization complex between the probe and a target nucleic acid in a sample, according to all known hybridization techniques and particularly the techniques of spot deposition on filter, called DOT-BLOT [Maniatis et al. (1982) Molecular Cloning, Cold Spring Harbor], so-called SOUTHERN BLOT DNA transfer techniques [Southern E.M., J. Mol. Biol. (1975) 98: 503], the so-called NORTHERN BLOT RNA transfer techniques, or the so-called sandwich techniques, in particular with a capture probe and / or a detection probe, said probes being capable of hybridizing

<Desc / Clms Page number 20>

 with two different regions of the target nucleic acid, and at least one of said probes (usually the detection probe) being capable of hybridizing with a target region which is species-specific, it being understood that the Capture probe and the detection probe must have at least partially different nucleotide sequences.

 The nucleic acid to be detected (target) may be DNA or RNA (the first obtained after PCR amplification). In the case of the detection of a target of double-stranded nucleic acid type, it is necessary to proceed to the denaturation of the latter before the implementation of the detection method. The target nucleic acid can be obtained by extraction by known methods of the nucleic acids of a sample to be examined. The denaturation of a double-stranded nucleic acid can be carried out by the known methods of chemical, physical or enzymatic denaturation, and in particular by heating to an appropriate temperature, greater than 80 ° C.

 To implement the abovementioned hybridization techniques, and in particular the sandwich techniques, a probe of the invention, called a capture probe, is immobilized on a solid support, and another probe of the invention, called a detection probe. , is labeled with a marker agent. The examples of support and marker agent are as defined above.

 Advantageously, a species probe is immobilized on a solid support, and another species probe is labeled with a marker.

 Another application of a said oligonucleotide mixture of the invention is its use as a nucleotide primer comprising a single-stranded oligonucleotide selected from oligonucleotides having a sequence of at least 12 nucleotide motifs included in one of the sequences SEQ ID No. 1 at 2, which can be used in the synthesis of a nucleic acid in the presence of a polymerase by a method known per se, especially in amplification methods using such a synthesis

<Desc / Clms Page number 21>

 in the presence of a polymerase (PCR, RT-PCR, etc.). In particular, a primer of the invention may be used for the specific reverse transcription of a messenger RNA sequence of a bacterium of a species of the genus Corynebacterium to obtain a corresponding complementary DNA sequence. Such reverse transcription may constitute the first stage of the RT-PCR technique, the next stage being the PCR amplification of the obtained complementary DNA. The primers of the invention can also be used for the specific amplification by polymerase chain reaction of the total sequence of the rpoB gene DNA of a species of the genus Corynebacterium.

 According to a particular case, said primer comprising an oligonucleotide of the invention further comprises the sense or antisense sequence of a promoter recognized by an RNA polymerase (T7 promoters, T3, SP6 for example [Studier FW, BA Moffatt (1986) J Mol Biol.

189: 113]: Such primers are useful in nucleic acid amplification methods involving a transcription step, such as, for example, NASBA or 3SR techniques [Van Gemen B. et al. Abstract MA 1091, 7thInternational Conference on AIDS (1991) Florence, Italy].

 Another subject of the invention is a nucleotide primer comprising a mixture of single-chain oligonucleotides chosen from oligonucleotides having sequences comprising one of the sequences SEQ ID Nos. 1 and 2 or preferably consisting of one of the sequences SEQ. ID. Nos. 1 and 2 which is useful for the total or partial sequencing of the rpoB gene of any species of the genus Corynebacterium.

 The sequencing of the partial or complete rpoB gene in any bacterium of the genus Corynebacteriulll allows the identification of any Corynebacterium bacteria by bioinformatic analysis of this sequence and the recognition of new species of unknown Corynebacterium bacteria.

<Desc / Clms Page number 22>

 Preferably, in a use as a primer or for sequencing rpoB genes, use is made of said oligonucleotide mixtures of sequence SEQ ID Nos. 1 and 2.

 The present invention also relates to a diagnostic kit useful in a method according to the invention comprising at least one said rpoB gene fragment or oligonucleotide according to the invention, comprising a sequence included in one of the sequences SEQ.ID. n 3 to 60 and / or an oligonucleotide or said mixture of equimolar oligonucleotides according to the invention, comprising sequences included in the sequences SEQ.ID. No. 1 and 2, and the oligonucleotides and rpoB gene fragments of reverse sequences and complementary sequences, as defined above.

 In the present description, the term "inverse sequence and complementary sequence" means the following sequences: the inverse sequence of said sequence, the sequence complementary to said sequence, and the sequence complementary to the inverse sequence of said sequence.

 As mentioned in the definitions, an oligonucleotide or nucleic acid fragment according to the invention may be in the form of a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA) for which in this case T is replaced by U.

 Finally, a final subject of the invention is a gene therapy probe for treating infections caused by a strain belonging to a species of the genus Corynebacterium, said probe comprising an oligonucleotide as defined above. This gene therapy probe, capable of hybridizing with the messenger RNA and / or the genomic DNA of said bacteria, can block the phenomena of translation and / or transcription and / or replication.

<Desc / Clms Page number 23>

 The principle of gene therapy methods is known and relies in particular on the use of a probe corresponding to an antisense strand: the formation of a hybrid between the probe and the sense strand is capable of disturbing at least one of steps of decryption of genetic information. The gene therapy probes can therefore be used as antibacterial drugs, making it possible to fight against infections caused by bacteria of species of the genus Corynebacterium.

 Other features and advantages of the present invention will appear and the invention will be better understood with the aid of the following description which relate to the experiments carried out and results obtained for the purpose of carrying out the invention and which are given in purely illustrative.

 Table 1 below lists the Corynebacterium species for which rpoB sequences have been determined. The strains mentioned are from the Institut Pasteur Collection (CIP) or the Culture Collection of the University of Gothenburg ( CCUG), the sequences SEQ ID No. 1 to 120 are described in the sequence listing appended to the description.

 In Table 2 are listed the different primers used for the amplification and sequencing of rpoB genes. The positions shown are relative to the rpoB gene sequence of the bacterium Corynebacterium diphtheriae.

 In Table 2, when presenting sequences comprising nucleotides W, H, Y, V, R, B, M, K, S or D, these have the meanings known to those skilled in the art. and, also conventionally, these primers are in fact used as an equimolar mixture of oligonucleotides of different sequences at the location of said nucleotides as explained above.

 Table 3 presents comparisons of similarities of the 16S rRNA and rpoB gene sequences between the two subspecies C. affermentans and between the 11 pairs of species considered close for which

<Desc / Clms Page number 24>

 the similarities between 16S rRNA gene sequences are greater than or equal to 98.5%, with statistical comparison of the similarity averages obtained.

 FIGS. 1 and 2 are graphical representations of the range of variability (RSV (Y-axis)) of the rpoB gene sequences (FIG. 1) and respectively 16S rRNA (FIG. 2) of the various species of the genus Corynebacterium studied by windows of 50 nucleotides (X axis). The hyper-variable region, bordered by conserved regions, used for species identification using primers C2700F and C3130R, was framed.

 Figure 3 is a dendogram representing the phylogenetic relationships of the different Corynebacterium species by the "neighbor-joining" method. The tree was constructed by the alignment of the rpoB gene sequences. The "bootstrap" sampling values (probability of accuracy of the percent nodes) calculated on the basis of a sample of 1000 trees, are indicated at each node.

