Download PDF - Zoological Studies - Academia Sinica

ISSN: 1021-5506 

Zoological Studies 

An International Journal 

Volume 51, Number 2 

March, 2012 

Published by Biodiversity Research Center 

Academia Sinica, Taipei, Taiwan

Zoological Studies 

CHIEF EDITOR 

LI, WEN-HSIUNG 

Biodiversity Research Center, 

Academia Sinica, Taipei, Taiwan 

MANAGING EDITOR 

LEE, SIN-CHE 

Biodiversity Research Center, 


COLEMAN, DAVID C., USA 

EDWARDS, JAMES, Denmark 

ADVISORY BOARD 

KNOWLTON, NANCY, USA 

O , BRIEN, STEPHEN J., USA 

WU, CHUNG-I, USA 

AYALA, FRANCISCO J., USA 

EDITORIAL BOARD 

HWANG, PUNG-PUNG, Taiwan 

TING, CHAU-TI, Taiwan 

CHANG, CHING-FONG, Taiwan 

LEE, LING-LING, Taiwan 

TSO, I-MIN, Taiwan 

CHANG, ERNEST S., USA 

LOOF, ARNOLD DE, Belgium 

WU, SHI-KUEI, USA 

CHEN, CHAOLUN ALLEN, Taiwan 

McCULLOUGH, DALE R., USA 

XIA, XUHUA, Canada 

CHIANG, TZEN-YUH, Taiwan 

MOK, MICHAEL HIN-KIU, Taiwan 

YEN, SHEN-HORN, Taiwan 

DAI, CHANG-FENG, Taiwan 

RANDALL, JOHN E., USA 

YU, HON-TSEN, Taiwan 

HUANG, RU-CHIH C., USA 

SHAO, KWANG-TSAO, Taiwan 

YU, SIMON S.J., USA 

ASSISTANT EDITORS 

CHEN, CHUN-CHIAO VANESSA, Biodiversity Research Center, 


ISI Journal Citation Reports®Ranking: 2010: 65/145 (Zoology) 

Impact Factor: 1.046 

WU, CHIA-CHI KIKI, Biodiversity Research Center, Academia 

Sinica, Taipei, Taiwan 

The publication of Zoological Studies, a bimonthly journal, is 

supported by Biodiversity Research Center, Academia Sinica, 

Taipei 115, Taiwan. Phone and Fax No.: 886-2- 27899529, 

E-mail:zoolstud@gate.sinica.edu.tw; URL: http://zoolstud.sinica. 

edu.tw 

This journal has been awarded by the National Science Council, Taiwan. It 

can be available from Editorial Office, Biodiversity Research Center, Academia 

Sinica, Taipei 115, Taiwan. Printed by Cabin Printing Co., Ltd. 1st Fl., No. 30, 

Lane 210, Sec. 2, Fu-Shin S. Rd., Taipei 100, Taiwan. 

Monogamous System in the Taiwan Vole Microtus 

kikuchii Inferred from Microsatellite DNA and Home 

Ranges (photo by Y.C. Chang)

Zoological Studies 51(2): 137-142 (2012) 

Determination of the Thermal Tolerance of Symbiodinium Using the 

Activation Energy for Inhibiting Photosystem II Activity 

Jih-Terng Wang 1, *, Pei-Jie Meng 2,3 , Yi-Yun Chen 1 , and Chaolun Allen Chen 4,5,6 

1 

Graduate Institute of Biotechnology, Tajen Univ., Pingtung 907, Taiwan 

2 

National Museum of Marine Biology and Aquarium, Checheng, Pingtung 944, Taiwan 

3 

Institute of Marine Biodiversity and Evolution, National Dong Hwa Univ., Checheng, Pingtung 944, Taiwan 

4 

Institute of Oceanography, National Taiwan Univ., Taipei 108, Taiwan 

5 

Biodiversity Research Center, Academia Sinica, Nangang, Taipei 115, Taiwan 

6 

Taiwan International Graduate Program (TIGP)- Biodiversity, Academia Sinica, Nangang, Taipei 115, Tawian 

(Accepted October 4, 2011) 

Jih-Terng Wang, Pei-Jie Meng, Yi-Yun Chen, and Chaolun Allen Chen (2012) Determination of the thermal 

tolerance of Symbiodinium using the activation energy for inhibiting photosystem II activity. Zoological Studies 

51(2): 137-142. Holobionts with different Symbiodinium clades or subclades display varying levels of thermal 

tolerance; however, an index to quantify and standardize this difference has not yet been formulated. In this 

study, the potential for the activation energy (Ea) to inhibit photosystem (PS)II being used to represent the heat 

tolerance of Symbiodinium was investigated. As the Ea required for PSII heat denaturation increased, the PSII 

apparatus in the algae remained stable at higher temperatures; thus, PSII activity was maintained at higher 

temperatures. The Ea was determined by fitting the kinetics data of the decrease in the maximum quantum 

yield (Fv/Fm) of freshly isolated Symbiodinium (FIS) at an elevated temperature to the Arrhenius equation. The 

results indicated that the PSII activity of FIS linearly decreased with an increase in the incubation time under 

thermal stress (r 2 > 0.95), and the rate of PSII denaturation significantly fit the Arrhenius equation (r 2 > 0.95) 

after a logarithmic transformation. Comparisons between 5 Symbiodinium subclades indicated that D1a, known 

as the most heat-tolerant subclade, showed the highest Ea value (348 ± 16 kJ/mole), which was significantly 

(p < 0.05) higher than those of B1, C1, C3, and C15 (126-262 kJ/mole). The reliability of the Ea calculation 

was confirmed by the low coefficient of variation (< 10%), suggesting that it can reliably be used to quantify the 

thermal tolerance of Symbiodinium. http://zoolstud.sinica.edu.tw/Journals/51.2/137.pdf 

Key words: Coral bleaching, Activation energy, PSII activity, Symbiodinium. 

Symbiodinium algae, the dinoflagellates 

mostly found in symbiosis with corals and sea 

anemones, are widely considered to underpin the 

ecological success of cnidarian-alga symbioses 

in shallow, nutrient-poor waters (Muscatine and 

Porter 1977, Falkowski et al. 1993). However, 

thermal stress caused by increasing seawater 

temperatures results in a breakdown of symbiotic 

associations and seriously threatens coral reefs 

worldwide (Hoegh-Guldberg et al. 2007, Lesser 

2007). Thermal breakdown of coral-Symbiodinium 

symbioses causing coral bleaching was found 

to be closely related to the thermal inhibition of 

photosystem (PS)II activity of symbiotic algae 

(Hill et al. 2004, Takahashi et al. 2008). With the 

9 currently described clades (A-I) and numerous 

subclades within Symbiodinium (see review in 

Coffroth and Santos 2005), the algae were also 

shown to exhibit different extents of tolerance to 

thermal stress in culture or in hospite (Bhagooli 

and Hidaka 2003, Rowan 2004, Tchernov et al. 

2004, Robinson and Warner 2006, Sampayo et al. 

*To whom correspondence and reprint requests should be addressed. Tel: 886-8-7624002. Fax: 886-8-7621645. 

E-mail:jtw@mail.tajen.edu.tw 

137

138 

Wang et al. – Thermal Tolerance Index of Symbiodinium 

2008). Selecting thermally-tolerant Symbiodinium 

clades or subclades; therefore, was proposed 

as a way to promote the survival of corals in the 

coming century (Chen et al. 2005a, Berkelmans 

and van Oppen 2006). This proposal was based 

either on the biogeographic distribution of thermaltolerant 

Symbiodinium in historically warming 

regions (Chen et al. 2005a b, LaJeunesse et al. 

2010) or on thermal-tolerant experiments under 

controlled laboratory conditions (Rowan 2004, 

Tchernov et al. 2004, Sampayo et al. 2008). 

However, conflict occurs when thermal tolerance is 

determined among different Symbiodinium clades 

or subclades. For example, both biogeographic 

and physiological experiments showed that 

Symbiodinium clade D (specifically subclade D1a) 

is the most heat-tolerant clade compared to clades 

A, B, and C (Rowan 2004, Chen et al. 2005b, 

LaJeunesse et al. 2010). However, analysis of the 

thylakoid membrane integrity showed that there 

are also thermal-tolerant subclades within clades A, 

B, and C, suggesting that a priori ribosomal DNA 

phylotyping is not diagnostic for thermal sensitivity 

of Symbiodinium associations (Tchernov et al. 

2004). To resolve this conflict, it is necessary to 

develop a quantitative comparison with a single 

parameter or index to determine the thermal 

tolerance among Symbiodinium clades and 

subclades. 

The thermal tolerance between different 

Symbiodinium clades or subclades has been 

compared by estimating the temperaturedependent 

performance of the photosynthesisirradiation 

response (Iglesias-Prieto et al. 1992, 

Rowan 2004), the degree of decrease in PSII 

activity during heat treatment (Bhagooli and Hidaka 

2003, Rowan 2004, Robinson and Warner 2006, 

Sampayo et al. 2008), or thermal sensitivity to 

the induction of stress proteins (or enzymes) and 

their related genes (Downs et al. 2000, Brown et 

al. 2002, Souter et al. 2011). However, comparing 

results between studies has been difficult due to 

the experimental designs and conditions used. In 

this study, we attempted to develop a universal 

index, as indicated by the activation energy (Ea) 

for thermally inhibiting PSII activity, to represent the 

thermal tolerance of members of Symbiodinium, 

since the PSII activity of Symbiodinium is closely 

associated with photosynthesis of the alga and 

its symbiotic stability with corals (Robinson and 

Warner 2006, and references therein). Moreover, 

the function of the PSII apparatus is determined by 

the natural state of several proteins, such as the 

D1 protein, peridinin-chlorophyll-a-binding proteins, 

the chlorophyll-a/chlorophyll-c2/peridinin protein 

complex, etc. (Takahashi et al. 2008). Thus, 

the loss of PSII activity is expected to follow the 

process of protein denaturation. If the denaturation 

of PSII proteins follows a first-order reaction, then 

the Ea for thermally inhibiting PSII activity could 

be calculated from the Arrhenius equation (a 

kinetic equation for measuring the Ea by linearly 

regressing the rate constant on the reaction 

temperature in °K). This Ea value could potentially 

represent the thermal tolerance of Symbiodinium. 

Based on this idea, this study was conducted by 

subjecting freshly isolated Symbiodinium (FIS) 

to elevated temperatures, measuring the rate of 

decline in PSII activity (as indicated by Fv/Fm over 

time), and then fitting the rate constants to the 

Arrhenius equation to calculate the Ea. 

MATERIALS AND METHODS 

Symbiodinium isolation and subclade typing 

Freshly isolated Symbiodinium (FIS) samples 

used in this study were designated Symbiodinium 

C1, C3, C15, D1a, and B1 from 4 hard corals 

(Stylophora pistillata, Acropora humilis, Porites 

lutea, and Galaxea fasicularis) and a sea anemone 

(Aiptasia pulchella), respectively, based on a 

recent study (Wang et al. 2011). The corals were 

collected by scuba diving in Kenting National Park, 

Taiwan (21°55'54"N, 120°44'45"E), and the sea 

anemone was obtained from a laboratory culture 

as described in Wang et al. (2011). Isolation of 

Symbiodinium from each replicate of the animal 

host was conducted as previously described 

(Wang and Douglas 1997, Wang et al. 2011). 

Briefly, coral fragments having about 100 cm 2 of 

live tissue were stripped of tissue using an air 

blast, and tentacles of 10 Aiptasia pulchella were 

homogenized with a tissue grinder. After mixing 

with 2-3 volumes of artificial seawater (Instant 

Ocean, Sarrebourg Cedex, France), the resultant 

slurry was passed through a 15-μm nylon mesh to 

remove debris. Symbiodinium was then isolated 

by centrifugation at 860 xg for 3 min and washed 

with artificial seawater 3 times. Symbiodinium was 

preserved in 80% ethanol before conducting the 

phylotype analysis by resolving the polymerase 

chain reaction (PCR) product of the ribosomal 

internal transcribed spacer (ITS) 2 in denatured 

gel gradient electrophoresis (DDGE) developed 

by LaJeunesse et al. (2003) and modified as 

described in Wang et al. (2011). Since the co-


139 

existence of multiple clades or subclades in a 

single coral host is well documented (Chen et 

al. 2005a b, Berkelmans and van Oppen 2006), 

FIS phylotyping of the ITS2 gene by PCR- 

DGGE represented the dominant Symbiodinium 

population from which the host was isolated. To 

obtain Ea data from a single subclade, the kinetics 

data were abandoned if the PCR-DGGE suggested 

the possibility of a mixture of clades or subclades 

of FIS in the preparation (data not shown). 

Fluorescence methodology 

FIS samples with about (0.5-0.8) × 10 6 

cells/ml, counted with an improved Neubauer 

hemocytometer (Marienfeld, Germany), were 

maintained at 25°C under dim light (< 5 μE/m 2 /s, 

PAR) for 1 h before proceeding with heat treatment. 

Measurement of changes in the maximum 

quantum yield [Fv/Fm = (Fm - Fo)/Fm] of FIS at the 

elevated temperatures began by suspending an 

algal pellet, collected from centrifugation of 10 ml 

of an algal suspension at 860 xg for 2 min, in the 

original volume of artificial seawater which had 

been prewarmed to the experimental temperature 

(of 31, 33, 35, 37, 39, or 41°C). The value of Fv/Fm 

of the FIS suspension was directly measured at 

2-min intervals with a DIVING-PAM fluorometer 

(Walz, Germany) at the DIVING-PAM setting of 

8 for measuring the light and saturating flash of 

the actinic light. The Fv/Fm of treated FIS was 

measured under indoor illumination (< 10 μE/m 2 /s, 

PAR), and heat treatment was completed within 

12 or 14 min depending on the temperature used. 

The Fv/Fm value of a control FIS that remained 

at 25°C under dim light for 4 h was examined to 

evaluate the quality of FIS used in the experiment. 

Kinetics and statistical analyses 

The rate constant, k (1/min), of PSII protein 

denaturation at each temperature was 

obtained from the slope of the linear regression 

of Fv/Fm values against incubation times. Then, 

each k value was natural-logarithmically (ln) 

transformed to produce an Arrhenius plot with 

1/T in °K. The fitness of the kinetics data to the 

Arrhenius equation, [ln(k) = ln(A) - (Ea/R)(1/T)], 

was examined by a linear regression of ln(k) 

against 1/T. Therefore, the Ea of each sample was 

calculated from the Arrhenius equation obtained 

above with the gas constant, R (= 8.314 J/mol/°K). 

The coefficient of variation (CV) was used to 

examine the reproducibility between experiments. 

Comparisons of Ea values between Symbiodinium 

subclades were made using a one-way analysis 

of variance (ANOVA) following by Fisher’s 

least significance difference (LSD) test, with a 

significance level of p < 0.05. 

RESULTS 

Fv/Fm values of FIS from each preparation, 

which ranged 0.618-0.675, were comparable 

between Symbiodinium subclades with a 4-h 

incubation at 25°C under dim light. When data 

from mixed populations of Symbiodinium subclades 

were excluded, Fv/Fm values of all subclades tested 

(C1, B1, C3, C15, and D1a) linearly decreased 

with incubation time at an elevated temperature, as 

shown by data for Symbiodinium subclade D1a in 

figure 1A. Coefficients of the linear regression (r 2 ) 

of the decrease in Fv/Fm values with incubation time 

at each treated temperature were all significant 

(p < 0.05), and were 0.982 ± 0.008 (mean ± S.D., 

n = 40) for D1a, 0.979 ± 0.010 (n = 35) for C15, 

0.981 ± 0.015 (n = 30) for C3, 0.980 ± 0.019 

(n = 30) for B1, and 0.988 ± 0.007 (n = 40) for C1. 

When the logarithmically transformed denaturation 

rate (k) of PSII was plotted against 1/T, coefficients 

of the linear regression were also significant 

(p < 0.05), and showed a good fit to the Arrhenius 

equation (r 2 = 0.942-0.985), as shown by D1a data 

in figure 1B. The regression coefficients obtained 

were 0.961 ± 0.019 (n = 8) for D1a, 0.966 ± 0.012 

(n = 7) for C15, 0.965 ± 0.020 (n = 6) for C3, 0.965 

± 0.017 (n = 6) for B1, and 0.966 ± 0.013 (n = 8) 

for C1. The Ea for PSII denaturation was then 

calculated from each Arrhenius equation (Table 

1). The Ea values significantly differed among the 

5 different Symbiodinium subclades (F4,30 = 288.3, 

p < 0.001). The post-hoc analysis with Fisher’s 

LSD test also indicated that Symbiodinium D1a 

displayed the highest Ea, followed in order by C15, 

C3, B1, and C1 (Table 1). Ea values for D1a and 

C15 were almost 2-fold higher than those of B1 

and C1. 

DISCUSSION 

This study proposes that the activation energy 

for inhibiting PSII activity under thermal stress 

could be used to represent the thermal tolerance 

of Symbiodinium. With such an index, thermal 

tolerances among Symbiodinium subclades could 

be compared on a universal scale. In order to

140 


test the hypothesis, 5 Symbiodinium subclades, 

for which the tolerance or sensitivity to heat was 

compared in the literature (LaJeunesse et al. 2003, 

Fabricius et al. 2004, Rowan 2004, Berkelmans 

and van Oppen 2006), were selected for testing in 

this study. 

When a Symbiodinium alga is stressed due 

to an elevated temperature, many physiological 

responses are evoked, including upregulation of 

stress protein synthesis, downregulation of normal 

protein synthesis, and an increase in protein 

denaturation (as reviewed by Brown et al. 2002). 

It would be easy to obtain the correlation between 

heat-stress indicators of the tested organism and 

temperature, but none of them can be summarized 

to a constant value to reflect the heat-stress 

response or tolerance of a Symbiodinium alga 

without a kinetics analysis. Kinetics studies on the 

increase and subsequent collapse in the rate of 

respiration or heart beat were used to represent 

the thermal tolerance of a snail (Stenseng et 

al. 2005), crab (Stillman 2002), and shellfish 

(Dahlhoff and Somero 1993). Increases in the 

rates of respiration and heart beat usually follow 

Q10 over a wide range of temperatures. With 

photosynthetic algae, a decline in PSII activity 

during heat treatment was found, in this study, 

to be very suitable for a kinetics analysis of the 

thermal deterioration of Symbiodinium algae for 4 

reasons. First, the PSII activity of Symbiodinium 

can be instantly determined in situ; therefore, 

the time interval for the kinetic analysis can be 

precisely controlled. Second, the PSII activity of 

Symbiodinium was proven to be closely related to 

the photosynthetic capability of the alga (Robinson 

and Warner 2006, and references therein). Third, 

Fv/Fm 

(A) 

0.8 

0.7 

0.6 

0.5 

0.4 

0.3 

0.2 

0.1 

ln (k) (min -1 ) 

(B) 

-2 

-3 

-4 

-5 

-6 

0.0 

-7 

0 2 4 6 8 10 12 14 16 3.18 3.20 3.22 3.24 3.26 3.28 

Time (min) 

T -1 × 10 3 (°K) 

Fig. 1. Representative data obtained from freshly isolated Symbiodinium subclade D1a. (A) Decrease in the maximum quantum yield 

(Fv/Fm) of Symbiodinium when incubated at 33 (●), 35 (○), 37 (▼), 39 (■), and 41°C (□). (B) An Arrhenius plot obtained from data in (A). 

The equations and coefficients of the linear regression of Fv/Fm against time are: y = -0.0027x + 0.6876, r 2 = 0.984 (33°C); y = -0.0042x 

+ 0.677, r 2 = 0.991 (35°C); y = -0.0131x + 0.6984, r 2 = 0.979 (37°C); y = -0.0438x + 0.7445, r 2 = 0.993 (39°C); and y = -0.0551x + 0.7394, 

r 2 = 0.967 (41°C). That for ln(k) on 1/T is y = -41315x + 128.96, r 2 = 0.968. 

Table 1. Activation energy (Ea) for inhibiting photosystem II activity of freshly isolated Symbiodinium under 

thermal stress. n, number of replicates from different colonies; Ea, activation energy, the data of which 

followed by the same superscript letter do not significantly differ at p = 0.05 according to Fisher’s LSD test; 

CV, coefficient of variation 

Cnidarian host Symbiodinium subclade n Ea (kJ/mole) CV (%) 

Stylophora pistillata C1 8 126 ± 10 a 7.6 

Aiptasia pulchella B1 6 144 ± 7 b 4.9 

Acropora humilis C3 6 214 ± 7 c 3.2 

Porites lutea C15 7 262 ± 25 d 9.4 

Galaxea fasicularis D1a 8 348 ± 16 e 4.5


141 

the stability of the PSII apparatus is determined 

by the natural state of a set of proteins, especially 

the D1 protein (Waner et al. 1999, Takahashi et al. 

2008). Fourth, the kinetics of protein denaturation 

under heat treatment were reported to follow a 

1st-order reaction and comply with the Arrhenius 

equation (Weijers et al. 2003), and the Ea for 

the thermal inhibition (or denaturation) of PSII 

proteins can be easily obtained from the Arrhenius 

equation. Consequently, the data obtained in this 

study indicated that Ea values for inhibiting PSII 

activity of each Symbiodinium subclade were 

consistent with previous studies (LaJeunesse 

et al. 2003, Fabricius et al. 2004, Rowan 2004, 

Tchernov et al. 2004, Berkelmans and van Oppen 

2006, Díaz-Almeyda et al. 2011), i.e., D1a and C15 

were the 2 most thermally tolerant Symbiodinium 

among the tested subclades. Reproducibility of 

the Ea data for each Symbiodinium subclade was 

determined to be acceptable by examining values 

of the CV which ranged 3.2%-9.4%. 

In summary, a high regression coefficient 

(r 2 > 0.95) obtained from the kinetics data and 

the low CV between replicates (< 10%) indicated 

that the calculated Ea values for PSII denaturation 

were stable and reliable. This evidence suggests 

that the Ea for inhibiting PSII activity during 

heat stress can be used to quantify the thermal 

tolerance of Symbiodinium; thus, facilitating 

ecological, physiological, and evolutionary studies 

of coral symbiosis and bleaching biology. Based 

on this idea, it is also possible to develop an index 

to represent bleaching susceptibility of corals by 

selecting proper physiological indicator(s), changes 

in which with an increase in heating temperature or 

light intensity follow a 1st-order reaction. 

Acknowledgments: The authors would like to 

thank members of the Coral Reef Evolutionary 

Ecology and Genetics (CREEG) Group, Biodiversity 

Research Center, Academia Sinica 

(BRCAS) for field support and D.P. Chamberlin 

for English editing. This work was supported by 

an Academic Sinica Thematic grant (2008-2010) 

to JTW and CAC, and a National Science Council 

grant (NSC96-2628-B-001-004-MY3) to CAC. This 

is CREEG-BRCAS contribution no. 69. 

REFERENCES 

Berkelmans R, MJH van Oppen. 2006. The role of zooxanthellae 

in the thermal tolerance of corals: a “nugget of 

hope” for coral reefs in an era of climate change. Proc. R. 

Soc. Lond. B 273: 2305-2312. 

Bhggooli R, M Hidaka. 2003. Comparison of stress susceptibility 

of in hospite and isolated zooxanthellae among five 

coral species. J. Exp. Mar. Biol. Ecol. 291: 191-197. 

Brown BE, CA Downs, RP Dunne, SW Gibb. 2002. Exploring 

the basis of thermotolerance in reef coral Goniastrea 

aspera. Mar. Ecol. Progr. Ser. 242: 119-129. 

Chen CA, JT Wang, LS Fang, YW Yang. 2005a. Fluctuating 

algal symbiont communities in Acropora palifera 

(Scleractinia: Acroporidae) from Taiwan. Mar. Ecol. Progr. 

Ser. 295: 113-121. 

Chen CA, YW Yang, NV Wei, WS Tsai, LS Fang. 2005b. 

Symbiont diversity in the scleractinian corals from tropical 

reefs and non-reefal communities in Taiwan. Coral Reefs 

24: 11-22. 

Coffroth MA, SR Santos. 2005. Genetic diversity of symbiotic 

dinoflagellates in the genus Symbiodinium. Protist 156: 

19-34. 

Dahlhoff E, GN Somero. 1993. Effects of temperature on 

mitochondria from abalone (genus Haliotis): adaptive 

plasticity and its limits. J. Exp. Biol. 185: 151-168. 

Díaz-Almeyda E, PE Thomé, M El Hafidi, R Iglesias-Prieto. 

2011. Differential stability of photosynthetic membranes 

and fatty acid composition at elevated temperature in 

Symbiodinium. Coral Reefs 30: 217-225. 

Downs CA, E Mueller, S Phillips, JE Fauth, CM Woodley. 

2000. A biomarker system for assessing the health of 

coral (Montastrea faveolata) during heat stress. Mar. 

Biotechnol. 2: 533-544. 

Fabricius KE, JC Mieog, PL Colin, DH Idip, MJH van Oppen. 

2004. Identity and diversity of coral endosymbionts 

(Zooxanthellae) from three Palauan reefs with contrasting 

bleaching, temperature and shading histories. Mol. Ecol. 

13: 2445-2458. 

Falkowski PG, Z Dubinsky, L Muscatine, L McCloskey. 1993. 

Population control in symbiotic corals. BioScience 43: 

606-611. 

Hill R, AWD Larkum, G Frankart, M Kuhl, PJ Ralph. 2004. 

Loss of functional photosystem II reaction centres in 

zooxanthellae of corals exposed to bleaching conditions: 

using fluorescence rise kinetics. Photosynth. Res. 82: 59- 

72. 

Hoegh-Guldberg O, PJ Mumby, AJ Hooten, RS Steneck, P 

Greenfield, E Gomez et al. 2007. Coral reefs under rapid 

climate change and ocean acidification. Science 318: 

1737-1742. 

Iglesias-Prieto R, JL Matta, WA Robins, RK Trench. 1992. 

Photosynthetic response to elevated temperature in the 

symbiotic dinoflagellates Symbiodinium microadriaticum in 

the culture. Proc. Natl. Acad. Sci. USA 89: 10302-10305. 

LaJeunesse TC, WK Loh, RV Woesik, O Hoegh-Guldberg, 

GW Schmidt, WK Fitt. 2003. Low symbiont diversity in 

southern Great Barrier Reef corals relative to those of the 

Caribbean. Limnol. Oceanogr. 48: 2046-2054. 

LaJeunesse TC, R Smith, M Walther, J Pinzón, DT Pettay, 

M McGinley et al. 2010. Host-symbiont recombination 

versus natural selection in the response of coraldinoflagellate 

symbioses to environmental disturbance. 

Proc. R. Soc. Lond. B 277: 2925-2934. 

Lesser MP. 2007. Coral reefs bleaching and global climate 

change: Can coral survive the next century? Proc. Natl. 

Acad. Sci. USA 104: 5250-5260. 

Muscatine L, JW Porter. 1977. Reef corals: mutualistic 

symbiosis adapted to nutrient poor environment.

142 


BioScience 27: 154-157. 

Robinson JD, ME Warner. 2006. Differential impacts of 

photoacclimation and thermal stress on the photobiology 

of four different phylotypes of Symbiodinium (Pyrrhophyta). 

J. Phycol. 42: 568-579. 

Rowan R. 2004. Thermal adaptation in reef coral symbionts. 

Nature 430: 742. 

Sampayo EM, T Ridgway, P Bongaerts, O Hoegh-Guldberg. 

2008. Bleaching susceptibility and mortality of corals are 

determined by fine-scale differences in symbiont type. 

Proc. Natl. Acad. Sci. USA 105: 1444-1449. 

Souter P, LK Bay, N Anderakis, N Császár, FO Seneca, MJH 

van Oppen. 2011. A multilocus, temperature stressrelated 

gene expression profile assay in Acropora 

millepora, a dominant reef-building coral. Mol. Ecol. 

Resources 11: 225-421. 

Stenseng E, C Braby, GN Somero. 2005. Evolutionary and 

acclimation-induced variation in the thermal limits of heart 

function in congeneric marine snails (genus Tegula): 

implications for vertical zonation. Biol. Bull. 208: 138-144. 

Stillman JH. 2002. Causes and consequences of thermal 

tolerance limits in rocky intertidal porcelain crabs, genus 

Petrolisthes. Integr. Compar. Biol. 42: 790-796. 

Takahashi S, S Whitney, S Itoh, T Maruyama, M Badger. 2008. 

Heat stress causes inhibition of the de novo synthesis 

of antenna proteins and photobleaching in cultured 

Symbiodinium. Proc. Natl. Acad. Sci. USA 105: 4203- 

4208. 

Tchernov D, MY Gorbunov, C de Vargas, SW Yadav, AJ 

Milligan, M Häggblom, PG Falkowski. 2004. Membrane 

lipids of symbiotic algae are diagnostic of sensitivity to 

thermal bleaching in corals. Proc. Natl. Acad. Sci. USA 

101: 13531-13535. 

Wang JT, AE Douglas. 1997. Nutrients, signals, and photosynthate 

release by symbiotic algae: the impact of taurine 

on the dinoflagellate alga Symbiodinium from the sea 

anemone Aiptasia pulchella. Plant Physiol. 114: 631-636. 

Wang JT, PJ Meng, E Sampayo, SL Tang, CA Chen. 2011. 

Photosystem II breakdown induced by reactive oxygen 

species (ROS) in the freshly-isolated Symbiodinium of 

Montipora (Scleractinia; Acroporidae). Mar. Ecol. Progr. 

Ser. 422: 51-62. 

Warner MK, WK Fitt, GW Schmidt. 1999. Damage to photosystem 

II in symbiotic dinoflagellates: a determinant of 

coral bleaching. Proc. Natl. Acad. Sci. USA 96: 8007- 

8012. 

Weijers M, PA Barneveld, MAC Stuart, RW Visschers. 2003. 

Heat-induced denaturation and aggregation of ovalbumin 

at neutral pH described by irreversible first-order kinetics. 

Protein Sci. 12: 2693-2703.


Larval Development of Fertilized “Pseudo-Gynodioecious” Eggs 

Suggests a Sexual Pattern of Gynodioecy in Galaxea fascicularis 

(Scleractinia: Euphyllidae) 

Shashank Keshavmurthy 1 , Chia-Min Hsu 1,2 , Chao-Yang Kuo 1 , Vianney Denis 1 , Julia Ka-Lai 

Leung 1,3 , Silvia Fontana 1,4 , Hernyi Justin Hsieh 5 , Wan-Sen Tsai 5 , Wei-Cheng Su 5 , and Chaolun 

Allen Chen 1,2,6,7, * 

1 


2 


3 

Institute of Life Sciences, National Taiwan Normal Univ., Taipei 106, Taiwan 

4 

Univ. of Milan-Bicocca, Piazza della Scienza 2, Milan 20126, Italy 

5 

Penghu Marine Biological Research Center, Makong 880, Taiwan 

6 

Institute of Life Science, National Taitung Univ., Taitung 950, Taiwan 

7 


(Accepted September 22, 2011) 

Shashank Keshavmurthy, Chia-Ming Hsu, Chao-Yang Kuo, Vianney Denis, Julia Ka-Lai Leung, Silvia 

Fontana, Hernyi Justin Hsieh, Wan-Sen Tsai, Wei-Cheng Su, and Chaolun Allen Chen (2012) Larval 

development of fertilized “pseudo-gynodioecious” eggs suggests a sexual pattern of gynodioecy in Galaxea 

fascicularis (Scleractinia: Euphyllidae). Zoological Studies 51(2): 143-149. Galaxea fascicularis possesses 

a unique sexual pattern, namely “pseudo-gynodioecy”, among scleractinian corals. Galaxea fascicularis 

populations on the Great Barrier Reef, Australia are composed of female colonies that produce red eggs and 

hermaphroditic colonies that produce sperm and white eggs. However, white eggs of hermaphroditic colonies 

are incapable of being fertilized or undergoing embryogenesis. In this study, the reproductive ecology and 

fertilization of G. fascicularis were examined in Chinwan Inner Bay, Penghu, Taiwan in Apr.-June 2011 to 

determine the geographic variation of sexual patterns in G. fascicularis. Synchronous spawning of female and 

hermaphroditic colonies was observed between 17:30 and 20:00 (1 h after sunset) between 24-28 May 2011 (7-11 

nights after the full moon in May), and at same times between 22-24 June 2011 (6-8 nights after the full moon in 

June). Red eggs were significantly larger than white eggs, although both types of eggs had a distinct nucleus, 

which was located at the edge of the eggs, suggesting that they were in the final stage of maturation and ready 

to release gametes. Crossing experiments showed that both white and red eggs could be fertilized in vivo, and 

they synchronously developed into swimming larvae, suggesting that instead of being pseudo-gynodioecious, 

the sexual pattern of G. fascicularis is gynodioecious. http://zoolstud.sinica.edu.tw/Journals/51.2/143.pdf 

Key words: Gynodioecy, Pseudo-gynodioecy, Galaxea fascicularis, Reproductive mode, Synchronous spawning. 

Sexual patterns and modes of development 

are the most important life-history traits in 

scleractinian corals, and have been one of the 

major research themes over the last 3 decades 

(reviewed in Richmond and Hunter 1990, Harrison 

and Wallace 1990, Baird et al. 2009, Harrison 

2011). Three sexual patterns (hermaphroditic, 

gonochronic, and mixed) and 2 modes of 

development (broadcast-spawned gametes and 

brooded larvae) were identified (Harrison 2011). 

*To whom correspondence and reprint requests should be addressed. Shashank Keshavmurthy, Chia-Min Hsu, and Chao-Yang Kuo 

contributed equally to this work. Tel: 886-2-27899549. Fax: 886-2-27858059. E-mail:cac@gate.sinica.edu.tw 

143

144 

Keshavmurthy et al. – Gynodioecy in Scleractinian Corals 

Among the 444 species studied, 295 species 

are hermaphroditic and 109 are gonochronic (or 

dioecious). The remaining species are either 

mixed or have contrasting modes of reproduction. 

For the mode of development, 354 species spawn 

gametes into the water, and 60 species brood 

larvae (Harrison 2011). 

Galaxea spp. were originally described as 

being simultaneous hermaphrodites (Harrison et 

al. 1984). However, subsequent research at the 

Great Barrier Reef (GBR), Australia demonstrated 

that Galaxea species have populations composed 

of female colonies that spawn pinkish-red eggs, 

and hermaphroditic colonies that produce sperm 

and lipid-filled white eggs (Harrison 1989). 

Hermaphroditic G. fascicularis colonies produce 

functional sperm that can fertilize spawned, 

pigmented eggs of female colonies (Fig. 1). 

However, white eggs contain unusually large 

lipid spheres, cannot undergo fertilization, and 

function to lift the sperm bundles up to the water 

surface where the buoyant pigmented eggs 

accumulate, suggesting that these white eggs 

potentially enhance fertilization success (Harrison 

1989). Harrison (2011) suggested that the 

pseudo-gynodioecious sexual pattern in at least 

some Galaxea species is therefore functionally 

gonochronic. However, this detailed observation 

was only made in the GBR, and the sample sizes 

of hermaphroditic and female colonies were 

relatively small (n = 2 for each sex). Further 

studies outside the GBR with a larger sample size 

of colonies are necessary to confirm the pseudogynodioecious 

sexual pattern of Galaxea spp. 

In this study, the reproductive ecology and 

fertilization of G. fascicularis were studied in detail 

at Chinwan Inner Bay (CIB), Penghu Is., Taiwan. 

Galaxea fascicularis is one of the dominant coral 

species of the scleractinian community at CIB 

(Hsieh 2008, Hsieh et al. 2011). This provided 

us with the opportunity to study the reproductive 

ecology and reexamine the sexual pattern of G. 

fascicularis. 

(A) 

(B) 

(C) 

(D) 

Fig. 1. Galaxea fascicularis larval development. (A) White bundle containing white eggs and sperm; (B) red bundle full of red eggs 

only; (C) white eggs within a hermaphroditic polyp each with a clear nucleus (arrow), and (D) red eggs within a female polyp each with 

a clear nucleus (arrow). Scale bars = 200 μm.


145 


Study site and sample collection 

Coral spawning was observed at CIB 

(23°31'N, 119°33'E), Penghu Is., Taiwan in Apr.- 

June 2011. CIB is a semi-enclosed embayment 

where coral communities have developed on top 

of volcanic rocks, with 75 species of scleractinian 

corals described (Hsieh 2008, Hsieh et al. 2011). 

Over 50 colonies of G. fascicularis with a colony 

size of > 10 cm in diameter were collected, 

deposited in individual buckets, and moved 

to tanks with a continuous seawater flow and 

aeration system at the joint marine laboratory of 

the Biodiversity Research Center, Academia Sinica 

(BRCAS)-Penghu Marine Biological Research 

Center (PMBRC) at CIB. Acropora muricata 

was also collected for reference to compare 

developmental stages from fertilized eggs to 

elongated planular larvae (Miller and Ball 2002). 

Observation of spawning and crossing experiments 

Observations of spawning behavior at CIB 

began on 12 Apr. 2011, 5 d before the full moon in 

Apr., based on previous observations (Chen et al. 

unpubl. data). Throughout the spawning period, 

seawater flow in the tanks was stopped daily, by 

turning the taps off after sunset (ca. 18:30 at CIB). 

If no spawning was observed on any particular 

day, seawater flow was restored after 22:30. The 

time of release of gamete bundles was recorded 

once polyps and tentacles were retracted, and 

colored bundles, either white or pinkish-red, 

were released to the surface of the buckets. On 

24 May 2011, 10 colonies of G. fascicularis with 

white eggs and 10 colonies with red eggs were 

labeled for bundle collection. Gamete bundles 

released to the surface of the water in the buckets 

were separately scooped up using recycled 

plastic cups, and brought back to the laboratory 

for crossing experiments. Both white and red 

bundles were filtered through a plankton mesh 

with a 150-μm-mesh size to separate eggs and 

sperm. Aliquots of eggs and sperm were collected 

for size measurements and density counts. 

Sperm density was diluted to 10 5 -10 6 /ml for the 

crossing experiment (Willis et al. 1997 2006). 

White and red eggs were mixed and fertilized 

with diluted sperm. Developmental stages were 

observed every hour and categorized based on 

stages described for Acropora by Miller and Ball 

(2000) using the same terminology. A series of 

photographs was taken using an Olympus 5050 

camera (Tokyo, Japan) attached to the eyepiece 

of an Olympus light microscope to obtain images 

of the developmental stages between white and 

red eggs until the swimming planular larval stage. 

Galaxea fascicularis white and red eggs inside 

the coral tissues were photographed under 40x 

magnification (objective lens 4x and eyepiece 

10x) using an Olympus microscope (model SZ40) 

fitted with an Olympus C5050 digital camera. The 

gonads were placed in a Petri dish immersed in 

seawater without a cover. Images of white and red 

egg were photographed under 100x magnification 

(object 10x and eyepiece 10x) using an Olympus 

microscope (model CX31) fitted with an Olympus 

E510 digital camera. The same gonads were 

moved to a glass slide and gently put on the slide 

cover without any pressure. Time-series photos of 

G. fascicularis were taken under 40x magnification 

(objective lens 4x and eyepiece 10x) using an 

Olympus microscope (model SZ40) fitted with 

Olympus SP350 and C5050 digital cameras. The 

cameras were fitted directly to the eyepiece of 

the microscope to obtain the photos. Time-series 

photos of Acropora muricata were taker under 40x 

magnification with an Olympus C5050 camera. 

The egg size and scale shown in the photos were 

obtained by micro-ruler photo of a hemocytometer 

obtained at the respective magnifications. 

RESULTS 

Galaxea fascicularis colonies at CIB, 

Penghu Is. were either female (pinkish-red eggs) 

or hermaphroditic (white eggs with sperm sacs) 

(Fig. 1A, B). No spawning was observed for G. 

fascicularis in Apr. 2011 (normal spawning period 

in Penghu begins from Apr.). However, on 24 

May 2011, 7 nights after the full moon of May, 

synchronous spawning of G. fascicularis (> 30 

colonies) was first observed at 19:30, 1 h after 

sunset at the Penghu Is. with a peak of gamete 

bundles released at around 20:00 (Fig. 1A, B). 

Continued release of bundles was observed the 

following 4 nights with a decrease in the number 

of colonies spawned on the 8th night after the full 

moon (Table 1). Another synchronous spawning 

event of over 30 colonies was observed on 22 

June, 6 nights after the full moon of June (Table 1). 

Some colonies spawned multiple times either on 

different nights in May or continuously in June. 

Dissecting gamete bundles suggested

146 


that both white and red eggs of G. fascicularis 

were mature and had reached the same stage 

just before spawning. Some white eggs from 

hermaphroditic colonies possessed a clear 

nucleus close to the edge of the egg, as seen in 

red eggs (Fig. 1C, D). Spawned white eggs had 

a significantly (t-test = -72.1769, p < 0.01) smaller 

mean diameter (290.20 ± 2.60 μm, n = 171) than 

red eggs (438.58 ± 3.13 μm, n = 184) (Fig. 2). 

Fertilization experiments showed that both 

white and red eggs were mature, and embryo 

development was synchronous (Fig. 3). Twocell 

cleavage was observed during the 1st hr 

after fertilization (Fig. 3A). The time of the initial 

development (cell-cleavage stage) cycle in G. 

fascicularis embryos was similar to that of A. 

muricata before reaching the prawn-chip stage (Fig. 

3C-F). Galaxea fascicularis took 8 hr to reach the 

prawn-chip stage, while A. muricata needed at 

least 12 hr after fertilization (Miller and Ball 2000). 

Also, embryonic development from the donut to the 

pear stage in G. fascicularis was significantly faster 

than that of A. muricata (Fig. 3I-P). The swimming 

ability of planular larvae fertilized from white eggs 

did not differ from that of larvae from red eggs. 

gynodioecious sexual pattern in scleractinian 

corals. 

Egg, embryonic, and larvae development in 

Galaxea fascicularis 

According to a previous study (Harrison 

1989) conducted at the GBR, Australia, the 

reproduction mode in G. fascicularis was reported 

to be pseudo-gynodioecious suggesting that 

white eggs produced by this species cannot be 

fertilized. This raises the question as to why white 

eggs of G. fascicularis at CIB, Penghu Is., Taiwan 

were fertile, but those in the GBR, Australia were 

not? Two possible scenarios are proposed to 

explain this difference. First, our observed results 

may have been due to geographic differentiation 

between G. fascicularis populations in the GBR, 

Australia and those at CIB, Penghu Is., Taiwan. 

In some scleractinian corals, sexual patterns 

and reproductive modes can vary in different 

geographic regions (reviewed in Harrison 2011). 

For example, histological studies on Pocillopora 

damicornis colonies in Japan indicated that 

brooded planulae develop from eggs, and may 

DISCUSSION 

Our study provides several lines of evidence, 

including final maturation, fertilization, 

and embryonic and larvae development, to 

demonstrate that the sexual pattern of the G. 

fascicularis population at CIB, Penghu Is., Taiwan 

is gynodioecious. This is the 1st record of the 

Table 1. Month, date, days after the full moon, 

time of spawning (hours after sunset), and 

numbers of colonies spawned of G. fascicularis in 

Chinwan Inner Bay, Penghu, Taiwan in 2011 

Mean diameter of eggs (µm) 

250 300 350 400 450 500 

Month Date 

No. of days after Time of spawning Number of 

a full moon (h after sunset) colonies spawned 

from a total of n = 50 

May 24 7 1 > 30 

25 8 1 > 30 

26 9 1 < 5 

27 10 1 < 5 

28 11 1 < 5 

June 22 6 1 > 30 

23 7 1 - 

24 8 1 - 

-, not spawning. 

Red 

Egg colour 

White 

Fig. 2. Difference in egg sizes between female (red egg color) 

and hermaphroditic (white egg color) colonies of Galaxea 

fascicularis. The egg size data were plotted using software R 

to generate a box plot. The upper and lower hinge of the box 

indicate 75th and 25th percentile of the data set. The line in the 

middle of the box represents median for each data set of egg 

sizes indicating a skewed data set. Vertical dotted lines with 

whiskers at top and bottom represent maximum and minimum 

values. Circles in the figure are outliers with values outside 

the 25%-75% interval. The absence of circles for red eggs 

indicates that there were no outliers.


147 

be produced sexually (Diah Permata et al. 2000). 