 Figure 4 is a dendogram representing the phylogenetic relationships of different Corynebacterium species by the "neighbor-joining" method. The tree was constructed by alignment of the 16S ribosomal RNA gene sequences. The bootstrap values (percent accuracy of the percent nodes) calculated on the basis of a sample of 1000 trees are indicated at each node.

1- Materials and methods
1. 1- Bacterial strains
The bacterial strains used are listed in Table 1.

All strains were cultured on Columbia agar plates at 5% sheep blood and were incubated for 24 to 72 hours at 30 ° C to 37 ° C at 5% CO 2.

<Desc / Clms Page number 25>

Amycolatopsis mediterranei et Mycobacteriu!J1.s!J1egmatis (Genebank access numbers NC~003450, AF242549 et MSU24494 respectively). La séquence consensus a permis de déterminer les amorces utilisées ensuite pour les PCR, la technique de genome walking (17) et pour le séquençage. Certaines amorces ont été déterminées ultérieurement à l'analyse des résultats obtenus. Les amorces sont présentées au tableau 2. 1. 2- amplification and sequencing of the rpoB gene
The existing Corynebacterium rpoB gene sequence and closest species have been aligned to produce a consensus sequence. The sequences chosen were those of Corynebacterium glutamicum,

Amycolatopsis mediterranei and Mycobacterium ™ J1egmatis (Genebank access numbers NC ~ 003450, AF242549 and MSU24494 respectively). The consensus sequence made it possible to determine the primers subsequently used for the PCRs, the genome walking technique (17) and for the sequencing. Some primers were subsequently determined for the analysis of the results obtained. The primers are presented in Table 2.

 Bacterial DNA was extracted from strains suspensions by QIAamp blood kit (Qiagen, Hilden, Germany) according to the manufacturer's recommendations. All PCR reaction mixtures included 2.5 X 10-2 U Taq polymerase per 1.1X Taq buffer, 1.8 mM MgCl 2 (Gibco BRL, Life Technologies, Cergy Pontoise, France), 200 μM dATP, dCTP, dTTP and dGTP (Boehringer Manheim GmbH, Hilden, Germany), and 0.2 u, M from each primer (Eurogentec, Seraing, Belgium). The PCR reaction mixtures were subjected to 35 denaturation cycles at 94 ° C for 30 sec, primer hybridization for 30 sec, and extension at 72 ° C. for 2 min. Each amplification program started with a denaturation step at 95 ° C. for 2 minutes. and ended with an elongation step at 72 C for 10 min. The determination of the gene end sequence was performed using the Universal GenomeWalker Kit (Clontech Laboratories, Palo Alto, CA). Briefly, the genomic DNA was digested with Eco RV, Dra I, Pvu II, Stu I and Sca I. The DNA fragments were ligated with the GenomeWalker adaptor, PCR was performed incorporating the primer "adaptor primer" provided by the manufacturer and specific primers. For amplification, 1. 5 U of ELONGASE enzyme (Boehringer Manheim) was used with 10 pmol of each primer, 20 mM of each dNTP, 10 mM Tris-HCl, 50 mM KCl, 1.6 mM MgCl 2 and 5 l of digested DNA for a final volume of 50 l. The amplicons were purified using the QIAquick spin PCR purification kit (Qiagen).

<Desc / Clms Page number 26>

Sequence reactions were performed using the reagents of the ABI Prism 3100 sequencing sequencer (dRhod.Terminator RR Mix, Perkin Elmer Applied Biosystems).

1. 3- Determination of partial discriminant sequences in the 16S rRNA and rpoB genes
In order to detect the portions of sequence with high variability surrounded by conserved regions, the SVARAP (for Sequence VARActivity Analysis Program, Hypertext link "Download" at the URL: http://ifr48.free.fr/recherche/ game frame / game rickettsia.html).

Once this analysis was done, the most polymorphic zones of the rpoB gene were determined and universal primers, selected in the conserved edge zones, were designated after various unsuccessful attempts. The PCR conditions that incorporated the universal primers (C2700F-C3130R, Table 2) were the same as previously mentioned. These primers were used for the amplification and sequencing of a highly variable zone for all the strains studied.

1. 4- rpoB Sequence Analysis
The rpoB gene fragments obtained in this study were analyzed using Sequence Analysis Software (Applied Biosystems), and the partial sequences were combined into a single consensus sequence using the "Sequence Assembler" Software "(Applied Biosystems). All access numbers for the strains are listed in Table 1. Multiple alignments and percentages of similarity between genes of different species were made by CLUSTAL W (18) on the EMBL-EBI server (http: // www .ebi.ac.uk / clustalw /). Phylogenetic trees were made from the sequences by three methods: "neighbor-joining", "maximum parsimony" and "maximum likelihood" (4). The bootstraps were performed to evaluate the strength of the nodes using SEQBOOT in the PHYLIP software.

<Desc / Clms Page number 27>

2- RESULTS
2. 1- RpoB Sequences of Corynebacterium Species.

 Virtually all rpoB gene sequences were determined for all strains. The rpoB sequences were more polymorphic than those of the ribosomal 16S RNA. This polymorphism is more particularly clear for species poorly differentiated by 16S rDNA (Table 3), because among the 11 pairs of species with a similarity in 16S rRNA ranging from 98.5% to 99.7%, the similarity in rpoB ranges from 84. 9 to 96. 6%. The similarity averages observed in the 11 pairs were significantly different between 16S rRNA and rpoB. This higher polymorphism is also highlighted by calculating the rate of variability (RSV: range site variability) (Figures 1 and 2). RSV> 10 is found for 44/67 in rpoB against 5/27 in 16S rRNA (Fishert's test, p <0.001). RSV> 20 is found for 13/67 in rpoB and 0/27 in 16S rRNA (Fishert's test, p = 0.008). The similarity of the 2 subspecies of C. afermentans is 98.2%, thus 1.6% above the highest similarity observed between 2 species.

 2. 2- Phylogenetic analysis.

 Based on the analysis of the rpoB gene sequences, phylogenetic analysis using the "neighbor-joining", "parsimony" and "maximum-likelihood" methods shows the same organization for the 4 groups supported by high "bootstrap" values. (Figures 3 and 4). Group 4 alone was visible through the use of the 16S rRNA gene. The "bootstar" values p obtained in rpoB are always higher than those obtained in 16D rRNA. Values> 95% are observed for 14/55 of the 16S rRNA nodes whereas they are 24/55 in rpoB (Fishert's test, p = 0.004). For some species, such as C. testudinoris, C. renale, C. seminal or C. glucuronolytycum, the phylogenic position is more difficult to specify. The actual position of T. otidis in a genus separate from that of Corynebacterium is not certain. The rpoB gene study confirms that the

<Desc / Clms Page number 28>

 Rhodococcus is different from the genus Corynebacterium and C. hoagii is quite equivalent to R. equii (http://www.bacterio.cict.fr/c/corynebacterium.html).

2. 3- Identification of strains
Using the SVARAP software program, 4 hyper-variable zones were detected (figure 1). These areas are between positions 1-450,800-1100, 1400-1750, and 2750-3200. Several attempts to provide universal primers for the purpose of amplifying the first 3 zones, have remained unsuccessful. It was possible to provide a pair of consensus primers (C2700F-C3130R) that allowed successful amplification of the 4th zone (positions 2750-3200) in all species of the genus Corynebacterium as well as Rhodococcus equi and Turicella otitidis. The amplified fragment has a size of 434 to 452 bp depending on the species. Interestingly, this region is the most variable (Figure 1). The similarities observed in this portion of rpoB are also significantly lower than those observed in 16S RNA since they range between 87.9% and 95.9% (Table 3). The similarity of the 2 subspecies of C. afermentans is 96.6% or 0.7% higher than the similarity between two species.