Different reproductive patterns occur in the 

eastern Pacific and Gulf of California populations 

of P. damicornis, which are characterized by 

the production of eggs and sperm and inferred 

spawning of mature gametes, but there is no 

evidence of brooding or planular production in 

those populations (Glynn et al. 1991, Colley et 

al. 2006, Chavez-Romo and Reyes-Bonilla 2007, 

Glynn and Colley 2009). It was suggested by 

Harrison (2011) that variations in reproductive 

characteristics and life-history traits recorded 

among populations in different regions indicate 

that these characteristics are unusually variable in 

this species. Alternatively, P. damicornis may be 

a species complex containing cryptic species with 

different reproductive patterns (Flot et al. 2008, 

Souter 2010). Determining whether G. fascicularis 

with the fertilization capability of white eggs 

from CIB and the GBR is the same species with 

unusually variable life-history traits or there are 

cryptic species with different reproductive patterns 

requires further investigation using a molecular 

genetic analysis. 

Another explanation is that results may 

have been due to the small sample size of G. 

fascicularis (2 female and 2 hermaphroditic) 

colonies utilized in the fertilization trials at the GBR 

(Harrison 1989). The percentage of mature white 

eggs in hermaphroditic colonies was relatively low 

compared to those large lipid bodies in gamete 

bundles released into the water column, thereby 

reducing the chance of obtaining fertile eggs for 

further observations of embryo development. In 

our study, large numbers of gamete bundles were 

collected from both female and hermaphroditic G. 

Acropora muricata 


Acropora muricata 


(A) 2 cell, 2 hr 

(B) 2 cell, 1 hr 

(I) dount, 16 hr 

(J) dount, 9 hr 

R 

W 

W 

R 

(C) 8 cell, 4 hr 

(D) 8 cell, 3hr 

(K) fat dount, 19 hr 

(L) fat dount, 11 hr 

R 

W 

W 

R 

(E) 32 cell, 6 hr 

(F) 32 cell, 5 hr 

(M) Pear, 47 hr 

(N) Pear, 13 hr 

W 

W 

R 

R 

(G) prawn-chip, 12 hr 

(H) prawn-chip, 8 hr 

(O) spindle planular larvae, 76 hr 

(P) spindle planular larvae, 66 hr 

W 

R 

R 

W 

Fig. 3. Embryo stages of Galaxea fascicularis and Acropora muricata. The time of each stage is indicated in hours after fertilization. 

(A, B) Two-cell stage; (C, D) 8-cell stage; (E, F) 32-cell stage; (G, H) prawn-chip stage; (I, J) donut stage; (K, L) fat-donut stage; (M, N) 

pear stage; (O, P): spindle planular larvae. R and W = Developmental stages form red and white fertilized eggs. Scale bar = 200 μm.

148 


fascicularis colonies, and fertilization took place 

with large quantities of gametes that increased the 

chances of observing serial embryo development 

of white eggs from hermaphroditic colonies. 

Further investigations of the percentage of fertile 

white eggs in gamete bundles of hermaphroditic 

colonies and of the survival, settlement, recruitment 

success, and growth of derived juvenile corals are 

needed to confirm the contribution of white eggs to 

G. fascicularis populations. 

Overall, results from this study showed that 

embryonic development time is much shorter 

in G. fascicularis compared to that in Acropora. 

The length of embryonic development could 

affect dispersal and recruitment among different 

spawning corals (Nakamura and Sakai 2010). For 

example, among spawning pocilloporid corals, 

larvae that develop relatively more rapidly have 

higher recruitment at sites where adult coral cover 

is high. In contrast, recruitment is not related to 

adult coral cover in acroporid and poritid corals, 

the embryonic development times of which are 

relatively slow (Nakamura and Sakai 2010). 

The shorter embryonic development time might 

facilitate G. fascicularis settling locally faster, and 

helping it become the dominant species after 

a series of disturbances and disappearance of 

acroporid corals (Acropora and Montipora) after 

a cold shock event in 2008 at CIB (Hsieh et al. 

2008 2011). The recruitment of acroporid corals 

may be slower because sources of larvae are from 

neighboring coral communities outside CIB. 

Sexual pattern of Galaxea fascicularis 

gynodioecy 

Completion of embryonic and larval development 

of white eggs from hermaphroditic colonies 

suggests that the sexual pattern of G. fascicularis 

is gynodioecious, instead of pseudo-gynodioecious 

as proposed by Harrison (1989). Studies on 

plant reproductive systems have indicated that 

gynodioecy is a transitional step towards dioecy 

(gonochorism) from hermaphroditism (reviewed 

in Charlesworth 2006). This scenario might be 

applicable to the evolution of sexual pattern traits 

in Galaxea. Galaxea is the only coral genus that 

possesses a sexual pattern of gynodieocy, and 

phylogenetic studies have relocated Galaxea from 

the family Oculinidae to the Euphyllidae, where it 

forms a sister clade to the genus Euphyllia (Fukami 

et al. 2008, Dai and Horng 2010). The sexual 

patterns of 8 Euphyllia species can be divided into 

either dioecious species with spawned gametes 

(e.g., E. ancora) or hermaphroditic species with 

brooded larvae (e.g., E. glabrescens) (Veron 

2000). Gynodieocy in Galaxea might represent a 

transitional step of sexual pattern evolution in the 

family Euphyllidae. In addition, gynodieocy also 

suggests a unique inheritance mode of genetics 

in Galaxea compared to true hermaphroditic or 

dioecious species. Further work on ancestral 

reconstruction of life-history traits and genetic 

structuring of populations should provide insights 

into the evolutionary novelty of gynodioecy in 

Galaxea among scleractinian corals. 

Acknowledgments: Many thanks go to the 

staff of the Penghu Marine Biological Research 

Center (PMBRC), Council of Agriculture for logistical 

support, and members of the Coral Reef 

Evolutionary Ecology and Genetics (CREEG) 

laboratory, Biodiversity Research Center, 

Academia Sinica (BRCAS) and 2 anonymous 

reviewers for constructive comments. CMH and 

JKL are recipients of a PhD fellowship, and SK 

is the recipient of a postdoctoral fellowship from 

Academia Sinica (2010-2012). VD is the recipient 

of a postdoctoral fellowship from the National 

Science Council (NSC), Taiwan. This study was 

made possible by an Academia Sinica Thematic 

Grant (AS-100-TP2-A02) and grants from the 

NSC (NSC99-2621-B-001-006-MY3) to CAC and 

(NSC98-2313-B-056-001-MY3) HJH. This is 

CREEG-BRCAS contribution no. 75, and BRCAS- 

PMBRC Joint Marine Laboratory contribution no. 1. 

REFERENCES 

Baird AH, JR Guest, BL Willis. 2009. Systematic and biogeographical 

patterns in the reproductive biology of 

scleractinian corals. Annu. Rev. Ecol. Syst. 40: 551-571. 

Charlesworth D. 2006. Evolution of plant breeding systems. 

Curr. Biol. 16: R726-R735. 

Chavez-Romo HE, H Reyes-Bonilla. 2007. Sexual reproduction 

of the coral Pocillopora damicornis in the southern 

Gulf of California, Mexico. Cienc. Mar. 33: 495-501. 

Colley SB, PW Glynn, AS Mayt, JL Mate. 2006. Speciesdependent 

reproductive responses of eastern Pacific 

corals to the 1997-1998 ENSO event. In Proceedings 

of the 10th International Coral Reef Symposium, vol. 1, 

Okinawa, Japan, 2004, pp. 61-70. 

Dai CF, S Horng. 2010. In, Scleractinia Fauna of Taiwan 1. 

The Complex group. National Taiwan University, Taipei 

Taiwan, pp. 175. 

Diah Permata W, RA Kinzie III, M Hidaka. 2000. Histological 

studies on the origin of planulae of the coral Pocillopora 

damicornis. Mar. Ecol. Progr. Ser. 200: 191-200. 

Flot JF, H Magalon, C Cruaud, A Couloux, S Tillier. 2008. 

Patterns of genetic structure among Hawaiian corals of


149 

the genus Pocillopora yield clusters of individuals that are 

compatible with morphology. Compt. Rend. Biol. 331: 

239-247. 

Fukami H, CA Chen, AF Budd, A Collins, C Wallace, YY Chuang 

et al. 2008. Mitochondrial and nuclear genes suggest 

that stony corals are monophyletic but most families of 

stony corals are not (order Scleractinia, class Anthozoa, 

phylum Cnidaria). PLoS ONE 3: 1-9. 

Glynn PW, SB Colley. 2009. Survival of brooding and 

broadcasting reef corals following large-scale 

disturbances: Is there any hope for broadcasting 

species during global warming? In Proceedings of the 

11th International Coral Reef Symposium, vol. 1, Ft. 

Lauderdale, FL, USA, 2008, pp. 361-365. 

Glynn PW, NJ Gassman, CM Eakin, J Cortés, DB Smith, HM 

Guzmán. 1991. Reef coral reproduction in the eastern 

Pacific: Costa Rica, Panamá, and Galápagos Islands 

(Ecuador). I. Pocilloporidae. Mar. Biol. 109: 355-368. 

Harrison PL. 1989. Pseudo-gynodioecy: an unusual breeding 

system in the scleractinian coral Galaxea fascicularis. 

Proc. 6th. Int. Coral Reef Symp. 2: 699-705. 

Harrison PL. 2011. Sexual reproduction of scleractinian 

corals. In Z Dubinsky, N Stambler, eds. Coral reefs: an 

ecosystem in transition Part 3. USA: Springer, pp. 59-85. 

Harrison PL, RC Babcock, GD Bull, JK Oliver, CC Wallace, 

BL Willis. 1984. Mass spawning in tropical reef corals. 

Science 223: 1187-1188. 

Harrison PL, CC Wallace. 1990. Reproduction, dispersal and 

recruitment of scleractinian corals. In Z Dubinsky, ed. 

Coral reefs. Amsterdam: Elsevier, pp. 133-207. 

Hsieh HJ, KS Chen, YL Lin, YA Huang, AH Baird, WS Tsai et 

al. 2011. Establishment of a no-take area (NTA) could 

not guarantee the preservation of coral communities in 

Chinwan Inner Bay, Penghu, Taiwan. Zool. Stud. 50: 443- 

453. 

Hsieh HJ, IL Shen, MS Jeng, WS Tsai, WC Su, CA Chen. 

2008. Tropical fish killed by the cold. Coral Reefs. DOI: 

10.1007/s00338-008-0378-3. 

Miller DJ, EE Ball. 2000. The coral Acropora: what it can 

contribute to our knowledge of metazoan evolution and 

the evolution of developmental processes. BioEssays 22: 

291-296. 

Nakamura MS, K Sakai. 2010. Spatiotemporal variability in 

recruitment around Iriomote Island, Ryukyu Archipelago, 

Japan: implications for dispersal of spawning corals. Mar. 

Biol. 157: 801-810. 

Richmond RH, CL Hunter. 1990. Reproduction and recruitment 

of corals: comparisons among the Caribbean, the tropical 

Pacific, and the Red Sea. Mar. Ecol. Progr. Ser. 60: 185- 

203. 

Souter P. 2010. Hidden genetic diversity in a key model 

species of coral. Mar. Biol. 157: 875-885. 

Willis BL, RC Babcock, PL Harrison, CC Wallace. 1997. 

Experimental hybridization and breeding incompatibilities 

within the mating systems of mass spawning reef corals. 

Coral Reefs 16: S53-S65. 

Willis BL, MJH van Oppen, DJ Mille, SV Vollmer, DJ Ayre. 

2006. The role of hybridization in the evolution of reef 

corals. Ann. Rev. Ecol. Evol. Syst. 37: 489-517. 

Veron JEN. 2000. Corals of the world. Townsville, Australia: 

Australian Institute of Marine Science.


Diverse Interactions between Corals and the Coral-Killing Sponge, 

Terpios hoshinota (Suberitidae: Hadromerida) 

Jih-Terng Wang 1, *, Yi-Yun Chen 1 , Pei-Jie Meng 2,3 , Yu-Hsuan Sune 3 , Chia-Min Hsu 4 , Kuo-Yen Wei 1 , 

and Chaolun Allen Chen 4,5,6 

1 

Graduate Institute of Biotechnology, Tajen Univ., Pingtung 907, Taiwan 

2 

National Museum of Marine Biology and Aquarium, Pingtung 944, Taiwan 

3 

Institute of Marine Biodiversity and Evolution, National Dong Hwa Univ., Checheng, Pingtung 944, Taiwan 

4 


5 


6 



Jih-Terng Wang, Yi-Yun Chen, Pei-Jie Meng, Yu-Hsuan Sune, Chia-Min Hsu, Kuo-Yen Wei, and Chaolun 

Allen Chen (2012) Diverse interactions between corals and the coral-killing sponge, Terpios hoshinota 

(Suberitidae: Hadromerida). Zoological Studies 51(2): 150-159. Terpios hoshinota is an encrusting sponge 

which can kill corals by overgrowing them. However, little is known about interactions between sponges and 

corals. Using visual observations and scanning electron microscopy (SEM), 4 features, including hairy tips, 

thick tissue threads, compact edges, and disintegrated tissues, displayed at the coral-facing front of Terpios 

were summarized from examining 20 species of corals. Hairy tips, found on 13 species of coral victims, were 

occupied by cyanobacteria, sponge tissues, and spicules. Thick tissue threads, found on only 7 coral species, 

were obviously an extension of Terpios tissues. Twelve coral species displayed a compact edge at the Terpioscoral 

border, in which some Terpios fronts had extruding spicules. Disintegrated tissue was only found on the 

coral side in 5 species of coral, but that on the sponge side was only found on 1 coral species. Only a few 

disintegrated tissues being found at the Terpios-coral border suggests that allelochemicals are not the major 

player in Terpios-coral interactions. The interactions also did not display species specificity, except in the case 

of Terpios having been retrogressively grown over by a coral, which was only found in Millepora exaesa. Under 

SEM examination, coral nematocysts were usually found on the surface of the invading Terpios, but they did not 

seem to retard the growth of the sponge. In summary, exploitation of the substratum by T. hoshinota on coral 

does not move forward in a consistent manner. The performance of Terpios, such as when overgrowing a coral, 

building a clear border, or being retrogressively overgrown by a coral, may rely on the viability status of both 

organisms. http://zoolstud.sinica.edu.tw/Journals/51.2/150.pdf 

Key words: Terpios, Cyanobacteria, Coral-killing sponge, Substrata competition. 

In coral reefs, sponges are a well-known 

space competitor (Suchanek et al. 1983, Rützler 

2002), but few are recognized as real threats to 

the survival of corals. Terpios hoshinota Rützler 

and Muzik, 1993, a cyanobacteriosponge, is an 

exception, as its high growth rate can encrust 

almost every type of hermatypic coral encountered. 

Its widespread infection was first reported in Guam 

(Bryan 1973), and subsequently in the Ryukyus, 

Japan (Rützler and Muzik 1993, Reimer et al. 2011) 

and Green I. (Lyudao), Taiwan (Liao et al. 2007). 

Terpios hoshinota was also found in Truk Lagoon 

in American Samoa, Cebu I. in the Philippines, 

Thailand (Plucer-Rosario 1987), and even on the 


E-mail:jtw@mail.tajen.edu.tw 

150

Wang et al. – Coral-Terpios Interactions 151 

Great Barrier Reef (Fujii et al. 2011). Damage 

caused by an invasion of Terpios caused nearly 

30% loss of coral coverage on some reefs in 

Guam (Plucer-Rosario 1987). At Green I., Taiwan, 

an unprecedented overgrowth by Terpios on corals 

was found in 2006, which also caused almost 30% 

coral coverage loss along a 100-m transect belt 

(Liao et al. 2007). The complete recovery from 

a Terpios encrustation, e.g., at Anae I. in Guam, 

took more than 10 yr, when the disturbance level 

decreased (Plucer-Rosario 1987). Therefore, once 

a Terpios outbreak occurs, there will be long-term 

impacts on a coral reef ecosystem and on activities 

that rely on a healthy condition of the reefs. 

Ecologically, T. hoshinota is distributed above 

the limit of the euphotic zone, probably due to 

the presence of endosymbiotic photosynthetic 

cyanobacteria (Bryan 1973, Plucer-Rosario 

1987, Rützler and Muzik 1993). A histological 

examination of T. hoshinota indicated that the 

sponge contained a high percentage (> 50%) 

of intercellular cyanobacteria and 5%-18% of 

cells were in the dividing stage (Rützler and 

Muzik 1993, Hirose and Murakami 2011). High 

abundances and activities of cyanobacteria 

contained in T. hoshinota suggest that a potential 

source of the sponge’s nutrients is derived from 

photosynthetic bacteria (Rützler and Muzik 

1993). It was hypothesized by Bryan (1973) 

that Terpios probably kills coral for nutrients 

with toxic chemicals, but comparisons between 

tissue-depleted and healthy coral suggested 

that the sponge might just overgrow the coral 

surface to occupy more space (Plucer-Rosario 

1987). During growth, Terpios moves forward by 

lateral propagation, extending short, fine tendrils 

across crevices to new substrate (Rützler and 

Muzik 1993). Terpios hoshinota can also develop 

tissue threads, instead of whole sheets of tissue, 

to move over a shaded area and establish new 

territory (Soong et al. 2009). However, Terpios 

occasionally exhibits retrogression (i.e., negative 

growth) and can even be overgrown by some 

corals (e.g., Montipora and Porites) or red 

calcareous algae (Plucer-Rosario 1987). Thus, 

Terpios does not always win during its advance. 

Interactions between Terpios and corals were 

examined from the viewpoint of changes in the 

bacterial community. Tang et al. (2011) indicated 

that invasion by Terpios onto corals initiates a 

shift in the coral bacterial community from one on 

healthy corals to that found on corals with blackband 

disease. Their results suggested that harmful 

bacteria weakening the coral might favor Terpios 

outcompeting the coral for substratum (Tang et al. 

2011). 

As yet, only limited information briefly describing 

how Terpios invades victimized corals 

is available (Bryan 1973, Plucer-Rosario 1987, 

Rützler and Muzik 1993, Soong et al. 2009, Tang 

et al. 2011), and it is not clear how different coral 

species respond to an invasion by Terpios at the 

coral-sponge border under a fine scale. Therefore, 

the aim of this study was to examine the border 

between these 2 antagonists with scanning 

electron microscopy (SEM). Our findings provide 

insights into interactions between an aggressively 

invading sponge and its coral victims. 


Sample collection and maintenance 

Field observations of coral-Terpios interactions 

were conducted at Gon-Guam and Chai- 

Ko, Green I., Taiwan (22°39'N, 121°29'E) from Aug. 

2008 to July 2010. Due to the strong northeasterly 

monsoon in winter, observations were made more 

intensively during summer (May-Sept.). During 

the investigation, interactions between coral and 

Terpios were recorded with an underwater camera. 

To further examine the interaction border between 

corals and Terpios, 19 species of scleractinian 

coral and 1 hydrozoan coral with T. hoshinota 

invasion were collected by scuba diving from 3-5 m 

in depth at Gon-Guam and Chai-Ko on 28 July 

2010 and examined by SEM. The 19 scleractinian 

corals included Isopora palifera, Montipora 

aequituberculata, Mon. peltiformis, Hydnophora 

rigida, Favia stelligera, Psammocora digitata, 

Echinopora lamellose, Echinophyllia aspera, 

Goniastrea edwardsi, G. aspera, Pocilliopora 

verrucosa, Acropora digitifera, Stylophora pistillata, 

Platygyra ryukyuensis, Leptoria phrygia, Favites 

chinensis, Cyphastrea microphthalma, Porites 

lutea, and Por. cylindrical. The hydrozoan coral 

examined was Millepora exaesa. Every species 

was duplicated by collecting a sample from 2 

different colonies, and the interactions were 

photographed before collection. Terpios-coral 

specimens were sealed in a plastic bag underwater 

when collected and preserved in fixative once the 

diver had left the water. 

Terpios hoshinota on I. palifera was also 

collected and maintained in an aquarium (60 × 45 

× 45 cm) equipped with illumination (12-h:12-h light 

dark regime and 70-90 μE/m 2 /s photosynthetically

152 Zoological Studies 51(2): 150-159 (2012) 

active radiation, temperature control (25°C), 

filtration (EHEIM, Deizisau, Germany), and a 

protein skimmer. The seawater level in the tank 

was kept at only 20 cm deep, and 2 underwater 

pumps were used to create flow above the sponge. 

Terpios hoshinota could grow along the cut edge of 

the original coral substrata and also onto the shell 

debris at the bottom of the tank. Newly growing 

sponge on the shell debris was also examined 

by SEM for comparison of Terpios on a non-coral 

substratum. 

SEM method 

Freshly collected Terpios hoshinota was 

persevered in fixative (2.5% glutaraldehyde, 

2% paraformaldehyde, and 5% sucrose in 

0.1 M phosphate buffer at pH 7.0) overnight at 

4°C. Subsequently, specimens were washed in 

phosphate buffer and post-fixed in 2% OsO4/0.1 M 

phosphate buffer (pH 7.3) overnight. Standard 

procedures were used to prepare coated samples 

for SEM observations. Coral-Terpios samples 

were dried in a critical-point dryer (Hitachi HCP-2, 

Tokyo, Japan), and coated with platinum in an ion 

sputter (Hitachi E1010). SEM observations were 

made on an SEM (Hitachi S-3500N) at a voltage of 

5 kV. 

RESULTS 

After examining interactions of T. hoshinota 

with 19 species of scleractinian coral and 1 

hydrozoan coral, the results indicated that there 

were 4 types of interactions between them, i.e., 

hairy tips, thick tissue threads, compact edges, 

and disintegrated tissues (Table 1). The 2 most 

common features at the coral-facing growth front 

of Terpios were hairy tips and compact edges, 

which were respectively found in 13 (totally 23 

specimens) and 12 (totally 23 specimens) species 

of victim corals. Thick tissue threads were less 

often found at the coral-facing growth front of 

the sponge, and were found in only 7 (totally 8 

specimens) species of coral victims, and only that 

on Por. cylindrical was found in both specimens 

examined. Disintegrated tissues were more rarely 

Table 1. Morphological characterization of interactions between T. hoshinota and corals. “+” and “-” signs 

respectively represent the presence and absence of a character in the 2 replicates 

Sponge-coral border 

Coral specimen 

Terpios hoshinota 

Coral 

Hairy tips Thick tissue threads Compact edges Disintegrated tissues Disintegrate tissues 

Scleractinian coral 

Acropora digitifera ++ -- ++ -- +- 

Isopora palifera ++ -- -- -- -- 

Montipora aequituberculata ++ -- -- -- -- 

Montipora peltiformis ++ -- -- -- -- 

Porites cylindrical +- ++ ++ -- -- 

Porites lutea -- +- ++ -- -- 

Pocilliopora verrucosa ++ -- -- -- -- 

Psammocora digitata ++ -- -- -- -- 

Stylophora pistillata -- +- ++ -- +- 

Cyphastrea microphthalma +- -- ++ -- -- 

Echinopora lamellosa ++ -- ++ -- -- 

Favia stelligera ++ -- ++ -- -- 

Favites chinensis -- -- ++ -- -- 

Goniastrea aspera ++ -- -- -- -- 

Goniastrea edwardsi -- -- ++ -- ++ 

Hydnophora rigida +- +- -- -- +- 

Leptoria phrygia -- +- ++ -- -- 

Platygyra ryukyuensis -- +- ++ -- -- 

Echinophyllia aspera ++ -- -- -- -- 

Hydrozoan coral 

Millepora exaesa -- +- +- +- +-


observed at the coral-facing growth front of the 

sponge, which was only found in 1 specimen 

of Mil. exaesa. On the coral side, disintegrated 

tissues were also rarely observed; only 5 (totally 6 

specimens) coral species displayed disintegrated 

tissues at the coral-Terpios border. Eighty percent 

of specimens of the 19 species of coral displayed 

comparable color morphs and Symbiodinium 

densities with nearby corals in the same colony 

which had not been attacked by Terpios (see 

example photos in Figs. 1A, 2A, 3B). Table 1 also 

indicates that on I. palifera, Mon. aequituberculata, 

Mon. peltiformis, Poc. verrucosa, Psa. digitata, and 

Eph. aspera, the sponge displayed only 1 feature, 

hairy tips, at the coral-facing growth front; but the 

sponge on the other 14 species of coral displayed 

more than 1 feature. 

Typical examples of detailed interactions 

between corals and Terpios are shown in figures 

1-6. Figure 1 shows lots of hairy tips along 

the Terpios growth front on I. palifera. Hairy 

tips of Terpios touch the coral surface when 

it moves forward. As shown in figure 1A, the 

coral surface at the boundary next to Terpios 

displayed no significant changes in the color 

morph or Symbiodinium density. Under SEM examination, 

hairy tips were found to be occupied 

by cyanobacteria, sponge tissues, and spicules 

(Fig. 1B-D). Nematocysts obviously from the 

victim coral were also found on the surface of the 

hairy tips (Fig. 1D). Direct exposure of internal 

cyanobacteria and spicules from the hairy tips 

(Fig. 1C, D) was caused by the loss of the fragile 

pinacoderm during SEM processing. 

In figure 2, the compact edge and thick 

tissue threads at the Terpios growth front on Pla. 

ryukyuensis are shown. The thick tissue threads 

were obviously an extension of sponge tissues. 

However, the microscopic image of the compact 

edge of Terpios revealed only spicules but no 

sponge tissue or cyanobacteria extruding from 

the sponge front (Fig. 2B, C). Figure 2B and 2C 

also indicate that there was no direct contact 

between the sponge front and coral tissues, and 

no obvious disintegration was found on the coral 

surface. Sometimes, a clear border was also 

found at the coral-Terpios interface. As shown in 

figure 3A, the sponge seemed to hold its growth 

(A) 

(B) 

SE 

WD36.5 mm 5.00 kV x90 500 μm 

(C) 

(D) 

S 

C 

S 

N 

SE 

WD36.5 mm 5.00 kV x450 100 μm 

SE 

WD38.5 mm 5.00 kV x900 50 μm 

Fig. 1. Terpios hoshinota displaying hairy tips at the growth front in an interaction with coral. (A) An example from Terpios invading 

Isopora palifera; (B-D) SEM examination of the hairy tips found in (A) at different magnifications. The white arrowhead indicates the 

location of hairy tips. C, cyanobacteria; N, nematocyst; S, spicules.


by showing a compact edge at the boundary 

with disintegrated tissues of S. pistillata. This 

interaction was not prevalent throughout the entire 

Stylophora colony, because thick tissue threads 

derived from the sponge were also found to 

interact with the coral on different branches of the 

same colony (Fig. 3B). Under SEM examination, 

there was a 200-500-μm wide border without coral 

or sponge tissues between the 2 antagonists (Fig. 

3C). When zooming into the Terpios front at the 

coral-interacting side, as shown in figure 3, many 

stinging nematocysts were found at the leading 

edge of Terpios tissues. Opposition against 

Terpios growth was also found in an extreme case 

during our field survey: 1 A. digitifera colony had 

maintained the same boundary with Terpios for 

more than a year with no advance or regression. 

Disintegration of coral tissues at the coral- 

Terpios border, even though very seldom, was 

also found. Taking G. edwardsi as an example, 

the coral tissue displayed disintegration and had 

disintegrated into filamentous residues along 

the border contacting Terpios (Fig. 4A). When 

examined at high magnification, the growth front 

of Terpios seemed to move forward by penetrating 

underneath the disintegrated coral tissue (Fig. 

(A) 

(B) 

(C) 

TF 

TF 

S 

CS 

CS 

SE 

WD5.7 mm 5.00 kV x120 250 μm 

SE 

WD5.8 mm 5.00 kV x1.0 k 50 μm 

Fig. 2. Terpios hoshinota displaying a compact edge and thick tissue threads at the growth front in an interaction with coral. (A) An 

example of Terpios infecting Platygyra ryukyuensis; (B, C) SEM examination of the growth front with a compact edge of the sponge 

found in (A), indicated by a white arrowhead, at different magnifications. Thick tissue threads from the sponge are marked by white 

arrows. CS, coral surface; S, spicules; TF, Terpios front.


(A) 

(B) 

(C) 

(D) 

TS 

TS 

N 

S 

DB 

SE 

CS 

WD33.1 mm 5.00 kV x30 1 mm 

SE 

WD34.1 mm 5.00 kV x300 100 μm 

Fig. 3. Coral displaying both disintegrated and comparatively normal tissues along the growth front of T. hoshinota on different 

branches of the same colony. (A, B) Example from Terpios infecting Stylophora pistillata which displays (A) disintegrated coral tissues 

and (B) comparatively normal coral tissues at the coral-sponge interface. (C, D) SEM examination of the coral-sponge interface with 

disintegrated coral tissues at different magnifications. Disintegrated coral tissue is marked by a white arrowhead, and thick tissue 

threads from the sponge are marked by white arrows. CS, coral surface; DB, dead coral boundary; N, nematocyst; S, spicules; TS, 

Terpios surface. 

(A) 

CS 

(B) 

NC 

TS 

TS 

NC 

SE 

WD20.8 mm 5.00 kV x35 1 mm 

SE 

S 

WD20.2 mm 5.00 kV x300 100 μm 

Fig. 4. SEM examination of the disintegration of Goniastrea edwardsi tissues at the growth front of T. hoshinota. (A, B) The 

same specimen at different magnifications; the white arrowhead indicates the growth direction of Terpios. CS, coral surface; NC, 

disintegrated coral tissue; S, spicules; TS, Terpios surface.


4B). Disintegration was also found on the sponge 

side at the interaction of Mil. exaesa and Terpios. 

On Mil. exaesa, Terpios showed a retreat or 

curving-back of the sponge tissue at the coralsponge 

front (Fig. 5A). However, at another part 

of the border between Mil. exaesa and Terpios, 

thick tissue threads of the growth front of Terpios 

had crossed over the coral tissue and touched 

down a certain distance behind the border (Fig. 

5B). When examining the interaction found in 

figure 5A by SEM, there was a 100-300-μm wide 

border with disintegrated Terpios tissues in which 

spicules were exposed (Fig. 5C). At the coral 

front interacting with Terpios, many spirocysts 

were found to be protruding from the coral surface 

(Fig. 5D). Along a disintegrated Terpios tissue 

zone (Fig. 6A), a piece of Mil. exaesa tissue at 

the coral-Terpios border also had spicules that 

had penetrated through the coral surface (Fig. 

6B), suggesting retrogressive growth of coral on 

Terpios. 

In order to compare the growth of the Terpios 

on coral with a non-coral substratum, the sponge 

moving onto fragments of bivalve shells was 

also examined by SEM. As shown in figure 7A, 

Terpios had expanded its tissue onto the shell 

fragments by the 7th d of maintenance in the 

aquarium. The SEM examination indicated that 

rather than showing no direct contact between 

the coral and Terpios growth front, the sponge 

tissue had firmly attached to the surface of the 

shell fragments, and a group of protruding spicules 

was nearly completely free of sponge tissues and 

cyanobacteria (Fig. 7B). 

DISCUSSION 

By examining 20 species of coral with 

Terpios hoshinota invasion, it was found that 

(A) 

(B) 

CS 

TS 

TS 

CS 

(C) 

(D) 

TS 

S 

NT 

Sp 

SE 

CS 

WD33.9 mm 5.00 kV x45 1 mm 

SE 

WD33.6 mm 5.00 kV x700 50 μm 

Fig. 5. Millepora exaesa fighting back against invasion by T. hoshinota. (A, B) The same specimen at different locations; the black 

arrowhead indicates a curving back of Terpios tissue; the black arrow indicates a thick tissue thread extending from the growth front 

of Terpios; and the white circle indicates the site from which (D) is amplified. CS, coral surface; NT, disintegrated Terpios tissue with 

exposed spicules; S, spicules; Sp, spirocyst; TS, Terpios surface.


features of the border between the 2 antagonists 

were not uniform among coral species or even 

within the same colony. These observations 

indicate that interactions between corals and 

Terpios are dynamic and also not speciesspecific 

as described in other coral-sponge 

interactions (Averts 1998 2000, McLean and 

Yoshioka 2008). Averts (2000) also indicated 

that the direction of overgrowth by the sponge 

might be attributed to the level of compactness 

of the coral, suggesting that the health status of 

the coral might also be a determining factor in 

Terpios infections. Overgrowth by the sponge 

when invading a coral was described as occurring 

by elevating the sponge’s growing edge (McLean 

and Yoshioka 2007), but this was not the only 

feature found at the interface of coral-Terpios 

interactions. On the coral side, the growing edge 

of Terpios often displayed hairy tips, i.e., short, fine 

tendrils described by Rützler and Muzik (1993), 

which are full of sponge tissues, spicules, and 

cyanobacteria as found in the arm-like structure 

(ALS) of Tang et al. (2011). But ALSs of Terpios 

were less often found in the field. We usually 

found ALSs when the growing edge of the sponge 

ran out of substratum of an invaded coral and 

tried to climb over an adjacent coral colony or 

perhaps faced strong defense by the coral victim 

(e.g., Mil. exaesa as seen in the inset of Fig. 1D). 

Another feature at the coral-Terpios border was 

the smooth and compact growing edge of Terpios, 

which is similar to the interaction in other crustose 

sponges, such as Cliona caribbaea and Cli. lampa, 

advancing on coral (Rützler 2002). 

The observation of a several-millimeter-wide 

band of dead zooids paralleling the growing edge 

of the sponge usually indicates that allelochemical 

interactions are important in spatial competition 

(A) 

(A) 

CS 

SE 

(B) 

NT 

WD33.7 mm 5.00 kV x35 1 mm 

(B) 

TS 

S 

S 

S 

SE 

WD33.6 mm 5.00 kV x300 100 μm 

SE 

SF 

WD11.3 mm 5.00 kV x180 250 μm 

Fig. 6. Millepora exaesa growing over T. hoshinota. (A, B) 

The same specimen at different magnifications; the white 

circle indicates the site from where (B) is amplified. CS, coral 

surface; NT, disintegrated Terpios tissue with spicules exposed; 

S, spicules penetrating out of the coral surface. 

Fig. 7. Growth of T. hoshinota on shell debris in an aquarium. 

(A) Terpios on Isopora palifera maintained in a laboratory 

aquarium; the white arrowhead indicates shell debris used for 

examination. (B) SEM examination of the shell debris with 

Terpios. S, spicules; SF, shell fragment; TS, Terpios surface.


on coral reefs (Jackson and Buss 1975). An 

allelochemical effect was also considered one 

of the mechanisms by which some aggressive 

sponges invaded corals (Jackson and Buss 

1975, Porter and Targett 1988). In coral-Terpios 

interactions, both specimens from G. edwardsi 

and one of 2 specimens from 4 other coral 

species displayed disintegration at the coralsponge 

border. Most of the coral specimens 

(80%) showed comparable color morphs and 

Symbiodinium densities between tissues closely 

contacting the sponge and those remote from the 

coral-Terpios border. Therefore, even though T. 

hoshinota was reported to produce chemicals, 

such as nakiterpiosin and nakiterpiosinone, 

with potent cytotoxicity (Teruya et al. 2004), 

allelochemicals might not be the major mechanism 

by which Terpios kills coral during its competition 

for substratum. It was more evident that Terpios 

kills corals by overgrowing them. 

Scleractinian corals exhibit a wide variety 

of offensive and defensive mechanisms for 

acquiring and maintaining a living space (Connell 

1973, Wahle 1980, McCook et al. 2001). One of 

the mechanisms is to use stinging warfare such 

as nematocysts or spirocysts. The ‘stinging’ 

mechanism includes the effects of polyps, sweeper 

tentacles, and mesenterial filaments. Several 

processes were documented in interspecific 

competition among corals (reviewed by Lang 

and Chornesky 1990) and also between corals 

and a range of other animals such as zoanthids 

and gorgonians (Karlson 1980, Chornesky 1983, 

Chadwick 1987). During overgrowth by Terpios, 

some but not all victimized corals were observed 

to have ejected nematocysts at the contacting 

border. However, the defenses, including potential 

effectors not observable by SEM, such as 

chemicals, did not seem to be very effective in 

most cases. One successful case was found in 

the interaction between S. pistillata and Terpios, 

in which nematocysts at the surface of the 

growing edge of the sponge seemed to deter its 

advance. The most effective defense by coral’s 

stinging warfare was found in Mil. exaesa, in which 

the coral not only caused disintegration of the 

Terpios growing edge but was also overgrowing 

the sponge in the reverse direction. Of course, 

chemical effects derived from Mil. exaesa cannot 

be excluded because it is a notorious toxin 

producer (Wittle et al. 1971, Shiomi et al. 1989, 

Radwan and Aboul-Dahab 2004, Iguchi et al. 

2008). Millepora exaesa was further found to 

retrogressively grow on invading Terpios according 

to findings of spicules protruding from the coral 

surface next to the coral-sponge border. This 

occurred only when the coral grew on un-degraded 

spicules left behind by disintegrated tissues of 

Terpios. When the soft tissues of coral moved 

over lobed tyrostyle spicules, the spicules were 

lifted up and penetrated through the coral tissue as 

shown in figure 6B. 

Overgrowth by Terpios has caused substantial 

losses of coral coverage in Guam (Plucer- 

Rosario 1987), the Ryukyus, Japan (Rützler and 

Muzik 1993), and Green I., Taiwan (Liao et al. 

2007). According to the experience in Guam, the 

coral coverage in Guam might recover (Plucer- 

Rosario 1987). A similar observation was also 

made in Japan (Reimer et al. 2011). Fortunately, 

the coverage of Terpios has not further expanded 

at Green I. since it was first noted in 2006 (Liao et 

al. 2007). The static situation of Terpios coverage 

might partly be due to a seasonal typhoon effect, 

but the dynamic interactive mode between the 2 

antagonists, as revealed in this study, might be 

a crucial factor promoting the survival of invaded 

corals. If disturbance decreases, Connell (1978) 

suggested that coral recolonization is possible 

within a period of time. Therefore, it is our hope 

that we will see coral recovery from the Terpios 

invasion, if the environmental conditions of coral 

reefs can be protected from anthropogenic and 

natural disturbances. 

Acknowledgments: We would like to thank 

members of the Coral Reef Evolutionary Ecology 

and Genetics (CREEG) Group, Biodiversity 

Research Center, Academia Sinica (BRCAS) for 

field support, and Profs. K. Soong and E. Hirose 

for their valuable comments. This work was made 

possible by grants from the National Science 

Council, Taiwan (NSC98-2321-B-127-001-MY3) to 

JTW and (NSC98-2321-B-001-024-MY3) CAC and 

a BRCAS grant to CAC. This is CREEG-BRCAS 

contribution no. 72. 

REFERENCES 

Averts LAM. 1998. Sponge/coral interactions in Caribbean 

reefs: analysis of overgrowth patterns in relation to 

species identity and cover. Mar. Ecol. Progr. Ser. 175: 

241-249. 

Averts LAM. 2000. Dynamics behind standoff interactions 

in three reef sponge species and the coral Montastrea 

cavernosa. Mar. Ecol. 21: 191-204. 

Bryan PG. 1973. Growth rate, toxicity and distribution of the 

encrusting sponge Terpios sp. (Hadromerida: Suberitidae)


in Guam, Mariana Islands. Micronesica 9: 237-242. 

Chadwick NE. 1987. Interspecific aggressive behavior of 

the corallimorpharian Corynactis californica (Cnidaria: 

Anthozoa): effects on sympatric corals and sea anemones. 

Biol. Bull. 173: 110-125. 

Chornesky EA. 1983. Induced development of sweeper 

tentacles on the reef coral Agaricia agaricites: a response 

to direct competition. Biol. Bull. 165: 569-581. 

Connell JH. 1973. Population ecology of reef-building corals. 

In OA Jones, R Endean, eds. Biology and geology of 

coral reefs, Vol. II: Biology 1. New York: Academic Press, 

pp. 205-245. 

Connell JH. 1978. Diversity in tropical rain forests and coral 

reefs. Science 199: 1302-1310. 

Fujii T, S Keshavmurthy, W Zhou, E Hirose, CA Chen, JD 

Reimer. 2011. Coral-killing cyanobacteriosponge (Terpios 

hoshinota) on the Great Barrier Reef. Coral Reefs 30: 

483. 

Hirose E, A Murakami. 2011. Microscopic anatomy and 

pigment characterization of coral-encrusting black sponge 

with cyanobacterial symbiont, Terpios hoshinota. Zool. 

Sci. 28: 199-205. 

Iguchi A, S Iwanaga, H Nagai. 2008. Isolation and characterization 

of a novel protein toxin from fire coral. Biochem. 

Biophys. Res. Comm. 365: 107-112. 

Jackson JBC, L Buss. 1975. Allelopathy and spatial competition 

among coral reef invertebrates. Proc. Nat. Acad. 

Sci. USA 72: 5160-5163. 

Karlson RH. 1980. Alternative competitive strategies in a 

periodically disturbed habitat. Bull. Mar. Sci. 30: 894-900. 

Lang JC, EA Chornesky. 1990. Competition between scleractinian 

reef corals - a review of mechanisms and effects. 

In Z Dubinsky, ed. Ecosystems of the world, Vol. 25. 

Coral reefs. Amsterdam: Elsevier, pp. 209-252. 

Liao MH, SL Tang, GM Hsu, KC Wen, H Wu, WM Chen et al. 

2007. The “black disease” of reef-building corals at Green 

Island, Taiwan - outbreak of a cyanobacteriosponge, 

Terpios hoshinota (Suberitidae: Hadromerida). Zool. 

Stud. 46: 520. 

McCook LJ, J Jompa, G Diaz-Pulido. 2001. Competition 

between corals and algae on coral reefs: a review of 

evidence and mechanisms. Coral Reefs 19: 400-417. 

McLean EL, PM Yoshioka. 2007. Associations and interactions 

between gorgonians and sponges. In MR Custódio, G 

Lôbo-Hajdu, E Hajdu, GP Muricy, eds. Porifera research: 

biochemistry, innovation and sustainability. Série Livros 

28. Rio de Janeiro: Museu Nacional, pp. 443-448. 

McLean EL, PM Yoshioka. 2008. Substratum effects on the 

growth and survivorship of the sponge Desmapsamma 

anchorata. Carib. J. Sci. 44: 83-89. 

Plucer-Rosario G. 1987. The effect of substratum on the 

growth of Terpios, an encrusting sponge which kills corals. 

Coral Reefs 5: 197-200. 

Porter JW, NM Targett. 1988. Allelochemical interactions 

between sponges and corals. Biol. Bull. 175: 230-239. 

Radwan FY, HM Aboul-Dahab. 2004. Milleporin-1, a new 

phospholipase A2 active protein from the fire coral 

Millepora platyphylla nematocysts. Comp. Biochem. 

Physiol. Part C Toxicol. Pharmacol. 139: 267-272. 

Reimer JD, Y Nozawa, E Hirose. 2011. Domination and 

disappearance of the black sponge: a quarter century 

after the initial Terpios outbreak in southern Japan. Zool. 

Stud. 50: 395. 

Rützler K. 2002. Impact of crustose Clionid sponges on 

Caribbean reef corals. Acta Geol. Hispan. 37: 61-72. 

Rützler K, K Muzic. 1993. Terpios hoshinota, a new cyanobacteriosponge 

threatening Pacific reefs. Sci. Mar. 57: 

395-403. 

Shiomi K, M Hosaka, N Yanaike, H Yamanaka, T Kikuchi. 1989. 

Partial characterization of venoms from two species of 

fire corals Millepora platyphylla and Millepora dichotoma. 

Nippon Suisan Gakk 55: 357-362. 

Soong K, SL Yang, CA Chen. 2009. A novel dispersal 

mechanism of a coral-threatening sponge, Terpios 

hoshinota (Suberitidae, Porifera). Zool. Stud. 45: 596. 

Suchanek TH, RC Carpenter, JD Witman, CD Harvell. 

1983. Sponge as important space competitors in deep 

Caribbean coral reef communities. In ML Reaka, ed. The 

ecology of deep and shallow coral reefs. Symposia Series 

for Undersea Research, NOAA Undersea Research 

Program 1(1). Washington DC: National Oceanic and 

Atmospheric Administration (NOAA), pp. 55-60. 

Tang SL, MJ Hong, MH Liao, WN Jane, PW Chiang, CB Chen, 

CA Chen. 2011. Bacteria associated with an encrusting 

sponge (Terpios hoshinota) and the corals partially 

covered by the sponge. Environ. Microbiol. 13: 1179- 

1191. 

Teruya T, S Nakagawa, T Koyama, T Arimoto, M Kita, D 

Uemura. 2004. Nakiterpiosin and nakiterpiosinone, 

novel cytotoxic C-nor-D-homosteroids from the Okinawan 

sponge Terpios hoshinota. Tetrahedron 60: 6989-6993. 

Wahle CM. 1980. Detection, pursuit, and overgrowth of 

tropical gorgonians by milleporid hydrocorals: Perseus 

and Medusa revisited. Science 209: 689-691. 

Wittle LW, RE Middlebrook, CE Lane. 1971. Isolation and 

partial purification of toxin from Millepora alcicornis. 

Toxicon 9: 329-331.


Biodiversity of Planktonic Copepods in the Lanyang River (Northeastern 

Taiwan), a Typical Watershed of Oceania 

Hans-Uwe Dahms 1 , Li-Chun Tseng 2 , Shih-Hui Hsiao 2 , Qing-Chao Chen 3 , Bong-Rae Kim 4 , and 

Jiang-Shiou Hwang 2, * 

1 

Green Life Science Department, College of Convergence, Sangmyung Univ., 7 Hongij-dong, Jongno-gu, Seoul110-743, South Korea 

2 

Institute of Marine Biology, National Taiwan Ocean University, 2 Pei-Ning Road, Keelung 202, Taiwan 

3 

South China Sea Institute of Oceanology, Chinese Academy of Science, Guangzhou 510301, China 

4 

National Fisheries Research and Development Institute, Inland Fisheries Research Institute, Kyunggi-do 114-3, South Korea 


Hans-Uwe Dahms, Li-Chun Tseng, Shih-Hui Hsiao, Qing-Chao Chen, Bong-Rae Kim, and Jiang-Shiou 

Hwang (2012) Biodiversity of planktonic copepods in the Lanyang River (northeastern Taiwan), a typical 

watershed of Oceania. Zoological Studies 51(2): 160-174. To evaluate the environmental status of a typical 

Oceania watershed in Taiwan, zooplankton samples were collected bimonthly along the Lanyang River (NE 

Taiwan) at 9 different stations including 1 estuarine and 8 freshwater stations during 10 sampling campaigns 

from June 2004 to Dec. 2005. Upstream stations showed lower chlorophyll a and temperature values than 

downstream stations; the highest chlorophyll a concentration was found in the estuary at all times. We 

identified 21 copepod species, belonging to 4 orders, 12 families, and 20 genera in total. Eleven species 

were recorded only once among all samples. The Calanoida was restricted to samples from the estuary. The 

Poecilostomatoida was only recorded from the estuary and the Lanyang Bridge station. The Harpacticoida was 

only recorded from the estuary, Lanyang Bridge, and Tsu-Keng River stations. At 2 mid-section stations, no 

copepods were found. The upstream station showed lower abundance, species number, species richness, and 

evenness and diversity indices than the downstream and estuarine stations. The estuarine station provided the 

highest copepod abundance (3410.05 individuals/m 3 ) and species number (12 species/station) in Aug. 2004 

when the waters showed the highest salinities (37 psu), indicating the marine origin of the diverse biota. Among 

all samples, there were no significant differences in the abundance, number of species, or indices of richness, 

evenness, and diversity among sampling months. In contrast, our analysis clearly showed a succession in 

abundance and species composition among sampling months. At the estuarine station, copepod abundances 

were significantly positive correlated with salinity (r = 0.880, p = 0.001). Numbers of species were significantly 

positive correlated with chlorophyll a (r = 0.790, p = 0.007), salinity (r = 0.780, p = 0.008), and copepod 

abundance (r = 0.785, p = 0.007). Copepod abundances were mainly affected by intruding seawater, but there 

was no interaction with the month of sampling. http://zoolstud.sinica.edu.tw/Journals/51.2/160.pdf 

Key words: Riverine zooplankton, River ecology, Estuary, Copepod mesozooplankton, Plankton communities. 

When compared to the open ocean, coastal 

and estuarine ecosystems may be smaller, 

in terms of area and volume, but the amount 

of organic carbon exported to the deep ocean 

through the coastal fringe (1.7 × 10 15 tons C/yr) 

can reach nearly that of the entire oceanic realm 

(13.2 × 10 15 tons C/yr) (Bienfang and Ziemann 

1992, Carlsson et al. 1995). Coastal tropical 

environments are of particular importance in this 

respect (Nittrouer et al. 1995). Increasing attention 

has been given to small mountainous rivers with 

drainage areas of < 10,000 km 2 . These smaller 

but numerous rivers could collectively be very 

important in transporting sediments and particulate 

* To whom correspondence and reprint requests should be addressed. Hans-Uwe Dahms and Li-Chun Tseng contributed equally to this 

work. Tel: 886-935289642. Fax: 886-2-24629464. E-mail:jshwang@mail.ntou.edu.tw 

160

Dahms et al. – Lanyang River Copepods 161 

organic carbon to the ocean (Hsu et al. 1998). 

Many of these rivers are present on islands of the 

western Pacific, collectively called Oceania (Kao 

and Liu 1996 1997). On Oceania islands, such 

as Taiwan, high precipitation, steep slopes, small 

basin areas, and frequent flood events can induce 

high erosion rates (Carry et al. 2002). These 

natural characteristics make watersheds much 

more vulnerable to anthropogenic perturbations 

(Cearreta et al. 2000) such as exacerbation of 

erosion induced by human perturbations in the 

Lanyang River (Kao and Liu 2002). 

Rivers provide a unique gradation of environments: 

from pristine waters to a mix of riverine 

and seawater in their estuaries. Considering the 

high resilience of the estuarine portion of rivers, 

analyses of zooplankton community assemblages 

along riverine, estuarine, and marine sections of 

a river mouth are warranted to understand the 

main determinants of zooplankton communities 

in estuaries (Thor et al. 2005, Hwang et al. 2000 

2006 2009b 2010). 

The Lanyang River is a typical watershed on 

an Oceania island and is used as an example in 

the present study. Shiah et al. (1996) differentiated 

3 types of waters in the estuary of the Lanyang 

River: river-mouth water, marine seawater, and 

mixed water. Amounts of precipitation in the 

drainage basin and estuary of the Lanyang River 

are influenced by a shift in seasonal currents. 

These are driven by the northward flow of the 

Kuroshio Current along eastern Taiwan year round 

and during winter by the northeasterly monsoon 

(Jan et al. 2002, Lee and Chao 2003, Liang et al. 

2003, Liu et al. 2003, Hwang et al. 2006, Tseng 

et al. 2008b, Hsieh et al. 2011). Although being 

the largest tidal river in northeastern Taiwan, 

comparatively few biological and hydrological 

investigations have been undertaken in the 

Lanyang River and its estuary. For example, there 

is no information available about zooplankton in 

general or copepod community structures, and 

particularly about their dynamics. To determine 

the ecological health of a river, such as the 

Lanyang River, an assessment study needs 

to sample a variety of physicochemical and 

biological parameters. Studies at higher levels 

of organization are important to understand 

environmental stressors on ecologically relevant 

endpoints such as community diversity. Thus, 

organism-level responses are important in 

assessing the health of aquatic systems and their 

recovery after a disturbance. Establishment of 

relationships between stressors and biological 

responses serve as the basis of management 

decisions and environmental remediation practices. 

Copepods are claimed to be numerically 

the most abundant metazoans (Schminke 2007, 

Chang et al. 2010, Hwang et al. 2004 2010, Kâ 

and Hwang 2011) and play a central role in the 

transfer of carbon from producers to higher trophic 

levels in most aquatic ecosystems (Jerling and 

Wooldridge 1995). Copepods are the primary 

consumers of phytoplankton and are the main prey 

items of larval and juvenile fishes that link pelagic 

food webs (Tseng et al. 2008a 2009, Vandromme 

et al. 2010, Wu et al. 2010). Copepods are used 

as indicator species for waters of different qualities 

and origins (Bonnet and Frid 2004, Hwang and 

Wong 2005, Thor et al. 2005, Hwang et al. 2006 

2009a 2010). Understanding the copepod fraction 

of the mesozooplankton is thus meaningful to 

fundamental ecology and applied environmental 

monitoring (Chullasorn et al. 2009 2011, Hwang et 

al. 2009b). This also holds for the management 

and protection of biological resources of other 

riverine watersheds worldwide and in Oceania. 

In the present paper, we investigated planktonic 

copepod assemblages in the freshwater 

and estuarine portions of the Lanyang River in 

order to understand the major determinants such 

as temperature, salinity, chlorophyll (Chl) a, and 

copepod abundances and distributions in a typical 

smaller watershed of a subtropical Oceania island. 

Study site 


The Lanyang River is a comparatively small 

watershed in Taiwan but the largest in northeastern 

Taiwan (Fig. 1). It originates at an elevation of 

3535 m and runs for only 73 km. It is on average 

0.5 km wide with a comparatively small drainage 

basin area of 820 km 2 (Kao 1996). The main 

channel flowing northeasterly, is affected by high 

precipitation, and has a steep slope (with a mean 

gradient of 1: 21) (Kao 1996). The river mouth 

is shallow (< 2 m deep) and narrow. The annual 

precipitation in this watershed ranged 2000- 

5000 mm for the past 50 yr, with an average of 

about 3000 mm (Kao and Liu 2002). This amount 

is high as an average value on a global scale, 

but typical for Oceania islands. The lithology 

and climatic conditions are homogeneous in the 

watershed. The basement rock of the Lanyang 

River watershed is composed mainly of Tertiary


argillite-slate and metasandstone (Ho 1975). 

There are 2 gauge stations along the main channel 

of the river. Gauge 1 is located above the tidal 

zone at the river mouth. Gauge 2 is located in 

the upper part at an elevation of 450 m. The 

drainage areas above G1 and G2 are 820 and 

273 km 2 , respectively. There were 2 massive 

road construction events in the study area in the 

past 50 yr which were the major anthropogenic 

disturbances in the watershed and which also 

allowed farming disturbances on otherwise steep 

slopes. Vegetable plantations were developed 

along the riverbeds and banks of the main stem 

as high as 1250 m in elevation. There is little 

domestic effluent in the upper and midstream 

sections, but heavy discharges in the estuary of 

the Lanyang River. Most disturbances are due 

to agricultural activities in upstream areas and a 

quarry in the midstream portion. 

Zooplankton and water sample collection 

Based on preliminary surveys of salinity and 

copepod distributions, 9 stations were set up at 

24°27'41"-24°43'01"N and 121°24'12"-121°49'31"E 

along the Lanyang River in order to cover most 

of the range of environmental conditions. These 

stations are grouped in 3 areas and include fresh 

waters and brackish waters in the estuarine river 

mouth (Fig. 1, Table 1). The largest distance 

between the Gah-Siang (GS) Bridge and the coast 

is about 73.00 km. There is a drastic decrease 

N 

Tsu-Keng River Lanyang Bridge 

Yi-Lan County 

Sung-Luo River 

Estuary 

Niour-Douh Bridge 

Ga-Yuan Bridge 

26° 

CHINA 

East China Sea 

Taiwan Strait 

Pengjiayu 

Ji-Kwan Bridge 

Gah-Siang 

Bridge 

Sh-Gu-Fuh River 

24° 

22° 

TAIWAN 

Pacific Ocean 

120° 122° 

Fig. 1. Sampling stations along the Lanyang River in northeastern Taiwan. 

Table 1. Station name, abbreviation, code, elevation, and distance to the coast 

Location Abbreviation Code for station Elevation (m) Distance to coast (km) 

Gah-Siang Bridge GS Bridge A 1534 73.00 

Sh-Gu-Fuh River SGF River B 948 67.43 

Ji-Kwan Bridge JK Bridge C 808 65.08 

Ga-Yuan Bridge GY Bridge D 376 47.10 

Niour-Douh Bridge ND Bridge E 209 35.11 

Sung-Luo River SL River F 189 28.69 

Tsu-Keng River TK River G 90 17.55 

Lanyang Bridge LY Bridge H 2 6.21 

Estuary Estuary I 1 0.10


in elevation from 1534 to 90 m between the GS 

Bridge and Tsu-Keng (TK) River stations. The 

Sung-Luo (SL) River and TK River stations are 

located where these streams merge with the 

Lanyang River. Whereas 7 upper stations belong 

to the freshwater zone, the 2 stations of Lanyang 

(LY) Bridge and the estuary are influenced by 

seawater. Waters at the LY Bridge station are less 

affected by seawater as they are somewhat farther 

from the coast. 

Stations were sampled every 2nd month 

during 10 sampling periods from June 2004 to 

Dec. 2005. Tows were performed from a boat 

at the estuary station and by foot at the river 

stations. Since the channel of the Lanyang River 

is shallow and narrow, boats cannot navigate in 

the middle and upstream sections. Zooplankton 

samples were obtained by towing a modified North 

Pacific (NORPAC) zooplankton net (with a mouth 

diameter of 45 cm, a mesh size of 100 µm, and 

a length of 180 cm with a Hydrobios flow meter 

(Germany) mounted at the center of the net mouth) 

horizontally for 10 min at the surface at all stations 

(Hwang et al. 2007). Zooplankton were preserved 

in a buffered 5% formalin-seawater solution for 

later sorting, identification, and counting in the 

laboratory. 

Water temperature and salinity were measured 

with a mercury thermometer and refractometer 

(S-100, Tanaka Sanjiro Co.,Ltd., Japan), 

respectively. Water samples at 1 m in depth were 

collected with Niskin bottles to determine Chl a 

concentrations using the fluorometric method 

of Parsons et al. (1984). Other parameters like 

precipitation, nutrient and organic loadings were 

not measured but were taken from the literature 

(Kao and Liu 1996 1997). 

Copepod enumeration and identification 

In the laboratory, zooplankton samples were 

subsampled with a Folsom splitter. Procedures 

for species identification and counting were similar 

to those described by Hwang et al. (1998 2006). 

Adult copepods in the subsamples were identified 

and counted under a stereomicroscope. Species 

were identified according to keys and references 

by Chen and Zhang (1965), Chen et al. (1974), 

Shih and Young (1995), and Chihara and Murano 

(1997). Freshwater copepods were identified 

according to Dussart and Defaye (2006) and 

Einsle (1996) if not indicated otherwise. 

Data analysis 

Copepod community structures were 

analyzed using the Plymouth Routine In 

Multivariate Ecology Research (PRIMER) 

computer package (Version IV; Clarke and 

Warwick 1994). In order to reduce the higher 

heteroscedasticity observed in the abundance data 

for major taxa, a transformation power (λ = 0.983) 

was generated by regression coefficients, that 

were simultaneously estimated using a method of 

maximizing the log-likelihood function (Box and 

Cox 1964). Copepod abundance data were log 

(X + 1)-transformed before clustering, using the 

matrix of abundances composed of samples and 

species. Similarity coefficients between samples 

were computed using the Bray-Curtis similarity 

and clustering strategy of flexible links. Three 

stations (Ji-Kuan (JK) ridge, Ga-Yuan (GY) Bridge, 

and Niour-Douh (ND) Bridge) were not considered 

in the cluster analysis since they contained no 

copepods. For correlations between abiotic 

factors and zooplankton abundances, Pearson’s 

product moment correlation coefficients were 

calculated with the SPSS computer package 

(Chicago, IL, USA). The Mann-Whitney U-test 

was applied to compare spatial and seasonal 

differences in surface-water temperatures. A oneway 

analysis of variance (ANOVA) was applied 

to reveal differences in abundances, numbers of 

species, and indices of richness, evenness, and 

diversity among sampling months. The Shannon- 

Wiener diversity index (Weaver and Shannon 

1949) together with the richness index and Pielou’s 

evenness index (Pielou 1966) were applied to 

estimate the copepod community composition. 

RESULTS 

Overview of the Lanyang River 

Hydrographic parameters, Chl a, and salinity 

We recorded high surface temperatures 

from June to Dec. in both years 2004 and 2005. 

Stations along the upper stream showed lower 

Chl a (0.84 ± 0.25 μg/L) and temperature (19.4 

± 4.45°C) values than the downstream stations 

(2.35 ± 1.90 μg/L for Chl a and 25.5 ± 4.11°C for 

temperature) (Fig. 2). The estuarine station always 

had higher concentrations of Chl a (Fig. 2A). 

Spatial differences in surface water temperature 

were not significant, but seasonal differences


Chlorophyll a (μg/L) 

7 

6 

5 

4 

3 

2 

1 

0 

35 

Gah-Siang Bridge 





(A) 

(B) 


Tsu-Keng River 

Lanyang Bridge 

Estuary 

in temperature were significant (p < 0.05; Mann- 

Whitney U-test), with the lowest temperature of 

9.1°C recorded in Feb. 2005 (GS Bridge station) 

and the highest temperature of 31.5°C in Aug. 

2004 (ND Bridge and LY Bridge stations) (Fig. 2B). 

All sampling stations, except the estuarine one, 

had freshwater conditions throughout the study 

period, with salinities of 0 psu at all times (Fig. 2C). 

A plume-ward progressive increase in salinity was 

obvious in the estuary. The value recorded off the 

estuary station showed remarkable changes from 

0 (i.e., fresh water) to 37 psu, with an average 

of 9.58 psu, indicating a variable influence of 

riverine freshwater outflow near the surface from 

upstream and of near-bottom intrusion of saline 

water from the ocean. The salinity was 37.0 psu 

when seawater intruded the estuary, and it was 0 

psu when fresh water flushed the estuary after a 

heavy rainfall or during an ebb tide (Fig. 2C). All 3 

hydrographic parameters showed maximum values 

at the estuarine station (Fig. 2A-C). 

30 

Copepod abundance and diversity 

Temperature (°C) 

Salinity (PSU) 

25 

20 

15 

10 

5 

40 

30 

20 

10 

0 

(C) 

June Aug. Oct. Dec. Feb. Apr. June Aug. Oct. Dec. 

2004 2005 

Sampling month 

Fig. 2. Chlorophyll a (A), water temperature (B), and salinity 

(C) in each sampling month at each sampling station. Only the 

estuary station exhibited salinities of > 0 psu. 

In total, 28 species and 21 genera, belonging 

to 12 families and 4 copepod orders 

were identified from the marine, estuarine, and 

riverine portions of the Lanyang River (Table 

2). The Poecilostomatoida was only recorded 

at the estuarine and LY Bridge stations. At the 

sampling station closest to the Lanyang River 

mouth, Apocyclops borneoensis showed the 

highest occurrence rate (6.67%). In contrast, 11 

copepod species were recorded only once among 

all samples (with an occurrence ratio (OR) of 

1.11%). No copepods were found at the following 

3 stations: JK Bridge, GY Bridge, and ND Bridge, 

located in the lower section of the upper 1/2 of the 

river (Table 2). 

In terms of both diversity and abundance, 

copepods were the most dominant component 

of the zooplankton in all samplings. Among all 

zooplankton, cyclopoid copepods were most 

prominent, in terms of both diversity and density at 

most sampling stations throughout the investigation 

period. The number of calanoids was highest in 

the estuary. The Poecilostomatoida was only found 

in the estuary. From all samples, results showed 

that copepod abundances at the estuarine station 

were significantly affected by the intrusion of 

seawater. Freshwater copepods were represented 

by 1 calanoid species of Mongolodiaptomus birulai 

and 9 cyclopoid species of Acanthocyclops sp., 

Apocyclops borneoensis, Cyclopina sp., Cyclops


Table 2. Abundance (mean ± S.D. individuals (ind.)/m 3 ), relative abundance (RA, %), and occurrence rate 

(OR, %) of copepods (ind./m 3 ) at recorded stations. A, GS Bridge; B, SGF River; C, JK River; D, GY Bridge; 

E, ND Bridge; F, SL River; G, TK River; H, LY Bridge; I, estuary 

Species 

Recorded 

station 

Mean ± S.D. 

(ind./m 3 ) 

RA (%) OR (%) 

Calanoida 

Acartiidae 

Acartia (Odontacartia) erythraea Giesbrecht 1889 I 184 3.808 1.11 

Acartia (Plantacartia) negligens Dana 1849 I 2.48 ± 2.15 0.103 2.22 

Centropagidae 

Sinocalanus sp. I 0.4 0.008 1.11 

Sinocalanus tenellus (Kikuchi) 1928 I 0.68 0.014 1.11 

Diaptomidae 

Mongolodiaptomus birulai (Rylov) 1922 I 0.68 0.014 1.11 

Eucalanidae 

Subeucalanus subcrassus (Giesbrecht) 1888 I 13.14 0.272 1.11 

Paracalanidae 

Acrocalanus gracilis Giesbrecht 1888 I 15.37 ± 3.15 0.636 2.22 

Paracalanus aculeatus Giesbrecht 1888 I 3.93 ± 1.7 0.244 3.33 

Parvocalanus crassirostris (Dahl) 1893 I 473.19 ± 708.37 29.379 3.33 

Pseudodiaptomidae 

Pseudodiaptomus annandalei Sewell 1919 I 15.93 ± 17.04 0.989 3.33 

Pseudodiaptomus serricaudatus (Scott T) 1894 I 365.22 ± 622.25 22.676 3.33 

Temoridae 

Temora turbinata (Dana) 1849 I 93.1 ± 128.56 3.854 2.22 

Cyclopoida 

Cyclopidae 

Acanthocyclops sp. H 0.75 ± 1.06 0.031 1.11 

Apocyclops borneoensis Lindberg 1954 A, B, H, I 36.81 ± 47.42 4.570 6.67 

Cyclops sp. A, H, I 30.79 ± 31.81 1.912 3.33 

Eucyclops sp. F, I 6.4 ± 7.38 0.265 2.22 

Mesocyclops pehpeiensis Hu 1943 G, I 6.06 ± 2.12 0.251 2.22 

Mesocyclops sp. G, H, I 0.97 ± 0.82 0.060 3.33 

Microcyclops sp. A, B, H, I 6.63 ± 7.94 0.549 4.44 

Thermocyclops kawamurai Kikuchi 1940 H, I 380.91 ± 514.96 15.766 2.22 

Cyclopinidae 

Cyclopina sp. I 56.98 ± 68.13 2.358 2.22 

Oithona rigida Giesbrecht 1896 I 116.14 ± 133.15 4.807 2.22 

Oithona similis Claus 1866 I 13.14 0.272 1.11 

Harpacticoida 

Euterpinidae 

Euterpina acutifrons (Dana) 1847 I 289.15 5.984 1.11 

Poecilostomatoida 

Corycaeidae 

Corycaeus (Ditrichocorycaeus) erythraeus Cleve 1901 I 13.14 0.272 1.11 

Corycaeus (D.) subtilis M. Dahl 1912 H, I 20.38 ± 5.07 0.844 2.22 

Corycaeus (Farranula) concinna (Dana) 1847 H 0.78 0.016 1.11 

Corycaeus (F.) gibbula Giesbrecht 1891 I 2.2 0.046 1.11 

Total 53.69 ± 367.2 100.0


sp., Eucyclops sp., Mesocyclops sp., Mesocyclops 

peheiensis, Microcyclops sp., and Thermocyclops 

kawamurai. 

The highest abundance (3410.05 ind./m 3 ) was 

recorded in Aug. 2004, followed by 745.04 ind./m 3 

in Feb. 2005, and the 3rd highest record was 

193.50 ind./m 3 in June 2004 at the estuarine 

station. Only the estuarine station showed 

significant differences in copepod abundances 

during the sampling period. Copepod abundances 

were < 5.0 ind./m 3 at all freshwater stations (Fig. 

3A). The number of species at the 9 sampling 

Copepod abundance (ind. m -3 ) 

3500 

3000 

2500 

2000 

1500 

1000 

500 

150 

100 

50 

0 

(A) 

Gah-Siang Bridge 






Tsu-Keng River 

Lanyang Bridge 

Estuary 

14 

(B) 

1.6 

(C) 

Number of species (no. station -1 ) 

12 

10 

8 

6 

4 

2 

0 

Richness index 

1.4 

1.2 

1.0 

0.8 

0.6 

0.4 

0.2 

0.0 

1.0 

(D) 

1.8 

1.6 

(E) 

0.8 

1.4 

Evenness index 

0.6 

0.4 

0.2 

Diversity index 

1.2 

1.0 

0.8 

0.6 

0.4 

0.2 

0.0 


2004 2005 


0.0 


2004 2005 


Fig. 3. Total copepod abundance (A), number of species (B), indices of richness (C), evenness (D), and Shannon-Wiener diversity (E) 

of each sampling month at each sampling station.


stations ranged 0-12/station. The highest species 

number (of 12 species/station) was recorded at 

the estuarine station in Aug. 2004 (Fig. 3B). The 

record of identified species was < 2 at the LY 

Bridge station. In the remaining 8 stations of the 

freshwater zone, the number of identified species 

ranged 0-1/station during the sampling period (Fig. 

3B). The indices of richness (Fig. 3C), evenness 

(Fig. 3D), and diversity (Fig. 3E) showed high 

variations at the estuarine station. Indices could 

not be calculated at the remaining 8 sampling 

stations due to species numbers being < 2. 

Temporal and spatial variations in the copepod 

community structure 

As for seasonal differences, the highest 

record of average copepod abundances 

(379.06 ind./m 3 ) was in Aug. 2004, and the 2nd 

highest record was 84.65 ind./m 3 in Feb. 2005. 

The remaining sampling months showed values 

of < 25 ind./m 3 (Fig. 4A). The highest species 

number (13) was also recorded in Aug. 2004 

(Fig. 4B), whereas the lowest record of 1 was in 

Feb. 2005. Most sampling months presented 


1600 

1500 

400 

300 

200 

100 

0 

(A) 

Number of species (no. month -1 ) 

14 

12 

10 

8 

6 

4 

2 

0 

(B) 

1.2 

(C) 

2.0 

(D) 

1.0 

1.6 

Diversity index Richness index 

0.8 

0.6 

0.4 

0.2 

0.0 

0.8 

0.6 

0.4 

(E) 


1.2 

0.8 

0.4 

0.0 


2004 2005 


0.2 

0.0 


2004 2005 


Fig. 4. Average copepod abundance (A), total copepod species number (B), indices of richness (C), evenness (D) and Shannon- 

Wiener diversity (E) in each sampling month.


communities with < 4 species. Indices of richness 

(Fig. 4C), evenness (Fig. 4D), and diversity (Fig. 

4E) showed some temporal variability without a 

clear trend. There were no significant differences 

in abundance, species number, or indices of 

richness, evenness, and diversity of copepods 

among sampling months (Fig. 4, p > 0.05, one-way 

ANOVA). 

When stations were compared, the highest 

mean abundance (462.40 ind./m 3 , Fig. 5A) was 

found at the estuarine station. Accumulated 

records of copepod species provided the highest 

species numbers (26 species/station, Fig. 5B) at 

the estuarine station. The 7 upstream stations 

(GS Bridge, SGF River, JK Bridge, GY Bridge, 

ND Bridge, SL River, and TK River) showed 

lower values of abundance, species number, and 

richness, evenness, and diversity indices than the 

downstream stations (LY Bridge and estuarine 

stations) throughout the year (Fig. 5A-E). 

Diversity index Richness index 


1600 

1500 

500 

400 

300 

200 

100 

0 

1.6 

1.4 

1.2 

1.0 

0.8 

0.6 

0.4 

0.2 

0.0 

1.4 

1.2 

1.0 

0.8 

0.6 

0.4 

0.2 

0.0 

(A) 

(C) 

(E) 

GS Bridge 

SGF River 

JK Bridge 

GY Bridge 


ND Bridge 

SL River 

TK River 

LY Bridge 

Estuary 

Fig. 5. Average copepod abundance (A), total copepod species number (B), indices of richness (C), evenness (D) and Shannon- 

Wiener diversity (E) at each sampling station. 

Number of species (no. station -1 ) 


30 

25 

20 

15 

10 

5 

0 

1.0 

0.8 

0.6 

0.4 

0.2 

0.0 

(B) 

(D) 

GS Bridge 

SGF River 

JK Bridge 

GY Bridge 

ND Bridge 

SL River 

TK River 

LY Bridge 

Estuary 

Sampling month


Copepod community structure 

A cluster analysis using Bray-Curtis similarities 

of taxonomic abundances provided 

3 groups of stations: IB (SL River), IIB (TK 

River), IIIA (estuarine station and LY Bridge), 

and IIIB (SGF River and GS Bridge) (Fig. 6). 

Accumulations of major 75% copepods in each 

group according to Bray-Curtis similarity cluster 

results are given in table 3. The grouping results 

allocated downstream and upstream stations 

to different groups. The TK River and SL River 

stations were separated in single groups due to 

the appearance of rare species and low copepod 

abundances. In the upstream area of the Lanyang 

River, Apocyclops borneoensis and Microcyclops 

sp. were major species at the SGF River and GS 

Bridge stations. The dominant species at the SL 

River and TK River stations were Eucyclops sp. 

and Mesocyclops peheiensis, respectively. The 

III A 

Estuary 

II A 

LY Bridge 

III B 

SGF River 

I A 

GS Bridge 

II B 

TK River 

I B 

SL River 

0 20 40 60 80 100 

Bray-Curtis similarity 

Fig. 6. Cluster analysis of Bray-Curtis similarities. Stations 

fell into 3 groups: IB (SL River), IIB (TK River), IIIA (estuarine 

station and LY Bridge), and IIIB (SGF River and GS Bridge). 

cluster results indicated that copepod communities 

were affected by intruding seawater at the 

estuarine and LY Bridge stations (Table 3). Thus, 

copepod communities clearly differed in the upper, 

middle, and downstream areas. 

Estuarine station: relationships of copepod 

abundance and species number with environmental 

factors 

We found 2 peculiarities of copepod assemblages 

in the Lanyang River. First, there was a 

low abundance and low diversity in the freshwater 

zone. Second, seawater intrusions transported 

oceanic copepods to the estuarine area which 

raised the abundance and diversity of the copepod 

communities. Only the estuary station was 

significantly affected by seawater. Based on 

these results, we focused on data of the estuarine 

station to reveal the effects of intruding seawater 

(Fig. 7). The highest abundance (3410.05 ind./m 3 ) 

and species number (12 species/station) (Fig. 7A) 

corresponded to the highest measured salinity 

(37.0 psu) in the estuary (Fig. 7C). Pearson’s 

product moment correlation analysis confirmed 

the positive correlation of copepod abundances 

with salinity (r = 0.880, p = 0.001) (Table 4). 

The species number was significantly positive 

correlated with Chl a (r = 0.790, p = 0.007), salinity 

(r = 0.780, p = 0.008), and copepod abundance 

(r = 0.785, p = 0.007). These results indicated 

that copepod assemblages at the estuarine station 

were strongly affected by intruding seawater which 

changed the hydrography and biota. 

Table 3. Accumulated of major 75% copepods in each group according to the Bray-Curtis similarity cluster 

results 

Copepod species 

Group 

IB IIB IIIA IIIB 

Acartia erythraea 6.70 

Apocyclops borneoensis 47.30 

Eucyclops sp. 100.00 

Euterpina acutifrons 10.53 

Mesocyclops peheiensis 98.99 

Microcyclops sp. 41.21 

Pavocalanus crassirostris 17.22 

Pseudodiaptomus serricaudatus 13.29 

Thermocyclops kawamurai 27.73 

Cumulative contribution (%) 100.00 98.99 75.47 88.50


DISCUSSION 

Progress in understanding environmental 

conditions that control the distribution and 

abundance of riverine zooplankton and their 

ecological significance has lagged far behind 

that of lentic environments (Casper and Thorp 

2007). Hydrologically dynamic rivers commonly 

show diverse rotifer assemblages, whereas 

microcrustaceans are almost always absent 

(Richardson 1992, Sluss et al. 2008). This is 

in contrast to lakes where copepods and large 

cladocerans most frequently dominate the system, 

with relative abundances often influenced by 

biotic (e.g., chaoborid dipteran and fish predation) 

and abiotic factors (e.g., inorganic turbidity) 

abundance 

species no. 

Salinity (PSU) 


4000 

3000 

2000 

1000 

0 

40 

30 

20 

10 

(A) 

(C) 

12 

9 

6 

3 

0 

Number of species 

Chlorophyll a (μg/L) Temperature (°C) 

30 

27 

24 

21 

18 

15 

7 

6 

5 

4 

3 

2 

1 

(B) 

(D) 

0 


0 


2004 2005 


2004 2005 


Fig. 7. Variations in copepod abundances and number of species (A), temperature (B), salinity (C), and chlorophyll a (D) of the estuary 

station in each sampling month. 

Table 4. Correlation between water temperature, chlorophyll a, salinity, copepod abundance and species 

number at the estuary station during June 2004 to Dec. 2005 

Pearson correlation 

Temperature Chlorophyll a Salinity Abundance 

Chlorophyll a 0.429 

Salinity 0.346 0.531 

Abundance 0.390 0.596 0.880 ** 

Species number 0.575 0.790 ** 0.780 ** 0.785 ** 

** Correlation is significant at the 0.01 level (2-tailed).


(Wetzel 2001). Slack waters are suggested to 

be critical for sustaining a high biomass and 

diversity of zooplankton (Thorp and Casper 

2003). Where those are lacking, and the river 

channel is steep and presents a high current 

velocity, the zooplankton is affected by turbulence 

and commonly shows low biomass (Sluss et al. 

2008). This may also hold for the Lanyang River, 

particularly the 3 stations (JK Bridge, GY Bridge, 

and ND Bridge) in the midstream section where we 

found no copepods in any sampling period. 

A study by Hsu et al. (2004) further explored 

the positive relationship between observed 

sediment fluxes and runoff in the Lanyang River 

which may also have ultimately affected the 

zooplankton communities and caused the lack of 

copepods at these stations. According to those 

authors, the annual sediment discharge and 

sediment yield of the Lanyang River are 8.0 Mt 

and 8154 Mt/km 2 , respectively. The annual runoff 

is 2773 × 10 6 m 3 , and transient runoff always 

rises sharply from the baseline level of several 

tens of m 3 /s (with a mean rate of 62 m 3 /s) to 

an abnormal level of thousands of m 3 /s after a 

heavy rainfall (with an average annual rainfall of 

3256 mm). Since 1949, the maximal records of 

daily runoff and suspended sediment concentration 

are 4580 m 3 /s and 118 g/L, respectively (Water 

Resources Bureau 1997a b). Sediment discharges 

depend on river runoff, and a function relating the 

2 parameters was established (Kao 1996). 

According to Sluss et al. (2008), it is uncertain 

which abiotic factors control both the relative 

abundance of major groups and the relative size 

of the zooplankton community of rivers. Biological 

factors were addressed relatively rarely, but field 

surveys and in situ experiments suggest that 

competition and predation play roles in regulating 

river plankton at least in slack waters (Casper and 

Thorp 2007). 

Our study demonstrated that marine zooplankton 

substantially contributed to the 

estuarine section of the Lanyang ecosystem. 

Here, the highest abundance (3410.05 ind./m 3 ) 

and species number (12 species/station) corresponded 

with the highest salinity (37.0 psu), 

demonstrating the marine role in shaping and 

maintaining the estuarine planktonic community. 

As mentioned, the zooplankton abundance 

of the Lanyang River estuarine station was 

significantly affected by seawater intrusions, and 

the number of zooplankton groups was affected 

by water temperature (as affected by the seasonal 

monsoon; see Hsieh et al. 2011). Hence, the 

marine compartment may determine the dynamics 

of the zooplankton communities in the estuary of 

the Lanyang River (Tan et al. 2004). The estuary 

of the Lanyang River is next to nearshore waters 

off the northeastern coast of Taiwan. Hwang et 

al. (1998) found that copepods represented the 

dominant zooplankton group along the northern 

coast of Taiwan. 

River flow and tidal motions respectively 

drive the riverine and marine communities towards 

estuaries (Hsieh and Chiu 1997, Waniek et al. 

2005, Zhang et al. 2010) and hence shape the 

diversity and density of estuarine communities 

(Waniek 2003, Froneman 2004). However, there 

is the possibility that resident dormant stages 

contribute to estuarine populations as well, once 

they emerge from their sedimentary depositions 

(Dahms and Qian 2004, Dahms et al. 2006). The 

biology and mesozooplankton including copepod 

assemblages of the East China Sea and Kuroshio 

Current are little known (Hsiao et al. 2004 2011), 

even though there was an interdisciplinary 

study of the Kuroshio Current (Marr 1970) and 

several oceanographic research programs, such 

as KEEP (Kuroshio-East China Sea Exchange 

Process) in the last decade by several research 

institutions and universities in Taiwan (Liu 1997, 

Hwang et al. 2006). In conclusion, copepod upstream 

assemblages were characterized by low 

abundances and low species diversities, whereas 

the estuarine station showed a high abundance 

and a high number of species which were correlated 

with intruding seawater. 

Acknowledgments: Assistance by laboratory 

members of J.S. Hwang at various stages of 

sample collection and manuscript preparation is 

gratefully acknowledged. We are thankful to the 

captain and crew of local ships in the Lanyang 

River estuary. We acknowledge the initiative of 

Drs. K.T. Shao and H.J. Lin to help in getting the 

present research underway. 

REFERENCES 

Bienfang PK, DA Ziemann. 1992. The role of coastal high 

latitude ecosystems in global export production. In PG 

Falkowski, AD Woodhead, eds. Primary productivity and 

biogeochemical cycles in the sea. New York: Plenum, pp. 

285-297. 

Bonnet D, C Frid. 2004. Seven copepod species considered 

as indicators of water mass influence and changes: 

results from a Northumberland coastal station. S. Afr. J. 

Mar. Sci. 61: 485-491.


Box GEP, DR Cox. 1964. An analysis of transformations. J. 

Roy. Stat. Soc. Ser. B 26: 211-246. 

Carlsson P, E Graneli, P Tester, L Boni. 1995. Influences 

of riverine humic substances on bacteria, protozoa, 

phytoplankton, and copepods in a coastal plankton 

community. Mar. Ecol. Prog. Ser. 127: 213-221. 

Carry AE, CA Nezat, WB Lyons, SJ Kao, DM Hicks, JS Owen. 

2002. Trace metal fluxes to the ocean: the importance of 

high-standing oceanic islands. Geophys. Res. Lett. 29: 

2099. 

Casper AF, JH Thorp. 2007. Diel and lateral patterns of 

zooplankton distribution in the St. Lawrence River. River 

Res. Appl. 23: 73-85. 

Cearreta A, MJ Irabien, E Leorri, I Yusta, IW Croudace, 

AB Cundy. 2000. Recent anthropogenic impacts on 

the Bilbao Estuary, northern Spain: geochemical and 

microfaunal evidence. Estuar. Coast. Shelf Sci. 50: 571- 

592. 

Chang WB, LC Tseng, HU Dahms. 2010. Abundance, 

distribution and community structure of planktonic 

copepods in surface waters of a semi-enclosed 

embayment of Taiwan during monsoon transition. Zool. 

Stud. 49: 735-748. 

Chen QC. 1992. Zooplankton of China seas. Beijing: Science 

Press, pp. 1-87. 

Chen QC, SZ Zhang. 1965. The planktonic copepods of the 

Yellow Sea and the East China Sea. I. Calanoida. Stud. 

Mar. Sin. 7: 20-131, 53 plates. (in Chinese, with English 

summary) 

Chen QC, SZ Zhang, CS Zhu. 1974. On planktonic copepods 

of the Yellow Sea and the East China Sea. II. Cyclopoida 

and Harpacticoida. Stud. Mar. Sin. 9: 27-76, 24 plates. (in 

Chinese, with English summary) 

Chihara M, M Murano. 1997. An illustrated guide to marine 

plankton in Japan. Tokyo: Tokyo Univ. Press, 1574 pp. 

Chullasorn S, HU Dahms, KW Lee, JS Ki, N Schizas, P Kangtia 

et al. 2011. Upscaled description for Tisbe alaskensis 

sp. nov. (Crustacea, Copepoda) combining structural and 

molecular traits. Zool. Stud. 50: 103-117. 

Chullasorn S, WX Yang, HU Dahms, P Kangtia, M Holinska, 

W Anansatitporn et al. 2009. Naupliar development of 

Eucyclops cf. serrulatus tropicalis, Euc. cf. spatulatus, and 

Ectocyclops medius Kiefer, 1930 (Copepoda: Cyclopidae). 

Zool. Stud. 48: 12-32. 

Clarke KR, RM Warwick. 1994. Change in Marine Communities: 

An Approach to Statistical Analysis and 

Interpretation. Primer User Manual. (Plymouth Routines 

in Multivariate Ecological Research). Plymouth Marine 

Laboratory, Bournemouth, UK. Bourne Press Limited. 

Dahms HU, X Li, G Zhang, PY Qian. 2006. Resting stages of 

Tortanus forcipatus (Crustacea, Calanoida) in sediments 

of Victoria Harbor, Hong Kong. Estuar. Coast. Shelf Sci. 

67: 562-568. 

Dahms HU, PY Qian. 2004. Drift pump and drift net. J. Exp. 

Mar. Biol. Ecol. 301: 29-37. 

Dussart BH, D Defaye. 2006. World directory of Crustacea 

Copepoda of inland waters. II. Cyclopiformes. Leiden, 

the Netherlands: Backhuys Publishers, 354 pp. 

Einsle E. 1996. Copepoda: Cyclopoida. Genera Cyclops, 

Megacyclops, Acanthocyclops. In HJF Dumont, ed. 

Guides to the identification of the microinvertebrates of 

the continental waters of the world. Vol. 10. Leiden, the 

Netherlands: Backhuys Publishers, 82 pp. 

Froneman PW. 2004. Zooplankton community structure and 

biomass in a South African temporarily open/closed 

estuary. Estuar. Coast. Shelf Sci. 60: 125-132. 

Ho CS. 1975. An introduction to the geology of Taiwan. Taipei, 

Taiwan: Ministry of Economic Affairs, 153 pp. 

Hsiao SH, TH Fang, C Shih, JS Hwang. 2011. Effects of the 

Kuroshio Current on copepod assemblages in Taiwan. 

Zool. Stud. 50: 475-490. 

Hsiao SH, CY Lee, CT Shih, JS Hwang. 2004. Calanoid 

copepods of the Kuroshio Current east of Taiwan, with 

notes on the presence of Calanus jashnovi Hulseman, 

1994. Zool. Stud. 43: 323-331. 

Hsieh CH, TS Chiu. 1997. Copepod abundance and species 

composition of Tanshui River estuary and adjacent waters. 

Acta Zool. Taiwan. 8: 75-83. 

Hsieh HY, WT Lo, LJ Wu, DC Liu, WC Su. 2011. Comparison 

of distribution patterns of larval fish assemblages in the 

Taiwan Strait between the northeasterly and southwesterly 

monsoons. Zool. Stud. 50: 491-505. 

Hsu SC, FJ Lin, WL Jeng, YC Chung, LM Shaw, KW Hung. 

2004. Observed sediment fluxes in the southwesternmost 

Okinawa Trough enhanced by episodic events: flood 

runoff from Taiwan rivers and large earthquakes. Deep- 

Sea Res. I 51: 979-997. 

Hsu SC, FJ Lin, WL Jeng, TY Tang. 1998. The effect of a 

cyclonic eddy on the distribution of lithogenic particles in 

the southern East China Sea. J. Mar. Res. 56: 813-832. 

Hwang JS, QC Chen, CK Wong. 1998. Taxonomic composition 

and grazing rate of calanoid copepods in coastal waters 

of northern Taiwan. Crustaceana 71: 378-389. 

Hwang JS, QC Chen, CK Wong. 2003. Taxonomic composition, 

density and biomass of free-living copepods in 

the coastal waters of southwestern Taiwan. Crustaceana 

76: 193-206. 

Hwang JS, HU Dahms, LC Tseng, QC Chen. 2007. Intrusions 

of the Kuroshio Current in the northern South China Sea 

affect copepod assemblages of the Luzon Strait. J. Exp. 

Mar. Biol. Ecol. 352: 12-27. 

Hwang JS, R Kumar, HU Dahms, LC Tseng, QC Chen. 2010. 

Interannual, seasonal, and diurnal variation in vertical 

and horizontal distribution patterns of 6 Oithona spp. 

(Copepoda: Cyclopoida) in the South China Sea. Zool. 

Stud. 49: 220-229. 

Hwang JS, R Kumar, CW Hsieh, AY Kuo, S Souissi, MH Hsu et 

al. 2010. Patterns of zooplankton distribution along the 

marine, estuarine and riverine portions of the Danshuei 

ecosystem in northern Taiwan. Zool. Stud. 49: 335-352. 

Hwang JS, R Kumar, CS Kuo. 2009a. Impact of predation 

by the copepod, Mesocyclops pehpeiensis on life table 

demography and population dynamics of four cladoceran 

species: a comparative laboratory study. Zool. Stud. 48: 

738-752. 

Hwang JS, S Souissi, HU Dahms, LC Tseng, FG Schmitt, 

QC Chen. 2009b. Rank-abundance allocations as a 

tool to analyze planktonic copepod assemblages off the 

Danshuei River estuary (northern Taiwan). Zool. Stud. 