2. 4- Discussion
The description of new species is currently based on the results of DNA-DNA hybridization and on the description of phenotypic characters, currently called polyphasic classification (7,19).

However, hybridization is a complicated, expensive, technically complex and labor-intensive technique. The absence or rarity of reproducible characters limits the phenotypic characterization and therefore the phenotypic identification of routine clinical microbiology laboratories. The development of gene amplification / sequencing, especially that of 16S ribosomal RNA, has simplified the taxonomy and identification of many bacterial species, especially those with few distinguishable phenotypic traits. However, as for

<Desc / Clms Page number 29>

Co 1)1nebacteritf!J1, la séquence du 16S rDNA n'est pas assez variable pour l'étude phylogénique basée sur de hautes valeurs de "bootstrap" (figure 1) ou pour permettre une identification basée sur la détermination d'une courte séquence. Les résultats, basés sur les séquences rpoB de ces bactéries, confirment que ce gène est significativement plus variable que le 16S RNA et il est proposé de l'utiliser à la place du 16S ARNr pour l'étude phylogénique des Corynebacterium. Les n#uds à branchement profond sont supportés par de hautes valeurs de "bootstrap" et permettent la mise en évidence de 4 groupes (figure 3). Même parmi les groupes mal résolus, quelques groupes de bactéries sont bien identifiés, comme celui contenant C. diphteriae, C. pseudotuberculosis, C. ulcerans et C. kutscheri.

Co 1) 1nebacteritf! J1, the sequence of 16S rDNA is not variable enough for the phylogenetic study based on high bootstrap values (Figure 1) or to allow identification based on the determination of a short sequence . The results, based on the rpoB sequences of these bacteria, confirm that this gene is significantly more variable than the 16S RNA and it is proposed to use it in place of the 16S rRNA for the phylogenetic study of Corynebacterium. Deep-wired nodes are supported by high bootstrap values and allow highlighting of 4 groups (Figure 3). Even among the poorly resolved groups, a few groups of bacteria are well identified, such as that containing C. diphtheriae, C. pseudotuberculosis, C. ulcerans and C. kutscheri.

 In Table 3, the 11 pairs of Corynebacterium with the highest similarity in 16S rRNA, show that the complete sequence must be determined to ensure certain identification. The universal primers provided according to the invention allow the amplification and sequencing of rpoB fragments of 434 to 452 bp sufficiently polymorphic to allow the identification of all species of the genus Corynebacterium. The highest similarity observed between 2 different species is 95. 9% whereas it is 99. 7% in 16S rRNA by the use of a sequence almost 4 times longer (Table 3). In addition, the 2 subspecies of C. afermentans have a partial rpoB similarity of 96.6%, 0.7% above the similarity between 2 different species.

 This difference is 0.1% for the complete 16S rRNA, making it impossible to differentiate between 2 closely related species or 2 subspecies.

This difference is even greater (1.6%) when the complete rpoB sequence is considered. The cut off thresholds may be defined for the definition of a species and a subspecies in the genus Corynebacterium based on the complete sequence of rpoB as respectively less than 96% and greater than 98%, namely that two different species are defined reliably if the similarity rate is less than 96% and two identical species if the similarity rate is

<Desc / Clms Page number 30>

 greater than 98%. These thresholds are comparable to those observed for the genera Bartonella, Afipia and Bosea (12.9).

<Desc / Clms Page number 31>

Table 1

<tb> Gcnbank <SEP> Sequence <SEP> rpoB <SEP> complete <SEP> Sequence <SEP> rpoB <SEP> partial
<tb> 16S <SEP> rRNA <SEP> SEQ <SEP> ID <SEP> Size <SEP> of <SEP> The <SEP> SEQ <SEP> ID <SEP> Size <SEP> of <SEP> la
<tb> n <SEP> sequence <SEP> (pb) <SEP> n <SEP> sequence <SEP> (pb)
<tb> Corynebacterium <SEP> accolens <SEP> CIP <SEQ> 104783T <SEQ> AJ439346 <SEQ> 61 <SEQ> 3282 <SEQ> 3 <SEQ> 446
<tb> Corynebacterium <SEP> afermentans <SEP> CIP <SEP> 103499T <SEP> X <SEP> 82054 <SEP> 62 <SEQ> 3347 <SEQ> 4 <SEQ> 446
<tb> subspecies. <SEP> afermentans
<tb> Corynebacterium <SEP> afermentans <SEP> CIP <SEP> 103500T <SEP> X <SEP> 82055 <SEQ> 118 <SEQ> 3178 <SEQ> 117 <SEQ> 446
<tb> lipophilum
<tb> Corynebacterium <SEP> Ammoniagenes <SEP> CIP <SEP> 101283T <SEP> X <SEP> 82056 <SEP> 63 <SEP> 3349 <SEP> 5 <SEP> 446
<tb> Corynebacterium <SEP> amycolatum <SEP> CIP <SEP> 103452T <SEP> X <SEP> 82057 <SEQ> 64 <SEQ> 3435 <SEJ> 6 <SEQ> 434
<tb> Corynebacterium <SEP> argentoratense <SEP> CIP <SEP> 104296T <SEP> X <SEP> 83955 <SEP> 65 <SEP> 3349 <SEP> 7 <SEP> 446
<tb> Corynebacterium <SEP> aurimucosum <SEP> CCUG <SEQ> 47449T <SEP> AJ309207 <SEP> 66 <SEQ> 3330 <SEQ> 8 <SEQ> 446
<tb> Corynebacterium <SEP> auris <SEP> CIP <SEP> 104632T <SEP> X <SEP> 81873 <SEQ> 67 <SEQ> 3357 <SEQ> 9 <SEQ> 446
<tb> Corinobacterium <SEP> auriscanis <SEP> CIP <SEP> 106629T <SEP> AJ243820 <SEP> 68 <SEP> 3346 <SEP> 10 <SEP> 452
<tb> Corynebacterium <SEP> Bovis <SEP> CIP <SEQ> 5480T <SEP> X <SEP> 82051 <SEP> 69 <SEP> 3450 <SEP> 11 <SEP> 452
<tb> Corynebacterium <SEP> callunae <SEP> CIP <SEQ> 104277T <SEP> X <SEP> 82053 <SEQ> 70 <SEQ> 3340 <SEK> 12 <SEQ> 446
<tb> Corynebacterium <SEP> camporealensis <SEP> CIP <SEP> 105508T <SEQ> Y09569 <SEQ> 71 <SEQ> 3340 <SEQ> 13 <SEQ> 446
<tb> Corynebacterium <SEP> capitovis <SEP> CIP <SEP> 106739T <SEP> AJ297402 <SEP> 72 <SEP> 3350 <SEQ> 14 <SEP> 446
<tb> Corynebacterium <SEP> confusum <SEP> CIP <SEQ> 105403T <SEQ> Y15886 <SEQ> 73 <SEQ> 3356 <SEQ> 15 <SEQ> 446
<Tb>