48: 49-62. 

Hwang JS, S Souissi, LC Tseng, L Seuront, FG Schmitt, LS 

Fang et al. 2006. A 5-year study of the influence of 

the northeast and southwest monsoons on copepod 

assemblages in the boundary coastal waters between the 

East China Sea and the Taiwan Strait. J. Plankt. Res. 28: 

943-958. 

Hwang JS, YY Tu, LC Tseng, LS Fang, S Souissi, TH Fang 

et al. 2004. Taxonomic composition and seasonal


distribution of copepod assemblages from waters adjacent 

to nuclear power plant I and II in northern Taiwan. J. Mar. 

Sci. Technol. 12: 380-391. 

Hwang JS, CH Wang, TY Chan, eds. 2000. Proceedings of 

the International Symposium on Marine Biology in Taiwan- 

Crustacean and Zooplankton Taxonomy, Ecology and 

Living Resources. Natl. Taiwan Mus. Spec. Publ. Ser. 10: 

1-200. 

Hwang JS, CK Wong. 2005. The China Coastal Current as a 

driving force for transporting Calanus sinicus (Copepoda: 

Calanoida) from its population centers to waters off 

Taiwan and Hong Kong during the winter NE monsoon 

period. J. Plankt. Res. 27: 205-210. 

Jan S, J Wang, CS Chern, SY Chao. 2002. Seasonal variation 

of the circulation in the Taiwan Strait. J. Mar. Syst. 35: 

249-268. 

Jerling HL, TH Wooldridge. 1995. Plankton distribution and 

abundance in the Sundays River estuary, South Africa, 

with comments on potential feeding interactions. S. Afr. J. 

Mar. Sci. 15: 169-184. 

Kâ S, JS Hwang. 2011. Mesozooplankton distribution and 

composition on the northeastern coast of Taiwan during 

autumn: effects of the Kuroshio Current and hydrothermal 

vents. Zool. Stud. 50: 155-163. 

Kao SJ. 1996. Total organic carbon freight of a subtropical 

mountainous river (Lanyang-Hsi) in Taiwan. Acad. Bull. 

Chin. Naval Acad. 6: 19-70. 

Kao SJ, KK Liu. 1996. Particulate organic carbon export from 

a subtropical mountainous river (Lanyang-Hsi) in Taiwan. 

Limnol. Oceanogr. 41: 1749-1757. 

Kao SJ, KK Liu. 1997. Fluxes of DOC and fossil POC 

from an Oceania small river (Lanyang-Hsi) in Taiwan. 

Biogeochemistry 39: 255-269. 

Kao SJ, KK Liu. 2002. Exacerbation of erosion induced by 

human perturbation in a typical Oceania watershed: 

insight from 45 years of hydrological records from 

the Lanyang-Hsi River, northeastern Taiwan. Global 

Biogeochem. Cycles 1: 1-7. 

Lee HJ, SY Chao. 2003. A climatological description of 

circulation in and around the East China Sea. Deep-Sea 

Res. II 50: 1065-1084. 

Liang WD, TY Tang, YJ Yang, MT Ko, WS Chuang. 2003. 

Upper-ocean currents around Taiwan. Deep-Sea Res. II 

50: 1085-1106. 

Liu KK, ed. 1997. Kuroshio edge exchange processes 

collected papers. Vol. 4. Taipei, Taiwan: Joint Global 

Ocean Flux Study (China-Taipei) Committee. 

Liu KK, TH Peng, PT Shaw, FK Shiah. 2003. Circulation and 

biogeochemical processes in the East China Sea and 

the vicinity of Taiwan: an overview and a brief synthesis. 

Deep-Sea Res. II 50: 1055-1064. 

Marr J, ed. 1970. Symposium on the Cooperative Study of 

the Kuroshio and Adjacent Regions (1968: East-West 

Center). Honolulu, HI: East-West Center Press. 

Nittrouer CA, GJ Brunskill, AG Figueiredo. 1995. Importance 

of tropical coastal environments. Geo-Mar. Lett. 15: 121- 

126. 

Parsons TR, Y Maita, CM Lalli. 1984. A manual of chemical 

and biological methods for seawater analysis. Oxford, 

UK: Pergamon Press, 1-173. 

Pielou EC. 1966. The measurement of diversity in different 

types of biological collections. J. Theor. Biol. 13: 131-144. 

Richardson WB. 1992. Microcrustacea in flowing water: 

experimental analysis of washout times and a field test. 

Freshw. Biol. 28: 217-230. 

Schminke HK. 2007. Entomology for the copepodologist. J. 

Plankt. Res. 29: 149-162. 

Shiah FK, SJ Kao, KK Liu. 1996. Spatial variability of 

phytoplankton production and the implications of its 

controlling mechanisms in the coastal zone near the river 

mouth of Lanyang-Hsi. Bot. Bull. Acad. Sin. 37: 9-15. 

Shih CT, SS Young. 1995. A checklist of free-living copepods, 

including those associated with invertebrates, reported 

from the adjacent seas of Taiwan. Acta Zool. Taiwan 6: 

64-81. 

Sluss TD, GA Cobbs, JH Thorp. 2008. Impact of turbulence on 

riverine zooplankton: a mesocosm experiment. Freshw. 

Biol. 53: 1999-2010. 

Tan Y, L Huang, Q Chen, X Huang. 2004. Seasonal variation 

in zooplankton composition and grazing impact on 

phytoplankton standing stocks in the Pearl River Estuary, 

China. Cont. Shelf Res. 24: 1949-1968. 

Thor P, TG Nielson, P Tiselius, T Juul-Pederson, C Michel, 

EF Møller et al. 2005. Post-spring bloom community 

structure of pelagic copepods in the Disko Bay, western 

Greenland. J. Plankt. Res. 27: 341-356. 

Thorp JH, AR Black, KH Haag, JD Wehr. 1994. Zooplankton 

assemblages in the Ohio River: seasonal, tributary, and 

navigation dam effects. Can. J. Fish. Aquat. Sci. 51: 

1634-1643. 

Thorp JH, AF Casper. 2003. Importance of biotic interactions 

in large rivers: an experiment with planktivorous fish, 

dreissenid mussels and zooplankton in the St. Lawrence 

River. River Res. Appl. 19: 265-279. 

Thorp JH, S Mantovani. 2005. Zooplankton in turbid and 

hydrologically dynamic, prairie rivers. Freshw. Biol. 50: 

1474-1491. 

Tseng LC, HU Dahms, QC Chen, JS Hwang. 2009. Copepod 

feeding study in the upper layer of the tropical South 

China Sea. Helg. Mar. Res. 63: 327-337. 

Tseng LC, R Kumar, HU Dahms, QC Chen, JS Hwang. 2008a. 

Copepod gut contents, ingestion rates and feeding impact 

in relation to their size structure in the southeastern 

Taiwan Strait. Zool. Stud. 47: 402-416. 

Tseng LC, R Kumar, HU Dahms, CH Wu, QC Chen, JS Hwang. 

2008b. Monsoon-driven seasonal succession of copepod 

assemblages in the coastal waters of the northeastern 

Taiwan Strait. Zool. Stud. 47: 46-60. 

Vandromme P, FG Schmitt, S Souissi, EJ Buskey, JR Strickler, 

CH Wu et al. 2010. Symbolic analysis of plankton 

swimming trajectories: case study of Strobilidium sp. 

(Protista) helical walking under various food conditions. 

Zool. Stud. 49: 289-303. 

Waniek JJ. 2003. The role of physical forcing in the initiation of 

spring blooms in the Northeast Atlantic. J. Mar. Syst. 39: 

57-82. 

Waniek JJ, NP Holliday, R Davidson, L Brown, SA Henson. 

2005. Freshwater control of onset and species 

composition of Greenland shelf spring bloom. Mar. Ecol. 

Progr. Ser. 288: 45-57. 

Water Resources Bureau. 1997a. Hydrological year book of 

Taiwan, Republic of China, 1995. Taipei, Taiwan: Ministry 

of Economic Affairs, 399 pp. 

Water Resources Bureau. 1997b. Hydrological year book of 

Taiwan, Republic of China, 1995. Taipei, Taiwan: Ministry 

of Economic Affairs, 400 pp. 

Weaver W, CE Shannon. 1949. The mathematical theory of 

communication. Urbana, IL: Univ. of Illinois.


Wetzel RG. 2001. Limnology: lake and river ecosystems, 3rd 

ed. New York: Academic Press/Elsevier, 1006 pp. 

Wu CH, HU Dahms, EJ Buskey, JR Strickler, JS Hwang. 2010. 

Behavioral interactions of Temora turbinata with potential 

ciliate prey. Zool. Stud. 49: 157-168. 

Zhang G, S Sun, ZL Xu, QL Zhang. 2010. Unexpected 

dominance of the subtropical copepod Temora turbinata 

in the temperate Changjiang river estuary and its possible 

causes. Zool. Stud. 49: 492-503.


Changes in Oak Gall Wasps Species Diversity (Hymenoptera: 

Cynipidae) in Relation to the Presence of Oak Powdery Mildew (Erysiphe 

alphitoides) 

Mohammed Reza Zargaran 1, *, Nadir Erbilgin 2 , and Youbert Ghosta 1 

1 

Plant Protection Department- Sero Road- Agricultural Faculty, Urmia Univ., PO Box 165, Urmia, Iran 

2 

4-42 Earth Sciences Building, Department of Renewable Resources, Univ. of Alberta, Edmonton T6G 2E3, AB Canada 


Mohammed Reza Zargaran, Nadir Erbilgin, and Youbert Ghosta (2012) Changes in oak gall wasps species 

diversity (Hymenoptera: Cynipidae) in relation to the presence of oak powdery mildew (Erysiphe alphitoides). 

Zoological Studies 51(2): 175-184. Plant-mediated interactions usually lead to multipartite interactions in a 

community of organisms. To evaluate the impact of oak powdery mildew Erysiphe alphitoides infestation on 

the distributions of cynipid oak gall wasps (Hymenoptera: Cynipidae), a field survey was conducted in West 

Azerbaijan Province, Iran, in 2 consecutive years of 2009-2010. Multiple samples were taken from both infected 

and uninfected trees (Quercus spp.) at 4 different sites where maximum activity of E. alphitoides occurred and 

cynipid galls exhibited complete development. The species diversity and richness of gall-forming wasps were 

estimated and also parameters such as Simpson’s index, Shannon’s H’, and the Sorensen similarity quotient 

were calculated. Data were also analyzed by independent-samples t-test to compare the mean numbers of galls 

occurring on infected and uninfected trees. Results clearly indicated that the highest richness and diversity of 

oak gall-forming wasps were consistently found on uninfected trees at all study sites in the 2 consecutive years. 

Further, the number and diversity of gall-forming wasps were negatively correlated with the extent (percentage) 

of pathogen infection, and trees with the heaviest E. alphitoides infection had the lowest numbers of gall-forming 

wasps. In addition, E. alphitoides decreased the rate of Sorensen’s coefficient between regions where oak trees 

infected with E. alphitoides were sampled. This study demonstrates plant-mediated interactions between a 

native pathogen and a community of gall-forming insects on oak trees. 

http://zoolstud.sinica.edu.tw/Journals/51.2/175.pdf 

Key words: Cynipid gall wasps, Tree-mediated interactions, Species diversity, Abundance, Oak forest. 

Plant-mediated interactions were commonly 

reported in many studied systems (Karban and 

Baldwin 1997, Nakamura et al. 2003, Foss and 

Rieske 2004, Eyles et al. 2010, Staley et al. 2010). 

Such interactions usually lead to multipartite 

interactions in a community through indirect 

interactions as 1 organism may change a host’s 

suitability for others, and hosts become more or 

less suitable for subsequent attackers (Karban 

and Baldwin 1997). Most current knowledge of 

plant-mediated interactions was obtained through 

studies on herbaceous annuals or short-lived 

perennials, but much less is known about trees, 

either angiosperms or gymnosperms (Eyles et al. 

2010). 

In recent years, plant-mediated interactions 

in forest ecosystems were documented (see 

review by Eyles et al. 2010, Colgan and Erbilgin 

2011), although the implications of those studies 

are limited, in part, due to associations of a large 

diversity of insects and pathogens with different 

growth stages of trees (Eyles et al. 2010). 

*To whom correspondence and reprint requests should be addressed. E-mail:Zargaran391@yahoo.com 

175

176 

Zargaran et al. – Powdery Mildew Reduced Diversity of Cynipid Gall Wasps 

Further, it is difficult to compare different systems 

because their relationships usually depend on the 

interacting organisms, the intensity of damage, 

and the time since induction (Herms and Mattson 

1992, Eyles et al. 2007, Colgan and Erbilgin 2011). 

Nevertheless, those studies clearly demonstrated 

indirect interactions between species based on 

the initial damage they caused to trees. In some 

cases, 1 organism lowered the host suitability 

to a subsequent organism (Kosaka et al. 2001, 

Eyles et al. 2007), whereas other researchers 

found increased host susceptibility to subsequent 

attackers (Raffa et al. 1998, Wallin and Raffa 

2001). For example, defoliation by the pine looper 

(Bupalus piniaria L.) resulted in a strong decline 

in the resistance of Scots pine to the blue-stain 

fungus Leptographium wingfieldii (Långström et 

al. 2001). Trees in the lowest-defoliation classes 

were less susceptible to L. wingfieldii than those in 

higher-defoliation classes. 

An overwhelming majority of such studies 

focused on interactions between a few organisms 

at the same or different trophic levels, and roles of 

plant-mediated interactions among a community 

of organisms have seldom been documented, 

although in nature, trees serve as foci for communities 

of insects and diseases. This study 

provides an example of plant-mediated interactions 

in naturally occurring groups of organisms in 

natural oak (Quercus spp.) forests. 

We focused on interspecific interactions 

between a native tree disease, oak powdery 

mildew (Erysiphe alphitoides), and a community 

of native oak gall-forming wasps (Hymenoptera: 

Cynipidae). We were particularly interested in 

whether prior infection of oaks by E. alphitoides 

influenced the spatial abundance and richness of 

oak gall-forming wasps on these oaks. 

Large populations of many western Palearctic 

species, including oaks, are commonly found in 

Eastern Europe, Turkey, the Caucasus, and Iran 

(Hewitt 1999). In the northern, southern and 

western Iran, Q. pubescens Willd, Q. cerris L., Q. 

infectoria Olivier, and Q. macranthera Fisch are 

predominant; while junipers and oak forests such 

as Q. infectoria, Q. brantii, and Q. pubescens are 

predominant in the eastern region (Zargaran et al. 

2008). 

Oaks are reported to be primary hosts for 

a larger number of plant pathogens and insect 

herbivores (Stone et al. 2002). Among pathogens, 

powdery mildew fungi infestations, including 

species of Erysiphales are very common (Braun 

1995). Detailed on world-wide distributions of 

powdery mildew species were reported by Farr 

and Rossman (2010). Erysiphe alphitoides is a 

common fungal disease that appears on many oak 

species (Griffon and Maublanc 1912, Mougou- 

Hamdane et al. 2010). 

Oaks are also commonly attacked by gallforming 

insects (Ronquist and Liljeblad 2001). 

Cynipid wasps (Hymenoptera) are the 2nd most 

diverse family after cecidomyiid midges, and the 

majority of cynipid wasps are obligate parasites on 

oaks (Stone et al. 2002). There are about 1300 

species of cynipid oak gall-forming wasps globally, 

with the majority occurring in the Nearctic (Cornell 

1983, Ronquist and Liljeblad 2001, Stone et al. 

2002). 

Several studies documented the abundance 

and richness of gall wasps with respect to the 

richness and abundance of host plants (Chodjai 

1980, Starzomski et al. 2008, Zargaran et al. 

2008), plant quality (Genimar-Reboucas et al. 

2003, Egan and Ott 2007), other herbivorous 

insects and natural enemies (Veldtman and 

Mcgeoch 2003, Cuevas-Reyes et al. 2004, Prior 

and Hellmann 2010), and abiotic factors, such 

as water stress (Stone et al. 2002). Few studies 

focused on community-level interactions in gallforming 

insects. For example, Nakamura et al. 

(2003) demonstrated that gall-formers had a 

positive plant-mediated effect on other insect 

herbivores and reported that the stem gall 

midge Rabdophaga rigidae, and adults of 2 leaf 

beetles, Plagiodera versicolora and Smaragdina 

semiaurantiaca, on Salix eriocarpa were more 

abundant on lateral shoots and leaves of galled 

shoots than on ungalled shoots, respectively. 

However, roles of other organisms, particularly 

diseases, on cynipids are largely unstudied (Foss 

and Rieske 2004). Further, how gall-forming 

species are locally distributed and what biological 

factors affect their local distributions (Veldtman and 

McGeoch 2003) are largely unknown, given that 

the suitability of oviposition sites has the potential 

to generate indirect interspecific competition 

between gall-forming insects and other species 

(Stone et al. 2002). 

In this study, we attempted to determine 

whether prior E. alphitoides infestation of oak trees 

affected the community of oak gall-forming wasps. 

Specifically, we addressed whether gall-forming 

wasp abundance and diversity were affected by E. 

alphitoides infestations.


177 

Study sites 


Sampling was performed in West Azerbaijan 

Province, Iran in 2009-2010 (Table 1). 

Studied species 

Chodjai (1980) reported 36 oak gall wasp 

species associated with the oak Q. infectoria 

from Iran. Recent surveys were conducted on 

the cynipid fauna of Iran (Tavakoli et al. 2008, 

Zargaran et al. 2008) and according to the latest 

results, so far 82 species of oak gall wasps 

were recorded in oak forests of Iran, of which 25 

species were reported for the 1st time (Sadeghi 

et al. 2010). Those surveys confirmed that the 

cynipid fauna of Iran includes widespread western 

Palaearctic species such as Andricus kollari 

(Hartig) and Cynips quercusfolii (Hartig) (Chodjai 

1980, Zargaran et al. 2008). Oak powdery mildew 

Erysiphe alphitoiides L. was reported on Q. 

infectoria Oliv. for the 1st time in Iran (Tavanaei 

2006). 

Sampling methods 

At each site, oak cynipid galls were 

collected from Q. infectoria in late Sept. when the 

maximum activity of E. alphitoides occurred and 

the development of cynipid galls was completed. 

The optimal number of trees (sample unit) per 

site was determined according to Southwood 

and Henderson’s (2000) formula of N = [(t × s) / 

(D × m)] 2 , where t is Student’s t-test from standard 

statistical tables, D is the predetermined 

confidence limit for estimation of the mean as 

a decimal, m is the sampling mean and s is the 

standard deviation. Based on this analysis, the 

optimal number of trees was determined to be 20 

per site. Twenty trees infected with E. alphitoides 

and 20 trees without infection were surveyed at 

each site and in each of 2 consecutive years. All 

cynipid galls were counted on 4 randomly selected 

branches per tree. Galls found on plant surfaces 

(branches and leaves) were identified based on 

their morphology. 

Statistical analysis 

The Shannon-Weiner diversity index uses the 

following formula: 

Shannon’s H’ = -Σ No 

i = 1 

[pi*log pi] 

where pi is the proportion of the total number of 

individuals belonging to a morphotype, and No 

is the total number of morphotypes seen in that 

sample. Simpson’s diversity index is calculated 

using the following formula: 

Simpson’s D = 1 - 

Σ N 

i = 1 

ni(ni - 1) 

N(N - 1) 

where ni is the number of individuals of a particular 

morphotype and N is the total number seen in the 

sample (Magurran 2004). 

Diversity indices like the Shannon’s entropy 

(“Shannon-Wiener index”) and the Gini-Simpson 

index are not in themselves diversities. The 

number of equally-common species required to 

impact a particular value to an index is called the 

“effective number of species”. This is the true 

diversity of the community. Converting indices 

to true diversities gives them a set of common 

behaviors and properties. After conversion, 

diversity is always measured in units of the number 

Table 1. Characteristics at 4 study sites selected to investigate the effect of powdery mildew infestation on 

oak gall wasp species diversity and richness on oaks in West Azerbaijan Province, Iran in 2009-2010 

Characteristic Ghabre-hossein Mirabad Rabat Dare-ghabr 

Quercus species Q. infectori Q. infectoria Q. infectoria Q. infectori 

Q. brantii Q. brantii Q. brantii Q. brantii 

Q. libani Q. libani 

Latitude 36°28'N 36°15'N 36°14'N 36°11'N 

Longitude 45°18'W 45°22'W 45°33'W 45°24'W 

Weather Very humid and cold Very humid and cold Humid, mildly cold Humid, mildly cold 

Site

178 


of species (Jost 2006). Conversion of common 

indices to true diversities can be achieved as 

described in table 2. 

Evenness, the other information-statistical 

index, is affected by both the number of species 

and their equitability or evenness compared to a 

community’s actual diversity, and the value of E 

is constrained to 0-1.0. Shannon’s evenness is 

calculated by the formula: H’/ Hmax. 

Beta diversity is generally thought of as the 

change in diversity among various alpha diversities 

(variation in species composition among sites in a 

geographic region) (Koleff et al. 2003, Magurran 

2004). The classical Sorensen index is based on 

both the number of species present in the total 

sample and numbers only seen in each individual 

sample (Koleff et al. 2003). Sorenson’s measure 

is regarded as one of the most effective presence/ 

absence similarity measures. The Sorensen 

similarity index is calculated by Cs = 2a/(2a + b + c), 

where a is the number of species common to both 

sites, b is the number of species at site B but not at 

A, and c is the number of species at site A but not 

in B (Magurran 2004). It is used when research 

is conducted on more than 1 site and begins with 

a table or matrix giving the similarity between 

each pair of sites (using any similarity coefficient). 

The 2 most similar sites are combined to form 

a single cluster. The analysis then proceeds by 

successively combining similar sites until all are 

combined into a single cluster (a dendrogram). 

Cluster analysis measured using the hierarchical 

cluster and cluster method are based on Ward’s 

method. Sorensen’s similarity index value was 

used in a cluster analysis to illustrate similarity 

patterns at the 4 sites. Also, data were analyzed 

with an independent-samples t-test to compare 

mean numbers of galls occurring on infected and 

uninfected trees. The surface of the infected 

leaves was measured by a leaf area meter and 

Pearson’s correlation coefficient was used to test 

the relationship between percent leaf infection and 

number of leaf galls. 

RESULTS 

At 4 sites, 25 species of oak gall wasps 

(asexual generation) were collected and identified 

as the following species groups: Andricus (20 

species), Cynips (3 species), and Neuroterus (2 

species) (Table 3). Overall, stem gall wasps were 

more abundant (20) than leaf gall wasps (5). All 

stem gall wasps belonged to a single genus, 

Andricus. Leaf-causing gall wasps were members 

of Cynips and Neuroterus. The Andricus species 

group had the highest abundance among species 

groups collected from oaks. 

Distributions of oak gall wasps among sites 

differed (Table 3). Ghabre-hossein had the highest 

number of species among sites, with 21 species 

in 2009 and 17 species in 2010. Mirabad had the 

lowest species abundance, with 6 in 2009 and 

5 in 2010. Naturally some species overlapped 

between sites. There was a slight decline in 

species abundances from 2009 to 2010. 

The highest and lowest number of Andricus 

species were observed at Ghabre-hossein (16) 

and Mirabad (4), respectively, in 2009 (Table 3), 

whereas in 2010, the highest number of Andricus 

species was found at Dare-ghabr (13) and the 

lowest number was collected at Mirabad (3) (Table 

3). All species belonging to the genera Cynips and 

Neuroterus were only found at Ghabre-hossein. 

Table 3 also shows the distributions of 

species between infected and uninfected oak 

trees at 4 sites. Two Cynips species (C. quercus 

and C. quercusfolii) and 2 Neuroteus species 

(N. numismalis and N. quercus-baccarum) were 

commonly found on uninfected trees, occasionally 

found on slightly infected trees, and virtually 

absent from highly infected trees. Other species, 

exclusively stem galls, were found on both infe-cted 

and uninfected trees; however, they were more 

commonly found on infected trees. It was interesting 

to note that between C. quercus and C. 

quercusfolii, the latter was overall more abundant. 

Likewise between N. numismalis and N. quercus- 

Table 2. Conversion of common indices to true diversities 

Index x Diversity in terms of x Diversity in terms of pi 

Shannon entropy x ≡ -Σ N 

pi ln pi exp (x) exp (-Σ N 

pi ln pi ) 

i = 1 

i = 1 

S 

Gini-Simpson index x ≡ 1- Σ 

pi 2 S 

1/(1-x) 1/ Σ 

i = 1 

i = 1 

pi 2


179 

baccarum, the later was more abundant. Several 

stem gall wasps and 1 leaf gall wasp, C. cornifex, 

were found equally on infected and uninfected 

trees. None of the leaf gall wasps were found 

together on the same leaf in the current study. 

Overall, oak trees with oak powdery mildew 

infection had reduced richness and diversity of 

oak gall wasps (Table 4). The highest species 

richness was found on uninfected trees in all study 

sites in the 2 consecutive years. Gini-Simpson 

indices were 1.75 in 2009 and 1.71 in 2010 for 

infected and 2.33 in 2009 and 2.13 in 2010 for 

uninfected trees. Gini-Simpson indices were lower 

in 2010 compared to values in 2009. Among 

sites, uninfected trees at Ghabre-hossein had 

the highest Gini-Simpson indices in both years, 

followed by Dare-ghabr and Rabat. Mirabad 

had the lowest Gini-Simpson indices. Likewise, 

Shannon’s H index indicated that uninfected trees 

had the highest oak gall wasp diversity compared 

to infected trees at all sites (Table 4). Differences 

among sites were similar to the Gini-Simpson 

index, with Ghabre-hossein having the highest 

Shannon’s indices, followed by Dare-ghabr and 

Table 3. Gall wasps species associated with infected and uninfected oak trees in 2009 and 2010. We 

collected 25 gall wasps species in this research from 4 sites. The presence and absence of any gall wasps 

are shown by (+) and (-), respectively. The 1st sign indicates that the specimen was either present on (+) or 

absent from (-) uninfected trees, while the 2nd sign indicates that the specimen was either present on (+) or 

absent from (-) infected trees. For example, Andricus aries was present on uninfected trees (+), but absent 

from infected trees at Ghabre-hossein in 2009 

Gall wasp species 

Site 

Ghabre-hossein Mirabad Rabat Dare-ghabr 

2009 2010 2009 2010 2009 2010 2009 2010 

Stem gall 

Andricus aries 2 + (-) + (-) - (-) - (-) - (-) - (-) + (+) + (+) 

A. askewi 2 + (+) + (+) - (-) - (-) - (-) - (-) + (-) + (-) 

A. caputmedusae 2 + (+) + (+) - (-) - (-) + (+) + (+) - (-) - (-) 

A. conglomerates 2 + (-) + (-) - (-) - (-) - (-) - (-) + (-) + (+) 

A. coriarius 2 - (-) - (-) - (-) - (-) - (-) - (-) + (+) + (+) 

A. galeatus 2 + (+) + (-) - (-) - (-) - (-) - (-) + (-) + (-) 

A. hystrix 2 + (+) + (+) - (-) - (-) - (-) - (-) - (-) - (-) 

A. kollari 2 + (+) + (+) - (-) - (-) - (-) - (-) + (+) + (-) 

A. lucidus 2 - (-) - (-) + (+) + (+) - (-) - (-) + (+) + (+) 

A. mediterraneae 2 - (-) - (-) - (-) - (-) - (-) - (-) + (+) + (+) 

A. megalucidus 2 + (+) - (-) + (+) + (+) - (-) - (-) + (+) + (+) 

A. panteli 2 + (+) + (+) - (-) - (-) - (-) - (-) + (+) + (-) 

A. polycerus 2 + (+) + (+) - (-) - (-) - (-) - (-) + (+) - (-) 

A. quercuscalicis 2 + (+) + (+) - (-) - (-) - (-) - (-) + (+) + (+) 

A. quercustozae 2 + (+) - (-) + (+) - (-) + (+) + (+) + (-) - (-) 

A. seckendorffi 2 + (+) + (+) - (-) - (-) - (-) - (-) - (-) - (-) 

A. sternlichtii 2 + (-) + (-) - (-) - (-) - (-) - (-) + (+) + (+) 

A. theophrastea 2 + (+) - (+) - (-) - (-) + (+) - (+) - (-) - (-) 

A. tomentosus 2 - (-) - (-) - (-) - (-) + (+) + (+) + (+) + (+) 

A. megatruncicolus 2 + (+) - (-) + (+) + (+) + (+) + (+) - (-) - (-) 

Leaf gall 

Cynipis cornifex 2 + (+) + (+) - (-) - (-) - (-) - (-) - (-) - (-) 

C. quercus 1 + (-) + (-) + (-) + (+) + (-) + (-) - (-) - (-) 

C. quercusfolii 1 + (-) + (-) + (-) + (-) + (-) + (-) + (-) + (-) 

Neuroterus numismalis 1 + (-) + (-) - (-) - (-) + (+) + (-) + (-) + (-) 

N. quercus-baccarum 1 + (-) + (-) - (-) - (-) + (-) + (-) + (-) + (-) 

1 

Species commonly found on uninfected trees, rarely found on lightly infected trees, and virtually absent from highly infected trees. 

2 

Species commonly found on both infected and uninfected oak trees.

180 


Rabat. Mirabad had the lowest Shannon’s indices. 

An increase in either the Gini-Simpson index or 

Shannon’s H index reduced the evenness of gall 

wasps (Table 4). The highest and lowest species 

evenness values were found at Mirabad and 

Ghabre-hossein, respectively. 

Cluster analysis dendrogram are shown 

in figures 1 and 2. Dendrograms cluster sites 

according to how strongly correlated the sites are, 

and if sites are highly correlated, they will have a 

correlation value of 1 or close to 1. In the current 

study, the highest value of the Sorensen similarity 

between Dare-ghabr and Ghabre-hossein was 0.72 

for uninfected trees in 2009, while the similarity 

between these 2 sites measured from infected 

trees was 0.41. The lowest index of similarity 

was recorded between Rabat and Dare-ghabr 

on infected trees in 2009. In 2010, Sorensen 

similarity indices of infected and uninfected trees 

at Ghabre-hossein and Rabat were 0.27 and 0.40 

respectively. The mean number of oak galls was 

generally higher on uninfected trees than infected 

trees at all sites in 2 the consecutive years (Table 

5). Trees infected with powdery mildews showed 

the lowest mean number of cynipid galls. Among 

uninfected trees, the mean number of galls on 

uninfected trees ranged from14.8 at Rabat in 

2010 to 61.2 at Ghabre-hossein in 2009, while the 

same means for infected trees ranged from 6.2 

at Rabat to 25.4 at Ghabre-hossein in 2009. The 

maximum and minimum uninfected: infected ratios 

were 2.8 and 2.1 in Dare-ghabr in 2009 and 2010, 

respectively. 

Pearson’s correlation coefficients between 

the number of galls and percent infection showed 

significant negative correlations in 2009 (r = -0.714, 

n = 20, p < 0.01) and 2010 (r = -0.581, n = 20, 

p < 0.01) (Fig. 3). On infected oak trees, leaf gall 

abundances declined with increasing levels of 

powdery mildew. 

Table 4. Species diversity indices and the true diversity of oak gall wasps in 2009 and 2010 

Diversity indices 

Sites 

Simpson D 

Species 

richness 

Gini-Simpson True diversity Shannon’s H’ True diversity Evenness 

Infected oak trees (2009) 

Ghabre-hossein 0.9012 11.95 2.48 13.21 0.91 14 0.08 

Dare-ghabr 0.9104 7.38 1.99 9.95 0.89 11 0.10 

Rabat 0.9188 3.91 1.36 5.33 0.81 6 0.19 

Mirabad 0.9342 3.21 1.16 3.49 0.71 4 0.29 

All sites pooled 6.61 1.75 8.00 0.84 8.7 0.16 

Uninfected oak trees (2009) 


Dare-ghabr 0.9197 16.96 2.83 17.21 0.94 18 0.06 

Rabat 0.9176 7.32 1.99 7.79 0.87 9 0.13 

Mirabad 0.9419 4.86 1.58 5.27 0.81 6 0.19 

All sites pooled 11.875 2.33 12.48 0.89 13.5 0.11 

Infected oak trees (2010) 


Dare-ghabr 0.8422 8.29 2.12 8.42 0.88 9 0.12 

Rabat 0.9140 3.98 1.38 4.39 0.77 5 0.23 

Mirabad 0.9205 3.25 1.18 3.29 0.69 4 0.30 

All sites pooled 6.095 1.71 6.06 0.81 7 0.19 

Uninfected oak trees (2010) 


Dare-ghabr 0.9114 11.46 2.44 15.48 0.94 16 0.06 

Rabat 0.9272 8.79 2.17 7.04 0.85 8 0.14 

Mirabad 0.9380 3.86 1.35 4.31 0.77 5 0.24 

All sites pooled 9.21 2.13 10.78 0.87 11.5 0.13


181 

100 

Rescaled Distance Chister Combine (A) 

80 60 40 20 

0 

DISCUSSION 

Mirabad & Rabat 

Ghabre-hossein & Dare-ghabr 

Rabat & Dare-ghabr 

Mirabad & Dare-ghabr 

Ghabre-hossein & Mirabad 

Ghabre-hossein & Rabat 







100 

Rescaled Distance Chister Combine (B) 

80 60 40 20 

Fig. 1. Sorensen cluster analysis dendrogram of similarity 

coefficients for oak gall wasps occurring on infected (A, above) 

and uninfected (B, below) trees in 2009. 













100 

100 

Rescaled Distance Chister Combine (A) 

80 60 40 20 

Rescaled Distance Chister Combine (B) 

80 60 40 20 

Fig. 2. Sorensen cluster analysis dendrogram of similarity 

coefficients for oak gall wasps occurring on infected (A, above) 

and uninfected (B, below) trees in 2010. 

0 

0 

0 

Our results clearly demonstrated an indirect 

plant-mediated interaction between Erysiphe 

alphitoides and a community of cynipid oak gallforming 

wasps, and we found that pathogen 

infection significantly reduced the abundance and 

species richness of the native oak gall wasps. 

Although there were differences among sites, the 

highest and lowest abundance and richness values 

were always respectively associated with healthy 

and diseased oak trees, at any given site. 

This is the 1st study to demonstrate plantmediated 

interactions between a leaf pathogen 

and a community of gall-forming wasps. It was 

commonly reported that pathogen or insect attacks 

can affect the composition of insect and pathogen 

communities associated with plants and mediate 

the incidences and abundances of subsequent 

attackers (Stout et al. 2006, Eyles et al. 2010). 

In the current study, the mechanism of the plantmediated 

interaction between E. alphitoides and 

gall-forming wasps is not known although, based 

on earlier publications on cynipid gall wasps, we 

Table 5. t-test comparison of the mean number 

(± S.E.) of oak galls per trees between infected 

and uninfected oak trees in 2009 and 2010. A significant 

difference was accepted at < 0.05 

20.00 

year 

2009 

2010 

Site Year Mean number (± S.E.) of 

oak galls per tree 

Uninfected 

Infected 

Number of leaf gall wasps 

15.00 

10.00 

5.00 

Ghabre-hossein 2009 61.2 (±5.3) 25.4 (±6.1) 

2010 32.4 (±7.1) 17.3 (±3.2) 

Dare-ghabr 2009 54.2 (±8.2) 19.4 (±11.1) 

2010 38.4 (±1.8) 18.3 (±4.3) 

Mirabad 2009 22.5 (±9.4) 10.4 (±5.8) 

2010 16.9 (±2.7) 7.1 (±4.6) 

Rabat 2009 20.3 (±1.4) 8.7 (±3.3) 

2010 14.8 (±6.3) 6.2 (±2.4) 

Site Year Statistics 

t-value 

p-value 

0.00 

0.00 10.00 20.00 30.00 40.00 50.00 60.00 70.00 

Percent of leaf infection 

Fig. 3. Correlation between the number of leaf gall wasps and 

percent of leaf infection by oak powdery mildew on oaks in 

2009 and 2010. An increased percent of disease infection led 

to a decrease in leaf oak gall wasp numbers. 

Ghabre-hossein 2009 20.16 0.002 

2010 12.23 0.036 

Dare-ghabr 2009 19.05 0.001 

2010 15.64 0.026 

Mirabad 2009 14.52 0.031 

2010 9.37 0.048 

Rabat 2009 7.78 0.043 

2010 8.44 0.029

182 


suspect that E. alphitoides can influence gallformers 

in 2 possible ways. First, E. alphitoidesinfection 

of oak trees most likely systemically 

changes the host plant suitability, particularly host 

nutrients and host secondary compounds, as 

chemical interactions between gall-formers and 

their host plants are important for both the success 

and avoidance of gall formation. For example, 

nutrients of plant tissues play critical roles in the 

selection of oviposition sites and subsequent gall 

development (Hartley 1998, Stone and Schönrogge 

2003). Female cynipid gall wasps prefer host 

tissues with high nutritional quality (Stone et al. 

2002), and it is likely that an E. alphitoides infection 

may diminish nutritional substances in oak tissues 

(Stone and Schönrogge 2003). Decreasing 

nitrogen or increasing carbon, due to increased 

metabolism of carbon-based metabolites such as 

tannins and lignin (Scriber and Slansky 1981, Wold 

and Marquis 1997) or increases in photosynthesis 

(Bagatto et al. 1996) may alter carbon: nitrogen 

(C:N) ratio of plant tissues. Scriber and Slansky 

(1981) suggested that tissues with high C: N ratios 

provide low-quality food for developing immature 

wasps inside galls. Additional investigations in this 

system should focus on changes in plant nutritional 

quality due to E. alphitoides infestations to fully 

understand interactions between the disease and 

cynipid oak gall wasps. 

Further, our study cannot rule out the role 

of secondary metabolites, particularly tannin 

levels, in reducing the abundance and richness of 

cynipid gall wasps in diseased oak trees. Tannin 

is a phenolic compound used for defense against 

a variety of organisms and is also induced by 

pathogen infestation (Stone et al. 2002). Tannins 

in cynipid galls are known to be concentrated in 

the outer layers, where they may protect the gall 

from endophytic fungi (Taper et al. 1986, Taper 

and Case 1987, Wilson and Carroll 1997). For 

example, the endophytic fungus Discula quercina 

(Coelomycetes) was shown to cause almost 100% 

cynipid gall wasp mortality in artificial infection 

experiments (Wilson and Carroll 1997). Tannins 

may also protect gall-formers against parasitoids 

(Cornell 1983, Taper and Case 1987). This close 

association of cynipid gall wasp and tannin levels 

could explain the observed positive relationships 

of oak tannin levels with cynipid diversity and 

abundance (Taper and Case 1987, Wold and 

Marquis 1997, Stone et al. 2002). 

Although we do not know how different 

severities of Erysiphe alphitoides infestation 

affect tannin contents, we suspect that pathogen 

infection either increases tannin contents in all 

tissues such that high tannin contents in the 

inner layers of galls might not be suitable for the 

developing larvae, or significantly reduces tannin 

contents such that developing larvae are not 

protected from endophytic fungi, or a combination 

of both, as tannin content are very likely to vary 

with the severity of pathogen infection (Bonello et 

al. 2006). 

A 2nd possible alternative to explain the plantmediated 

interaction between E. alphitoides and 

cynipid gall wasps is that the presence of a fungus 

may prohibit oviposition by female wasps, as we 

observed that hyphae of E. alphitoides covered 

the surface of host leaves such that females could 

not lay eggs. An E. alphitoides infestation on 

leaves initially appears as light-green to yellow 

spots. As the disease severity progresses, spidery 

or threadlike white patches typically develop 

with scattered small, black fruiting bodies. The 

presence of an infestation of plant tissues by 

E. alphitoides could also indirectly increase 

competition for suitable oviposition sites among 

leaf gall wasps (Gilbert et al. 1994). However, 

this avoidance mechanism might only explain the 

reduction in leaf gall wasp diversity and species 

richness, not stem galls, as E. alphitoides is only 

present on oak leaves. 

Plant-mediated interactions between pathogens 

and herbivorous insects were commonly 

reported in other systems (Krause and Raffa 

1992, Felton and Korth 2000, Eyles et al. 2007). 

For example, Krause and Raffa (1992) found that 

infection of larch Larix decidua with the fungal 

pathogen Mycosphaerella laricina induced a 

systemic reduction in host quality for the larch 

sawfly Pristiphora erichsonii. Likewise, Eyles et 

al. (2007) reported that an infection by Diplodia 

pinea elicited resistance against the defoliating 

European pine sawfly Neodiprion sertifer in 

Austrian pine Pinus nigra. In our system, plant 

defensive responses apparently seem to be 

operating against only the gall wasp community 

and not E. alphitoides because we observed 

continuous colonization of the same oak trees 

by E. alphitoides after an initial infection. This 

suggests a possible “cross-talk” between defensive 

pathways against E. alphitoides (associated with 

salicylic acid) and cynipid gall wasps (associated 

with jasmonic acid) in oaks (Bostock 2005, Heil 

and Ton 2008). Even though we do not have a 

complete understanding of the defensive pathways 

induced in oaks by either oak gall wasps or E. 

alphitoides, further studies of oak systems should


183 

identify these pathways and determine whether 

induction of 1 pathway prevents synthesis of the 

other, thereby leading to an impaired capacity of 

a plant to respond to either pathogen infection or 

insect damage (Bostock 2005). 

We currently do not know why the abundance 

and species diversity of gall wasps were higher 

at the Ghabre-hossein and Dare-ghabr sites 

compared to the others. Despite differences in 

climate, both sites have similar vegetative cover 

and similar species abundance and richness levels 

of cynipid gall wasps. Despite their similarities 

in climate, Ghabre-hossein and Mirabad had 

different vegetative cover, and the former had a 

larger species complex. This suggests that the 

distribution of host plant species may be highly 

critical for determining patterns of herbivore 

abundances (Starzomski et al. 2008) along with 

factors like climate and phenological synchrony of 

herbivores with host plants. This is not surprising 

considering the fact that the abundance and 

richness of gall wasps are related to the richness 

and abundance of host plant species (Starzomski 

et al. 2008). Likewise, the species richness of oak 

gall wasps in Mexico was highly correlated to their 

host plants (Cuevas-Reyes et al. 2004). Further, 

Stone et al. (2002) suggested that geographical 

differences in the oak gall wasp fauna were related 

to oak distribution patterns in different regions. The 

current study also added further complexity to host 

plant-gall wasp interactions; i.e., the role of plant 

pathogens in the spatial distribution of herbivorous 

insects. Specifically, as indicated by the cluster 

analysis dendrogram, although the Sorensen 

similarity value for uninfected trees was fairly high 

between Dare-ghabr and Ghabre-hossein (0.72), 

E. alphitoides infestations dramatically reduced the 

similarity index between these 2 sites to 0.41. 

Acknowledgments: The authors are grateful to 

the head of the Agricultural and Natural Resources 

Research Center of West Azerbaijan (Dr. R. 

Sokouti Oskouii) for his scientific and financial 

support. 

REFERENCES 

Bagatto G, LC Paquette, D Shorthouse. 1996. Influence of 

galls of Phanacis taraxaci on carbon partitioning within 

common dandelion, Taraxacum sp. Entomol. Exp. Appl. 

79: 111-117. 

Bonello P, TR Gordon, DA Herms, DL Wood, N Erbilgin. 2006. 

Nature and ecological implications of pathogen-induced 

systemic resistance in conifers: a novel hypothesis. 

Physiol. Mol. Plant. Pathol. 68: 95-104. 

Bostock RM. 2005. Signal crosstalk and induced resistance: 

straddling the line between cost and benefit. Annu. Rev. 

Phytopathol. 43: 545-580. 

Braun U. 1995. The powdery mildews (Erysiphales) of Europe. 

New York: Gustav Fischer Verlag Press. 

Chodjai M. 1980. Study of the gall forming cynipid 

Hymenoptera of Iranian oak forests. J. Entomol. Soc. 

Iran. 3: 1-44. 

Colgan LJ, N Erbilgin. 2011. Tree-mediated interactions 

between the jack pine budworm and a mountain pine 

beetle fungal associate. Ecol. Entomol. (in press) 

Cornell H. 1983. The secondary chemistry and complex 

morphology of galls formed by the Cynipinae 

(Hymenoptera): why and how? Am. Midl. Nat. 110: 225- 

236. 

Cuevas-Reyes P, M Quesada, P Hanson, R Dirzo, K Oyama. 

2004. Diversity of gall-inducing insects in a Mexican 

tropical dry forest: the importance of plant species 

richness, life-forms, host plant age and plant density. 