<Desc / Clms Page number 32>

<tb> Genbank <SEP> Sequence <SEP> rpoB <SEP> complete <SEP> Sequence <SEP> rpoB <SEP> partial
<tb> 16S <SEP> rRNA <SEP> SEQ <SEP> ID <SEP> Size <SEP> of <SEP> The <SEP> SEQ <SEP> ID <SEP> Size <SEP> of <SEP> la
<tb> n <SEP> sequence <SEP> (pb) <SEP> n <SEP> sequence <SEP> (pb)
<tb> Corynebacterium <SEP> coyleae <SEP> CIP <SEP> 104929T <SEP> X <SEP> 96497 <SEP> 74 <SEP> 3314 <SEP> 16 <SEQ> 446 <SEP>
<Tb>

Corynebacteriu!J1 cystitidis CIP 103424T X 82058 75 3340 17 446

Corynebacteriu! J1 cystitidis CIP 103424T X 82058 75 3340 17 446

<tb> Corynebacterium <SEP> diphtheriae <SEP> CIP <SEP> 100721T <SEP> X <SEP> 82059 <SEP> 76 <SEQ> 3477 <SEQ> 18 <SEQ> 446
<tb> Corynebacterium <SEP> durum <SEP> CIP <SEP> 105490T <SEP> Z97069 <SEP> 77 <SEQ> 3340 <SEQ> 19 <SEQ> 446
<tb> Corynebacterium <SEP> efficiens <SEQ> YS-314 <SEP> AB055963- <SEP> 3480 <SEP> 20 <SEP> 446
<tb> Corynebacterium <SEP> falsenii <SEP> CIP <SEP> 105466T <SEP> Y13024 <SEQ> 78 <SEQ> 3330 <SEP> 21 <SEP> 452
<tb> Corynebacterium <SEP> felinum <SEP> CIP <SEQ> 106740T <SEQ> AJ401282 <SEQ> 79 <SEQ> 3334 <SEQ> 22 <SEQ> 446
<tb> Corynebacterium <SEP> flavescens <SEP> CIP <SEP> 69.5T <SEP> X <SEP> 82060 <SEP> 80 <SEP> 3303 <SEP> 23 <SEP> 446
Corynebacterium SEP freneyi SEP CIP SEP 106767T SE292762 SEP 81 SEP 3345 SEP 24 SEP 434
<tb> Corynebacterium <SEP> glucuronolyticum <SEP> CIP <SEP> 104577T <SEP> X <SEP> 86688 <SEP> 82 <SEP> 3328 <SEP> 25 <SEP> 434
<tb> Corynebacterium <SEP> Glutamicum <SEP> ATCC <SEP> 13032 <SEP> X80629 <SEP> 3480 <SEP> 26 <SEP> 446
<tb> Corynebacterium <SEP> imitans <SEP> CIP <SEP> 105130T <SEQ> Y09044 <SEQ> 83 <SEQ> 3333 <SEQ> 27 <SEQ> 446
<tb> Corynebacterium <SEP> jeikeium <SEP> CIP <SEP> 103337T <SEP> X <SEP> 82062 <SE> 84 <SE> 3463 <SEP> 28 <SEP> 452
<tb> Corynebacterium <SEP> kroppenstedtii <SEQ> CIP <SEQ> 105744T <SEQ> Y10077 <SEQ> 85 <SEQ> 3349 <SEQ> 29 <SEQ> 452
<tb> Corynebacterium <SEP> kutscheri <SEP> CIP <SEP> 103423T <SEP> X <SEP> 82063 <SEQ> 86 <SEQ> 3168 <SEQ> 30 <SEQ> 446
<tb> Corynebacterium <SEP> lipophiloflavum <SEP> CIP <SEP> 105127T <SEQ> Y09045 <SEP> 87 <SEQ> 3340 <SEP> 31 <SEQ> 446
<tb> Corynebacterium <SEP> macginleyi <SEP> CIP <SEQ> 104099T <SEP> X <SEP> 80499 <SEQ> 88 <SEQ> 3173 <SEQ> 32 <SEQ> 446
<Tb>

<Desc / Clms Page number 33>

<tb> Genbank <SEP> Sequence <SEP> rpoB <SEP> complete <SEP> Sequence <SEP> rpoB <SEP> partial
<tb> 16S <SEP> rRNA <SEP> SEQ <SEP> ID <SEP> Size <SEP> of <SEP> The <SEP> SEQ <SEP> ID <SEP> Size <SEP> of <SEP> la
<tb> n <SEP> sequence <SEP> (pb) <SEP> n <SEP> sequence <SEP> (pb)
<tb> Corynebacterium <SEP> Mastitidis <SEP> CIP <SEP> 105509T <SEQ> Y09806 <SEQ> 89 <SEQ> 3174 <SEQ> 33 <SEQ> 446
<tb> Corynebacterium <SEP> matruchotii <SEP> CIP <SEP> 81.82T <SEP> X <SEP> 82065 <SEP> 90 <SEQ> 3338 <SEP> 34 <SEQ> 446
<tb> Corynebacterium <SEP> minutissimum <SEP> CIP <SEP> 100652T <SEP> X <SEP> 84679 <SEP> 91 <SEP> 3358 <SEP> 35 <SEP> 446
<tb> Corynebacterium <SEP> mucifaciens <SEP> CIP <SEP> 105129T <SEP> Y11200 <SEP> 92 <SEP> 3330 <SEP> 36 <SEP> 446
<tb> Corynebacterium <SEP> Mycetoides <SEP> CIP <SEP> 55.51T <SEP> X <SEP> 82066 <SEP> 93 <SEP> 3332 <SEP> 37 <SEP> 446
<tb> Corynebacterium <SEP> phocae <SEP> CIP <SEP> 105741T <SEQ> Y10076 <SEQ> 94 <SEQ> 3180 <SEQ> 38 <SEQ> 446
<tb> Corynebacterium <SEP> pilosum <SEP> CIP <SEP> 103422T <SEP> X84246 <SEP> 95 <SEP> 3296 <SEP> 39 <SEP> 446
<tb> Corynebacterium <SEP> Propinquum <SEP> CIP <SEP> 103792T <SEP> X <SEP> 81917 <SEQ> 96 <SEQ> 3179 <SEQ> 40 <SEQ> 446
<tb> Corynebacterium <SEP> CIP <SEP> 103420T <SEP> X <SEP> 81918 <SEP> 97 <SEP> 3477 <SEP> 41 <SEP> 446
<Tb>

p s eu do dip h theriticum

ps eu do dip h theriticum

<tb> Corynebacterium <SEP> Pseudotuberculosis <SEP> CIP <SEP> 102968T <SEP> X <SEP> 81916 <SEP> 98 <SEP> 3447 <SEP> 42 <SEP> 446
<tb> Corynebacterium <SEP> renal <SEP> CIP <SEQ> 103421T <SEQ> X <SEQ> 81909 <SEQ> 99 <SEQ> 3442 <SEQ> 43 <SEQ> 446
<tb> Corynebacterium <SEQ> riegelii <SEP> CIP <SEQ> 105310T <SEQ> Y14651 <SEQ> 100 <SEQ> 3180 <SEQ> 44 <SEQ> 446
<tb> Corynebacterium <SEP> Seminal <SEP> CIP <SEQ> 104297T <SEP> X <SEP> 84375 <SEQ> 101 <SEQ> 3153 <SEQ> 45 <SEQ> 434
<tb> Corynebacterium <SEP> simulans <SEP> CIP <SEP> 106488T <SEP> AJ012837 <SEQ> 102 <SEQ> 3176 <SEQ> 46 <SEQ> 446
<tb> Corynebacterium <SEP> singulare <SEP> CIP <SEP> 105491T <SEQ> Y10999 <SEQ> 103 <SEQ> 3180 <SEQ> 47 <SEQ> 446
<tb> Corynebacterium <SEP> spheniscorum <SEP> CCUG <SEP> 45512T <SEQ> AJ429234 <SEP> 104 <SEQ> 3283 <SEQ> 48 <SEQ> 446
<Tb>