Ecology 92: 707-716. 

Egan SP, JR Ott. 2007. Host plant quality and local adaptation 

determine the distribution of a gall-forming herbivore. 

Ecology 88: 2868-2879. 

Eyles A, P Bonello, R Ganley, C Mohammed. 2010. Induced 

resistance to pests and pathogens in trees. New Phytol. 

185: 893-908. 

Eyles A, R Chorbadjian, C Wallis, R Hansen, D Cipollini, D 

Herms et al. 2007. Cross-induction of systemic induced 

resistance between an insect and a fungal pathogen in 

Austrian pine over a fertility gradient. Oecologia 153: 

365-374. 

Farr DF, AY Rossman. 2010. Fungal databases. Available at 

http://nt.ars-grin.gov/ fungal databases Accessed 10 Apr. 

2011. 

Felton GW, KL Korth. 2000. Trade-offs between pathogen and 

herbivore resistance. Curr. Opin. Plant. Biol. 3: 309-314. 

Foss LK, LK Rieske. 2004. Stem galls affect oak foliage with 

potential consequences for herbivory. Ecol. Entomol. 29: 

273-280. 

Genimar-Reboucas J, V Eduardo-Martins, F Wilson. 2003. 

Richness and abundance of gall-forming insects in the 

Mamiraua Varzea, a flooded Amazonian forest. Uakari 1: 

39-42. 

Gilbert F, C Astbury, J Bedingfield, B Ennis, S Lawson, T Sitch. 

1994. The ecology of the pea galls of Cynips divisa. In 

MAJ Williams, ed. Plants galls: organisms, interactions, 

populations. Oxford, UK: Clarendon, pp. 331-349. 

Griffon E, A Maublanc. 1912. Les Microsphaera des chênes. 

Bull. Soc. Mycol. 28: 88-104. 

Hartley SE. 1998. The chemical composition of plant galls: Are 

levels of nutrients and secondary compounds controlled 

by the gall-former? Oecologia 113: 492-501. 

Heil M, J Ton. 2008. Long-distance signalling in plant defence. 

Plant. Sci. 13: 264-272. 

Herms DA, MJ Mattson. 1992. The dilemma of plants: grow or 

defend. Rev. Biol. 67: 283-335. 

Hewitt GM. 1999. Post-glacial re-colonization of European 

biota. J. Linn. Soc. 68: 87-112. 

Jost L. 2006. Entropy and diversity. Oikos 113: 363-375. 

Karban R, IT Baldwin. 1997. Induced responses to herbivory. 

Chicago, IL: Univ. of Chicago Press. 

Koleff P, K Gaston, J Lennon. 2003. Measuring beta diversity 

for presence/absence data. J. Anim. Ecol. 72: 367-382.

184 


Kosaka H, T Aikawa, N Ogura, K Tabata, T Kiyohara. 2001. 

Pine wilt disease caused by the pine wood nematode: the 

induced resistance of pine trees by a virulent isolates of 

nematode. Eur. J. Plant. Pathol. 107: 667-675. 

Krause SC, KF Raffa. 1992. Comparison of insect, fungal, and 

mechanically induced defoliation of larch-effects on plant 

productivity, host susceptibility. Oecologia 90: 411-416. 

Långström B, H Solheim, C Hellqvist, P Krokene. 2001. Host 

resistance in defoliated pine: effects of single and mass 

inoculations using bark beetle-associated blue-stain fungi. 

Agric. For. Entomol. 3: 211-216. 

Magurran AE. 2004. Measuring biological diversity. Oxford, 

UK: Blackwell Publishing Press. 

Mougou-Hamdane A, X Giresse, C Dutech, ML Desprez- 

Loustau. 2010. Spatial distribution of lineages of oak 

powdery mildew fungi in France, using quick molecular 

detection methods. Ann. For. Sci. 67: 449-457. 

Nakamura N, Y Miyamoto, T Ohgushi. 2003. Gall initiation 

enhances the availability of food resources for herbivorous 

insects. Funct. Ecol. 17: 851-857. 

Prior KM, JJ Hellmann. 2010. Impact of an invasive oak 

gall wasp on a native butterfly: a test of plant-mediated 

competition. Ecology 91: 3284-3293. 

Raffa KF, SC Krause, PB Reich. 1998. Long-term effects of 

defoliation on red pine suitability to insects feeding on 

diverse plant tissues. Ecology 79: 2353-2364. 

Ronquist F, J Liljeblad. 2001. Evolution of the gall wasp-host 

plant association. Evolution 55: 2503-2522. 

Sadeghi SE, G Melika, GN Stone, M Assareh, H Askary, M 

Tavakoli et al. 2010. Oak gall wasps fauna of Iran 

(Hymenoptera: Cynipidae: Cynipini). 7th International 

Congress of Hymenoptroists 112, Hungary: The international 

society of Hymenopterists. 

Scriber JM, F Slansky. 1981. The nutritional ecology of 

immature insects. Annu. Rev. Entomol. 26: 183-211. 

Southwood TR, PA Henderson. 2000. Ecological methods. 

Oxford, UK: Blackwell. 

Staley JT, A Stewart-Jones, TW Pope, DJ Wright, SR Leather, 

P Hadley et al. 2010. Varying responses of insect 

herbivores to altered plant chemistry under organic and 

conventional treatments. Proc. R. Soc. Lond. Biol. 277: 

779-786. 

Starzomski BM, RL Parker, DS Srivastava. 2008. On the 

relationship between regional and local species richness: 

a test of saturation theory. J. Ecol. 89: 1921-1930. 

Stone GN, K Schönrogge. 2003. The adaptive significance of 

insect gall morphology. Trends in Ecol. Evol. 18: 512-522. 

Stone GN, K Schönrogge, R Atkinson, D Bellido, J Pujade- 

Villar. 2002. The population biology of oak gall wasps 

(Hymenoptera: Cynipidae). Annu. Rev. Entomol. 47: 633- 

668. 

Stout MJ, JS Thaler, BPHJ Thomma. 2006. Plant-mediated 

interactions between pathogenic microorganisms and 

herbivorous arthropods. Annu. Rev. Entomol. 51: 663- 

689. 

Taper ML, TJ Case. 1987. Interactions between oak tannins 

and parasite community structure: Unexpected benefits of 

tannins to cynipid gall-wasps. Oecologia 71: 254-261. 

Taper ML, EM Zimerman, TJ Case. 1986. Sources of 

mortality for a cynipid gall-wasp Dryocosmus dubiosus 

(Hymenoptera: Cynipidae): the importance of tannin/ 

fungus interaction. Oecologia 68: 437-495. 

Tavakoli M, G Melika, SE Sedeghi, ZS Penzes, M Assareh, R 

Atkinson et al. 2008. New species of Cynipid gall wasps 

from Iran and Turkey (Hymenoptera: Cynipini). Zootaxa 

1699: 1-64. 

Tavanaei GH. 2006. Report of two fungi causing powdery 

mildew on oak trees in forests of west Azarbaijan and 

Kordistan Provinces. Iran. J. For. Range Prot. Res. 4: 46- 

47. 

Veldtman R, MA McGeoch. 2003. Gall-forming insect 

species richness along a non-scleromorphic vegetation 

rainfall gradient in South Africa: the importance of plant 

community composition. Aust. Ecol. 28: 1-13. 

Wallin KF, KF Raffa. 2001. Effects of folivory on subcortical 

plant defences: Can defence theories predict interguild 

processes? Ecology 82: 1387-1400. 

Wilson D, GC Carroll. 1997. Avoidance of high-endophyte 

space by gall-forming insects. Ecology 78: 2153-2163. 

Wold EN, RJ Marquis. 1997. Induced defence in white oak: 

effects on herbivores and consequences for the plant. 

Ecology 78: 1356-1369. 

Zargaran MR, SE Sadeghi, S Hanifeh. 2008. Identification of 

oak gall wasps and their parasitoids in west Azerbaijan 

Province of Iran, Urmia, Iran. Institute of Forests and 

Rangelands, 108 pp. (in Persian with English abstract)


Age and Growth of Oxygymnocypris stewartii (Cyprinidae: 

Schizothoracinae) in the Yarlung Tsangpo River, Tibet, China 

Bin Huo, Cong-Xin Xie*, Bao-Shan Ma, Xue-Feng Yang, and Hai-Ping Huang 

College of Fisheries, Huazhong Agricultural Univ., Wuhan, Hubei 430070, China 


Bin Huo, Cong-Xin Xie, Bao-Shan Ma, Xue-Feng Yang, and Hai-Ping Huang (2012) Age and growth of 

Oxygymnocypris stewartii (Cyprinidae: Schizothoracinae) in the Yarlung Tsangpo River, Tibet, China. Zoological 

Studies 51(2): 185-194. To better understand the biology of Oxygymnocypris stewartii and its relationship with 

management considerations, the age and growth of O. stewartii were examined using sectioned otoliths of 712 

specimens collected from Aug. 2008 to Aug. 2009. The standard length (SL) ranged 45-587 mm. The location 

of the 1st annulus was validated by a daily growth increment (DGI) analysis of otoliths. Monthly changes in 

the marginal increment ratio of the otoliths with 1-8 annuli indicated that an annulus forms once a year, from 

Mar. to June. The index of the average percentage error (IAPE) of the sectioned otoliths was 0.5%, and the 

coefficient of variation (CV) for the age estimation was 0.7%. Estimated ages ranged 3-17 yr for males, 2-25 yr 

for females, and 1-6 yr for those of undetermined sex. The SL-BW relationship was described as BW = 6.108 

× 10 -6 SL 3.126 for females, BW = 9.872 × 10 -6 SL 3.052 for males, and BW = 3.203 × 10 -5 SL 2.821 for undetermined. 

The von Bertalanffy function was used to model the observed length-at-age data as Lt = 526.8 {1 - exp[-0.141 

(t - 0.491)]} for males, and Lt = 618.2 {1 - exp[-0.106(t - 0.315)]} for females. Females grew at a slower rate but 

attained a larger size than males. Knowledge of this species’ characteristics of slow growth and a long life will 

be useful for establishing reasonable management practices for its conservation. 


Key words: Age, Growth, Otolith, Oxygymnocypris stewartii, Tibet. 

T he subfamily Schizothoracinae is the 

predominant group of endemic fishes living in 

high-elevation rivers and lakes on the Qinghai- 

Tibetan Plateau (Cao et al. 1981). They are 

found in very localized populations. Another 

characteristic of these species is that they 

are affected by anthropogenic pressures of 

indiscriminate fishing, habitat modification resulting 

from dam construction, and biological invasions. 

In view of such alterations to the environment, 

it has become a priority to make efforts towards 

better understanding the biology of the subfamily 

Scizothoracinae and its relationship with management 

considerations. 

Among the Schizothoracinae fishes inhabiting 

in the Yarlung Tsangpo River, Oxygymnocypris 

stewartii is one of the endemic species that 

lives only in the clear, cool waters at elevations 

of 3600-4200 m (Wu and Wu 1992, Chen and 

Cao 2000). Moreover, as a result of the extreme 

plateau environment, such as low temperatures 

and poor food availability, O. stewartii is slowgrowing 

and long-lived. These characteristics of a 

limited distribution, slow growth, and long life make 

O. stewartii populations particularly vulnerable 

to excessive exploitation. However, the rapidly 

increasing demands for fish attributed to enhanced 

immigration and gradual changes in many traditional 

customs have led to the overexploitation 

of fish resources. The immoderate exploitation 

has ultimately resulted in O. stewartii populations 

rapidly declining, and this species is listed in the 


E-mail:xiecongxin@mail.hzau.edu.cn 

185

186 

Huo et al. – Age and Growth of Oxygymnocypris stewartii 

IUCN’s Red List of Threatened Species as a nearthreatened 

fish (Ng 2010). However, attempts 

to develop effective population management 

strategies have been obstructed by a lack of basic 

biological information. The available information 

mainly focuses on its taxonomy (Lloyd 1908, 

Cao and Deng 1962), its origin and evolution 

(Cao et al. 1981), and aspects of its phylogenetic 

development and biogeography (Chen 1998, Chen 

2000, He and Chen 2007). There have been few 

studies on the otolith microstructure, age and 

growth of O. stewartii (Jia and Chen 2009 2011). 

Accurate age determination and estimates of 

growth and mortality parameters are fundamental 

requirements for understanding population 

dynamics and provide essential data needed to 

maintain sustainable yields by fisheries (Campana 

and Thorrold 2001). Results from the only 2 

studies of age and growth of O. stewartii (Jia and 

Chen 2009 2011) validated the periodicity of otolith 

increment formation. However, no studies have 

provided evidence to validate the 1st annual ring 

or the precision of aging methods. This is often an 

overlooked but necessary component of any aging 

study (Campana 2001). The objectives of this 

study were first to describe annulus characteristics 

of otoliths, second to validate annuli and verify 

annual periodicity in otoliths, and finally to estimate 

the age and growth of O. stewartii. 


In total, 712 O. stewartii individuals were 

obtained from the Yarlung Tsangpo River and a 

tributary (Xiang Qu) monthly from Aug. 2008 to 

Aug. 2009 by means of floating gillnets, bottom 

gillnets, and trap nets (Fig. 1). More than 30 fish 

were collected each month. The standard length 

(SL) of each fresh specimen was measured to the 

nearest 1 mm using a tapeline, and body weight 

(BW) was measured to the nearest 0.1 g with an 

electronic balance. Lapillus otoliths were extracted 

from each fish, washed with 95% ethanol, airdried, 

and then stored in labeled tubes. 

Both right and left lapillus otoliths were 

removed from each individual, but usually just the 

left otolith was used for the analysis. Otoliths were 

mounted with the ventral face on a glass slide 

using thermoplastic glue, with the dorsoventral 

axis perpendicular to the slide plane. The otoliths 

were then ground from the dorsal face using wet 

sandpaper (600-1500 grit) and polished with 

alumina paste (3 μm) until the core was visible 

under a compound microscope. The otoliths were 

removed by dissolving the glue with xylene, and 

then the otoliths were re-affixed to the glass slides 

using nail polish, with the polished face down. The 

ventral face was then ground and polished until the 

core was exposed again. 

88°W 90°W 

N 

Namling 

Xiang Qu River 

Lhasa River 

Xaitongmoin 

Nyemo 

Quxu 

Yarlung Tsangpo River 

Xigaze 

Bainang 

Nyang Qu River 

Rinbung 

Yarlung Tsangpo River 

29°N 

Gyangze 

0 25 50 100 km 

90°W 

Fig. 1. Sampling locations of Oxygymnocypris stewartii in the Yarlung Tsangpo River.


187 

The presumed daily growth increments 

(DGIs) of otoliths of 6 young fish of 45-63 mm 

SL (5 individuals caught on 4 Jan. 2009 and 1 

individual caught on 23 Feb. 2009) were counted, 

and the radius of the otoliths was measured along 

the posterior axis (Sequeira et al. 2009). The DGI 

periodicity was validated to be daily (Jia and Chen 

2009). 

A marginal increment ratio (MIR) analysis was 

used to verify the period of opaque zone formation 

in the otoliths. Monthly variations of the MIR 

(1-8 annuli) were established using the following 

equation: 

MIR = (R - Rn) / (Rn - Rn-1); 

where R is the otolith radius, Rn is the distance 

from the focus to the outer edge of the last annulus 

formed, and Rn-1 is the distance from the focus to 

the outer edge of the penultimate complete annulus 

(Haas and Recksiek 1995). Measurements were 

conducted along the posterior growth axis using an 

image analysis system (Leica Application Suite EZ, 

Heerbrugg, Switzerland) with a direct data feed 

between the dissecting microscope (Leica EZ 4D) 

and a computer. 

Each fish was assigned to an age class 

assuming 1 Mar. as the birth date, which approximately 

corresponds to the peak spawning 

season. A new ring mark found on the otolith of 

a fish captured before 1 Mar. was not considered 

to be an annulus in the age assignment, whereas 

when a fish sampled after the assumed birth 

date had no new ring mark, an annulus that was 

supposed to have formed was considered in the 

age estimation (Granada et al. 2004). 

Otolith readings were made along the 

posterior growth axis. The reader had no prior 

knowledge of the length, sex, or time of capture 

before the age estimation. All ages were determined 

twice by the same interpreter after a 

considerable time (3 wk). Readings were only 

accepted if both counts by the same examiner 

were in agreement. If the 2 readings differed, 

then the otolith was recounted, and the final count 

was then accepted as the agreed age. If the 

3rd reading had no consensus with either of the 

previous 2 readings, the sample was discarded. 

SL-BW relationgships were calculated by the 

power relationship: BW = a × SL b ; where a and 

b are parameters. The standard von Bertalanffy 

growth function (von Bertalanffy 1938) was used 

to describe the observed body length-at-age using 

the following formula: 

Lt = L∞ {1 - exp[-k (t - t0)]}; 

where L∞ is the asymptotic body length-at-age, 

which represents the average body length-at-age 

individuals would attain if they grew indefinitely, k 

is the growth coefficient, and t0 is the age at length 

0. 

The growth performance index, Ø (Ø = 

log10k + 2log10L∞), was calculated to compare 

the growth parameters obtained in the present 

paper with values reported by other authors for 

schizothoracine fishes (Munro and Pauly 1983). 

The index of the average percentage error 

(IAPE) and coefficient of variation (CV) were 

calculated to measure the ageing precision 

between the 2 readings. The equations (Campana 

2001) are expressed as follows: 

IAPE = 1 N 

Σ N 

j = 1 

CV = 1 N ΣN ( 

j = 1 

( 1 R 

Σ R 

i = 1 

|Xij - Xj| 

Xj 

Xj 

) × 100%, and 

Σ R 

(Xij - Xj) 2 

i = 1 R - 1 ) × 100%; 

where N is the number of fish aged, R is the 

number of times each fish is aged, Xij is the ith age 

determination of the jth fish, and Xj is the mean 

age calculated for the jth fish. 

The BW-SL relationship and von Bertalanffy 

function were calculated by a non-linear regression 

analysis (the Levenberg-Marquardt method; 

Levenberg 1944). The difference in the BW-SL 

relationship between the sexes was compared by 

an analysis of covariance (ANCOVA). Deviation 

of the allometric coefficient, b, from the theoretical 

value of isometric growth (b = 3) was tested by 

a t-test (Pauly 1984). A residual sum of squares 

analysis (ARSS) was used to determine whether 

any significant difference existed in the von 

Bertalanffy equations for males and females (Chen 

et al. 1992). 

The analysis was carried out using SPSS 

16.0 (Chicago, IL, USA), Originpro 8.0 (Originlab, 

Northampton, USA), Microsoft Excel 2003 

(Redmon, WA, USA), and Photoshop CS4 

Extended (Adobe, San Jose, USA). Statistical 

significance was accepted when p < 0.05.

188 


RESULTS 

Length-frequency distributions 

15 

12 

Female 

Male 

Undetermined 

Of the 712 O. stewartii sampled, 373 were 

females with SLs of 116-587 mm, 206 were 

males with SLs of 167-455 mm, and 133 were an 

undetermined sex with SLs of 45-260 mm. Lengthfrequency 

distributions signnificantly differed 

between sexes (Kolmogorov-Smirnov; D = 4.371, 

p < 0.001) (Fig. 2). SLs of the captured fish were 

mainly 100-450 mm (87.5%), and females were 

significantly larger than males. 

Age validation and annual periodicity 

Frequency (%) 

9 

6 

3 

0 

0 100 200 300 400 500 600 

Standard length (mm) 

The lapilli of 6 young O. stewartii with 

SLs ranging 44.5-63.2 mm showed the typical 

pattern of translucent and opaque zones, which 

were respectively equivalent to the accretion 

and discontinuous zones, composing a daily 

growth increment (Fig. 3). A continuous series 

of concentric rings of declining size ranging from 

4.6 to 0.5 μm was observed from the core to the 

otolith margin. The 6 young specimens showed 

no transition zones (annuli). The estimated ages 

were 178-202 (195 ± 9) d, which validated the 6 

specimens to be young-of-the-year (YOY) fish. 

The mean radius of the lapilli was 669.97 (standard 

deviation (S.D.) = 71.29) μm, while that of the 1st 

annulus was 676.04 (S.D. = 64.61) μm for older 

fish. 

For otolith sections with 1-8 annuli, monthly 

changes of the MIR gradually increased from 

June to Jan., and appeared to peak at 0.815 in 

Jan. followed by a gradual decrease to 0.482 in 

May (Fig. 4). Significant differences were found 

in MIR values among months (one-way ANOVA, 

F = 13.326, p < 0.001). Tukey’s post-hoc pairwise 

comparisons revealed that the MIR in Jan. 

significantly differed from those from Mar. to June 

(p < 0.001). These results indicated that the 

opaque band of the otoliths was laid down once a 

year from Mar. to June. 

Fig. 2. Distributions of the standard length frequency of O. 

stewartii. 

(A) 

(B) 

P 

N 

D-zone 

L-zone 

DGI 

Age structure 

Sectioned otoliths of O. stewartii showed the 

typical pattern of teleosts under transition light, 

with an alternating sequence of broad opaque and 

narrow hyaline bands that became progressively 

narrower and of similar widths as the number 

of bands increased (Fig. 5). Of the 712 otoliths 

examined, only 10 (approximately 1.4%) were 

Fig. 3. Daily growth increments (DGIs) in the lapillus of O. 

stewartii with 45 mm SL. (A) Daily growth increments of core 

region, scale bar = 20 μm. (B) Daily growth increments of 

peripheral area, scale bar = 20 μm. N, nucleus; P, primordial; 

L-zone, translucent zone; D-zone, opaque zone.


189 

discarded due to fragmentation and unidentifiable 

annulus deposition. The reliablility of the age 

estimates had low IAPEs (0.5%) and CVs (0.7%), 

reflecting concordance in the readings. The 

estimated age ranged 1-25 yr. Registered ages 

of fish of undetermined sex ranged 1-6 yr, males 

ranged 3-17 yr, and females ranged 2-25 yr. The 

maximum estimated ages were 17 yr (455 mm SL) 

for males and 25 yr (502 mm SL) for females. 

Standard lengths at age of the 712 specimens 

are given in table 1. Significant variation was 

observed in the SL of individuals at the same age, 

1.0 

0.9 

0.8 

0.7 

and the variation increased with elapsed years. 

SL-BW relationships 

SL-BW relationships were separately 

calculated for males, females, and undetermined 

(Fig. 6). Significant differences were found in 

SL-BW relationships between sexes (ANCOVA, 

F = 14.764, p < 0.0001). The regression equations 

are shown as follows: 

Female BW = 6.108 × 10 -6 SL 3.126 (R 2 = 0.955, 

n = 373); 

Male BW = 9.872 × 10 -6 SL 3.052 (R 2 = 0.957, 

n = 206); and 

Undetermined: BW = 3.203 × 10 -5 SL 2.821 

(R 2 = 0.981, n = 133). 

MIR (%) 

0.6 

0.5 

0.4 

0.3 

The allometric index value (b) obtained 

from the function significantly differed from 3 for 

females (t-test, t = 6.011, p < 0.01) and exhibited 

no statistical difference from 3 for males (t-test, 

t = 1.972, p > 0.05). 

0.2 

Jan. Feb. Mar. Apr. May June July Aug. Sept. Oct. Nov. Dec. 

Month 

Fig. 4. Mean monthly MIR for O. stewartii lapillus otoliths with 

1-8 annuli, error bars represent the S.D. 

Growth 

The mean length-at-age did not significantly 

differ between sexes for age classes 3-5 (unpaired 

t-test, all p > 0.05). Therefore, the length-at- 

(A) 

(B) 

11 12 13 19 

1 

2 

3 

4 5 6 

11 

Fig. 5. Sectioned lapillus of O. stewartii with mm SL, estimated to be 19 yr old under transmitted light using the dissecting microscope. 

Dots represent annuli. Scale bars: A = 0.5 mm; B = 0.3 mm.

190 


age data of undetermined specimens (except 

for two 6-yr-old individuals) were included in the 

von Bertalanffy models for both sexes. The von 

Bertalanffy functions fitted to the observed lengthat-age 

are given as follows: 

Lt = 526.8 {1 - exp[-0.141(t - 0.491)]} (R 2 = 

Body weight (g) 

3500 

3000 

2500 

2000 

1500 

1000 

500 

0 

0 

Female 

Male 

Undetermined 

100 200 300 400 500 600 700 


Fig. 6. Length-weight relationships of O. stewartii. 

0.893) for males and 

Lt = 618.2 {1 - exp[-0.106(t - 0.315)]} (R 2 = 

0.911) for females. 

The growth curve descirbed a trend of 

relatively slow growth based on the obseved 

length-at-age data between sexes (Fig. 7). Growth 

parameters suggested that the growth rate of 

females was lower than that of males. The lengthat-age 

rapidly increased during the 1st 4 yr (Table 1, 

Fig. 7). The growth performances indices (Ø) of O. 

stewartii were 4.6076 for females and 4.5925 for 

males. 

DISCUSSION 

Based on the capture date (4 Jan. and 

23 Feb.) and the hatching time (1 Mar.), the 

daily growth increnements of YOY fish were 

supposededly about 300 or 360. However, DGIs 

of only 178-202 were observed in this study. 

This phenomenon was also mentioned in other 

Table 1. Number of specimens and Mean ± S.D. and range of standard length at age of O. stewartii 

Age (yr) Female Male Undetermined 

n Mean ± S.D. (mm) Range (mm) n Mean ± S.D. (mm) Range (mm) n Mean ± S.D. (mm) Range (mm) 

1 14 44.5-87.1 56.4 ± 11.0 

2 1 116 116 14 87.1-124.0 103.8 ± 8.7 

3 14 151-199 171.6 ± 14.6 3 167-211 183.7 ± 23.9 89 87.9-205 142.9 ± 30.3 

4 42 184-273 234.6 ± 23.1 21 208-273 244.4 ± 16.0 7 151-233 194.7 ± 31.6 

5 70 210-327 273.4 ± 25.4 66 239-312 275.2 ± 16.7 6 237-258 250.8 ± 8.4 

6 55 253-409 318.9 ± 29.8 58 249-363 296.9 ± 23.1 2 246-260 253.0 ± 9.9 

7 33 280-440 344.1 ± 34.3 29 263-365 313.2 ± 25.2 

8 14 245-483 372.7 ± 59.5 7 323-393 353.9 ± 24.8 

9 21 351-520 425.8 ± 36.0 7 324-382 351.1 ± 21.1 

10 11 388-556 449.6 ± 46.7 3 343-369 352.3 ± 14.5 

11 6 405-488 429.0 ± 30.3 1 374 374 

12 20 378-521 436.4 ± 41.7 1 350 350 

13 26 349-528 432.4 ± 38.1 2 365-372 368.5 ± 4.9 

14 23 396-524 444.3 ± 34.2 3 406-425 417.7 ± 10.2 

15 9 410-555 467.2 ± 42.8 

16 4 426-508 470.0 ± 34.8 

17 3 493-562 517.0 ± 39.0 1 455 455 

18 2 485-518 501.5 ± 23.3 

19 2 444-507 475.5 ± 44.5 

20 6 504-587 541.8 ± 30.4 

21 2 539-559 549.0 ± 14.1 

22 2 537-562 549.5 ± 17.7 

23 

24 2 496-536 516 ± 28.3 

25 1 502 502


191 

Scizothoracinae fishes. Numbers of DGIs within 

the 1st annulus were 137-154 in Ptychobarbus 

dipogon (Li et al. 2009), 121-184 in O. stewartii 

(Jia and Chen 2009), and 130-168 in Schizothorax 

o’connori (Ma et al. 2011). The daily width 

increment declined from 4.6 to 0.5 µm between 

the core and the otolith margin for YOY fishes. 

The variability in the daily width increment may 

be related to several factors, especially the water 

temperature (Marshall and Parker 1982, Neilson 

and Geen 1982, Campana 1984). The variation in 

the daily width increment within the annulus was 

consistent with that of water temperature. The 

daily width increment declined near the translucent 

zone when water temperatures decreased 

indicating that O. stewartii growth became slower at 

that time (Jia and Chen 2009). Translucent zones 

representing slow or no growth periods in the year 

may be composed of many fine increments, but 

these increments were too fine to be seen under a 

light microscope. Therefore, the above-described 

phenomenon could be attributed to the theoretical 

resolution limit of the light microscope (Campana 

and Neilson 1985). Perhaps, a scanning electron 

microscope would be a more-accurate method. 

Identification of the 1st or innermost growth 

increment is an important component of any age 

validation study. Validation of the 1st increment 

is a mandatory adjunct to an age determination; 

without a correctly defined starting point, age 

determinations will be consistently wrong by 

a constant amount. In species with a clearly 

interpretable otolith microstructure, daily increment 


700 

600 

500 

400 

300 

200 

100 

0 

0 

5 10 15 

Age (yr) 

Female 

Male 

20 25 30 

Fig. 7. The von Bertalanffy growth curve of O. stewartii with 

the observed standard length at age estimated from otoliths. 

The length-at-age data of the undetermined specimens were 

included in models fitting both sexes (except for two 6 yr old 

individuals) 

counts can often be used to confirm the identity 

of the 1st annulus (Waldron 1994, Lehodey and 

Grandperrin 1996). DGIs can be used to estimate 

the expected radius of the 1st annulus in otoliths 

(Campana 2001). In this study, the mean radius 

of older fish approached that of the 1st annulus in 

YOY fish, indicating that the 1st annulus of lapilli 

was validated in O. stewartii. 

Mechanisms of growth increment formation 

are poorly understood. There are several possible 

explanations for band formation; temperature, 

feeding regimes, and the reproductive cycle may 

be factors affecting growth increment formation 

(Beckman and Wilson 1995, Morales-Nin 2000, 

Tserpes and Tsimenides 2001, Grandcourt et al. 

2006, Liu et al. 2009). In this study, deposition 

of the opaque zone in otoliths of O. stewartii 

occurred in the spring and early summer, whereas 

the hyaline zone was formed in winter months. A 

similar phenomenon for Scizothoracinae fishes 

was also demonstrated for O. stewartii (Jia and 

Chen 2009), P. dipogon (Li et al. 2009), S. waltoni 

(Qiu and Chen 2009), and S. o’connori (Ma et 

al. 2011). Deposition of the opaque zone occurs 

from Mar. to June (Fig. 4), corresponding to the 

reproductive activity and water temperature 

variations, and deposition of the hyaline zone 

occurs during winter months, when there is 

reduced metabolic activity. Formation of the 

opaque zone in otoliths of O. stewartii appeared to 

be partially associated with reproductive activity. 

Peak reproductive activity (which occurs in Mar., 

unpubl. data) may promote a redirection of energy 

to reproduction, with a consequent reduction in 

somatic growth, which could possibly affect the 

physiology of otolith growth. Moreover, formation 

of the opaque zone in otoliths of O. stewartii may 

be partially related to water temperature. The 

average water temperature around the Xigaze is 

2°C in Feb., rising abruptly to 15°C in June (Li et 

al. 2010). This abrupt rise in water temperature 

could cause changes in metablolic activities of 

fish and could result in opaque zone deposition. 

Similar influences by reproducion and water 

temperature on other fishes were reported in past 

studies (Morales-Nin and Ralston 1990, Mann 

and Buxton 1997, Pajuelo et al. 2003, Bustos 

et al. 2009). Also, in a review of otolith studies 

including 94 species from 36 families, Beckman 

and Wilson (1995) found that the formation of 

opaque and hyaline zones might be related to 

water temperatures and spawning activity. Thus, 

formation of the annulus in otoliths of O. stewartii 

could be due to an interaction between water

192 


temperature and reproduction. 

The maximum ages estimated for O. stewartii 

in this study were 25 yr for females and 17 yr 

for males, which were comparable to values 

obtained by Jia and Chen (2011) for both sexes, 

indicating that females live longer than males. 

Li and Chen (2009) recorded 45 yr for females 

and 24 yr for males of P. dipogon based on an 

interpretation of sectioned otoliths. Chen et al. 

(2009) found 18 yr for females and 16 yr for males 

of S. younghusbandi younghusbandi by means 

of otoliths. Yao et al. (2009) obtained 24 yr for 

females and 18 yr for males of S. o’connori using 

otoliths. Ma et al. (2010) also reported 50 yr 

for females and 40 yr for males of S. o’connori 

based on otolith observations. Those studies 

revealed that great longevity is a common trait in 

schizothoracine fishes. 

Comparing results of the growth of O. 

stewartii with those of Jia and Chen (2011), the k 

value obtained in this study was smaller (Table 2). 

Differences among all of the estimated parameters 

could be attributed to several factors: (1) different 

sampled locations, (2) different age groups 

employed to fit the VBGF function (the previous 

study used 1-6 age groups), and (3) different size 

distributions. 

The growth performance indices (Ø) of 

O. stewartii were larger than those of other 

schizothoracines (Table 2), indicating that the 

growth of O. stewartii is relatively greater than 

other fishes of the Schizothoracinae, which inhabit 

the same elevatons and region. These growth 

differences might be related to feeding (Jia and 

Chen 2011). Carnivorous fishes can obtain more 

energy than that gained by other feeding habits 

(Hofer et al. 1985). O. stewartii is piscivorous, and 

its food could contain more energy than that of 

other Schizothoracinae fishes mentioned above. 

The von Bertalanffy growth coefficient (k) 

is a useful index for addressing the potential 

vulnerability of stocks to excessive mortality 

(Musick 1999). Comparing the parameters of 

some Schizothoracinae fishes, Li and Chen (2009) 

suggested that they are slow-growing species 

with k values of around 0.1. Slow-growing, longlived 

fishes tend to be particularly vulnerable to 

excessive exploitation and exhibit rapid stock 

collapse, after which population turnover may 

be lower than expected, and their responses to 

rehabilitation measures slower than predicted 

(Musick 1999). In this study, the estimated 

maximum age was 25 yr, and the k value was 

around 0.1, indicating that O. stewartii is a slowgrowing, 

long-lived species. Therefore, it is 

essential to establish reasonable management 

practices for this species to allow for its sustainable 

use. First, more scientific work such as 

biological studies, resource investigations, and 

life history studies should be vigorously carried 

out in the near future to accumulate fundamental 

biological data in order to properly manage this 

species; and 2nd, based on these data, new 

fishery regulations should be established, and the 

effectiveness of these regulations assessed by 

the continuous monitoring of stocks. These new 

fishery regulations should focus on a sustainable 

fishing intensity, a minimum catch size, and proper 

fishing methods to prevent overfishing. Prohibiting 

fishing and marketing during the spawning season 

may be 1 way to protect the older classes of O. 

stewartii; finally, local governments should properly 

Table 2. Comparison of growth characters of Schizothoracinae fishes in different studies 

Species Region Age material Sex L∞ (mm) k (year -1 ) t0 Ø Sources 

Schizothorax o’connori Yarlung Tsangpo River Otolith F 492.4 0.1133 -0.5432 4.4389 Yao et al. (2009) 

M 449.0 0.1260 -0.4746 4.4049 

Yarlung Tsangpo River Otolith F 576.9 0.081 -0.946 4.4307 Ma et al. (2010) 

M 499.7 0.095 -0.896 4.3751 

Schizothorax waltoni Yarlung Tsangpo River Otolith F 691.1 0.056 -2.466 4.4273 Qiu and Chen (2009) 

M 689.8 0.051 -3.257 4.3850 

Ptychobarbus dipogon Lhasa River Otolith F 598.66 0.0898 -0.7261 4.5076 Li and Chen (2009) 

M 494.23 0.1197 -0.7296 4.4659 

Schizothorax younghusbandi Yarlung Tsangpo River Otolith F 471.4 0.0789 0.2 4.2439 Chen et al. (2009) 

younghusbandi 

Lhasa River 

M 442.7 0.0738 -1.4 4.1603 

Oxygymnocypris stewartii Yarlung Tsangpo River Otolith F 877.4821 0.1069 0.5728 4.9153 Jia and Chen (2011) 

M 599.3939 0.1686 0.6171 4.7823 

Yarlung Tsangpo River Otolith F 618.2 0.106 0.315 4.6076 Present study 

M 526.8 0.141 0.491 4.5926


193 

guide local customs like “Releasing Day” to protect 

spawning populations and recruitment. 

Acknowledgments: The authors thank the 

Institute of Hydrobiology, Chinese Academy of 

Sciences, Wuhan, China for providing the otolith 

image analysis system. 

REFERENCES 

Beckman DW, CA Wilson. 1995. Seasonal timing of opaque 

zone formation in fish otoliths. In DH Secor, JM Dean, 

SE Campana, eds. Recent developments in fish otolith 

research. Columbia, SC: Univ. of South Carolina Press, 

pp. 27-43. 

Bustos R, Á Luque, JG Pajuelo. 2009. Age estimation and 

growth pattern of the island grouper, Mycteroperca fusca 

(Serranidae) in an island population on the northwest 

coast of Africa. Sci. Mar. 73: 319-328. 

Campana SE. 1984. Lunar cycles of otolith growth in the 

juvenile starry flounder Platichthys stellatus. Mar. Biol. 

80: 239-246. 

Campana SE. 2001. Accuracy, precision and quality control 

in age determination, including a review of the use and 

abuse of age validation methods. J. Fish Biol. 59: 197- 

242. 

Campana SE, J Neilson. 1985. Microstructure of fish otoliths. 

Can. J. Fish Aquat. Sci. 42: 1014-1032. 

Campana SE, SR Thorrold. 2001. Otoliths, increments, and 

elements: keys to a comprehensive understanding of fish 

populations? Can. J. Fish Aquat. Sci. 58: 30-38. 

Cao WX, YY Chen, YF Wu, SQ Zhu. 1981. Origin and 

evolution of schizothoracine fishes in relation to the 

upheaval of the Xizang Plateau. In CAS, ed. The 

comprehensive scientific expedition to the Qinghai-Xizang 

Plateau, studies on the period, amplitude and type of the 

uplift of the Qinghai-Xizang Plateau. Beijing: Science 

Press, pp. 118-130. (in Chinese) 

Cao WX, ZL Deng. 1962. The schizothoracine fishes in the 

region and adjacent area of western Szechwan Province. 

Acta Hydrobiol. Sin. 2: 27-53. (in Chinese) 

Chen F, YF Chen, DK He. 2009. Age and growth of 

Schizopygopsis younghusbandi younghusbandi in the 

Yarlung Zangbo River in Tibet, China. Environ. Biol. Fish. 

28: 155-162. 

Chen Y, DA Jackson, HH Harvey. 1992. A comparison of von 

Bertalanffy and polynomial functions in moldelling fish 

growth data. Can. J. Fish Aquat. Sci. 49: 1228-1235. 

Chen YF. 1998. Study on phylogenetic and distribution pattern 

of the schizothoracine fishes. I Phylogenetic. Acta 

Zootaxon. Sin. 23: 17-25. (in Chinese) 

Chen YF. 2000. Systermatics and resource biology of the 

schizothoracine fishes. PhD dissertation, Chinese 

Academy of Science, Wuhan, China. (in Chinese) 

Chen YF, WX Cao. 2000. Schizothoracinae. In PQ Yue, 

ed. Fauna sinica osteicthtyes cypriniformes III. Beijing: 

Scince Press, pp. 273-388. (in Chinese) 

Granada VP, Y Masuda, T Matsuoka. 2004. Age and growth of 

the yellowbelly threadfin bream Nemipterus bathybius in 

Kagoshima Bay, southern Japan. Fish. Sci. 70: 497-506. 

Grandcourt EM, TZA Abdessalaam, F Francis. 2006. Age, 

growth, mortality and reproduction of the blackspot 

snapper, Lutjanus fulviflamma (Forsskål, 1775), in the 

southern Arabian Gulf. Fish. Res. 78: 203-210. 

Haas RE, CW Recksiek. 1995. Age verification of winter 

flounder in Narragansett Bay. Trans. Am. Fish. Soc. 124: 

103-111. 

He DK, YF Chen. 2007. The molecular phylogeny and biogeography 

of highly specialized Schizothoracinae. Chin. 

Sci. Bull. 52: 303-311. (in Chinese) 

Hofer R, G Krewedl, F Koch. 1985. An energy budget for an 

omnivorous cyprinid: Rutilus rutilus (L.). Hydrobiologia. 

122: 53-59. 

Jia YT, YF Chen. 2009. Otolith microstructure of 

Oxygymnocypris stewartii (Cypriniformes, Cyprinidae, 

Schizothoracinae) in the Lhasa River in Tibet, China. 

Environ. Biol. Fish. 28: 45-52. 

Jia YT, YF Chen. 2011. Age structure and growth characteristics 

of the endemic fish Oxygymnocypris stewartii 

(Cypriniformes: Cyprinidae: Schizothoracinae) in the 

Yarlung Tsangpo River, Tibet. Zool. Stud. 50: 69-75. 

Lehodey P, R Grandperrin. 1996. Age and growth of the 

alfonsino Beryx splendens over the seamounts off New 

Caledonia. Mar. Biol. 125: 249-258. 

Levenberg K. 1944. A method for the solution of certain nonlinear 

problems in least squares. Q. Appl. Math. 2: 164- 

168. 

Li HJ, N Zhang, XT Lin. 2010. Spatio-temporal characteristics 

of Yarlung Zangbo River in Tibet. J. Henan Norm. Univ. 

38: 126-130. (in Chinese) 

Li XQ, YF Chen. 2009. Age structure, growth and mortality 

estimates of an endemic Ptychobarbus dipogon (Regan, 

1905) (Cyprinidae: Schizothoracinae) in the Lhasa River, 

Tibet. Environ. Biol. Fish. 28: 97-105. 

Li XQ, YF Chen, DK He, F Chen. 2009. Otolith characteristics 

and age determination of an endemic Ptychobarbus 

dipogon (Regan, 1905) (Cyprinidae: Schizothoracinae) in 

the Yarlung Tsangpo River, Tibet. Environ. Biol. Fish. 86: 

53-61. 

Liu KM, ML Lee, SJ Joung, YC Chang. 2009. Age and growth 

estimates of the sharptail mola, Masturus lanceolatus, in 

waters of eastern Taiwan. Fish. Res. 95: 154-160. 

Lloyd RE. 1908. Report on the fish collected in Tibet by Capt 

FH and Stewart IMS. Rec. Indian Mus. 2: 341-344. 

Ma BS, CX Xie, B Huo, XF Yang, HP Huang. 2010. Age and 

Growth of a Long-Lived Fish Schizothorax o’connori in the 

Yarlung Tsangpo River, Tibet. Zool. Stud. 49: 749-759. 

Ma BS, CX Xie, B Huo, XF Yang, P Li. 2011. Age validation, 

and comparison of otolith, vertebra and opercular bone for 

estimating age of Schizothorax o’connori in the Yarlung 

Tsangpo River, Tibet. Environ. Biol. Fish. 90: 159-169. 

Mann B, C Buxton. 1997. Age and growth of Diplodus sargus 

capensis and D. cervinus hottentotus (Sparidae) on the 

Tsitsikamma coast, South Africa. Cybium 21: 135-147. 

Marshall SL, SS Parker. 1982. Pattern identification in the 

microstructure of sockeye salmon (Oncorhynchus nerka) 

otoliths. Can. J. Fish Aquat. Sci. 39: 542-547. 

Morales-Nin B, S Ralston. 1990. Age and growth of Lutjanus 

kasmira (Forskål) in Hawaiian waters. J. Fish Biol. 36: 

191-203. 

Morales-Nin B. 2000. Review of the growth regulation 

processes of otolith daily increment formation. Fish. Res. 

46: 53-67. 

Munro JL, D Pauly. 1983. A simple method for comparing the 

growth of fishes and invertebrates. ICLARM Fishbyte 1:

194 


5-6. 

Musick JA. 1999. Ecology and Conservation of Long-lived 

Marine Animals. Am. Fish. Soc. Symp. 23: 1-10. 

Neilson JD, GH Geen. 1982. Otoliths of chinook salmon 

(Oncorhynchus tshawytscha): daily growth increments 

and factors influencing their production. Can. J. Fish 

Aquat. Sci. 39: 1340-1347. 

Ng HH. 2010. Oxygymnocypris stewartii. IUCN Publishing 

Red List of Threatened Species. Available at http://www. 

iucnredlist.org/apps/redlist/details/168408/0 Accessed 

Apr. 2010. 

Pajuelo JG, JM Lorenzo, R Domínguez-Seoane. 2003. Age 

estimation and growth of the zebra seabream Diplodus 

cervinus cervinus (Lowe, 1838) on the Canary Islands 

shelf (central-East Atlantic). Fish. Res. 62: 97-103. 

Pauly D. 1984. Fish population dynamics in tropical waters: a 

manual for use with programmable calculators. Manila, 

the Philippines: International Center for Living Aquatic 

Resources Management. 

Qiu H, YF Chen. 2009. Age and growth of Schizothorax 

waltoni in the Yarlung Tsangpo River in Tibet, China. 

Ichthyol. Res. 56: 260-265. 

Sequeira V, A Neves, AR Vieira, I Figueiredo, LS Gordo. 2009. 

Age and growth of bluemouth, Helicolenus dactylopterus, 

from the Portuguese continental slope. ICES J. Mar. Sci. 

66: 524-531. 

Tserpes G, N Tsimenides. 2001. Age, growth and mortality of 

Serranus cabrilla (Linnaeus, 1758) on the Cretan shelf. 

Fish. Res. 51: 27-34. 

von Bertalanffy L. 1938. A quantitative theory of organic 

growth (inquiries on growth laws II). Hum. Biol. 10: 181- 

213. 

Waldron ME. 1994. Validation of annuli of the South African 

anchovy, Engraulis capensis, using daily otolith growth 

increments. ICES J. Mar. Sci. 51: 233-234. 

Wu YF, CZ Wu, eds. 1992. The fishes of the Qinghai-Xizang 

Plateau. Chengdu, China: Sichuan Publingshing House 

of Science and Technology. (in Chinese) 

Yao JL, YF Chen, F Chen, DK He. 2009. Age and growth of 

an endemic Tibetan fish, Schizothorax o’connori, in the 

Yarlung Tsangpo River. J. Freshw. Ecol. 24: 343-345.


Collection of Pollen Grains by Centris (Hemisiella) tarsata Smith (Apidae: 

Centridini): Is C. tarsata an Oligolectic or Polylectic Species? 

Lia Gonçalves 1 , Cláudia Inês da Silva 2 , and Maria Luisa Tunes Buschini 1, * 

1 

Departamento de Biologia, Univ. Estadual do Centro-Oeste, Rua Presidente Zacarias 875, CEP: 85010-990, Guarapuava (PR), Brasil 

2 

Departamento de Biologia, Univ. de São Paulo, Faculdade de Filosofia Ciências e Letras, Av. Bandeirantes, 3900, 14040-901, Ribeirão 

Preto-SP, Brasil. E-mail:claudiainess@gmail.com 


Lia Gonçalves, Cláudia Inês da Silva, and Maria Luisa Tunes Buschini (2012) Collection of pollen grains 

by Centris (Hemisiella) tarsata Smith (Apidae: Centridini): Is C. tarsata an oligolectic or polylectic species? 

Zoological Studies 51(2): 195-203. Among pollinator species, bees play a prominent role in maintaining 

biodiversity because they are responsible, on average, for 80% of angiosperm pollination in tropical regions. 

The species richness of the bee genus Centris is high in South America. In Brazil, these bees occur in many 

types of ecosystems. Centris tarsata is an endemic species occurring only in Brazil. No previous studies 

considered interactions between plants and this bee species in southern Brazil, where it is the most abundant 

trap-nesting bee. Accordingly, the goals of this study were to investigate plants used by this species for its larval 

food supply and determine if this bee is polylectic or oligolectic in this region. This work was conducted in the 

Parque Municipal das Araucárias, Guarapuava (PR), southern Brazil, from Mar. 2002 to Dec. 2003. Samples of 

pollen were collected from nests of these bees and from flowering plants in grassland and swamp areas where 

the nests were built. All of the samples were treated with acetolysis to obtain permanent slides. The family 

Solanaceae was visited most often (71%). Solanum americanum Mill. (28.6%) and Sol. variabile Mart. (42.4%) 

were the primary pollen sources for C. tarsata in the study area. We found that although C. tarsata visited 

20 species of plants, it preferred Solanum species with poricidal anthers and pollen grains with high protein 

levels. This selective behavior by females of C. tarsata indicates that these bees are oligolectic in their larval 

provisioning in this region of southern Brazil. http://zoolstud.sinica.edu.tw/Journals/51.2/195.pdf 

Key words: Centris (Hemisiella) tarsata, Solanum variabile, Solanum americanum, Provision of pollen grains. 

B ees of the family Apidae can fly long 

distances in tropical forests in search of preferred 

plant species, thus promoting cross-pollination 

(Frankie et al. 1983, Roubik 1993). The plantpollinator 

relationship is symbiotic and establishes 

a beneficial relationship between 2 species with 

different levels of dependency (Boucher et al. 

1982, Del-Claro 2004). According to Faegri and 

Van der Pijl (1979) and Proctor et al. (1996), plantpollinator 

interactions are considered to result from 

natural selection, which produces a wide variety of 

adaptations in plants, allows the transfer of pollen 

grains, and increases gene flow within a species. 

Among pollinator species, bees play an 

important role in maintaining biodiversity. On 

average, they are responsible for 80% of angiosperm 

pollination in tropical regions (Kevan and 

Baker 1983, Bawa 1990). The higher efficiency of 

bees as pollinators results from their high numbers 

compared to other pollinators and from their 

superior adaptations to complex floral structures. 

For example, their bodies and mouthparts are 

adapted to collect and transport resources, such as 

nectar and pollen, respectively (Kevan and Baker 

*To whom correspondence and reprint requests should be addressed. E-mail:liagoncalves22@hotmail.com; isatunes@yahoo.com.br 

195

196 

Gonçalves et al. – Pollen Sources of Centris tarsata 

1983, Michener 2000). 

Some bee species belonging to the tribes 

Tapnotaspidini and Centridini exhibit reproductive 

cycles and nesting activities that are synchronized 

with the flowering periods of certain species 

of plants (Rocha-Filho et al. 2008, Aguiar and 

Melo 2009, Bezerra et al. 2009, Gaglianone et 

al. 2011). These bees visit flowers to obtain oil, 

pollen, nectar, and resin (resources needed to 

build parts of their nests) to feed the larvae and 

maintain adults and their reproductive activities 

(Vogel 1974, Buchmann 1987, Roubik 1989, 

Vinson et al. 1996). Some studies showed the 

importance of these bees as pollinators of various 

species of Neotropical plants (Frankie et al. 

1976, Gottsberger et al. 1988, Freitas 1997), 

including those producing oil, such as species of 

the Malpighiaceae (Rêgo and Albuquerque 1989, 

Freitas et al. 1999) and Scrophulariaceae (Vogel 

and Machado 1991). 

The genus Centris is typically tropical, and 

its species belong to 12 subgenera. The species 

richness of Centris is high in South America. In 

Brazil, these bees are found in various ecosystems, 

such as dunes and sandbanks (Silva 

and Martins 1999, Silva et al. 2001, Viana and 

Alves-dos-Santos 2002), caatinga (Martins 1994, 

Zanella 2000, Aguiar and Almeida 2002, Aguiar et 

al. 2003), grasslands, and savannas (Silveira and 

Campos 1995, Albuquerque and Mendonça 1996). 

Centris tarsata has only been recorded from 

Brazil. The distribution of C. tarsata in Brazil is 

based on Aguiar and Garófalo (2004), information 

from specimens deposited in entomological 

collections (J.M.F. Camargo, pers. commun.), 

samples of females and/or males collected on 

flowers (Camargo and Mazucato 1984, Vogel 

and Machado 1991, Martins 1994, Silveira and 

Campos 1995, Albuquerque and Mendonça 1996, 

Freitas 1997, Schlindwein 1998, Zanella 2000), 

and the location of nests (Chandler et al. 1985, 

Camilo et al. 1995, Silva et al. 2001, Viana et al. 

2001, Aguiar and Martins 2002). This information 

indicates that C. tarsata occurs in the states of PA, 

MA PI, CE, PB, PE, BA, MG, SP, PR, RS, MS, MT, 

and GO. 

In the savanna area of Uberlândia (Minas 

Gerais State, Brazil), C. tarsata was recorded 

as one of the principal pollinators of West Indian 

cherry Malpighia emarginata DC (Malpighiaceae) 

(Vilhena and Augusto 2007). This bee is solitary 

and tends to nest in preexisting cavities. Its 

nests can be built in trap-nests (Silva et al. 2001, 

Aguiar and Garófalo 2004, Buschini and Wolff 

2006). In southern Brazil, C. tarsata is the most 

abundant bee species (Buschini 2006). It prefers 

open habitats and shows greater nesting activity 

during the hot season, especially in Dec. and Jan. 

(Buschini and Wolff 2006). 

Several studies were conducted in Brazil 

to identify sources of pollen used by different 

species of bees and to understand the degree 

of association between bees and the plants that 

they visit. Through an analysis of pollen grains, 

it is possible to identify the main floral resources 

used by bees. This information allows the assessment 

of resource availability in the field and 

the identification of times of resource scarcity 

(Salgado-Labouriau 1961, Ortiz 1994, Bastos et al. 

2003). 

An analysis of the pollen spectrum of C. 

tarsata based on samples from nests in the 

northeastern micro-region of Bahia State, Brazil 

indicated the presence of 17 pollen types from 7 

plant families. These samples, representing an 

assemblage of 5-11 pollen types, identified plants 

used by the bees to feed their offspring (Dórea et 

al. 2009). In Maranhão State, also in northeastern 

Brazil, pollen analyses of C. tarsata showed 

relatively high quantities of pollen grains from 

Banisteriopsis sp. (Malpighiaceae) and Cassia sp. 

(Caesalpiniaceae). 

Centris tarsata is endemic to Brazil. No 

previous studies of the interactions of plants with 

this bee species have been conducted in southern 

Brazil, where it is the most abundant trap-nesting 

bee. The goals of this study were to investigate 

the plants that constitute the larval food supply for 

C. tarsata and determine whether this bee has a 

polylectic or an oligolectic tendency in this region. 


This study was carried out in the Parque 

Municipal das Araucárias, located in the 

municipality of Guarapuava, Paraná State, 

southern Brazil (25°21'06"S, 51°28'08"W). The 

area of the park is approximately 104 ha. The 

vegetation is composed of mixed ombrophilous 

forest (42.75%), gallery forest (10.09%), fields 

(6.8%), swamps (7.13%), and altered areas 

(33.23%). The grasslands are physionomically 

characterized by areas of low grasses and no 

bushes. Species of the families Cyperaceae, 

Leguminosae, Verbenaceae, Compositae, and 

Umbelliferae are the principal plants in this habitat. 

The grasslands are surrounded by Araucaria


197 

forests, dominated by Araucaria angustifolia 

(Coniferae: Araucariaceae). The swamps are 

located in the lowest-elevation regions of the 

park and are primarily composed of grasses and 

members of the Compositae (Buschini and Fajardo 

2010). According to the Köppen clas sification, the 

climate is humid mesothermic, with no dry season 

and mild summers because of the elevation. The 

winter is moderate, with the frequent occurrence 

of frost. The annual mean temperature is approximately 

16°C. 

In this study, pollen grains were removed 

from provisioned cells of 11 nests of C. tarsata 

from a total of 128 trap-nests installed in the 

swamp and grassland areas. Centris tarsata has 

a seasonal pattern of nesting activity from Nov. 

to May (Buschini and Wolff 2006), so the pollen 

grains used in this study were collected from Mar. 

2002 to Dec. 2003. Pollen collected from the 

nests was preserved on permanent slides with the 

acetolysis method (Erdtman 1960). Five pol len 

grain slides were made for each nest to produce a 

total of 55 slides. Pollen grains were also collected 

from flowering plants from May 2006 to Apr. 2007. 

Pollen was collected throughout the area in which 

nests were built. The pollen was removed from 

the flowers and/or buttons of each plant to obtain 

2 slides per plant. All pollen grain slides from 

both nests and plants were examined using light 

microscopy to identify plants used by the bee. The 

pollen was quantified by consecutively counting 

300 pollen grains per slide. Total numbers of 

pollen grains counted were 1500 grains per 

nest and 16,500 grains in all. Subsequently, we 

determined the percentages of occurrence of each 

species and botanical family in C. tarsata nests 

according to the classification of Barth (1970) and 

Louveaux et al. (1970 1978). Thus, pollen types 

were classified as dominant (> 45% of total grain 

on the slides), accessory (15%-45%), important 

isolates (3%-14%), and occasional isolates (< 3%). 

RESULTS 

We collected 99 flowering plant species in the 

study area during the activity period of C. tarsata. 

Overall, 20 pollen types from 17 plant families 

were collected by this bee (Fig. 1, Table 1). 

The family Solanaceae was visited most 

often (71%). Solanum americanum Mill. (28.6%) 

and Sol. variabile Mart. (42.4%) were the primary 

pollen sources for C. tarsata in the study area. 

The 2nd most frequently visited family was the 

Phytolaccaceae. Phytollaca dioica L. supplied 

15.4% of the pollen in the samples. The family 

Malpighiaceae represented 4.5% of the pollen 

in the samples, whereas the families Lauraceae 

(3.2%), Myrthaceae (2.8%), Melastomataceae 

(1.01%), Lythraceae (0.9%), Campanulaceae 

(0.4%), Convolvulaceae (0.2%), Caesalpiniaceae 

(0.16%), Asteraceae (0.1%), Amaranthaceae 

(0.08%), and Polygalaceae (0.07%) occurred at 

low percentages. Erythroxylum deciduum A. St. 

Hil. (0.03%), of the family Erythroxilaceae, and 

another species not yet identified (Undetermined-1) 

(0.01%) appeared in more than 1 sample but at 

low occurrence percentages. Although the pollen 

types of Styrax leprosum Hook and Am. (0.09%) 

and another unidentified species (Undetermined-2) 

(0.04%) were recorded in only 1 sample, their 

percentages were higher than those of Ery. 

deciduum and Undetermined-1. 

The frequencies of occurrence of pollen 

types in the 11 samples analyzed showed that Sol. 

americanum and Sol. variabile (100%) were the 

most consistent, followed by Janusia guaranitica 

and Cinnamomum amoenum (Ness and Mart.) 

Kosterm (60%), Gomphrena elegans Mart., and 

Ipomoea grandifolia Lam. (40%). The 14 other 

pollen types occurred in 10%-30% of samples: 

Phytollaca dioica, Vernonia sp. Schreb, Senna 

multijuga (Rich.) H. S., Cuphea sp. P. Browne 

(30%), Ery. deciduum, Janusia sp. A. Juss, 

Tibouchina cerastifolia Cong, and Undetermined-1 

(20%), and Baccharis sp. L., Lobelia sp. Pohl, 

Ipomoea purpurea (l.) Roth, Campomanesia 

adamantium O. Berg, Polygala sp. L., Sty. 

leprosum Hook. and Arn, and Undetermined-2 

(10%). 

DISCUSSION 

Although C. tarsata used 20 types of pollen 

grains, pollen of Sol. americanum, Sol. variabile, 

and Phy. dioica were most common in the larval 

diet. The importance of the family Solanaceae as 

a source of pollen for C. tarsata was also reported 

by Aguiar et al. (2003) and Dórea et al. (2009) in 

the Caatinga, xerophytic vegetation predominant 

in semi-arid northeastern Brazil. According to 

Buchmann (1983), the presence of poricidal 

anthers in flowers of the Solanaceae establishes 

a close relationship with females of Centris. In 

this plant-pollinator relationship, pollination by 

vibration (buzz-pollination) is an effective method 

of extracting pollen from these plants (Buchmann

198 


(A) (B) (C) 

(D) 

(E) 

(F) 

(G) 

(H) 

(I) 

(J) 

(K) 

(L) 

(M) 

(N) 

(O) 

(P) 

(Q) 

(R) 

(S) 

(T) 

(U) 

2 μm 

Fig. 1. Pollen grains found in nests of Centris tarsata. (A) Gomphrena elegans, (B) Baccharis sp., (C) Vernonia sp., (D) Lobelia sp., (E) 

Ipomoea grandifolia, (F) I. purpurea, (G) Erythroxylum deciduum, (H) Senna multijuga, (I) Cinnamomum amoenum, (J) Cuphea sp., (K) 

Janusia guaranítica, (L) Janusia sp., (M) Tibouchina cerastifolia, (N) Campomanesia adamantium, (O) Phytolacca dioica, (P) Polygala 

sp., (Q) Solanum americanum, (R) Sol. variabile, (S) Styrax leprosum, (T) Undetermined-1, (U) Undetermined-2.


199 

1983). The collection of pollen by vibration 

also occurs on flowers of the Melastomataceae 

(Buchmann and Hurley 1978) and Caesalpiniaceae 

(Moure and Castro 2001). This method of pollination 

is associated with small pollen grains, as 

in Solanum species. These grains have a high 

amount of protein, which is important for larval 

development (Roulston et al. 2000). 

Studies in different Brazilian biomes also 

highlighted the importance of the families 

Solanaceae (Dórea et al. 2009), Malpighiaceae, 

Caesalpiniaceae, and Myrtaceae (Mendes and 

Rego 2007) as sources of pollen for C. tarsata. 

Aguiar et al. (2003), in Itatim (BA), northeastern 

Brazil, recorded the presence of pollen of the 

Caesalpiniaceae in the diet of C. tarsata offspring. 

Senna Mill. was also found to represent a frequent 

source of pollen and nectar for this bee. Plants of 

this genus are also associated with a mechanism 

of pollination by vibration (Santos et al. 2004, 

Anacleto and Marchini 2005, Andena et al. 2005). 

Moreover, Aguiar et al. (2003) stated that solitary 

bees, such as species of Centris, are more likely to 

act as generalists during foraging for nectar than 

Table 1. Occurrence of pollen grain types in nests of Centris tarsata: pollen accessory (PA), pollen important 

isolate (PII), pollen occasional isolate (POI) 

Pollen type 

Resources 

available 

Life form Local occurrence Month of 

collection 

Percent Classification of 

occurrence on pollen types 

slides 

Amaranthaceae 

Gomphrena elegans Mart. - Herb Swamp Mar. 0.08% POI 

Asteraceae 

Baccharis sp. L. Pollen, nectar Shrub Grassland Feb., Mar. 0.04% POI 

Vernonia sp. Schreb. Pollen, nectar Tree Forest Oct. 0.06% POI 

Campanulaceae 

Lobelia sp. Pohl. Herb Swamp Feb. 0.4% POI 

Convolvulaceae 

Ipomoea grandifolia Lam. Pollen Liana Swamp Mar. 0.13% POI 

Ipomoea purpúrea (l.) Roth. Pollen Liana Swamp Mar. 0.07% POI 

Erythroxilaceae 

Erythroxylum deciduum A. St. Hil. Pollen, nectar Shrub Grassland Sept. 0.03% POI 

Caesalpiniaceae 

Senna multijuga (Rich.) H. S. Pollen, nectar Tree Grassland Feb. 0.16% POI 

Lauraceae 

Cinnamomum amoenum (Nees) Kosterm. Pollen Tree Forest Oct. 3.2% PII 

Lythraceae 

Cuphea sp. P. Browne. Pollen, nectar Herb Swamp Apr. 0.9% POI 

Malpighiaceae 

Janusia guaranítica (A. St.-Hil.) A. Juss. Pollen, oil Herb Grassland Dec. 3.2% PII 

Janusia sp. A. Juss. Pollen, oil - - - 1.3% POI 

Melastomataceae 

Tibouchina cerastifolia Cong. Pollen, oil Herb Grassland Jan., Feb. 1.01% POI 

Myrtaceae 

Campomanesia adamantium O. Berg. Pollen Tree Grassland Oct. 2.8% POI 

Phytolaccaceae 

Phytolacca dioica L. Pollen Tree Grassland, forest Oct. 15.4% PA 

Polygalaceae 

Polygala sp. L. Pollen, nectar - - - 0.07% POI 

Solanaceae 

Solanum americanum Mill. Pollen Herb Grassland, Mar. 28.6% PA 

swamp 

Solanum variabile Mart. Pollen Tree Grassland Nov. 42.4% PA 

Styracaceae 

Styrax leprosum Hook. and Arn. Pollen, nectar Tree Forest Oct. 0.09% POI 

Undetermined-1 - - - - 0.04% POI 

Undetermined-2 - - - - 0.01% POI

200 


during foraging for pollen and oil. Those authors 

also stated that the exploitation of resources from 

the families Caesalpiniaceae and Malpighiaceae is 

frequently found in different biomes. 

In Salinas (MG), southeastern Brazil, 

Guimarães (2006) found that the family Myrtaceae 

was visited by several species of Centris. Similar 

results were obtained in the São Francisco Valley 

of Brazil by Siqueira et al. (2005), who reported a 

high frequency of Centris and Xylocopa visitation 

to flowers of this family. Pollen is the primary 

resource provided by this family for bees, which 

are probably its most efficient pollinators (Gressler 

et al. 2006). In these plants, pollination also 

occurs by vibration, although the anthers exhibit 

longitudinal dehiscence and are not poricidal 

(Proença 1992). 

Although the percentage of pollen from plants 

of the family Malpighiaceae in the diet of C. tarsata 

in Guarapuava was low (4.5%), this finding does 

not mean that these plants have little importance 

as resource suppliers for these bees. According to 

Anderson (1979), Vogel (1990), and Ramalho and 

Silva (2002), a close relationship between bees 

of the tribe Centridini and plants of this family can 

be interpreted as a product of a long evolutionary 

history of interactions between the 2 groups. This 

history could even explain the high reproductive 

success of these plants in the Americas. The 

plants provide both oil and pollen to feed the larvae 

of these bees. They bloom almost year-round, but 

the flowers are more highly abundant during the 

warm and rainy period (Silberbauer-Gottsberger 

and Gottsberger 1988). In the Brazilian savanna 

(i.e., the cerrado), the nesting and foraging 

activities of the Centridini are generally more 

frequent during the period of peak flowering of 

the Malpighiaceae (Rocha-Filho et al. 2008). The 

Centridini is considered to be key pollinators of 

this plant family (Michener 2000, Machado 2002 

2004, Machado et al. 2002, Alves dos Santos et al. 

2007). The system of oil production in these plants 

and collection of the oil by the bees require a 

series of morphological adaptations in both groups 

and behavioral adaptations by the bees (Simpson 

and Neff 1977). The oil, the primary resource 

that attracts the bees to the plants, is secreted by 

glands called elaiophores (Vogel 1974, Simpson 

and Neff 1981) and is included in the diet of larval 

bees. 

In the Malpighiaceae, pollen grain sizes 

usually range from medium to large. Pollen of 

Janusia occurred in small quantities in bee nests, 

but these quantities were considerably higher than 

those found for Sol. americanum, Sol. variabile, 

and Phy. dioica. According to Severson and 

Parry (1981), measurements of a pollen sample 

should be representative of the mass of pollen by 

including the average number of grains counted 

and should also reflect the estimated volumetric 

contribution of the grain type. Thus, the degree 

of importance of 1 type of pollen grain should 

not be based solely on its percentage but should 

also include both its numeric and volumetric 

representation in the sample. 

The sporadic presence of pollen of the 

Melastomataceae in nests of C. tarsata in 

Guarapuava may reflect the tendency of the bees 

to seek the oil of these plants to build their nests. 

When collecting the oil, they place their ventral 

abdomen and thorax on the stigma and anthers of 

the flowers. This behavior facilitates the transfer 

of pollen to the stigma (Gimenes and Lobão 

2006) and also results in the transport of small 

amounts of pollen from the plants to the bees’ 

nests. In studies in Camaçari (BA), northeastern 

Brazil, Oliveira-Rebouças and Gimenes (2004) 

observed that medium- and large-sized species 

of Centris were highly efficient at collecting pollen 

from flowers of the Melastomataceae. In the study 

region, the use of pollen of the Convolvulaceae 

(e.g., Ipomoea) by Centris may be related to the 

morphology of the pollen grains. These grains 

are large-sized, are porate and colpate with a 

perforated exine, and are spiculated and hairy. 

The spine characteristic of this genus assists in 

the attachment of pollen grains to the hair of bees, 

thereby optimizing the transport process (Machado 

and Melhem 1987, Sengupta 1972, Leite et al. 

2005). 

The occurrence of pollen from the 

Phytolaccaceae, Lauraceae, and Styracaceae 

in the diet of C. tarsata may be related to the 

bees’ search for resources in plants located in 

transitional areas between the grassland and 

Araucaria forest. These areas are close to sites 

where the bees nest. Frankie et al. (1983) also 

observed many species of Centris foraging in the 

canopy of mass-flowering tree species. 

Although C. tarsata was found to visit 20 

species of plants, it preferred Solanum species 

with poricidal anthers and pollen grains with high 

amounts of protein. This selective behavior by 

females of C. tarsata indicates that this bee is 

oligolectic in its larval provisioning in this region 

of southern Brazil. Because C. tarsata occurs in 

areas of natural grasslands and collects pollen from 

plants in transition zones between these areas and


201 

Araucaria forest, these bees undoubtedly promote 

the pollination of various plant species in these 

areas that are currently suffering from severe 

exploitation and fragmentation in southern Brazil. 

Further studies should be conducted to investigate 

the ability of these bees to explore different 

grassland fragments in this region and transport 

pollen grains between them, thereby increasing 

the genetic variability of the region’s plants. 

Acknowledgments: Partial support was provided 

by Fundação Araucária (The State of Paraná 

Research Foundation) and UNICENTRO (Univ. 

Estadual do Centro-Oeste). We thank Prof. Dr. J. 

Cordeiro for plant identification. 

REFERENCES 

Aguiar AJC, CF Martins. 2002. Abelhas e vespas solitárias 

em ninhos-armadilha na Reserva Biológica Guaribas 

(Mamanguape, Paraíba, Brasil). Rev. Bras. Zool. 19: 

101-116. 

Aguiar AJC, GAR Melo. 2009. Notes on oil sources for 

the bee genus Caenonomada (Hymenoptera, Apidae, 

Tapinotaspidini). Rev. Bras. Entomol. 53: 154-156. 

Aguiar CML, GF Almeida. 2002. Atividade diária de coleta de 

óleo por espécies de Centris (Hymenoptera: Apidae) em 

Mcvaughia bahiana W.R. Anderson (Malpighiaceae) na 

caatinga. Acta Biol. Leop. 24: 131-140. 

Aguiar CML, CA Garófalo. 2004. Nesting biology of Centris 

(Hemisiella) tarsata Smith (Hymenoptera, Apidae, 

Centridini). Rev. Bras. Zool. 21: 477-486. 

Aguiar CML, FCV Zanella, CF Martins, CAL Carvalho. 2003. 

Plantas visitadas por Centris spp. (Hymenoptera: Apidae) 

na caatinga para obtenção de recursos florais. Neotrop. 

Entomol. 32: 247-259. 

Albuquerque PMC, JAC Mendonça. 1996. Anthophoridae 

(Hymenoptera, Apoidea) e Flora associada em uma 

formação de cerrado no município de Barreirinhas, Ma, 

Brasil. Acta Amazôn. 26: 45-54. 

Alves-dos-Santos I, IC Machado, MC Gaglione. 2007. História 

natural das abelhas coletoras de óleo. Oecol. Bras. 11: 

242-255. 

Anacleto DA, LC Marchini. 2005. Análise faunística de abelhas 

(Hymenoptera, Apoidea) coletadas cerrado do Estado de 

São Paulo. Acta Sci. Biol. Sci. 27: 277-284. 

Andena SR, LR Bego, MR Mechi. 2005. A Comunidade de 

abelhas (Hymenoptera, Apoidea) de uma área de cerrado 

(Corumbataí, SP) e suas visitas às flores. Rev. Bras. 

Zoociênc. 7: 55-91. 

Anderson WR. 1979. Floral conservatism in Neotropical 

Malpighiaceae. Biotropica 11: 219-223. 

Barth OM. 1970. Análise microscópica de algumas amostras 

de mel. Pólen dominante. Anais Acad. Bras. Ciênc. 42: 

351-366. 

Bastos EMAF, VM Silveira, AEE Soares. 2003. Pollen 

spectrum of honey produced in cerrado areas of Minas 

Gerais State (Brazil). Braz. J. Biol. 63: 599-615. 

Bawa KS. 1990. Plant-pollinator interactions in tropical rain 

forests. Ann. Rev. Ecol. Syst. 21: 399-422. 

Bezerra ES, AV Lopes, IC Machado. 2009. Biologia 

reprodutiva de Byrsonima gardnerana A. Juss. 

(Malpighiaceae) e interações com abelhas Centris 

(Centridini) no Nordeste do Brasil. Rev. Bras. Bot. 32: 95- 

108. 

Boucher DH, S James, KH Keeler. 1982. The ecology of 

mutualism. Ann. Rev. Ecol. Syst. 13: 315-347. 

Buchmann SL. 1983. Buzz pollination in angiosperms. In 

CE Jones, RJ Little, eds. Handbook of experimental 

pollination biology. New York: Scientific and Academic 

Editions, pp. 73-113. 

Buchmann SL. 1987. The ecology of oil flowers and their 

bees. Ann. Rev. Ecol. Syst. 18: 343-369. 

Buchmann SL, JP Hurley. 1978. A biophysical model for buzz 

pollination in angiosperms. J. Theor. Biol. 72: 639-657. 

Buschini MLT. 2006. Species diversity and community 

structure in trap-nesting bees in southern Brazil. 

Apidologie 37: 58-66. 

Buschini MLT, S Fajardo. 2010. Biology of the solitary wasp 

Trypoxylon (Trypargilum) agamemnon Richards 1934 

(Hymenoptera: Crabronidae) in trap-nests. Acta Zool- 

Stockh. 91: 426-432. 

Buschini MLT, LL Wolff. 2006. Biologia de nidificação de 

Centris (Hemisiella) tarsata Smith no Sul do Brasil 

(Hymenoptera, Apidae, Centridini). Braz. J. Biol. 66: 

1091-1101. 

Camargo JMF, M Mazucato. 1984. Inventário da apifauna e 

flora apícola de Ribeirão Preto, SP - Brasil. Dusenia 14: 

55-87. 

Camillo E, CA Garófalo, JC Serrano, G Muccillo. 1995. Diversidade 

e abundância sazonal de abelhas e vespas 

solitárias em ninhos-armadilha (Hymenoptera, Apocrita, 

Aculeata). Rev. Bras. Entomol. 39: 459-470. 

Chandler L, JAF Barrigosi, EBS Diaz. 1985. The first definitive 

host record for Leucospis cayennensis Westwood 

(Hymenoptera: Leucospidae). Rev. Ceres 32: 170-174. 

Del-Claro K. 2004. Multitrophic relationships, conditional 

mutualisms, and the study of interaction biodiversity in 

tropical savannas. Neotrop. Entomol. 33: 665-672. 

Dórea MC, FAR Santos, LCL Lima, LER Figueroa. 2009. 

Análise Polínica do Resíduo Pós-Emergência de 

Ninhos de Centris tarsata Smith (Hymenoptera: Apidae, 

Centridini). Neotrop. Entomol. 38: 197-202. 

Erdtman G. 1960. The acetolized method. A revised 

description. Svensk Bot. Tidskrift 54: 561-564. 

Faegri K, L Van der Pijl. 1979. The principles of pollination 

ecology. 3rd ed. Oxford: Pergamon Press, 244 pp. 

Frankie GW, PA Opler, KS Bawa. 1976. Foraging behaviour of 

solitary bees: implications for outcrossing of a Neotropical 

forest tree species. J. Ecol. 64: 1049-1057. 

Frankie GW, SB Vinson, PA Opler. 1983. Centris aethyctera 

and Centris fuscata in the lowland dry forest of Costa Rica 

(Hymenoptera: Anthophoridae). In DH Janzen, ed. Costa 

Rica Natural History. Chicago, Univ. Press, pp. 707-708. 

Freitas BM. 1997. Number and distribution of cashew 

(Anacardium occidentale) pollen grains on the bodies 

of its pollinators, Apis mellifera and Centris tarsata. J. 

Apicult. Res. 36: 15-22. 

Freitas BM, JE Alves, GF Brandão, ZB Araujo. 1999. 

Pollination requirements of West Indian cherry (Malpighia 

emarginata) and its putative pollinators, Centris bees. J. 

Agric. Sci. 133: 303-311. 

Gaglianone MC, AJC Aguiar, F Vivallo, I Alves-dos-Santos. 

2011. Checklist das Abelhas Coletoras de Óleos do

202 


Estado de São Paulo, Brasil. Biot. Neotrop., 11: 1-10. 

(Online Edição em Inglês) 

Gimenes M, CS Lobão. 2006. A polinização de Krameria 

bahiana B.B. Simpson (Krameriaceae) por abelhas 

(Apidae) na restinga, BA. Neotrop. Entomol. 35: 440-445. 

Gottsberger G, JMF Camargo, I Silberbauer-Gottsberger. 

1988. A bee-pollinated tropical community: the beach 

dune vegetation of Ilha de São Luís, Maranhão. Braz. 

Bot. Jahrb. Syst. 109: 469-500. 

Gressler E, MA Pizo, L Patrícia, C Morellato. 2006. Polinização 

e dispersão de sementes em Myrtaceae do Brasil. Rev. 

Bras. Bot. 29: 509-530. 

Guimarães RA. 2006. Abelhas (Hymenoptera: Apoidea) 

visitantes das flores da goiaba (Psidium guajava L.), 

laranja (Citrus sinensis L.) e tangerina (Citrus reticulata 

B.) em pomares comerciais em Salinas - MG. Vitória da 

Conquista, BA: Univ. Estadual do Sudoeste da Bahia. 

Kevan PG, HG Baker. 1983. Insects as flower visitors and 

pollinators. Ann. Rev. Entomol. 28: 407-453. 

Leite KRB, R Simão-Bianchini, FAR Santos. 2005. Morfologia 

polínica do gênero Merremia Dennst. (Convolvulaceae) 

ocorrentes no Estado da Bahia, Brasil. Acta Bot. Bras. 

19: 313-321. 

Louveaux J, A Maurizio, G Vorwohl. 1970. Methods of 

melissopalynology. Bee World 51: 25-138. 

Louveaux J, A Maurizio, G Vorwohl. 1978. Methods of 

melissopalynology. Bee World 59: 139-157. 

Machado IC. 2002. Flores de óleo e abelhas coletoras de óleo 

floral: conceitos, distribuição e revisão. Ribeirão Preto, 

SP, BR.: Anais do V Encontro Sobre Abelhas, pp. 129- 

135. 

Machado IC. 2004. Oil-collecting bees and related plants: a 

review of the studies in the last twenty years and case 

histories of plants occurring in NE Brazil. In BM Freitas, 

JOP Pereira, eds. Solitary bees. Conservation, rearing 

and management for pollination. Fortaleza, CE, BR: 

Imprensa Univ., pp. 255-281. 

Machado IC, TS Melhem. 1987. Morfologia polínica de 

Ipomoea hederifolia L. e I. quamoclit L. (Convolvulaceae). 

Hoehnea 14: 25-30. 

Machado IC, S Vogel, AV Lopes. 2002. Pollination of 

Angelonia cornigera Hook. (Scrophulariaceae) by longlegged 

oil-collecting bees in NE Brazil. Plant. Biol. 4: 352- 

359. 

Martins CF. 1994. Comunidade de abelhas (Hym., Apoidea) 

da caatinga e do cerrado com elementos de campo 

rupestre do Estado da Bahia, Brasil. Rev. Nord. Biol. 9: 

225-257. 

Mendes FN, MMC Rêgo. 2007. Nidificação de Centris 

(Hemisiella) tarsata Smith (Hymenoptera, Apidae, 

Centridini) em ninhos-armadilha no Nordeste do 

Maranhão, Brasil. Rev. Bras. Entomol. 51: 382-388. 

Michener CD. 2000. The bees of the World. Baltimore, MD: 

Johns Hopkins Univ. Press, 913 pp. 

Moure JS, MS Castro. 2001. Uma nova espécie de Centris 

Fabricius (Hymenoptera, Apoidea, Anthophoridae) do 

Nordeste do Brasil. Rev. Bras. Zool. 18: 329-333. 

Oliveira-Rebouças P, M Gimenes. 2004. Abelhas (Apoidea) 

Visitantes de Flores de Comolia ovalifolia DC Triana 

(Melastomataceae) em uma Área de Restinga na Bahia. 

Neotrop. Entomol. 33: 315-320. 

Ortiz PL. 1994. The Cistaceae as food resources for honey 

bees in SW Spain. J. Apic. Res. 33: 136-144. 

Proctor M, P Yeo, A Lack. 1996. The natural history of 

pollination. London: Harper Collins Publishers, 496 pp. 

Proença CEB. 1992. Buzz pollination older and more 

widespread than we think? J. Trop. Ecol. 8: 115-120. 

Ramalho M, M Silva. 2002. Flora oleífera e sua guilda de 

abelhas em uma comunidade de restinga tropical. Rev. 

Univ. Estadual Feira Santana Bras. 2: 34-43. 

Rêgo MMC, PMC Albuquerque. 1989. Comportamento das 

abelhas visitantes de murici, Byrsonima crassifolia (L.). 

Kunth, Malpighiaceae. Bol. Mus. Para. Emílio Goeldi. 

Sér. Zool. 5: 179-193. 

Rocha-Filho LC, CI Silva, MC Gaglianone, SC Augusto. 2008. 

Nesting behavior and natural enemies of Epicharis 

(Epicharis) bicolor Smith, 1854 (Hymenoptera: Apidae). 

Trop. Zool. 21: 227-242. 

Roubik DW. 1989. Ecology and natural history of tropical 

bees. Cambridge Tropical Biology Series. New York: 

Cambridge Univ. Press, 514 pp. 

Roubik DW. 1993. Tropical pollinators in the canopy and 

understory - field data and theory for stratum preferences. 

J. Insect Behav. 6: 659-673. 

Roulston TH, JH Cane, SL Buchmann. 2000. What governs 

protein content of pollen: pollinator preferences, pollenpistil 

interactions, or phylogeny? Ecol. Monogr. 70: 617- 

643. 

Salgado-Labouriau ML. 1961. Pollen grains of plants of the 

“Cerrado” I. Ann. Acad. Bras. Cienc. 33: 119-130. 

Santos FM, CAL Carvalho, RF Silva. 2004. Diversidade 

de abelhas (Hymenoptera: Apoidea) em uma área de 

transição Cerrado-Amazônia. Acta Amazon. 34: 319-328. 

Schlindwein C. 1998. Frequent oligolecty characterizing a 

diverse bee-plant community in a xerophytic bushland of 

subtropical Brazil. Stud. Neotrop. Fauna E 33: 46-59. 

Sengupta S. 1972. On the pollen morphology of Convolvulaceae 

with special reference to taxonomy. Rev. 

Palaeobot. Palynol. 13: 157-212. 

Severson DW, JE Parry. 1981. A chronology of pollen 

collection by honeybees. J. Apic. Res. 20: 97-103. 

Silberbauer-Gottsberger I, G Gottsberger. 1988. A polinização 

de plantas do cerrado. Rev. Bras. Biol. 48: 651-663. 

Silva FO, BF Viana, EL Neves. 2001. Biologia e Arquitetura 

de ninhos de Centris (Hemisiella) tarsata Smith 

(Hymenoptera: Apidae: Centridini). Neotrop. Entomol. 30: 

541-545. 

Silva MCM, C Martins. 1999. Flora apícola e relações tróficas 

de abelhas (Hymenoptera: Apoidea) em uma área 

de duna (praia de Interlagos, Cabedelo - PB, Brasil). 

Principia 7: 40-51. 

Silveira FA, MJO Campos. 1995. A mellissofauna de 

Corumbataí (SP) e Paraopeba (MG) e uma análise 

da biogeografia das abelhas do cerrado brasileiro 

(Hymenoptera, Apoidea). Rev. Bras. Entomol. 39: 371- 

401. 

Simpson BB, JL Neff. 1977. Krameria, free-fatty acids and oilcollecting 

bees. Nature 267: 150-151. 

Simpson BB, JL Neff. 1981. Floral rewards: alternatives to 

pollen and nectar. Ann. MO Bot. Gard. 68: 301-322. 

Siqueira KMM, CF Martin, C Schlindwein, LHP Kill. 2005. 

Polinizadores efetivos da goiaba (Psidium guajava) em 

área irrigada do submédio do vale do São Francisco. 

Ann. Enc. Zool. Nord. 15: 260. 

Viana BF, I Alves-dos-Santos. 2002. Bee diversity of the 

coastal sand dunes of Brazil. In PG Kevan, VL Imperatriz- 

Fonseca, eds. Pollinating bees: the conservation link 

between agriculture and nature. Brasília, BR: Ministério


203 

do Meio Ambiente, pp. 135-153. 

Viana BF, FO Silva, AMP Kleinert. 2001. Diversidade e 

sazonalidade de abelhas solitárias (Hymenoptera: 

Apoidea) em dunas litorâneas no nordeste do Brasil. 

Neotrop. Entomol. 30: 245-251. 

Vilhena AMGF, SC Augusto. 2007. Polinizadores da aceroleira 

Malpighia emarginata DC (Malpighiaceae) em área de 

Cerrado no Triângulo Mineiro. Biosci. J. 23: 14-23. 

Vinson SB, GW Frankie, HJ Williams. 1996. Chemical ecology 

of bees of the genus Centris (Hymenoptera: Apidae). Fla. 

Entomol. 79: 109-129. 

Vogel S. 1974. Ölblumen und ölsammelnde Bienen. Trop. 

Subtrop. Pflanz. 7: 285-369. 

Vogel S. 1990. History of the Malpighiaceae in the light of 

pollination ecology. Memoir. NY Bot. Gard. 55: 130-142. 

Vogel S, ICS Machado. 1991. Pollination of four sympatric 

species of Angelonia (Scrophulariaceae) by oil-collecting 

bees in NE, Brasil. Plant. Syst. Evol. 178: 153-178. 

Zanella FCV. 2000. The bees of the Caatinga (Hymenoptera, 

Apoidea, Apiformes): a species list and comparative notes 

regarding their distribution. Apidologie 31: 579-592.


Monogamous System in the Taiwan Vole Microtus kikuchii Inferred from 

Microsatellite DNA and Home Ranges 

Jung-Sheng Wu, Po-Jen Chiang, and Liang-Kong Lin* 

Department of Life Science, Tunghai Univ., 181 Taichung Port Road, Sec. 3, Taichung 407, Taiwan 


Jung-Sheng Wu, Po-Jen Chiang, and Liang-Kong Lin (2012) Monogamous system in the Taiwan vole 

Microtus kikuchii inferred from microsatellite DNA and home ranges. Zoological Studies 51(2): 204-212. The 

Taiwan vole Microtus kikuchii is considered socially monogamous based on indirect information of captive 

behaviors and home-range ecology. Genetic components of its mating system were not previously examined. 

We tested the hypotheses that M. kikuchii is both socially and genetically monogamous by combining field 

information of home ranges with genetic analysis of relationships among individuals. Trapping was conducted 

in the Hehuan Mt. area of Taroko National Park, central Taiwan, from June 2004 to Aug. 2005. We chose 16 

microsatellite loci using primers designed for M. oeconomus and M. montebelli to amplify M. kikuchii DNA. 

Eleven loci produced clear, polymorphic banding patterns and were used for the genetic analysis. The homerange 

sizes of adults did not significantly differ between sexes or among seasons. For the 14 social units 

indicated by overlapping home ranges, 11 (78.6%) were male-female pairs. The other 3 social units involved 

more than 2 individuals. In two of these, ranges of a male-female pair overlapped ranges of their offspring and 

other individuals. The genetic analysis revealed that some of the male-female pairs identified by overlapping 

home ranges did not reproduce. Information based on the home-range data was not powerful enough to 

identify genetic components of M. kikuchiiʼs mating system and may provide misleading results. A parentage 

analysis based on microsatellite genotyping revealed litters (with a total 31 of offspring) sired by 18 males and 

20 females. The only 2 males that fathered more than 1 litter did so in different years when their 1st mate was 

no longer present. None of the 9 litters with multiple offspring had more than 1 father. Home-range overlap was 

mostly between a single male and a single female and with their offspring. All pairs producing offspring were 

genetically monogamous. Our results strongly support the hypotheses that M. kikuchii is socially and genetically 

monogamous. http://zoolstud.sinica.edu.tw/Journals/51.2/204.pdf 

Key words: Genetic monogamy, Home range, Parentage analysis, Social monogamy. 