<Desc / Clms Page number 34>

<tb> Genbank <SEP> Sequence <SEP> rpoB <SEP> complete <SEP> Sequence <SEP> rpoB <SEP> partial
<tb> 16S <SEP> rRNA <SEP> SEQ <SEP> ID <SEP> Size <SEP> of <SEP> The <SEP> SEQ <SEP> ID <SEP> Size <SEP> of <SEP> la
<tb> n <SEP> sequence <SEP> (pb) <SEP> n <SEP> sequence <SEP> (pb)
<tb> Corynebacterium <SEP> striatum <SEP> CIP <SEP> 81.15T <SEP> X <SEP> 81910 <SEQ> 105 <SEQ> 3346 <SEQ> 49 <SEQ> 446
<tb> Corynebacterium <SEP> sundsvallense <SEP> CIP <SEP> 105936T <SEQ> Y09655 <SEQ> 106 <SEQ> 3359 <SEQ> 50 <SEQ> 446
<tb> Corynebacterium <SEP> Terpenotabidum <SEP> CIP <SEP> 105927T <SEP> AB004730 <SEP> 107 <SEP> 3286 <SEP> 51 <SEP> 452
<tb> Corynebacterium <SEP> testudinoris <SEP> CCUG <SEP> 41823T <SEP> AJ295841 <SEP> 108 <SEP> 3320 <SE> 52 <SEP> 446
Corynebacterium SEP tbomssenii SEP CIP SEP 105597T SEP AF010474 SEP 109 SEP 3352 SEP 53 SEP 446
<tb> Corynebacterium <SEP> ulcerans <SEP> CIP <SEP> 106504T <SEP> X <SEP> 81911 <SEQ> 110 <SEQ> 3176 <SEQ> 54 <SEQ> 446
<tb> Corynebacterium <SEP> urealyticum <SEP> CIP <SEP> 103524T <SEP> X <SEP> 81913 <SEQ> 111 <SEQ> 3172 <SEQ> 55 <SEQ> 452
<tb> Corynebacterium <SEP> variabile <SEP> CIP <SEQ> 102112T <SEP> AJ222815 <SEQ> 112 <SEQ> 3343 <SEQ> 56 <SEQ> 452
<tb> Corynebacterium <SEP> vitaeruminis <SEP> CIP <SEP> 827T <SEP> X <SEP> 84680 <SEP> !! <SEP> 113 <SEP> 3296 <SEP> 57 <SEP> 446
<tb> Corynebacterium <SEP> xerosis <SEP> CIP <SEP> 100653T <SEP> X <SEP> 81914 <SEQ> 114 <SEQ> 3447 <SEQ> 58 <SEQ> 434
<tb> Rhodococcus <SEP> equi <SEP> (formerly <SEP> CIP <SEP> 81.17T <SEP> X <SEP> 82052 <SE> 115 <SE> 3357 <SE> 59 <SE> 449
<tb> Corynebacterium <SEP> boagii)
<tb> Rhodococcus <SEP> equi <SEP> CIP <SEQ> 5472T <SEQ> AF490539 <SEP> 120 <SEQ> 3320 <SEQ> 119 <SEQ> 449
<tb> Turicella <SEP> Otitidis <SEP> CIP <SEP> 104075T <SEP> X <SEP> 73976 <SEP> 116 <SEP> 3250 <SE> 60 <SEP> 446
<Tb>

<Desc / Clms Page number 35>

Table 2.

<Tb>
<Tb>

Name <SEP> of <SEP> Sequence <SEP> Position <SEP> Tm
<tb> the primer <SEP> (C)
<tb> C240F <SEP> GGAAGGAYGCATCTTGGCAGTCT <SEP> -13 <SEP> 68
<tb> C150F <SEP> GGYACGCCYGAGTGGC <SEP> 133 <SEP> 56
<tb> C35F <SEP> GGAAGGACCCATCTTGGCAGT <SEP> -13 <SEP> 66
<tb> C41F <SEP> CAGTCTCCCGCCAGACCA <SEP> 5 <SEP> 60
<tb> C445R <SEP> CATYGGGAARTCRCCGATGA <SEP> 401 <SEP> 60
<tb> C40F <SEP> CAGTCTCCCGCCAGACCAA <SEP> 5 <SEP> 62
<tb> C390F <SEP> ATCAAGTCYCAGACKGTYTTCATC <SEP> 322 <SEP> 68
<tb> C390R <SEP> GATGAARACMGTCTGRGACTTGAT <SEP> 322 <SEP> 68
<tb> C630F <SEP> GACCGCAAGCGYCGCCAG <SEP> 621 <SEP> 64
<tb> C600f <SEP> TGGYTBGARTTYGACGT <SEP> 574 <SEP> 50
<tb> C600r <SEP> ACGTCRAAYTCVARCCA <SEP> 574 <SEP> 50
<tb> C640R <SEP> GGCTGRCGRCGCTTGCGGT <SEP> 623 <SEP> 66
<tb> C890F <SEP> TACAAGRTCAACCGCAAG <SEP> 883 <SEP> 52
<tb> C820R <SEP> GGRCGYTGCTTGCGGTAGA <SEP> 772 <SEP> 62
<tb> C1050F <SEP> CGAYGACATYGACCACTT <SEP> 1040 <SEP> 54
<tb> C1050R <SEP> GGTTRCCRAAGTGGTCRATGTC <SEP> 1045 <SEP> 68
<tb> C1295F <SEP> CAGTTYMTGGACCAGAACAAC <SEP> 1254 <SEP> 62
<tb> C1410F <SEP> GAGCGYATGACCACBCAGGA <SEP> 1144 <SEP> 64
<tb> C1410R <SEP> TCCTGVGTGGTCATRCGCTC <SEP> 1144 <SEP> 64
<tb> C1415F <SEP> CBCACTACGGMCGYATGTG <SEP> 1373 <SEP> 62
<tb> C1740F <SEP> ACGATGCTAACCGTGCACTGAT <SEP> 1739 <SEP> 66
<tb> C1740R <SEP> CCCATCAGTGCACGGTTAGCAT <SEP> 1742 <SEP> 68
<tb> C1765R <SEP> GTGCTCSAGGAAYGGRATCA <SEP> 1718 <SEP> 62
<tb> C1770F <SEP> TGATGGGYGCSAACATGCAG <SEP> 1757 <SEP> 64
<tb> C1800f <SEP> ATGGGYGCSAACATGCAG <SEP> 1759 <SEP> 56
<tb> C1800r <SEP> CTGCATGTTSGCRCCCAT <SEP> 1759 <SEP> 56
<tb> C2160R <SEP> GRCCYTCCCAHGGCATGAA <SEP> 2107 <SEP> 60
<tb> C2130F <SEP> GGARGGCCACAACTACGAGGA <SEP> 2118 <SEP> 64
<tb> C2130R <SEP> GTGGCCYTCCCAHGGCATGAA <SEP> 2107 <SEP> 68
<tb> C2350F <SEP> ACATCCTGGTCGGTAAGGTCAC <SEP> 2339 <SEP> 68
<Tb>

<Desc / Clms Page number 36>

<Tb>
<tb> C2350R <SEP> GTGACCTTACCGACCAGGATGT <SEP> 2339 <SEP> 68
<tb> C2385F <SEP> CATCCTSGTSGGYAAGGTCA <SEP> 2340 <SEP> 64
<tb> C2410R <SEP> ATGATCGCRTCCTCGTAGTTGTG <SEP> 2125 <SEP> 68
<tb> C2410F <SEP> CACAACTACGAGGAYGCGATCAT <SEP> 2125 <SEP> 68
<tb> C2470R <SEP> CGATCTCGTGCTCCTCGATGT <SEP> 2192 <SEP> 66
<tb> C2590F <SEP> CARAAGCGCAAGATCCARGA <SEP> 2563 <SEP> 60
<tb> C2625F <SEP> AGATCCARGAYGGCGAYAAG <SEP> 2572 <SEP> 60
<tb> C3190F <SEP> ATGGAGGTGTGGGCAATGCAG <SEP> 3154 <SEP> 66
<tb> C3190R <SEP> CTGCATTGCCCACACCTCCAT <SEP> 3154 <SEP> 66
<tb> C3200r <SEP> CTGCATBGCCCACACCTCCAT <SEP> 3154 <SEP> 68
<tb> C3215R <SEP> GCCTGCATBGCCCACACCT <SEP> 3158 <SEP> 64
<tb> C3300F <SEP> GAAGGGCGADAAYATYCCGGAT <SEP> 3264 <SEP> 66
<tb> C3300R <SEP> TCCGGRATRTTHTCGCCCTTCA <SEP> 3263 <SEP> 66
<tb> C3350R <SEP> CCTTGAASGACTCHGGRATAC <SEP> 3290 <SEP> 64
<tb> C3490R <SEP> CACGGGACAGGTTGATGCC <SEP> 3430 <SEP> 62
<tb> C3630R <SEP> GAGMACCTCSACGTTSAGGCACA <SEP> 3335 <SEP> 70
<tb> C3500R <SEP> TCGTCDCGBGACAGGTTGATG <SEP> 3433 <SEP> 66
<tb> C2700F <SEP> CGWATGAACATYGGBCAGGT <SEP> 2714 <SEP> 60
<tb> C3130R <SEP> TCCATYTCRCCRAARCGCTG <SEP> 3140 <SEP> 62
<Tb>

<Desc / Clms Page number 37>

Table 3

<tb> Couples <SEP> of species <SEP> close <SEP> 16S <SEP> rDNA <SEP> ropB <SEP> complete <SEP> ropB <SEP> partial
<tb> C. <SEP> diphtheriae <SEP> / <SEP> C. <SEP> ulcerans <SEP> 98.5 <SEQ> 86 <SEP> 87.9
<tb> C. <SEP> diphtheriae <SEP> / <SEP> C. <SEP> pseudotuberculosis <SEP> 98. <SEP> 5 <SEP> 84. <SEP> 9 <SEP> 87.9
<tb> C. <SEP> ulcerans <SEP> / <SEP> C <SEP> pseudotuberculosis <SEP> 99. <SEP> 7 <SEP> 93. <SEP> 6 <SEP> 93
<Tb>

C pseudodiphtheritictfm / C. propinquum 99.3 89.7 93.9

C pseudodiphtheritictfm / C.propinquum 99.3 89.7 93.9

<tb> C. <SEP> aurimucosum <SEP> / <SEP> C. <SEP> singulare <SEP> 99 <SEP> 94. <SEP> 2 <SEP> 93.9
<tb> C. <SEP> aurimucosum <SEP> / <SEP> C. <SEP> minutissimum <SEP> 98. <SEP> 7 <SEP> 94. <SEP> 6 <SEP> 93.9
<tb> C. <SEP> singulare / <SEP> C. <SEP> minutissimum <SEP> 98. <SEP> 9 <SEP> 93. <SEP> 8 <SEP> 95. <SEP> 5
<tb> C. <SEP> xerosis <SEP> / <SEP><SEP> freneyi <SEP> 98. <SEP> 7 <SEP> 96. <SEP> 6 <SEP> 95. <SEP> 9
<tb> C. <SEP> macginleyi <SEP> / <SEP> C. <SEP> accolens <SEP> 98. <SEP> 7 <SEP> 93. <SEP> 3 <SEP> 91. <SEP> 7
<tb> C. <SEP> sundsvallens / <SEP> C. <SEP> thomssenii <SEP> 98. <SEP> 9 <SEP> 90. <SEP> 4 <SEP> 91
<tb> C. <SEP> mucifaciens <SEP> / <SEP> C. <SEP> afermantans <SEP> 98. <SEP> 5 <SEP> 94 <SEP> 92.4
<tb> Average <SEP> 98. <SEP> 85 <SEP> 91. <SEP> 91 <SEP> 92. <SEP> 45
<tb> Analysis <SEP> statistic <SEP> by <SEP> comparison <SEP> with <SEP> 16S <SEP> RNA <SEP> p <SEP> = <SEP> 0.03 <SEP> p <SEP> = <SEP > 0.01
<tb>(Student's<SEP> t-test)
<Tb>

C. afernaentans subspecies. afernaentas / 99.8 98.2 96.6

C. afernaentans subspecies. afernaentas / 99.8 98.2 96.6

<tb> C. <SEP> afermentans <SEP> subspecies <SEP> lipophilum
<Tb>

Claims (18)