Mating systems of mammals can be defined 

as monogamous, polygynous, polyandrous, or 

promiscuous based on the number of partners 

each individual has (Wittenberger 1979, Clutton- 

Brock 1989). In the past, a species’ mating system 

was indirectly determined by sexual dimorphism, 

space use, and mating behaviors (Emlen and 

Oring 1977, Getz and Hofmann 1986, Carter et 

al. 1995). Monogamy occurs in < 3% of mammal 

species (Kleiman 1977) and has attracted much 

research interest. Traditional ways to determine 

monogamy include 1) pair bonds between males 

and females in reproductive and non-reproductive 

seasons (Carter et al. 1995), 2) aggressive 

behaviors toward strange individuals (Carter et 

al. 1995, Back et al. 2002), 3) bi-parental care 

(Solomon 1993a, Patris and Baudoin 2000), 4) 

regulation of social factors (e.g., estrus induction) 

(Carter et al. 1995), 5) the same home range sizes 

for males and females (Gaulin and FitzGerald 

1988), and 6) shared use of a territory (e.g., 

strong overlap in home ranges) (Reichard 2003). 

* To whom correspondence and reprint requests should be addressed. Po-Jen Chiang and Liang-Kong Lin contributed equally to this 

work. Tel: 886-4-23595845. Fax: 886-4-23595845. E-mail:lklin@thu.edu.tw 

204

Wu et al. – Monogamy of Taiwan Voles 205 

These traditional methods provide clues for social 

monogamy, but not for genetic monogamy. Social 

monogamy indicates that 1 male and 1 female 

show social living behavior, but it infers no sexual 

or reproductive patterns (Reichard 2003). Genetic 

monogamy is when 1 male and 1 female have an 

exclusive reproductive relationship, and there are 

no extra-pair copulations (Reichard 2003). 

With the development of molecular genetic 

techniques, genetic data are being used to examine 

mating systems (Queller et al. 1993, Avise 

1994). Social mating systems may differ from 

genetic mating systems (Clutton-Brock and Isvaran 

2006). In small mammals, for example, Neotoma 

cinerea in North America was thought to be socially 

polygynous based on sexual dimorphism and 

female clustering (Finley 1958, Escherich 1981). It 

was identified as genetically monogamous using 

DNA fingerprinting techniques (Topping and Millar 

1998). In contrast, socially monogamous species 

were found to engage in extra-pair copulations 

suggesting they are not genetically monogamous. 

These include the genetically promiscuous 

Apodemus sylvaticus in the UK (Baker et al. 1999) 

and the genetically polygynous A. argenteus 

in Japan (Ohnishi et al. 2000). Peromyscus 

polionotus (Foltz 1981) and P. californicus (Ribble 

1991); however, are both socially and genetically 

monogamous. To distinguish between social and 

genetic components of a mating system (Hughes 

1998), monogamous mating systems should be 

examined with field observations and genetic 

analyses that indicate parentage of offspring and 

rule out extra-pair copulations (Kraaijeveld-Smit 

2004). 

In Microtus species occurring in the New 

and Old Worlds (Hoffmann and Koeppl 1985), 

promiscuousness and polygyny are common, 

but monogamy is rare (Wolff 1985). Microtus 

kikuchii is the only Microtus species endemic to 

Taiwan. It is the southernmost Old World Microtus 

species (Hoffmann and Koeppl 1985). It lives in 

diverse habitats, such as grasslands, scrub, and 

forests, including coniferous, broadleaf, and mixed 

coniferous and broadleaf forests. It is mainly 

found at elevations of > 2000 m in alpine habitats 

of coniferous forests and Yushan cane (Yushania 

niitakayamensis) grasslands. The reproductive 

season is from Mar. to Aug. (Lu 1991). Chen et 

al. (2006) studied the behavior of M. kikuchii in 

captivity, and found that when given the freedom 

to choose, it spent significantly more time with its 

mated partner than with strange individuals. They 

also observed paternal care of offspring. Wu 

(1998) studied the home ranges of M. kikuchii 

using radio-tracking and field trapping. He found 

that home range sizes did not differ between males 

and females, only opposite sexes had overlapping 

ranges, and each range overlapped with only 

1 individual of the opposite sex. Those results 

suggest social monogamy. To date; however, there 

has been no study of the genetic components of M. 

kikuchii mating systems. 

Parental care by both parents and pairing 

exclusivity are supporting behavioral components 

of monogamy (Solomon 1993b, Carter et al. 

1995, Patris and Baudoin 2000). These homerange 

and behavioral observational studies led 

us to hypothesize that M. kikuchii is socially and 

genetically monogamous. Since microsatellite 

DNA can be sensitive enough to identify parental 

relationships, relatedness, and dispersal rates 

(Scribner and Pearce 2000), we used microsatellite 

DNA and capture-recapture methods to identify 

consistencies between the social and genetic 

mating systems of M. kikuchii. We tested the 

following predictions: 1) adult home-range sizes 

do not significantly differ between sexes, 2) homerange 

overlaps among adults during reproductive 

seasons are extensive or exclusive to a single 

individual of the opposite sex, and 3) there is a 

lack of evidence of males mating with more than 1 

female at the same time (both females alive) or of 

litters sired by multiple males. 

Trapping 


Trapping was carried out from June 2004 to 

Sept. 2005 in the Hehuan Mt. area (121°17'17.4"E, 

24°08'36.4"N) of Taroko National Park, central 

Taiwan. The elevation is about 3000 m. The 

dominant vegetation is Yushan cane grassland. 

Sherman traps baited with sweet potato were 

set up in a 4-ha (200 × 200-m) grid. To reduce 

trapping mortality and help retain warmth in cold 

months, balled-up wads of shredded paper were 

put in front of the trigger of each Sherman trap. 

Previous trapping results with 10-m trap spacing in 

the same Hehuan Mt. area revealed mean home 

range sizes of 447.9 m 2 in spring, 423.4 m 2 in 

summer, 258.3 m 2 in fall, and 210.6 m 2 in winter 

with no statistical differences among seasons or 

between sexes (Wu 1998). Radio-tracking of 8 

individuals for at least 24 h of continuous tracking 

revealed a mean home range size of 843 m 2


(202-2260 m 2 ) and a > 20-m movement distance 

between radio locations in a single day (average 

47.5 m, range 22-89 m) (Wu 1998). To maximize 

the number of individuals trapped, we chose a 

20-m trap spacing to form a 40,000-m 2 grid with 

121 Sherman traps. In an attempt to catch all 

members of each family group, we trapped 5 

successive nights each month using the capturerecapture 

method. Because activity of M. kikuchii 

peaks at 04:00-10:00 and 16:00-21:00 (Wu 1998), 

we checked traps 3 times a day at 05:00-07:00, 

09:00-11:00, and 19:00-22:00. 

We used toe-clipping to mark each vole 

the 1st time it was caught. Clipped toes and 

additionally clipped pieces of the left ear and tail 

were preserved in 99.9% alcohol for the genetic 

analysis. For each capture, we recorded the trap 

site, individual number, sex, age, body weight, 

and reproductive status (e.g., whether the female 

nipple size indicated it was pregnant or lactating 

and whether a male had descended testes). 

Adults were distinguished from immature voles by 

the reproductive condition or weight (adult > 30 g). 

Home-range size and overlap 

Adult individuals captured more than 10 times 

(Swilling and Wooten 2002) and residing over a 

month within the trapping grid (i.e., trapped in at 

least 2 different but not necessarily consecutive 

monthly trap sessions) were considered residents 

and used for the home-range analysis. Although 

Seaman et al. (1999) suggested ≥ 30 relocations 

for a home range to reduce bias, it was almost 

impossible to achieve this number of trapping 

locations because of our regime of 4 trap nights 

per month and the short life of voles. Therefore, 

we calculated home ranges for individuals 

captured in at least 2 monthly trap sessions and 

with ≥ 10 locations. Individuals caught in only 

1 monthly trapping session were not included 

in the home-range analysis. Home-range sizes 

were estimated for the reproductive and nonreproductive 

seasons. ArcView GIS 3.3 (ESRI 

1996) with animal movement analysis (Hooge 

and Eichenlaub 2000) was used to estimate the 

minimum convex polygon (MCP) home-range 

size (m 2 ) from trapping locations. The percentage 

of home-range overlap between males and 

females was subsequently calculated. Because 

of the small sample sizes and dependency of 

some individuals on home ranges in both the 

reproductive and non-reproductive seasons, the 

nonparametric Mann-Whitney U-test was used to 

compare home-range sizes between adult males 

and females and between reproductive and nonreproductive 

seasons. Home-range overlap was 

examined for each 3-mo period in the reproductive 

seasons to ensure that home ranges overlapped 

at least part of the time. For example, examination 

of home-range overlap from Mar. to May could 

guarantee temporal overlap because individuals in 

the home-range analysis were captured in at least 

one of the following scenarios: Mar.-Apr., Apr.-May, 

or Mar.-May. Thus, ranges of individuals trapped in 

two of these 3 sessions would overlap temporally. 

The percentage of home-range overlap was only 

calculated between resident females and males. 

Selection of microsatellite primers 

There are no primers designed for Microtus 

kikuchii. Microtus montebelli and M. oeconomus 

are the most closely related species to M. kikuchii 

(Conroy and Cook 2000). Therefore, we tested 

primers for loci MSMM-1-8 designed for M. 

montebelli (Ishibashi et al. 1999) and for loci Moe1- 

8 designed for M. oeconomus (Van de Zande et al. 

2000) to determine their suitability for analyzing M. 

kikuchii microsatellite DNA sequences. 

Genomic DNA was extracted from leftear 

tissue with a DNA purification kit (Epicentre, 

Madison, WI, USA). The above primers amplified 

specific sequences. A polymerase chain reaction 

(PCR) used a total volume of 50 μl with 1 μl of a 

fluorescence-labeled forward primer (25 mM), 1 μl 

of an unlabeled reverse primer (25 mM), 5 μl PCR 

buffer (10x), 0.6 μl DNA, 0.6 μl DNTP (10 mM), 

0.6 μl Taq, and 41.2 μl water. Because the lengths 

of these PCR products were too short for direct 

sequencing, they were excised from the agarose 

gel for TA cloning. Each specific sequence was 

ligated with a vector (Invitrogen, Grand I., NY, 

USA) and put into competent cells for TA cloning. 

All clones were further re-amplified with M13 

primers (forward and reverse) which were supplied 

with TA cloning kit (Invitrogen) for length check. 

PCR protocol of the TA cloning check started 

from denaturation at 94°C for 10 min. Twenty-five 

cycles were performed at the following conditions: 

1 min at 94°C, 1 min at 55°C for annealing, and 

1 min at 72°C for extension. Horizontal electrophoresis 

with a 2% agarose gel was used to 

check the sequence lengths of the clones. 

Clones containing sequences of < 500 bp 

(Schlotterer and Harr 2001) were sent to Mission 

Biotech Company (Taichung, Taiwan) to be 

sequenced on an ABI PRISM TM 3730xl DNA


Analyzer (Applied Biosystems, Carlsbad, CA, 

USA). Usable loci were determined using BioEdit 

6.0.5 (Hall 1999) to check each sequence for 

repeating units and whether both sides of the 

sequence were conserved and stable. Primers of 

usable microsatellite loci were used to synthesize 

fluorescent primers for the microsatellite analysis. 

Genetic data analysis 

For the microsatellite analysis, protocols 

for DNA extraction and the PCR were the same 

as those described above. PCR products were 

separated on an ABI 310 genetic analyzer (Applied 

Biosystems). Individuals were genotyped using 

Genotyper vers. 2.0 (Applied Biosystems). 

Tests of pairwise linkage disequilibrium 

between loci were conducted using GenePop 

(Raymond and Rousset 1995). Allele diversity, 

heterozygosity (observed Ho and expected He), 

and Hardy-Weinberg equilibrium of each loci were 

calculated and tested using GENALEX 6 (Peakall 

and Smouse 2006). 

CERVUS 2.0 (Slate et al. 2000) and 

GENALEX 6 (Peakall and Smouse 2006) were 

used to estimate parentage. Since the real 

parentage of any individual could not be assured 

based on the capture data, we randomly compared 

genotypes of all individuals to all males to identify 

the most likely fathers. These offspring-father pairs 

were randomly compared to all females to identify 

the most likely mothers. An error rate of 1% was 

incorporated into the simulation with 80% relaxed 

and 95% strict confidence intervals. Parentage 

was confirmed on the basis of mismatching 

putative parentage at 0 loci or 1 locus, the LOD 

score (log-likelihood of each candidate parent), and 

the confidence of ΔLOD (the difference between 

the 2 most likely parents). A ΔLOD score of > 3.0 

confirmed parentage, while a ΔLOD score of < -3.0 

rejected parentage (Slate et al. 2000). A ΔLOD 

score was calculated by the difference in LOD 

scores between the most likely and the 2nd most 

likely candidate parents (either of which might be 

the true parent). The most likely candidate parent 

was the one with a ΔLOD score exceeding the 

critical ΔLOD score with a 95% confidence interval. 

Relationships of individuals with overlapping 

home ranges were checked with results of the 

parentage analysis to see whether they were 

mates or family members. 

RESULTS 

In total, 169 voles (79 males and 90 females) 

were caught in 1615 captures. One vole was 

excluded from the parentage analysis due to 

failure to amplify its DNA. 

Polymorphism of microsatellite loci 

In total, 11 microsatellite loci were chosen. 

Seven loci (MSMM-2, -3, -4, -5, -6, -7, and -8) 

used primers designed from Microtus montebelli 

and 4 loci (Moe1, -2, -5, and -6) used primers 

designed from M. oeconomus (Table 1). Except 

for MSMS-7, numbers of alleles were > 10; 

averaging 14.3 (range 8-19). All amplified loci 

were polymorphic. The observed heterozygosity 

(Ho) value of each locus was close to the expected 

heterozygosity (He) value. Average values of Ho 

and He were both 0.88. As a result, the mean 

inbreeding coefficient, F, was essentially 0 at 

-0.002. There were no departures from Hardy- 

Weinberg equilibrium (Table 1), indicating that 

the study population was under Hardy-Weinberg 

equilibrium. Locus pairs MSMM-4/MSMM-7 

and MSMM-4/Moe5 showed significant linkage 

disequilibrium. Most loci showed no significant 

linkage disequilibrium. Therefore, locus MSMM-4 

was not used for the genetic analysis. 

Parentage analysis 

The critical ΔLOD with a 95% level of 

certainty was 0.08 (with 95% of the parentage 

resolved) if neither parent was known. Of the total 

168 voles used for the parentage analysis, 20 

mated pairs were found (18 males and 20 females) 

to have 31 offspring. In total, 69 voles were 

assigned parentage (Table 2). In other words, 

41.1% (69/168) of the 168 voles, including adult 

and immature voles, could be assigned parentage 

with both parents identified. Except for 2 males 

(49M and 50M), each male mated with only 1 

female during the study period. The 2 males who 

mated with more than 1 female did so in different 

breeding seasons in different years and after the 

1st female was no longer present. 

Home-range size and overlap and their relationships 

The home-range sizes were 2763.6 ± 

2228.5 m 2 (n = 22) for adult males and 2170.0 ± 

1341.3 m 2 (n = 20) for adult females. No significant


difference was found between sexes (Mann- 

Whitney U-test, p = 0.31). Average home-range 

sizes in the reproductive season were 1826.1 ± 

1463.9 m 2 (n = 23) for adult males and 1684.2 ± 

1256.7 m 2 (n = 19) for adult females. The average 

home-range sizes in the non-reproductive season 

were 2072.7 ± 1637.7 m 2 (n = 11) for adult males 

and 1125.0 ± 874.6 m 2 (n = 8) for adult females. 

No significant difference in home-range sizes 

was found between sexes (Mann-Whitney U-test, 

p = 0.74 for the reproductive season and p = 0.16 

for the non-reproductive season). The sample size 

for the non-reproductive season was small. 

We separated the reproductive season into 

3 periods of 3 mo each and compared the homerange 

overlap among resident individuals (Fig. 1). 

Only those with ranges that overlapped ranges 

of the opposite sex are shown. There were 21 

pairwise combinations of home ranges overlapping 

those of the opposite sex. Eleven (52.4%) showed 

exclusive home-range overlap between 1 male 

and 1 female (Fig. 1). Eight (38.1%) of these 21 

pairwise combinations between male and female 

ranges were detected as sexually paired partners. 

Six (75%) of these 8 reproductive pairs had 

exclusive, overlapping home ranges. The average 

overlap of a male’s range with a female’s range 

did not statistically differ from the average overlap 

of a female’s range by a male’s range (Wilcoxon 

rank-sum test, p = 0.126). Average percentages 

of a female’s home range overlapped by a male’s 

were significantly larger in mated pairs (77.1%, 

n = 8) than in pairs not found to produce offspring 

(41.8%, n = 11) (Mann-Whitney U-test, p = 0.0372). 

Average percentages of a female’s home range 

overlapped by a male’s were also significantly 

larger than a male’s home range overlapped by his 

sexual female partner’s (42.4%, Wilcoxon ranksum 

test, p = 0.0499, n = 8). In other words, a 

female’s home range tended to overlap more with 

that of her sexual partner, but males did not show 

this trend. 

In total, 14 social units were recognized 

based on overlapping home ranges involving 

Table 1. Microsatellites used in the study of Microtus kikuchii at Hehuan Mt., Taiwan, from June 2004 to 

Sept. 2005. Microsatellite variations include the annealing temperature (Ta), number of alleles, observed 

heterozygosity (Ho), expected heterozygosity (He), inbreeding coefficient (F), Hardy-Weinberg equilibrium 

(H-W), and p value (p) 

Locus 

Core 

sequence 

Ta 

(°C) 

Sequence (5'-3') 

Allele size 

range (bp) 

Number of 

alleles 

Ho He F 

H-W 

p 

MSMM-2 a (CA)21 52 TAACCACAACCCCTCCAACTG 

TCATTTGGAGTTGCTGAGAAC 

MSMM-3 a (CA)15 52 TACGCCCTTCAAACTCATGTG 

TCCTTTATCTTAGGTGATGGAG 

MSMM-4 a (CA)19 52 TGTTTCAAGGCAATAAGGTGG 

TCGTTTCCCTGGAGATTGGG 

MSMM-5 a (CA)17 52 TCTAATACCCTCTTCCTTGGG 

TCCTATCAAGGGGCATTCATCT 

MSMM-6 a (CA)20 52 TCCTATCAAGGGGCATTCATCT 

TACAAAGCCATTGTTCCCTGCT 

MSMM-7 a (CA)18 56 TAAGAAGGGCCACTAAGACCC 

TGGGATTAAAGGTGTGCACCA 

MSMM-8 a (CA)17 50 TGCTTAGTTCACTGCTGAACC 

TCTTACTATCTGTCATTGAAGA 

Moe1 b (GT)18 60 TGGTTGTTCTGTGGTGAATACAG 

ACAGTAAGCAGTTTATCCACAAACC 

Moe2 b (GT)17 60 CATCTGATGAGTCCCTGAGG 

GCAACCTTCTTCTGACTTTTAC 

Moe5 b (TC)25 60 GGTCATGCTCCAAGAAGCTC 

AAAACCAAGGGTGCTGCTC 

Moe6 b (GT)25 60 GGTTTTCTGATTCAGGCAGG 

CCTCTTCTGGCCTCTCCAG 

163-197 15 0.893 0.900 0.007 NS 0.627 

102-136 14 0.833 0.827 -0.008 NS 0.279 

143-187 18 0.913 0.872 -0.047 NS 0.512 

69-111 19 0.900 0.910 0.011 NS 0.247 

145-167 12 0.873 0.857 -0.019 NS 0.987 

105-123 8 0.820 0.830 0.012 NS 0.915 

170-196 13 0.927 0.886 -0.046 NS 0.246 

93-133 15 0.847 0.890 0.049 NS 0.770 

145-185 15 0.887 0.889 0.002 NS 0.480 

108-138 14 0.833 0.866 0.037 NS 0.663 

210-246 14 0.913 0.998 -0.017 NS 0.420 

a 

Ishibashi et al. (1999). b Van de Zande et al. (2000). NS, non-significant.


June-Aug. 2004 Mar.-May 2005 June-Aug. 2005 

58F 

41M 

44M 

42F 

60M 

41M 

80F 

44M 

60M 

25F 

135F 

80F 

44M 

60M 

102M 

138F 

132F 

8F 

136F 

41M 

34F 

52M 

91F 

120M 

65F 

45M 

36F 

50M 

101M 

72F 

109M 

108M 

64F 

36F 

50M 

Fig. 1. Overlapping home ranges of adult Microtus kikuchii at Hehuan Mt., Taiwan, during 3 consecutive reproductive periods. 

Numbers indicate different individuals. Letters indicate the sex (M for males and F for females). Male home ranges are illustrated with 

solid-line boundaries and lightly shaded interiors. Female home ranges have bold dotted boundaries. Only overlapping home ranges 

between opposite sexes are shown. 

Table 2. Parentage analysis of M. kikuchii at Hehuan Mt., Taiwan 

Offspring a Date offspring captured Parents a between offspring and parents 

Number of mismatched loci 

(female/male) 

LOD b ΔLOD c * 

15M 2004 June 2F and 16M 1 / 1 8.06 4.84 

4M 2004 June 17F and 13M 0 / 0 8.36 0.55 

83F 2004 Sept. 0 / 0 9.64 7.79 

5M 2004 June 10F and 50M 0 / 0 11.40 6.31 

37M 2004 July 12F and 22M 0 / 0 9.66 7.26 

42F 2004 July 24F and 35M 0 / 0 9.59 2.17 

46M 2004 July 0 / 0 8.89 3.15 

58F 2004 July 19F and 30M 0 / 0 8.03 3.03 

43F 2004 July 48F and 49M 0 / 0 9.96 6.77 

77M 2004 Sept. 65F and 54M 0 / 0 8.93 4.98 

140F 2005 June 1 / 1 8.69 6.40 

144M 2005 June 0 / 0 6.14 1.10 

82F 2004 Sept. 74F and 90M 1 / 0 8.05 4.74 

110F 2005 Mar. 0 / 0 7.39 1.64 

70F 2004 Aug. 93F and 68M 1 / 0 9.07 0.46 

81F 2004 Sept. 0 / 0 9.65 2.30 

91F 2004 Oct. 0 / 0 10.20 2.91 

102M 2005 Jan. 18F and 40M 0 / 0 6.84 4.62 

111F 2005 Mar. 0 / 0 11.70 10.40 

135F 2005 May 80F and 44M 0 / 0 12.80 9.21 

136F 2005 May 0 / 0 8.86 4.20 

146M 2005 June 91F and 109M 0 / 0 10.10 2.67 

157M 2005 July 0 / 0 11.60 3.03 

148F 2005 June 58F and 49M 1 / 1 8.45 6.70 

150M 2005 June 72F and 101M 1 / 1 8.46 3.80 

160F 2005 July 1 / 0 8.03 1.90 

153M 2005 July 36F and 50M 0 / 0 9.96 5.52 

158F 2005 July 25F and 60M 0 / 0 9.87 7.89 

156F 2005 July 152F and 100M 0 / 0 10.50 5.17 

164M 2005 Aug. 111F and 102M 0 / 0 6.47 1.08 

167F 2005 Aug. 142F and 210M 0 / 0 10.50 8.23 

a 

Sex indicated by M (male) and F (female). b LOD score, log of product of likelihood ratios at each locus. c ΔLOD, difference in LOD 

score between the most likely candidate parent and the 2nd most likely candidate parent. *All ΔLOD values were significant (p < 0.05).


both sexes (Fig. 1). Eleven (78.6%) had overlaps 

exclusively between 1 male and 1 female. Six of 

these 11 social units (54.5%) were paired sexually 

and monogamously produced offspring, and 5 

social units were not detected to have produced 

any offspring. For the 3 social units with > 2 

individuals, only the social unit with 2 males and 

2 females (June-Aug. 2004) was not detected to 

have reproduced. The 2nd social unit (Mar.-May 

2005) had a mated pair (44M-80F). The 3rd (June- 

Aug. 2005) had a family group (parents 44M-80F 

and 2 daughters: 135F and 136F). No sexual 

pairing or family groups were found in June-Aug. 

2004. In 2005, all social units found to reproduce (8 

of 10, 80%) practiced monogamy and were either 

mated pairs or family groups. In total, 8 (57.1%) 

social units were found to have produced offspring. 

Six (75%) of these had exclusive home-range 

overlap between 1 male and 1 female. 

DISCUSSION 

Our results strongly support the hypotheses 

that Microtus kikuchii is socially and genetically 

monogamous. We identified litters sired by 18 

males and 20 females. The 2 males that fathered 

more than 1 litter did so in different years and with 

a different mate because their 1st mate was no 

longer present. None of the 9 litters with multiple 

offspring had more than 1 father (Table 2). We 

found no significant differences in home-range 

sizes between sexes. Most (78.6%) social units 

consisted of only 1 male and 1 female. Homerange 

overlaps between male and female pairs not 

found to produce offspring were relatively small 

(44M-58F, 41M-80F, and 120M-136F), except for 

60M and 80F. Therefore, overlap in home range 

was mostly by a single male, a single female, 

and their offspring, strongly suggesting social 

monogamy. 

Microtus kikuchii was suspected of being 

socially monogamous based on home ranges 

(Wu 1998) and observations of captive individuals 

(Chen et al. 2006). Combining our home-range 

data with a genetic analysis of parentage provided 

more in-depth information on the relationships of 

voles observed to have overlapping home ranges. 

Microtus ochrogaster is considered a socially 

monogamous species (Hofmann et al. 1984, Carter 

et al. 1995) even though not all adults live as malefemale 

pairs. Adults live in groups of single males 

and females, and groups of 3 or more adults were 

also documented (Getz et al. 1993, Cochran and 

Solomon 2000, Lucia et al. 2008). We maintain 

that M. kikuchii is socially monogamous because 

of similar home-range sizes between sexes, the 

very high proportion of social units comprised of 

male-female pairs, and the relatively low overlap 

in home ranges of individuals without reproductive 

relationships (e.g., not sexual partners or family 

members). 

Only six of the 11 male-female pairs identified 

by overlapping home ranges were found 

to be paired partners that had successfully 

produced young. Male-female pairs determined 

by overlapping home ranges might not truly 

be breeding pairs. In M. ochrogaster, socially 

monogamous, multiple paternity in five of 9 litters 

was also identified by a genetic study (Solomon 

et al. 2004). Thus, data from home-range overlap 

cannot reflect true pairing conditions or whether M. 

kikuchii is genetically monogamous. To determine 

the mating system of a species, field data and 

genetic data are both necessary (Hughes 1998, 

Kraaijeveld-Smit 2004). As we found no litters 

sired by multiple fathers, genetic monogamy of 

M. kikuchii should be assured. The parentage 

analysis showed survival of 1 or 2 offspring in each 

litter. This is consistent with Lu’s (1991) data from 

field trapping (range 1-3, average litter size 2.1) 

and our own observations from captive breeding 

(litter size 1-3 with 2 most frequent) (pers. unpubl. 

data). With an average litter size of 2.1, it may 

be more difficult to detect multiple paternity in M. 

kikuchii than for species with larger litter sizes, 

such as M. ochrogaster. Low detectability of 

multiple paternity due to small litter size is unlikely 

for M. kikuchii because Lu (1991) found a very 

low post-implantation mortality rate (2 resorbed 

embryos of 64 embryos). Moreover, we are confident 

that we trapped most of the population 

because our extensive trapping effort spanned 

2 breeding seasons, and we had high recapture 

rates (71.5%-96.5%). Even so, we still found no 

litters sired by multiple fathers. 

Some studies are beginning to show that 

in a number of species considered to be monogamous, 

females mate with multiple males. In 

mammals, extra-pair copulation was found in 

some socially monogamous species (Richardson 

1987, Agren et al. 1989, Solomon et al. 2004, 

Mabry et al. 2011). Previously, only 2 known 

rodent species simultaneously showed social and 

genetic monogamy, i.e., Peromyscus polionotus 

(Foltz 1981) and P. californicus (Ribble 1991). 

Genetic promiscuity and polygyny are common in 

Microtus (e.g., M. pennsylvanicus, M. richardsoni,


M. xanthognathus, and M. californicus), but 

monogamy is rare (Wolff 1985). Our study has 

added M. kikuchii to the list of rodent species 

simultaneously showing social and genetic 

monogamy. 

Acknowledgments: The authors thank the 

anonymous reviewers for their critical comments 

and many valuable remarks on the original 

manuscript. We thank Q.W. Zhu, J.K. Lin, G.H. 

Zhen, S.L. Yuan, and many other volunteers for 

help with fieldwork. We thank M.Y. Zhen, S.F. 

Zhen, Z.X. Zhang, L.Y. Liu, R.P. Huang, W.Y. 

Zhen, and Z.Y. Guo for help with genetic work. We 

thank the high-elevation experimental station of 

the Taiwan Endemic Species Research Institute 

for accommodations during fieldwork. Trapping 

protocols complied with government regulations. 

Permits were obtained from Taroko National Park. 

This research was funded by the National Science 

Council of Taiwan (NSC96-2621-B-029-001-MY3) 

and Tunghai Univ. 

REFERENCES 

Agren G, Q Zhou, W Zhong. 1989. Ecology and social behaviour 

of Mongolian gerbils, Meriones unguiculatus, at 

Xilinhot, Inner Mongolia, China. Anim. Behav. 37: 11-27. 

Avise JC. 1994. Molecular markers, natural history and 

evolution. New York: Chapman and Hall. 

Back SR, LA Beeler, RL Schaefer, NG Solomon. 2002. 

Testing functional hypotheses for the behavior of resident 

pine voles, Microtus pinetorum, toward non-residents. 

Ethology 108: 1023-1039. 

Baker RJ, KD Makova, RK Chesser. 1999. Microsatellites 

indicate a high frequency of multiple paternity in 

Apodemus (Rodentia). Mol. Ecol. 8: 107-111. 

Carter CS, AC De Vries, LL Getz. 1995. Physiological 

substrates of mammalian monogamy: the prairie vole 

model. Neurosc. Biobehav. Rev. 19: 303-314. 

Chen Y-C, Z-Y Shieh, L-K Lin. 2006. Mating system of Taiwan 

vole: evidence of behavioral studying. Chin. Biosci. 49: 

51-73. (in Chinese) 

Clutton-Brock TH. 1989. Mammalian mating systems. Proc. R. 

Soc. Lond. Ser. B Biol. Sci. 236: 339-372. 

Clutton-Brock TH, K Isvaran. 2006. Paternity loss in contrasting 

mammalian societies. Biol. Lett. 2: 513-516. 

Cochran GR, NG Solomon. 2000. Effects of food supplementation 

on the social organization of prairie voles 

(Microtus ochrogaster). J. Mammal. 81: 746-757. 

Conroy CJ, JA Cook. 2000. Molecular systematics of a 

Holarctic rodent (Microtus: Muridae). J. Mammal. 81: 

344-359. 

Emlen ST, LW Oring. 1977. Ecology, sexual selection, and the 

evolution of mating systems. Science 197: 215-223. 

Escherich PC. 1981. Social biology of the bushy-tailed 

woodrat, Neotoma cinerea. Univ. CA Publ. Zoology 110: 

1-132. 

ESRI. 1996. Arcview GIS Software. Redlands, CA: Environmental 

Systems Research Institute (ESRI). 

Finley RB. 1958. The woodrats of Colorado: distribution and 

ecology. Univ. KS Publ. Mus. Nat. Hist. 10: 213-552. 

Foltz DW. 1981. Genetic evidence for long-term monogamy 

in a small rodent, Peromyscus polionotus. Am. Nat. 117: 

665-675. 

Gaulin SJC, RW FitzGerald. 1988. Home-range size as a 

predictor of mating systems in Microtus. J. Mammal. 69: 

311-319. 

Getz LL, JE Hofmann. 1986. Social organization in freeliving 

prairie voles, Microtus ochrogaster. Behav. Ecol. 

Sociobiol. 18: 275-282. 

Getz LL, B Mcguire, T Pizzuto, JE Hofmann, B Frase. 

1993. Social-organization of the prairie vole (Microtus 

ochrogaster). J. Mammal. 74: 44-58. 

Hall TA. 1999. BioEdit: a user-friendly biological sequence 

alignment editor and analysis program for Window 95/998/ 

NT. Nucleic Acids Res. Symp. Ser. 41: 95-98. 

Hoffmann RS, JW Koeppl. 1985. Zoogeography. In RH 

Tamarin, ed. Biology of New World Microtus. Boston, 

MA: American Society of Mammalogist, pp. 84-115. 

Hofmann JE, LL Getz, L Gavish. 1984. Home range overlap 

and nest cohabitation of male and female prairie voles. 

Am. Midl. Nat. 112: 314-319. 

Hooge PN, B Eichenlaub. 2000. Animal movement extension 

to Arcview. ver. 2.0. Alaska Science Center - Biological 

Science Office, U.S. Geological Survey, Anchorage, AK, 

USA. 

Hughes C. 1998. Integrating molecular techniques with field 

methods in studies of social behavior: a revolution results. 

Ecology 79: 383-399. 

Ishibashi Y, Y Yoshinaga, T Saitoh, S Abe, H Iida, MC Yoshida. 

1999. Polymorphic microsatellite DNA markers in the field 

vole Microtus montebelli. Mol. Ecol. 8: 163-164. 

Kleiman DG. 1977. Monogamy in mammals. Q. Rev. Biol. 52: 

39-69. 

Kraaijeveld-Smit F. 2004. Behavioural ecology. In TJC 

Beebee, G Rowe, eds. An introduction to molecular 

ecology. Oxford, UK: Oxford Univ. Press, pp. 81-109. 

Lu MS. 1991. Ecology and reproduction of Microtus kikuchii 

in the Hohuanshan area. Master’s thesis, Tunghai Univ., 

Taichung, Taiwan. (in Chinese with English abstract) 

Lucia KE, B Keane, LD Hayes, YK Lin, RL Schaefer, NG 

Solomon. 2008. Philopatry in prairie voles: an evaluation 

of the habitat saturation hypothesis. Behav. Ecol. 19: 

774-783. 

Mabry KE, CA Streatfeild, B Keane, NG Solomon. 2011. 

avpr1a length polymorphism is not associated with either 

social or genetic monogamy in free-living prairie voles. 

Anim. Behav. 81: 11-18. 

Ohnishi N, T Saitoh, Y Ishibashi. 2000. Spatial genetic 

relationships in a population of the Japanese wood mouse 

Apodemus argenteus. Ecol. Res. 15: 285-292. 

Patris B, C Baudoin. 2000. A comparative study of parental 

care between two rodent species: implications for 

the mating system of the mound-building mouse Mus 

spicilegus. Behav. Proc. 51: 35-43. 

Peakall R, PE Smouse. 2006. GENALEX 6: genetic analysis 

in Excel. Population genetic software for teaching and 

research. Mol. Ecol. Notes 6: 288-295. 

Queller DC, JE Strassmann, CR Hughes. 1993. Microsatellite 

and kinship. Trends Ecol. Evol. 8: 285-288. 

Raymond M, F Rousset. 1995. An exact test for population


differentiation. Evolution 49: 1280-1283. 

Reichard UH. 2003. Monogamy: past and present. In UH 

Reichard, C Boesch, eds. Monogamy. Cambridge, UK: 

Cambridge Univ. Press, pp. 3-25. 

Ribble DO. 1991. The monogamous mating system of 

Peromyscus californicus as revealed by DNA fingerprinting. 

Behav. Ecol. Sociobiol. 29: 161-166. 

Richardson PRK. 1987. Aardwolf mating system: overt 

cuckoldry in an apparently monogamous mammal. S. Afr. 

J. Sci. 83: 405-410. 

Schlotterer C, B Harr. 2001. Microsatellite instability. In 

Encyclopedia of life sciences (eLS). NJ: J. Wiley & Sons, 

Ltd., pp. 1-4. (http://www.els.net) 

Scribner KT, JM Pearce. 2000. Microsatellite: evolutionary and 

methodological background and empirical applications 

at individual, population and phylogenetic levels. In 

AJ Baker, ed. Molecular methods in ecology. Berlin: 

Blackwell Science, pp. 235-273. 

Seaman DE, JJ Millspaugh, BJ Kernohan, GC Brundige, KJ 

Raedeke, RA Gitzen. 1999. Effects of sample size on 

kernel home range estimates. J. Wildl. Manage. 63: 739- 

747. 

Slate J, T Marshall, J Pemberton. 2000. A retrospective 

assessment of the accuracy of the paternity inference 

program CERVUS. Mol. Ecol. 9: 801-808. 

Solomon NG. 1993a. Body size and social preferences of 

male and female prairie voles, Microtus ochrogaster. 

Anim. Behav. 45: 1031-1033. 

Solomon NG. 1993b. Comparison of parental behavior in male 

and female prairie voles (Microtus ochrogaster). Can. J. 

Zool. Rev. Can. Zool. 71: 434-437. 

Solomon NG, B Keane, LR Knoch, PJ Hogan. 2004. Multiple 

paternity in socially monogamous prairie voles (Microtus 

ochrogaster). Can. J. Zool. 82: 1667-1671. 

Swilling WR, MC Wooten. 2002. Subadult dispersal in a 

monogamous species: the Alabama beach mouse 

(Peromyscus polionotus ammobates). J. Mammal. 83: 

252-259. 

Topping MG, JS Millar. 1998. Mating patterns and reproductive 

success in the bushy-tailed woodrat (Neotoma cinerea) as 

revealed by DNA fingerprinting. Behav. Ecol. Sociobiol. 

43: 115-124. 

Van de Zande L, RC van Apeldoorn, AF Blijdenstein, D de 

Jong, W van Delden, R Bijlsma. 2000. Microsatellite 

analysis of population structure and genetic differentiation 

within and between populations of the root vole, Microtus 

oeconomus in the Netherlands. Mol. Ecol. 9: 1651-1656. 

Wittenberger JF. 1979. The evolution of mating systems in 

birds and mammals. In P Marler, JG Vandenbergh, eds. 

Handbook of behavioral neurobiology. New York: Plenum, 

pp. 271-349. 

Wolff JO. 1985. Behavior. In RH Tamarin, ed. Biology of 

New World Microtus. Boston, MA: American Society of 

Mammalogists, pp. 340-372. 

Wu PJ. 1998. Population ecology and activity pattern of 

Kikuchii’s field vole (Microtus kikuchii) in Hohuanshan 

area. Master’s thesis, Tunghai Univ., Taichung, Taiwan. (in 

Chinese with English abstract)


A New Shallow-Water Species, Polycyathus chaishanensis sp. nov. 

(Scleractinia: Caryophylliidae), from Chaishan, Kaohsiung, Taiwan 

Mei-Fang Lin 1 , Marcelo V. Kitahara 2 , Hiroyuki Tachikawa 3 , Shashank Keshavmurthy 1 , and Chaolun 

Allen Chen 1,4,5,6, * 

1 


2 

Comparative Genomic Centre and ARC Centre of Excellence for Coral Reef Studies, James Cook Univ., Townsville 4810, Australia 

3 

Natural History Museum and Institute, Chiba 955-2, Japan 

4 


5 

Department of Life Science, National Taitung Univ., Taitung 950, Taiwan 

6 


(Accepted October 12, 2011) 

Mei-Fang Lin, Marcelo V. Kitahara, Hiroyuki Tachikawa, Shashank Keshavmurthy, and Chaolun Allen 

Chen (2012) A new shallow-water species, Polycyathus chaishanensis sp. nov. (Scleractinia: Caryophylliidae), 

from Chaishan, Kaohsiung, Taiwan. Zoological Studies 51(2): 213-221. A small population of a new species of 

zooxanthellate scleractinian coral, Polycyathus chaishanensis sp. nov., is described from shallow water (< 3 m) 

off Chiashan, Kaohsiung, an uplifted Pleistocene reef located on the southwest coast of Taiwan. Polycyathus 

chaishanensis sp. nov. is a zooxanthellate coral associated with Symbiodinium C1 and forms small encrusting 

colonies. Polycyathus chaishanensis sp. nov. differs from other Polycyathus by having (1) the smallest corallites 

(2.0-3.7 mm in calicular diameter) reported in the genus Polycyathus; (2) septa hexamerally arranged in 4 

incomplete cycles displaying dentate or laciniate axial edges; (3) crispate and well-developed pali before the 

secondary septa; and (4) light brown pigmented pali/columellar elements. When expanded, vivid-red to brown 

polyps rise considerably above the calice, and long and slender tentacles are covered with white nematocyst 

batteries. Polycyathus chaishanensis is the only species of Polycyathus known from Taiwanese waters and 

appears to be endemic to a small region at Chaishan. The small population of this new species raises concerns 

as to its vulnerability to natural and anthropogenic threats. 


Key words: Scleractinia, Polycyathus chaishanensis, Zooxanthellae, Chaishan, Shallow water. 

Described from specimens collected near 

St. Helena, in the South Atlantic Ocean, the 

genus Polycyathus Duncan, 1876 (Anthozoa: 

Scleractinia: Caryophylliidae) is characterized 

by small reptoid to plocoid colonies that form 

through corallites that grow close to the base of 

their neighbors and become sparser with age. 

The corallites are cylindrical to slightly conical 

in shape, bud from a common coenosteum or 

from stolons (Cairns 1995), and are epithecated. 

There are 3-5 irregularly arranged septal cycles, 

of which the last is usually incomplete, and the 

1st and 2nd are the most distinct and exsert. Two 

crowns of well-developed pali (P1 and P2) are 

present before the 2nd and 3rd septal cycles, of 

which P2 is usually more difficult to distinguish 

from columellar elements than P3 (Wijsman-Best 

1970). The fossa is deep and contains a papillose 

columella. According to Duncan (1876), septa that 

are not incised and the absence of endotheca are 

diagnostic characters of this genus. 

Ranging from shallow to waters deeper 


E-mail:cac@gate.sinica.edu.tw 

213

214 

Lin et al. – New Scleractinian Coral From Taiwan 

than 400 m (Cairns 1999), the vast majority of 

Polycyathus representatives are reported from the 

Pacific Ocean (Fig. 1), of which 5 are known to 

occur in southern Pacific waters (P. verrilli Duncan 

1876, P. octuplus Cairns 1999, P. fulvus Wijsman- 

Best 1970, P. norfolkensis Cairns 1995, and P. 

andamanensis Alcock 1893). In the northwestern 

Pacific, 3 Polycyathus species are described from 

the Philippines, in waters deeper than 35 m (Verheij 

and Best 1987). Among them, P. hodgsoni Verheij 

& Best 1978 and P. marigondoni Verheij & Best 

1978 have the lowest and highest number of septal 

cycles (3 and 5, respectively) compared to their 

congeners. 

In the present study, a new species of 

Polycyathus is described. This new species 

inhabits a shallow-water area of Chaishan, an 

uplifted reef developed about 0.6 Mya (Fig. 2). 

Chaishan is about 6 km long and is home to 

about 15.62% of coastal habitats of Kaohsiung 

City, southwestern Taiwan (CPAMI 2008). The 

beach at Chaishan is composed of scattered hard 

substrates of carbonaceous rocks of various sizes 

which originated from nearby coastal hills. The 

water column contains a high concentration of 

particles which increases the turbidity of the water 

and might be one of the contributing factors to 

the low number of scleractinian corals reported 

in this area. Nonetheless, the new species of 

Polycyathus described herein appears to be 

endemic to this small Taiwanese region, as so far, 

it has not been found anywhere else in Taiwan. 

Mitochondrial (mt) 16S ribosomal (r)RNA 

gene sequences were amplified and aligned 

with previously published sequences from 8 

representatives of morphologically related 

caryophylliid genera (including P. muellerae 

Abel 1959) and 13 representatives of noncaryophylliid 

families to investigate the validity of 

this genus. Following Kitahara et al. (2010a b), 

the phylogenetic analysis did not indicate that the 

Caryophylliidae is a monophyletic family, and also 

raises concerns about the validity of Polycyathus, 

which is one of the less-understood scleractinian 

genera. 


Specimens examined in the present study 

were collected by snorkeling in 2000, 2005, and 

2008 from a tidal pool (< 3 m in depth) at Chaishan, 

Kaohsiung, Taiwan (22°38'18"N; 120°15'19"E) (Fig. 

2). Colonies were photographed in situ using an 

Olympus SP350 camera (Center Valley, PA, USA) 

with an underwater housing. Collected specimens 

were bleached to remove soft tissues, rinsed with 

fresh water, thoroughly dried, and photographed 

using a Nikon D200 (Tokyo, Japan) camera. 

Morphological observations were carried out using 

an Olympus SZ-ST stereomicroscope equipped 

with an ocular graticule. Scanning electron 

microscopy (SEM) was performed on a FEI Quanta 

200/Quorum PP2000TR FEI, 2007 (Hillsboro, OR, 

N 

30°N 

PACIFIC OCEAN 

0° 

PACIFIC OCEAN 

30°S 

0 - 10 m 

11 - 50 m 

51 - 100 m 

> 100 m 

ATLANTIC OCEAN 

INDIAN OCEAN 

150°W 

90°W 

°W 0°E 

60°E 120°E 

Fig. 1. Worldwide distribution and depths of Polycyathus spp.