1. Complete rpoB gene or quasi-complete rpoB gene fragment of a bacterium of the genus Corynebacterium or related, selected from 56 species: Corynebacterium accolens, Corynebacterium afermentans, Corynebacterium ammoniagenes, Corynebacterium amycolatum, Corynebacterium argentoratense, Corynebacterium auris, Corynebacterium auriscanis, Corynebacterium bovis, Callunae Corynebacterium, Corynebacterium camporealensis, capitovis Corynebacterium, Corynebacterium confusum, coyleae Corynebacterium, Corynebacterium cystitidis, Corynebacterium diphtheria, Corynebacterium durum falsenii Corynebacterium, Corynebacterium FELINUM, Corynebacterium flavescens, Corynebacterium freneyi, glucuronolyticum Corynebacterium, Corynebacterium imitans, Corynebacterium jeikeium, Corynebacterium kroppenstedtii, Corynebacterium kutscheri, Corynebacterium lipophiloflavum, Corynebacterium macginleyi, Corynebacterium mastitidis, Corynebacterium m tru ch o tii, Corynebacterium minutissimum, Corynebacterium mucifaciens, Corynebacterium mycetoides, Corynebacterium phocae, Corynebacterium pilosum, Corynebacterium propinquum, Corynebacterium pseudodiphtheriticum, Corynebacterium pseudotuberculosis, Corynebacterium renale, Corynebacterium riegelii, Corynebacterium seminal, Corynebacterium simulans, Corynebacterium singulare, Corynebacterium striatum, Sundsvallense Corynebacterium, Corynebacterium terpenotabidum, thomssenii Corynebacterium, Corynebacterium ulcerans, Corynebacterium urealyticum, Corynebacterium variabilis, Corynebacterium vitaeruminis, Corynebacterium xerosis, Corynebacterium spheniscorum, aurimucosum Corynebacterium, Corynebacterium testudinoris, Rhodococcus equi, Turicella otitidis, characterized in that it comprises a sequence selected from the sequences as described in the sequences SEQ. ID. n 61 to 116, the sequences having at least 98% similarity with the sequences SEQ ID No. 61 to 116 and the inverse sequences and complementary sequences.  2. Complete rpoB gene or quasi-complete rpoB gene fragment of a bacterium of the genus Corynebacterium or related according to claim 1, characterized in that its sequence consists of a sequence <Desc / Clms Page number 39>  selected from the sequences SEQ. ID. n 61 to 116, the sequences having at least 98% similarity with the sequences SEQ ID No. 61 to 116 and the inverse sequences and complementary sequences.  3. Fragment of rpoB gene of a bacterium of the genus Corynebacterium selected from 58 species: Corynebacterium accolens, Corynebacterium afermentans, Corynebacterium ammoniagenes, Corynebacterium amycolatum, Corynebacterium argentoratense, Corynebacterium auris, Corynebacterium auriscanis, Corynebacterium bovis, Corynebacterium callunae, Corynebacterium camporealensis, Corynebacterium capitovis, Corynebacterium confusum, Corynebacterium coyleae, Corynebacterium cystitidis, Corynebacterium diphtheriae, Corynebacterium durum, Corynebacterium efficiens, Corynebacterium falsenii, Corynebacterium FELINUM, Corynebacterium flavescens, Corynebacterium freneyi, Corynebacterium glucuronolyticum, Corynebacterium glutamicum, Corynebacterium imitans, Corynebacterium jeikeium, Corynebacterium kroppenstedtii, Corynebacterium kutscheri, Corynebacterium lipophiloflavum, Corynebacterium macginleyi, Corynebacterium mastitidis, Corynebacterium matrucbotii, Corynebacterium minutissimum, Corynebacterium mucifaciens, Corynebacterium mycetoides, Corynebacterium phocae, Corynebacterium pilosum, Corynebacterium propinquum, Corynebacterium pseudodiphtheriticum, Corynebacterium pseudotuberculosis, renal Corynebacterium, Corynebacterium riegelii, Corynebacterium seminal, Corynebacterium simulans, Corynebacterium singulare, Corynebacterium striatum, Corynebacterium sundsvallense, Corynebacterium terpenotabidum, Corynebacterium thomssenii, Corynebacterium ulcerans, Corynebacterium urealyticum, Corynebacterium variabilis, Corynebacterium vitaeruminis, Corynebacterium xerosis, Corynebacterium spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinoris, Rhodococcus equi, Turicella otitidis, characterized in that it comprises a sequence chosen from the sequences as described in the sequences SEQ ID No. 3 at 60, the sequences having at least 98% similarity with the sequences SEQ ID Nos. 3 to 60 and the inverse sequences and complementary sequences.  4. Fragment of rpoB gene of a bacterium of the genus Corynebacterium or related according to claim 3, characterized in that its sequence <Desc / Clms Page number 40>  consists of a sequence chosen from the sequences SEQ ID Nos. 3 to 60, the sequences having at least 98% similarity with the sequences SEQ ID Nos. 3 to 60 and the inverse sequences and complementary sequences.  An oligonucleotide characterized in that it comprises a sequence specific for a bacterium of the genus Corynebacterium or related, preferably at least 20 consecutive nucleotides included in one of the sequences SEQ ID Nos. 3 to 60, the sequences having at least at least 98% of similarity with the sequences SEQ ID Nos. 3 to 60 and the inverse sequences and complementary sequences.  6. In vitro use as a probe, of a gene fragment or oligonucleotide according to one of claims 3 to 5.  An oligonucleotide characterized in that it comprises a sequence of at least 8, preferably at least 12, more preferably from 18 to 35 nucleotide units, of which at least 8, preferably at least 12, more preferably at least 12. 18 consecutive nucleotide motifs included in one of the following SEQ ID No. 1 and 2 sequences: SEQ ID No. 1: 5'-CGWATGAACATYGGBCAGGT-3 ', and SEQ ID No. 2: 5'-TCCATYTCRCCRAARCGCTG-3', in which : W represents A or T, Y represents C or T, B represents C, G or T and R represents A or G.  8. Oligonucleotide mixture, characterized in that it comprises an equimolar mixture of oligonucleotides according to claim 7, of different sequences comprising at least 12, preferably at least 18 consecutive nucleotide motifs included in one of the SEQ.ID sequences. . n 1 and 2, or oligonucleotides of reverse sequences or complementary sequences.  9. Mixture of oligonucleotides according to claim 8, characterized in that it consists of an equimolar mixture of 12 oligonucleotides of different sequences consisting in the sequence <Desc / Clms Page number 41>  SEQ.ID. n 1 or oligonucleotides of inverse sequences or complementary sequences.  10. Mixture of oligonucleotides according to claim 8, characterized in that it consists of an equimolar mixture of 16 oligonucleotides of different sequences consisting in the sequence SEQ. ID. n 2 or oligonucleotides of inverse sequences or complementary sequences.  11. In vitro use as an amplification primer, of an oligonucleotide or mixture of oligonucleotides according to one of claims 7 to 10.  12. Method for the in vitro detection by molecular identification of a bacterium of one of the species of the genus Corynebacterium or related, characterized in that the following is used: the complete or quasi-complete rpoB gene of said bacterium according to claim 1; or 2, or - a fragment of said gene according to claim 3 or 4, and / or - an oligonucleotide or mixture of oligonucleotides according to one of claims 5 and 7 to 10.  13. The method of claim 12, characterized in that it comprises the steps in which: Amplification primers comprising said mixtures of oligonucleotides according to one of Claims 8 to 10 are brought into contact with a sample containing or capable of containing nucleic acids of at least one such bacterium of the genus Corynebacterium or related and with as a 5 'primer a mixture of oligonucleotides according to claim 8 or 9, selected from oligonucleotides comprising a sequence included in the sequence SEQ.ID. n 1, preferably consisting of <Desc / Clms Page number 42> SEQ.ID. n 2, preferably consisting of said complete SED ID n 2 sequence or a complementary sequence, respectively.  in said complete sequence SEQ ID No. 1 or complementary sequences, and as 3 'primer, a mixture of oligonucleotides according to claim 8 or 10, comprising sequences included in the sequence  2- nucleic acid amplification is carried out by enzymatic polymerization reaction and the appearance or absence of an amplification product is determined, and thus the absence of said bacterium in the sample is determined if a product amplification did not appear.  14. Method according to claim 13, characterized in that it seeks to specifically detect a given species of a bacterium of the Corynebacterium group selected from the species: Corynebacterium accolens, Corynebacterium afermentans, Corynebacterium ammoniagenes, Corynebacterium amycolatum, Corynebacterium argentoratense, Corynebacterium auris, Corynebacterium auriscanis, Corynebacterium bovis, Corynebacterium callunae, Corynebacterium camporealensis, Corynebacterium capitovis, Corynebacterium confusum, Corynebacterium coyleae, Corynebacterium cystitidis, Corynebacterium diphtheria, Corynebacterium durum Corynebacterium efficiens, Corynebacterium falsenii, Corynebacterium FELINUM, Corynebacterium flavescens, Corynebacterium freneyi, Corynebacterium glucuronolyticum, Corynebacterium glutamicum, Corynebacterium imitans, Corynebacterium jeikeium, Corynebacterium kroppenstedtii , Corynebacterium kutscheri, Corynebacterium lipophiloflavum, Corynebacterium macginleyi, Corynebacterium mastitidis, Corynebacterium matrucbotii, Corynebacterium minutissimum, Corynebacterium mucifaciens, Corynebacterium mycetoides, Corynebacterium phocae, Corynebacterium pilosum, Corynebacterium propinquum, Corynebacterium pseudodiphtheriticum, Corynebacterium pseudotuberculosis, Corynebacterium renale, Corynebacterium riegelii, Corynebacterium seminal Corynebacterium simulans, Corynebacterium singulare, Corynebacterium striat um, Corynebacterium sundsvallense, Corynebacterium terpenotabidum, Corynebacterium thomssenii, Corynebacterium ulcerans, <Desc / Clms Page number 43> 4 or 5. Turicella otitidis, and in step 2, the presence of a said species is detected by hybridization of a species probe comprising an rpoB gene fragment or oligonucleotide specific for a said species according to one of the claims Corynebacterium aurimucosum, Corynebacterium testudinoris, Rhodococcus equi, Corynebacterium urealyticum, Corynebacterium variabilis, Corynebacterium vitaeruminis, Corynebacterium xerosis, Corynebacterium spheniscorum,  15. The method of claim 12, characterized in that it seeks to specifically detect a given species of a bacterium of the Corynebacterium group or related, selected from species. Corynebacterium accolens, Corynebacterium afermentans, Corynebacterium ammoniagenes, Corynebacterium amycolatum, Corynebacterium argentoratense, Corynebacterium auris, Corynebacterium auriscanis, Corynebacterium bovis, Corynebacterium callunae, Corynebacterium camporealensis, Corynebacterium capitovis, Corynebacterium confusum, Corynebacterium coyleae, Corynebacterium cystitidis, Corynebacterium diphtheria, Corynebacterium durum Corynebacterium efficiens, Corynebacterium falsenii, Corynebacterium FELINUM, Corynebacterium flavescens, Corynebacterium freneyi, Corynebacterium glucuronolyticum, Corynebacterium glutamicum, Corynebacterium imitans, Corynebacterium jeikeium , Corynebacterium kroppenstedtii, Corynebacterium kutscheri, Corynebacterium lipophiloflavum, Corynebacterium macginleyi, Corynebacterium mastitidis, Corynebacterium matruchotii, Corynebacterium minutissimum, Corynebacterium mucifaciens, Corynebacterium mycetoides, Corynebacterium phocae, Corynebacterium pilosum, Corynebacterium propinquum, Corynebacterium pseudodiphtheriticum, Corynebacterium pseudotuberculosis Corynebacterium kidney, Corynebacterium riegelii, Corynebacterium seminal , Corynebacterium simulans, Corynebacterium singulare, Corynebacterium striatum, Corynebacterium sundsvallense, terpenotabidum Corynebacterium, Corynebacterium thomssenii, Corynebacterium ulcerans, Corynebacterium urealyticum, Corynebacterium variabilis, Corynebacterium vitaeruminis, Corynebacterium xerosis, Corynebacterium spheniscorum, aurimucosum Corynebacterium, Corynebacterium testudinoris, Rhodococcus equi, Turicella otitidis, <Desc / Clms Page number 44> 2- determining the formation or absence of a hybridization complex between said probe and the nucleic acids of the sample, and thus determining the presence of said species of Corynebacterium or related bacteria in the sample if There is formation of a hybridization complex. A sample containing or likely to contain nucleic acids of at least one such bacterium is brought into contact with at least one species probe consisting in an rpoB gene fragment, or oligonucleotide according to one of claims 3 to 5, preferably a fragment respectively consisting in one of said sequences SEQ ID Nos. 3 to 60, the inverse sequences and complementary sequences, and  process in which  16. The method of claim 12, characterized in that it seeks to detect a given species of a bacterium of the genus Corynebacterium selected from species. Corynebacterium accolens, Corynebacterium afermentans, Corynebacterium ammoniagenes, Corynebacterium amycolatum, Corynebacterium argentoratense, Corynebacterium auris, Corynebacterium auriscanis, Corynebacterium bovis, Corynebacterium callunae, Camporealensis Corynebacterium, Corynebacterium capitovis, confusum Corynebacterium, Corynebacterium coyleae, cystitidis Corynebacterium, Corynebacterium diphtheria, Corynebacterium durum efficiens Corynebacterium, Corynebacterium falsenii, FELINUM Corynebacterium, Corynebacterium flavescens, Corynebacterium freneyi, glucuronolyticum Corynebacterium, Corynebacterium glutamicum Corynebacterium imitans, Corynebacterium jeikeium, Corynebacterium kroppenstedtii, Corynebacterium kutscheri, Corynebacterium lipophiloflavum, Corynebacterium macginleyi, Corynebacterium mastitidis, Corynebacterium matruchotii, Corynebacterium minutissimum, Corynebacterium mucifaciens, Corynebacterium mycetoides, Corynebacterium phocae, Corynebacterium pilosum, Corynebacterium propinquum, Corynebacterium pseudodiphtheriticum, Corynebacterium pseudotuberculosis Corynebacterium kidney , Corynebacterium riegelii, Corynebacterium seminal, Corynebacterium simulans, Corynebacterium singulare, <Desc / Clms Page number 45>  Corynebacterium striatum, Corynebacterium sundsvallense, Corynebacterium terpenotabidum, Corynebacterium thomssenii, Corynebacterium ulcerans, Corynebacterium urealyticum, Corynebacterium variabilis, Corynebacterium vitaeruminis, Corynebacterium xerosis, Corynebacterium spheniscorum, Corynebacterium aurimucosum, Corynebacterium testudinoris, Rhodococcus equi, Turicella otitidis, in which method, in a sample containing or capable of containing nucleic acids of at least one such bacterium of the genus Corynebacterium, the steps are carried out in which: a) a sequencing reaction of a fragment of the amplified rpoB gene of a said bacterium is carried out at the same time; using nucleotide primers consisting of said oligonucleotide mixtures according to one of claims 8 to 10, comprising sequences included in the sequences SEQ.ID. n 1 as a 5 'primer and SEQ.ID.n 2 as a 3' primer, or preferably oligonucleotides consisting in said SEQ sequences. ID. n 1 and 2, or said complementary sequences, and b) determining the presence or absence of the given species of said bacterium by comparing the sequence of said fragment obtained with the sequence of the complete rpoB gene of said bacterium or the sequence of a fragment of the rpoB gene of said bacterium comprising respectively said sequences n 3 to 60 and complementary sequences, and the presence of said bacterium in the sample is thus determined if the sequence of the fragment obtained is identical to the known sequence of the gene or the rpoB gene fragment of said bacterium.  17. The method of claim 16, characterized in that: in step a) the steps comprising: A first amplification of the nucleic acid of said sample with a pair of 5 'and 3' primers selected from said oligonucleotide mixtures according to one of claims 7 to 10, comprising sequences respectively included in the sequences SEQ. ID. n 1 and SEQ.ID. n 2, preferably consisting of said SEQ.ID. <Desc / Clms Page number 46> 2- a sequencing reaction of the amplifiers determined in step 1 with the primers 5 'and 3' consisting of said oligonucleotide mixtures comprising sequences included in the sequences SEQ. ID. n 1 and respectively SEQ.ID. n 2, or their complementary sequences, or preferably oligonucleotides consisting in said SEQ.ID. n 1 and 2 or their complementary sequences, and - in step b), the sequences obtained are compared with respectively one of the sequences SEQ.ID. n 3 to 60 or their complementary sequences  n 1 and 2, or the complementary sequences, and determining the appearance or absence of an amplification product, and 18. Diagnostic kit useful in a method according to one of claims 12 to 16, characterized in that it comprises at least one said oligonucleotide or mixture of oligonucleotides according to one of claims 5 and 7 to 10 and / or an rpoB gene fragment according to one of claims 3 or 4.