215 

N 

(A) 

(B) 

Kaohsiung City 

TAIWAN 

24°N 

22°N 

Chai-shan 

120°E 122°E 

(C) 

(D) 

(E) 

(F) 

Taiwan Strait 

Fig. 2. Map of sampling localities of Polycyathus chaishanensis sp. nov. (A) Landscape of an uplifted coral reef; (B) patches of 

limestone dominated by Ulva sp., chiton, and barnacles; (C) ancient coral; (D) Anthopleura sp.; (E) Psammocora sp.; (F) Porites 

okinawanensis. 

(A) 

(B) 

(C) 

(D) 

1 cm 2 mm 

Fig. 3. Polycyathus chaishanensis sp. nov. (A) Caulerpa racemosa and calcified red algae; (B) a specimen with brown tissues 

indicating the presence of zooxanthellae; (C) colony view of the holotype (NMNS-6309-001) consisting of 73 corallites in different 

stages of development; (D) calicular view (SEM) of 1 corallite of the holotypic colony (NMNS-6309-001).

216 


USA) instrument. 

Skeleton vouchers were deposited at the 

National Museum of Natural Science (NMNS), 

Taichung, Taiwan and at the Museum of Tropical 

Queensland (MTQ), Townsville, Australia. In 

the morphological description, the following 

abbreviations were used: CD, calicular diameter; 

GCD, great CD; Sx, septa of the x order; Px, pali 

of the x order; and H, height. Tissue samples 

preserved in CHAOS solution (Fukami 2004) were 

used for DNA extraction. 

Symbiodinium identification 

Following LaJeunesse (2002), denaturing 

gradient gel electrophoresis (DGGE) of the internal 

transcribed spacer (ITS)-2 region was performed 

to identify the Symbiodinium clade present in P. 

chaishanensis sp. nov. The ITS-2 region was 

amplified using primers ITS2 clamp and ITSintfor 

2 developed by LaJeunesse and Trench (2000). A 

polymerase chain reaction (PCR) was performed 

with a touch-down cycle according to LaJeunesse 

(2002). PCR products were subjected to electrophoresis 

for 15-16 h on denaturing gradient gels 

(45%-80%) using a CBS Scientific System (Del 

Mar, CA, USA). Gels were stained with SYBR 

green (Molecular Probes, Eugene, OR, USA) for 

20 min, and photographed for further analysis. 

Bands were excised from the gel and sent for 

direct sequencing. Resulting sequences were 

deposited in the NCBI database (with accession 

nos.: 180016-180021) 

Sequence analysis and phylogeny 

Forty mt16S rDNA and the cytochrome c 

oxidase subunit I (COI) sequences, including 

these 2 regions from the complete mt genome of 

P. chaishanensis sp. nov (Lin et al. 2011), were 

retrieved from GenBank. This dataset contained 

11 robust and 4 complex scleractinian families. 

Phylogenetic analyses were performed using 

MEGA 4.0 (Tamura et al. 2007) for Neighborjoining 

(NJ) and MrBayes 3.1.2 (Huelsenbeck 

and Ronquist 2001) for Bayesian inference (BI). 

The most appropriate model of nucleotides was 

determined to be HKY+I using MrModeltest vers. 

2.3 (Nylander 2004). The NJ analyses were 

performed with 500 replicates, and for the BI, 2 

runs each of 10 6 generations were calculated 

for each marker with topologies saved every 

100 generations. The 1st quarter of the saved 

topologies were discarded as burn-in, and the 

remaining ones were used to calculate posterior 

probabilities. 

Systematic description 

RESULTS 

Subclass Hexacorallia. 

Order Scleractinia Bourne, 1900. 

Suborder Caryophylliina Vaughan & Wells, 1943. 

Family Caryophylliidae Dana, 1846. 

Genus Polycyathus Duncan, 1876. 

Polycyathus chaishanensis sp. nov. 

Illustrations of the holotype are given in figures 3C, D, 4A-C; 

and illustrations of the paratype are given in figure 4D, E. 

Materials examined: Holotype: NMNS-6309- 

001 (Taichung, Taiwan). Paratypes: NMNS-6309- 

002, NMNS-6309-003 (Taichung, Taiwan), and 

MTQ G64703 (Queensland, Australia, 1 specimen). 

Type locality: 22°38'18''N, 120°15'19''E (Taiwan), 

3 m in depth. 

Description: Small reptoid colonies formed by 

closely spaced cylindrical corallites arising from a 

common coenosteum or from stolons. Holotypic 

colony consisting of approximately 70 corallites. 

Extratentacular budding common; however, some 

corallites displaying intratentacular division. Calice 

circular to slightly elliptical. Largest corallite 

examined 3.65 × 3.73 mm in CD and 4.0 mm in 

H. Theca thick. Costae more prominent near 

calicular edge. All costae equal in width (about 

0.21 mm wide), slightly convex, and bearing low, 

coarse granules. Intercostal striae deep and 

flat near calicular edge, becoming less distinct 

in direction of base. Coenosteum and theca 

white, but columellar elements usually light-brown 

pigmented. Vivid-red to dark brown sub-pellucid 

polyps considerably expanded above calicular 

edge; tentacles long, slender, with knobby end, 

and covered by small white verruca. 

Septa hexamerally arranged in 4 incomplete 

cycles, according to formula: S1 ≥ S2 > S3 > S4. 

Corallites < 2 mm in GCD with 12 or fewer septa, 

but larger corallites (up to 3.7 mm in GCD) with 

several pairs of S4 totaling up to 34 septa. S1 

exsert (0.5-0.7 mm), with straight and almostvertical 

axial edges sometimes bearing small, 

cylindrical (0.24 mm in diameter) palus. S2 only 

slightly less exsert and equal or narrower than 

S1. S3 less exsert, thinner, and about 2/3 width 

of S2. Axial edges of S1-S2 dentate, those of S3 

laciniated. S4 1/2-2/3 width of S3. Well-developed 

P3 (sometimes bilobated) present before S3. If


217 

(A) 

1 mm 

(B) 

(C) 

1 mm 

2 mm 

(D) 

(E) 

500 μm 1 mm 

Fig. 4. (A) Calicular view of 1 corallite of the holotypic colony (NMNS-6309-001) undergoing extratentacular budding; (B) calicular 

view of 1 corallite of the holotypic colony (NMNS-6309-001) undergoing intratentacular budding; (C) calicular view of 1 corallite of the 

holotypic colony (NMNS-6309-001); (D) lateral view of a corallite from the paratype colony (NMNS-6309-002); (E) detail of columellar 

elements MTQ G64703.

218 


present, P2 difficult to distinguish from columellar 

elements. Septal and palar faces bearing several 

pointed granules aligned perpendicular to septal/ 

palar edges. Fossa moderately deep, containing 

elongate papillose columella. Columella composed 

of 5-7 slender, irregularly shaped rods. 

Remarks: Polycyathus chaishanensis sp. nov. 

differs from all other known species of this genus 

by having a much smaller corallite. Twenty-one 

corallites examined from the holotype colony had 

a mean CD of 3.05 ± 0.26 mm (Fig. 5), whereas 

corallites among the other 18 valid Polycyathus 

species are significantly larger (mean CD of 

4.38 ± 1.10 mm). In addition, P. chaishanensis 

sp. nov. has one of the shallowest bathymetric 

ranges known from representatives of this genus 

(≤ 3 m) (Fig. 1), and all colonies were found to 

inhabit tidal pools. Of the 18 extant Polycyathus 

species, 3 were described from the Atlantic Ocean 

(P. atlanticus Duncan, 1876 [depth unknown], P. 

senegalensis Chevalier 1966 [12-143 m], and 

P. mayae Cairns 2000 [110-309 m]; 5 from the 

Indian Ocean (P. persicus Duncan 1876 [depth 

unknown], P. fuscomarginatus Klunzinger 1879 

[depth unknown], P. verrilli [depth unknown], P. 

difficilis Duncan 1889 [depth unknown], and P. 

andamanensis [depth unknown]); 1 species from 

the Mediterranean Sea (P. muellerae Abel 1959 

[10-32 m]); and according to Cairns (1999), 9 

Calicular Diameter (mm) 

8.00 

7.00 

6.00 

5.00 

4.00 

3.00 

2.00 

1.00 

P. chaishanensis Polycyathus spp. 

Fig. 5. Measurement of the calicular diameter (CD) of P. 

chaishanensis sp. nov. (21 corallites) and extant Polycyathus 

species (18 species). The CD of each P. chaishanensis 

corallite and its congeners are indicated by black circles in 

the box plot. The non-parametric Wilcoxon-Mann-Whitney 

rank sum test showed no significant difference (p = 0.1135) 

in calicular diameters between P. chaishanensis sp. nov. and 

extant Polycyathus species. 

species are known from Pacific waters (P. palifera 

Verrill 1869 [reef depth], P. hondaensis (Durham 

& Barnard 1952) [55-64 m], P. fulvus [30-50 m], P. 

isabela Wells, 1982 [14-23 m], P. hodgsoni [> 35 m]; 

P. marigondoni [35 m]; P. furanaensis Verheij & 

Best 1987 [6-52 m], P. norfolkensis [10-20 m], and 

P. octuplus [90-441 m]). 

Among Pacific and Indian congeners that 

have small corallites, P. chaishanensis sp. nov. is 

most similar to P. difficilis (Mergui Archipelago). 

Both species have an exserted S1, indistinct 

P1, and S2 and S3 with dentate/laciniate axial 

edges. However, P. chaishanensis sp. nov. differs 

in having 4 incomplete cycles of septa, while P. 

difficilis has 3 cycles of septa. 

Interestingly, DGGE from the ITS-2 confirmed 

the presence of Symbiodinium subclade C1 

associated with P. chaishanensis sp. nov. Although 

Wijsman-Best (1970) described the association 

of zooxanthellae with P. fulvus, to date, all other 

representatives of this genus are considered 

azooxanthellate (Cairns et al. 1999). However, to 

reinvestigate this important ecological aspect of 

shallow-water Polycyathus, new samples enabling 

the examination of their tissue must be collected. 

Etymology: This species is named for the 

uplifted reef in southern Taiwan (Chaishan) from 

which it was collected and to which it is possibly 

endemic. 

Distribution: Known only from the sublittoral 

zone (< 3 m deep) near Chaishan, Kaohsiung, 

Taiwan (22°37'13"N, 120°15'56"E to 22°38'18"N, 

120°15'19"E). 

DISCUSSION 

Phylogeny of Polycyathus 

To test the hypothesis that Polycyathus 

is a natural genus, a 16S rRNA sequence 

was extracted from the P. chaishanensis sp. 

nov. mt genome (accession no.: NC 015642; 

Lin et al. 2011) and aligned with previously 

published sequences from 8 representatives 

of morphologically related caryophylliid genera 

and 13 representatives of non-caryophylliid 

families. Results of the phylogenetic analysis are 

summarized in figure 6, and following Romano 

and Cairns (2000), Le-Goff Vitry et al. (2004), 

and Fukami et al. (2008), sequences from 4 

scleractinian species in the “complex” coral clade 

were used as an outgroup. Despite the fact that 

only 2 Polycyathus species were represented in


219 

86/64 

Colpophyllia natans 

Favia fragum 

Faviidae 

Lobophyllia hemprichii 

75/78 

Mussiidae 

Cynarina sp. 

100/96 

95/88 

100/96 

Hydnophora rigida 

Pectinia alcicornis 

Caulastraea furcata 

Merulinidae 

Pectiniidae 

Faviidae 

76/67 

Trochocyathus efateensis 

Caryophylliidae 

100/94 

Tethocyathus virgatus 

Dichocoenia stokesi 

Phyllangia mouchezii 

Rhizosmilia maculata 

100/95 

Meandrinidae 

Rhizangiidae 


Paracyathus pulchellus 

88/71 74/70 

Cladocora caespitosa Faviidae 

69/71 

77/87 

Oculina patagonica 

Oculinidae 

Astrangia sp. 

Rhizangiidae 

98/99 

Polycyathus muellerae 

Polycyathus chaishanensis 

Coscinaraea sp. 



Siderastreidae 

56/58 

Zoopilus echinatus 

Psammocora stellata 

Leptastrea bottae 

Fungia scutaria 

Fungia vaughani 

Fungiidae 

Siderastreidae 

Faviidae 

Fungiidae 

Caryophyllia grayi 

Caryophyllia atlantica 

100/100 

Caryophyllia diomedeae 

69/69 

Crispatotrochus rugosus 

Caryophyllia planilamellata 

Caryophyllia rugosa 

Caryophyllia unicristata 

Dasmosmilia lymani 

71/73 

Caryophyllia scobinosa 

Caryophyllia grandis 

100/95 Caryophyllia transversalis 

100/100 

Madracis mirabilis 

Pocillopora damicornis 

100/100 

Pocilloporidae 

Porites porites 

Acropora tenuis 

Siderastrea radians 

Fungiacyathus stephanus 


Complex corals 

0.01 

Fig. 6. Phylogenetic analyses based on Bayesian inference and Neighbor-joining analyses of the partial mitochondrial sequence of 

the 16S rRNA gene and the cytochrome oxidase subunit I gene from 41 scleractinian species. Numbers at the nodes correspond 

to Bayesian posterior probabilities and bootstrap support of the Neighbor-joining analysis, respectively. The scale unit is 0.01 

substitutions per site.

220 


the analysis, both the BI and NJ analyses indicated 

that this genus is not monophyletic. Polycyathus 

chaishanensis sp. nov. was not grouped with 

any other congener (P. muellerae) or any other 

caryophylliid representative. Instead, our results 

show that P. chaishanensis sp. nov. has a genetic 

immediacy to some representatives of the 

Siderastreidae (Coscinaraea and Psammocora), 

Fungiidae (Zoopilus and Fungia), and Faviidae 

(Leptastrea) (Fig. 6). In addition, our results 

support P. muellerae having a close relationship 

with Paracyathus pulchellus (Kitahara et al. 2010b) 

but not with Rhizosmilia maculata. These results 

were also supported by the COI sequence data 

(data not shown). 

In previous molecular studies, many of the 

morphologically defined families, especially those 

composed of zooxanthellate species, showed 

extensive polyphyly (Romano and Cairns 2000, 

Le Goff-Vitry et al. 2004, Fukami et al. 2008, 

Kitahara et al. 2010a). In an attempt to clarify 

the validity of morphology-based taxonomy, 

additional taxon sampling, more-comprehensive 

morphological analyses, and additional molecular 

data are required (Fukami et al. 2008). Therefore, 

molecular data from other Polycyathus species are 

needed to clarify the phylogenetic status of this 

genus. 

Ecology of Polycyathus chaishanensis sp. nov. 

The rare distribution and the small-sized 

population of this new species raise several 

concerns as to its vulnerability to natural and 

anthropogenic threats, in a period of intense urban 

development at Chaishan. 

Chaishan is an uplifted reef formed during the 

late Pleistocene (2.59-0.01 Mya; Gong et al. 1998). 

The Pleistocene reef limestone in southwestern 

Taiwan occurs in the Gutingkeng Formation near 

Kaohsiung (Gong et al. 1998). A debris avalanche 

and sandy substrate form the main characteristics 

of the Chaishan area and have contributed to 

the benthic communities of this region. Among 

hermatypic organisms reported from Chaishan’s 

formation, the most important are scleractinian 

corals (such as Acropora, Porites, Favia, and 

Favites), mollusks, and encrusting calcareous 

red algae (Gong et al. 1998). Hard surfaces 

exposed to light in the Chaishan area were found 

to be heavily dominated by algae, primarily the 

green algae Ulva fasciata and U. lactuca, and 

some turf algae such as Chaetomorpha antennina 

(Huang 2003). Colonial zooxanthellate corals, 

Psammocora sp. and Porites sp., were found on 

limestone or among fleshy algae. However, most 

of these scleractinian species were found in tidal 

pools of < 5 m deep. Reefs in shallow water with 

less light are usually dominated by zoanthus and 

sea anemones, probably including Anthopleura sp. 

(Fig. 2). In addition, overhangs and overhanging 

surfaces with less light are primarily dominated by 

encrusting sponges. Polycyathus chaishanensis 

sp. nov. was only found on well-lit reefs dominated 

by green and encrusting calcareous red algae, and 

was generally rare (Fig. 2). However, this area 

is dominated by green algae and turbid waters 

caused by erosion, which may have inhibited the 

occurrence of most other scleractinians. The small 

population of this new species raises concerns as 

to its vulnerability to natural and anthropogenic 

threats. 

Acknowledgments: We thank Dr. K. Soong 

(National Sun-Yat Sen Univ., Kaohsiung, Taiwan) 

for ecological information on the Chaishan area, 

Mr. L.C. Wang (National Taiwan Univ., Taipei, 

Taiwan) for assistance with the SEM technology, 

and Dr. Y. Nozawa for help with photography. 

Constructive comments from the members of the 

Coral Reef Evolutionary and Ecological Genetics 

(CREEG) Laboratory, Biodiversity Research 

Center, Academia Sinica (BRCAS) and 3 anonymous 

reviewers are especially appreciated. SK 

is the recipient of a postdoctoral fellowship from 

Academia Sinica (2010-2012). This study was 

supported by a BRCAS Thematic grant (2006- 

2008) and one from the National Science Council, 

Taiwan (NSC94-2621-B-001-005) to CAC. This is 

the CREEG Laboratory contribution no. 73. 

REFERENCES 

Cairns SD. 1995. The marine fauna of New Zealand: 

Scleractinia (Cnidaria: Anthozoa). NZ Oceanogr. Inst. 

Mem. 103: 1-216. 

Cairns SD. 1999. Cnidaria, Anthozoa: deep-water 

azooxanthellate Scleractinia from Vanuatu, and Wallis and 

Futuna Islands. Mém. Mus. natl. d'Hist. nat. 180: 31-167. 

Cairns SD, BW Hoeksema, J van der Land. 1999. Species 

richness of recent Scleractinia. Atoll Res. Bull. (National 

Museum of Natural History Smithsonian Institution 

Washington, DC, USA) 459: 1-46. 

CPAMI. 2008. The program of sustainable coastal development. 

Taipei, Taiwan: Construction and Planning 

Agency Ministry of the Interior (CPAMI) Press. (in 

Chinese) 

Duncan PM. 1876. Notices of some deep-sea and littoral 

corals from the Atlantic Ocean, Caribbean, Indian, New


221 

Zealand, Persian Gulf, and Japanese etc. seas. Proc. 

Zool. Soc. Lond. 44: 428-442. 

Fukami H, AF Budd, DR Levitan, J Jara, R Kersanach, N 

Knowlton. 2004. Geographic differences in species 

boundaries among members of the Montastraea annularis 

complex based on molecular and morphological markers. 

Evolution 58: 324-337. 

Fukami H, CA Chen, AF Budd, A Collins, C Wallace, YY Chuang 

et al. 2008. Mitochondrial and nuclear genes suggest 

that stony corals are monophyletic but most families of 

stony corals are not (order Scleractinia, class Anthozoa, 

phylum Cnidaria). PLoS One 3: e3222. 

Gong SY, SW Wang, TY Lee. 1998. Pleistocene coral reefs 

associated with claystones, southwestern Taiwan. Coral 

Reefs 17: 215-222. 

Huang SF. 2003. Seaweeds of northeastern Taiwan. Taipei, 

Taiwan: National Taiwan Museum Press. (in Chinese) 

Huelsenbeck JP, F Ronquist. 2001. MrBayes: Bayesian 

inference of phylogeny. Bioinformatics 17: 754-755. 

Kitahara MV, SD Cairns, DJ Miller. 2010a. Monophyletic 

origin of Caryophyllia (Scleractinia, Caryophylliidae), with 

descriptions of six new species. Syst. Biodivers. 8: 91- 

118. 

Kitahara MV, SD Cairns, J Stolarski, D Blair, DJ Miller. 2010b. 

A comprehensive phylogenetic analysis of the Scleractinia 

(Cnidaria, Anthozoa) based on mitochondrial CO1 

sequence data. PLoS One 5: e11490. 

LaJeunesse TC. 2002. Diversity and community structure of 

symbiotic dinoflagellates from Caribbean coral reefs. Mar. 

Biol. 141: 387-400. 

LaJeunesse TC, RK Trench. 2000. The biogeography of two 

species of Symbiodinium (Freudenthal) inhabiting the 

intertidal anemone, Anthopleura elegantissima (Brandt). 

Biol. Bull. 199: 126-134. 

Le Goff-Vitry MC, AD Rogers, D Baglow. 2004. A deep-sea 

slant on the molecular phylogeny of the Scleractinia. Mol. 

Phylogen. Evol. 30: 167-177. 

Lin MF, KS Luzon, WY Licuana, MC Ablan-Lagman, CA Chen. 

2011. Seventy-four universal primers for characterizing 

the complete mitochondrial genomes of scleractinian 

corals (Cnidaria; Anthozoa). Zool. Stud. 50: 513-524. 

Nylander JAA. 2004. MrModeltest v2. Program distributed by 

the author. Evolutionary Biology Centre, Uppsala Univ. 

Romano SL, SD Cairns. 2000. Molecular phylogenetic 

hypotheses for the evolution of scleractinian corals. Bull. 

Mar. Sci. 67: 1043-1068. 

Tamura K, M Dudley, M Nei, S Kumar. 2007. MEGA4: 

Molecular Evolutionary Genetics Analysis (MEGA) software 

vers. 4.0. Mol. Biol. Evol. 24: 1596-1599. 

Verheij E, MB Best. 1987. Notes on the genus Polycyathus 

Duncan, 1876 and a description of three new scleractinian 

corals from the Indo-Pacific. Zool. Mededelingen 61: 147- 

154. 

Wijsman-Best M. 1970. A new species of Polycyathus 

Duncan, 1876, from New Caledonia and a new record of 

Polycyathus senegalensis Chevalier, 1966 (Madreporaria). 

Beaufortia 227: 79-84.


Systematic Study of the Simocephalus Sensu Stricto Species Group 

(Cladocera: Daphniidae) from Taiwan by Morphometric and Molecular 

Analyses 

Shuh-Sen Young 1, *, Mei-Hui Ni 2 , and Min-Yun Liu 3 

1 

Department of Applied Science, National Hsinchu University of Education, Hsinchu 300, Taiwan 

2 

Hsinchu Municipal Hsinchu Elementary School, Hsinchu 300, Taiwan 

3 

National Applied Research Laboratories, Taiwan Ocean Research Institute, Taipei 106, Taiwan 


Shuh-Sen Young, Mei-Hui Ni, and Ming-Yun Liu (2012) Systematic study of the Simocephalus sensu stricto 

species group (Cladocera: Daphniidae) from Taiwan by morphometric and molecular analyses. Zoological 

Studies 51(2): 222-231. There is some controversy regarding the traditional taxonomy of the Simocephalus 

sensu stricto species group. We conducted molecular and morphometric analyses to differentiate the 3 species 

from this group found in Taiwan: S. vetulus (O.F. Müller, 1776), S. vetuloides Sars, 1898, and S. mixtus Sars, 

1903. The landmark method was employed, followed by a transfer into 24 characteristic values for a principal 

component analysis (PCA), the results of which indicated morphometric overlap among these species. The 

dorsal angle, brood size, and body length were smallest in S. vetulus, medium in S. vetuloides, and largest 

in S. mixtus. In the Simocephalus sensu stricto group from Taiwan, the dorsal angle and body length were 

significantly correlated with brood size in a quadratic manner. In the molecular analysis, 98 specimens of 

Simocephalus were used, and the 641-bp mitochondrial DNA cytochrome oxidase subunit 1 sequence was 

employed as a marker to analyze the genetics of S. vetulus, S. vetuloides, S. mixtus, S. serrulatus (Koch, 1841), 

and S. heilongjiangensis Shi and Shi, 1994. Simocephalus vetulus, S. vetuloides, and S. mixtus shared several 

haplotypes, and the interspecific genetic distance was merely 0.00671-0.00785, which is within the range of 

intraspecific differences. We concluded that S. vetulus, S. vetuloides, and S. mixtus in Taiwan belong to the 

same species and should be treated as S. cf. vetulus. The number of species of Simocephalus in Taiwan is thus 

reduced to 3: S. cf. vetulus, S. serrulatus, and S. heilongjiangensis. 


Key words: Systematics, Biodiversity, Simocephalus, Freshwater zooplankton. 

The general morphologies of Simocephalus 

vetulus (O.F. Müller, 1776), S. vetuloides Sars 

1898, and S. mixtus Sars 1903 are very similar. 

Sars (1916) first discriminated S. vetulus and 

S. vetuloides based on the dorsoposterior valve 

angle. After that, many authors defined S. 

vetuloides by a more-protruding dorsal valve 

margin and more-numerous and larger denticles 

on the posterior dorsal valve margin compared 

to S. vetulus (Uéno 1966, Chiang and Du 1979, 

Yoon and Kim 1987 2000, Shi and Shi 1996, Kim 

1998, Orlova-Bienkowskaja 2001, Tuo 2002). 

Other authors treated S. vetuloides as a local form 

(Johnson 1953) or as a synonym of S. vetulus 

(Fryer 1957, Harding 1961, Sharma 1978, Negrea 

1983, Michael and Sharma 1988). Sars (1903) 

described S. mixtus as having a more-protruding (to 

the rear) dorsal valve margin and larger denticles 

on the posterior dorsal valve margin compared to 

S. vetulus and S. vetuloides. Flössner (1972) and 

Negrea (1983) treated S. mixtus as a synonym of 

S. vetulus. After that, Orlova-Bienkowskaja (1998) 

*To whom correspondence and reprint requests should be addressed. E-mail:shuh@mail.nhcue.edu.tw 

222

Young et al. – Study of Simocephalus from Taiwan 223 

made a more-detailed revision and treated S. 

mixtus as a valid species. 

Orlova-Bienkowskaja (2001) proposed a 

different method of discriminating S. vetulus, S. 

vetuloides, and S. mixtus. She drew an inner circle 

along the shell posterior, the diameter of which 

and the prominence of the dorsal valve being key 

features for identification. The shell posterior of 

S. vetulus ends without an extending shell spine, 

the inner circle is larger than in S. vetuloides and 

S. mixtus, while S. mixtus has more-protruding 

dorsal valves than S. vetuloides. The diameter 

of the inner circle of S. mixtus is larger than the 

prominence portion, and S. vetuloides differs from 

S. mixtus in that the diameter of the inner circle of S. 

vetuloides is smaller than the prominence portion. 

In the past, many authors proposed S. vetulus 

to be a cosmopolitan species first des-cribed from 

the Old World, as it was found in many areas, 

with the exception of New Zealand and Australia 

(Werestschagin 1923, Uéno 1927, Rylov 1930, 

Hemsen 1952, Harding 1961, Manuilova 1964, 

Uéno 1966, Chiang and Du 1979, Rajapaksa and 

Fernando 1982, Boonsom 1984, Yoon and Kim 

1987, Kim 1998, Mizuno and Takahashi 1991, Du 

1993, Hann 1995, Shi and Shi 1996, Michael and 

Sharm 1998, Tuo 2002). Orlova-Bienkowskaja 

(2001) indicated that the distribution of S. vetulus 

was limited to northern Africa and Europe, 

while S. vetuloides had a limited distribution in 

eastern Siberia. Outside of Africa, Europe, and 

eastern Siberia, Simocephalus sensu stricto 

comprises S. punctatus Orlova-Bienkowskaja, 

1998, S. elizabethae (King, 1853), and S. 

mixtus. Simocephalus mixtus is a cosmopolitan 

species distributed in Asia, Eastern Europe, 

North Africa, and North America. Simocephalus 

(Coronocephalus) serrulatus (Koch, 1841) is 

also regarded as a cosmopolitan species, as 

it is distributed in Asia, Europe, Africa, North 

America, South America, and Australia (Orlova- 

Bienkowskaja 2001). 

Based on the description by Orlova- 

Bienkowskaja (2001) and other morphological 

comparisons, Tuo (2002) described 3 species 

of Simocephalus from Taiwan, S. serrulatus, 

S. vetulus, and S. vetuloides. Since then, this 

extensive collection has increased to include S. 

heilongjiangensis Shi and Shi, 1994 and S. mixtus 

Sars from southern Taiwan (Ni 2005). At some 

collection sites, S. vetulus and S. vetuloides were 

found simultaneously as were S. vetuloides and 

S. mixtus (Ni 2005). Morphological similarities 

among S. vetulus, S. vetuloides, and S. mixtus are 

large, with the exception of the shape of the dorsal 

valve. However, the shape of the dorsal valve 

of cladocerans may be affected by the brooding 

status, with growing embryos pushing the valve 

more prominently outwards, than in individuals 

without eggs. 

The species level is recognized as the 

basic unit of biodiversity (Mayer and Ashlock 

1991). Nowadays, alpha taxonomy is still based 

mainly on morphology. Morphometry is one of 

several possible methods to determine species 

and analyze morphological differences between 

closely related species and populations (Chen et 

al. 2010). With the advent of molecular technology 

for DNA sequencing, morphologically cryptic 

species have been increasingly revealed, and the 

use of DNA markers as a new tool to overcome 

morphological impediments was suggested (Tautz 

et al. 2003). The ideal DNA-based identification 

system (DNA barcodes) would employ a single 

gene, and be suitable for any organism in the 

taxonomic hierarchy. Folmer et al. (1994) designed 

a universal primer for the mitochondrial 

cytochrome oxidase subunit I (COI) gene, which 

subsequently became a popular marker to study 

invertebrates. Hebert et al. (2003), Tautz et al. 

(2003), Blaxter (2004), Lefébure et al. (2006), 

and Costa et al. (2007) suggested that the COI 

gene appears to be an appropriate molecular 

marker (as a DNA barcode) on several taxonomic 

scales, but particularly at the species level. We 

attempted to clarify the taxonomic status of S. 

vetulus, S. vetuloides, and S. mixtus in Taiwan 

by morphometric comparisons and used the 

mitochondrial (mt)DNA COI gene marker as a new 

character. 

This paper is our 1st step dealing with 

vetulus-like populations of Simocephalus in Taiwan, 

which are currently regarded as conspecific to 

the Palaearctic cosmopolitan species. We thus 

attempted to improve the taxonomy of the genus 

Simocephalus by solving a small piece of the 

puzzle from the overall picture. 


Samples were taken from many temporary 

freshwater bodies throughout Taiwan using a 

plankton net. Each sample was fixed in 70% 

ethanol (EtOH), later preserved in 95% EtOH and 

stored at a low temperature (< -20°C). Within 72 h, 

each raw sample was sorted and identified under 

a stereomicroscope. In total, 187 individuals (170


with eggs) were collected in 2003 and 2004 and 

used for the morphometric analysis: 45 individuals 

of S. vetulus from 8 sites, 72 individuals of S. 

vetuloides from 11 sites, and 70 individuals of 

S. mixtus from 10 sites. From this set of 187 

individuals, 72 individuals, including 22 individuals 

of S. vetulus from 8 sites, 28 individuals of S. 

vetuloides from 11 sites, and 22 individuals of S. 

mixtus from 10 sites, were selected for the DNA 

analysis. Additionally, 7 individuals of S. serrulatus 

(Fig. 1) from 3 sites and 19 individuals of S. 

heilongjiangensis (Fig. 1) from 5 sites were also 

included in the DNA analysis. Daphnia similoides 

Hudec, 1991 (Daphniidae) and Diaphanosoma 

dubium Manuilova, 1964 (Sididae) from Taiwan 

were analyzed in order to obtain outgroup 

sequences. 

Morphometric analysis 

Lateral-view images of S. vetulus, S. 

vetuloides, and S. mixtus were taken using a 

digital camera under a stereomicroscope for the 

morphometric study. Morphometric characters 

were extracted from the photographic images, and 

8 morphometric data points were used to construct 

(A) 

(B) 

(C) 

(D) 

(E) 

Fig. 1. General morphology of female Simocephalus with summer eggs found in Taiwan (all drawings are original). (A) S. vetulus; (B) 

S. vetuloides; (C) S. mixtus; (D) S. serrulatus; (E) S. heilongjiangensis. The valve shape is the major difference among S. vetulus, S. 

vetuloides, and S. mixtus; S. serrulatus has teeth on the top of its head, and S. heilongjiangensis has a different posterior end of the 

valve. Scale bars = 0.1 mm.


24 length measurements, each of which was 

divided by body length to obtain size-free ratios 

(Fig. 2). The body length and dorsal valve angle 

(Fig. 2) were also measured on the photographic 

images, and the clutch size of each individual 

was assessed under a microscope. SPSS vers. 

10.0.1 (Chicago, IL, USA) was used to analyze 

the numerical data. The data matrix was tested 

using the Kaiser-Meyer-Olkin (KMO) measure 

of sampling adequacy and by the Bartlett X 2 test 

prior to the principle component analysis (PCA). 

For individuals with eggs, Pearson’s correlation 

analyses and non-linear regressions among the 

dorsal angle, body length, and clutch size were 

carried out. 

DNA extraction, amplification, and sequencing 

Total genomic DNA was extracted using 

Chelex (InstaGene Matrix BIO-RAD 7326030, 

Bio-Rad Laboratories, Hercules USA) from single 

G 

F 

A 

H 

60° 60° 

E 

Fig. 2. Morphometry of each specimen extracted from 8 

data points (A-H), from which we constructed 24 length 

measurements; each length measurement was then divided by 

body length (AE) to obtain size-free ratios. The angle between 

lines AE and ED was taken as the dorsal valve angle. 

D 

B 

C 

animals. Each animal was taken from 95% EtOH 

and placed into pure water for 1 h for cleaning. 

After that, each animal was placed at the bottom 

of a 0.5-ml centrifuge tube for 30 min to dry in a 

speed vacuum-drying system. Dried samples 

were then ground up by needles, and 50 μl of a 5% 

Chelex solution was used to extract the DNA by 

incubation at 56°C for 2-3 h, followed by incubation 

at 90°C for 8 min. For each polymerase chain 

reaction (PCR), 5 μl of upper cleaning was used as 

the DNA template after centrifugation at 10 4 rpm 

(9168g) for 3 min. 

We employed the universal primers, LCO 

1490 (5'-GGTCAACAAATCATAAAGATATTGG-3') 

and HCO2918 (5'-TAAACTTCAGGGTGACCAA 

AAAATCA-3') (Folmer et al. 1994), to amplify the 

mitochondrial COI gene by a PCR. Each PCR 

sample had a total volume of 50 μl and consisted 

of pH 9.2 buffer solution (50 mM Tris-HCl, 16 mM 

ammonium sulfate, 2.5 mM MgCl2, and 0.1% 

Tween 20), 5 pM of each primer, 50 μM of dNTPs, 

2 units of Taq DNA polymerase (super Therm 

DNA polymerase, Bio-Taq, BioKit Biotechnology, 

Miaoli Taiwan), and 10-50 ng of genomic DNA. 

The PCRs were performed in an Eppendorf 

Mastercycler gradient 384 machine (Eppendorf, 

Hamburg, Germany). Thermocycling began with 

5 min of preheating and continued with 35 cycles 

at 94°C for 30 s, primer annealing at 51°C for 

45 s, and extension at 72°C for 45 s; followed by 

incubation at 72°C for 10 min for full extension 

of the DNA and ended with 4°C holding. PCR 

products were electrophoresed in 2% agarose 

gels, after which the gels were stained with 

ethidium bromide (EtBr) and photographed under 

an ultraviolet light box. DNA fragments were 

excised from the gel and extracted using a 1-4- 

3 DNA extraction kit (Gene-Spin, Protech, Taipei, 

Taiwan) to obtain purified DNA. Sequences of 

DNA fragments were resolved on an ABI3730 

automated sequencer (Applied Biosystems, 

Carlsbad, California USA) using 20-50 ng of template 

with 5 pM of the LCO1490 primer. 

Alignment, genetic diversity, and phylogeny 

After a search of GenBank, all COI sequences 

of Simocephalus were downloaded and aligned 

with our sequences. The download sequences 

included S. vetulus from the UK (accession no., 

DQ889172: Costa et al. 2007), S. cf. punctatus 

from Mexico and Guatemala (EU702310 and 

EU702282, Elias-Gutierrez et al. 2008), S. 

cf. exspinosus from Mexico and Guatemala


(EU702296 and EU702279, Elias-Gutierrez et al. 

2008), S. cf. mixtus from Mexico and Guatemala 

(EU702305 and EU702281, Elias-Gutierrez et 

al. 2008), and S. serrulatus from Mexico and 

Guatemala (EU702312, Elias-Gutierrez et al. 

2008). COI gene sequences were aligned by eye 

using the BioEdit program vers. 7.0.2 (Hall 1999). 

We calculated the haplotype diversity (Hd, Nei 

1987), nucleotide diversity (π, Nei 1987), genetic 

distance (Dxy, Nei 1987), and average genetic 

distances between each pair of species using 

MEGA 3 vers. 3.0 (Kumar et al. 2004). Daphnia 

similoides and Diaphanosoma dubium were used 

as outgroups, and the phylogenetic tree was 

derived using all sequences by the Neighborjoining 

(NJ) and maximum-parsimony (MP) 

methods (Saitou and Nei 1987) based on Kimura 

2-parameter (K2P) distances with 1000 bootstraps 

using MEGA 3. 

RESULTS 

Morphometric comparisons of Simocephalus 

vetulus, S. vetuloides, and S. mixtus 

The KMO value for the morphometric data 

matrix was 0.81, and Bartlett’s X 2 was 2583.96 

(d.f. = 276; p = 0.000), demonstrating the 

suitability of the PCA. After the PCA, 91% of 

the variance was explained by the 1st, 2nd, and 

3rd components combined. On the 1st and 2nd 

component plots, S. vetulus and S. mixtus were 

separated from each other, but S. vetuloides was 

mixed with both groups; thus, they did not separate 

very well into 3 different species (Fig. 3). 

Simocephalus vetulus individuals with eggs 

(n = 170) (clutch sizes ranged 1-4, dorsal valve 

angle ranged 39.5°-74.8°) had fewer eggs than the 

2 other species; S. vetuloides (clutch sizes ranged 

1-12, dorsal valve angle ranged 41.5°-69.5°) was 

intermediate; and S. mixtus (clutch sizes ranged 

1-30; dorsal valve angle ranged 63.4°-97.5°) had 

the most eggs. In a pooled analysis of these 

3 species, Pearson’s correlation between the 

dorsal valve angle and clutch size was r = 0.725 

(p = 0.000), and between body length and clutch 

size was r = 0.70 (p = 0.000). The relationship 

between clutch size (Y) and dorsal valve angle (X) 

fit a quadratic function Y = 0.0088X 2 - 0.9091X + 

25.3361 (r 2 = 0.53), and the one between clutch 

size (Y) and body length (X) also fit a quadratic 

function Y = 9.81X 2 - 20.48X + 12.00 (r 2 = 0.49). 

Hence, irrespective of the species, clutch size was 

positively correlated with the dorsal valve angle 

and body length. The valve shape was not a 

species-specific character, but rather it depended 

on the clutch size. 

Molecular analysis of COI sequences 

We used 110 COI sequences from S. vetulus 

(n = 22), S. vetuloides (n = 28), S. mixtus (n = 10), 

S. serrulatus (n = 7), S. heilongjiangensis (n = 19), 

Daphnia similoides (n = 5), and Diaphanosoma 

dubium (n = 7) for the phylogenetic analysis. Each 

sequence was 641 bp long. Twelve haplotypes 

were detected for the 5 species of Simocephalus 

with 151 segregation sites; the genetic diversity, 

Hd, was 0.891, and the nucleotide diversity, π, was 

0.07049. Simocephalus vetulus had 4 haplotypes 

from 8 sites (Hd = 0.576), S. vetuloides had 6 

haplotypes from 11 sites (Hd = 0.802), S. mixtus 

had 4 haplotypes from 9 sites (Hd = 0.636), 

S. serrulatus had 2 haplotypes from 3 sites 

(Hd = 0.571), and S. heilongjiangensis had 3 

haplotypes from 6 sites (Hd = 0.374) (Table 1). 

Genetic distances (Dxy) between each pair of 

species based on the COI gene ranged 0.00671- 

0.1604 (Table 2). Genetic distances among S. 

vetulus, S. vetuloides, and S. mixtus were all 

< 0.01, while those between S. serrulatus and the 

other species were > 0.15, and those between 

PCA 1 

3 

2 

1 

0 

-1 

-2 

-4 -3 

S. vetulus S. mixtus S. vetuloides 

-2 -1 0 

PCA 2 

1 2 3 4 

Fig. 3. Results of the principal component analysis of the 

morphometric dataset: 1st and 2nd principle component plot. 

Simocephalus vetulus and S. mixtus were well separated with 

a distribution gap, while S. vetuloides filled the gap and mixed 

with those 2 species.


S. heilongjiangensis and the other species were 

> 0.14. 

In the phylogenetic NJ tree (Fig. 4), S. 

vetulus, S. vetuloides, and S. mixtus (hap a-g) 

were mixed together as a well-supported group 

with a bootstrap value of 99%. Simocephalus 

serrulatus (hap k-l) and S. heilongjiangensis (hap 

h-j) were well separated, with each group being 

supported by a 99% bootstrap value. The dorsal 

valve shape variation was not associated with 

genetic differences based on the COI gene. The 

most protruding valve shape (S. mixtus) was 

common in haplotypes a and b. Valve shapes of 

S. vetulus and S. vetuloides were also common 

Table 1. Haplotypes (Hap) of each species of Simocephalus and their collection sites 

Haplotype n Collection sites 

S. vetulus 22 8 collection sites; HD = 0.576; π = 0.00806 

Hap a 14 scA (3), scB (3), scC (2), zb (6) 

Hap e 2 dgA (2) 

Hap f 3 dy (3) 

Hap g 3 scE (2), hsB (1) 

S. vetuloides 28 11 collection sites; HD = 0.802; π = 0.00777 

Hap a 10 hsA (3), scD (3), sf (1), xse (3) 

Hap b 5 dd (1), khC (1), mn (3) 

Hap c 3 lj (3) 

Hap d 6 bs (6) 

Hap e 2 khB (2) 

Hap g 2 gA (2) 

S. mixtus 22 10 collection sites; HD = 0.636; π = 0.00535 

Hap a 12 gA (2), dh (3), dy (3), hsA (1), scF (3) 

Hap b 6 dd (2), dy (1), tt (3) 

Hap e 3 dgB (3) 

Hap g 1 gs (1) 

S. serrulatus 7 3 collection sites; HD = 0.571; π = 0.00357 

Hap k 4 mf (4) 

Hap l 3 gs (1), sf (2) 

S. heilongjiangensis 19 6 collection sites; HD = 0.374; π = 0.00140 

Hap h 15 pjA (3), pjB (4), pjC (4), pjD (4) 

Hap i 2 khA (2) 

Hap j 2 khA (2) 

bs: Baoshan (Hsinchu County); dd: Dadu (Taichung County); dgA-B: Dongang A-B (Pingtung County); dh: Dahu 

(Miaoli County); dy: Dayuan (Taoyuan County); gA: Green Grass Lake (Hsinchu City); gs: Guanxi (Hsinchu 

County); hsA-B: Hengshan A-B (Hsinchu County); khA-C: Kaohsiung City A-C; lj: Longjing (Taichung County); 

mf: Minfu (Hsinchu city); mn: Meinong (Kaohsiung County); pjA-D: Pingzhen A-D (Taoyuan County); scA-E: 

Hsinchu City A-E; sf: Shinfeng (Hsinchu County); tt: Taitung city; xse: Xiangshan (Hsinchu City); zb: Zhubei 

(Hsinchu County). 

Table 2. Genetic distances (Dxy) among Simocephalus species from Taiwan based on 

mitochondrial DNA cytochrome oxidase subunit I sequences 

S. vetuloides S. mixtus S. vetulus S. serrulatus 

S. vetuloides - - - - 

S. mixtus 0.00671 

S. vetulus 0.00785 0.00698 

S. serrulatus 0.15550 0.15572 0.15473 

S. heilongjiangensis 0.16017 0.16046 0.15945 0.14391


in haplotype b. Haplotypes e and g were shared 

by all 3 morphospecies (Fig. 5, Table 1). We 

reconstructed the phylogenetic trees by including 

both our sequences and downloaded sequences, 

and obtained NJ and MP phylogenetic trees with 

similar tree structures (Fig. 6). Haplotypes a-g 

from Taiwan were all placed in the same group. 

DISCUSSION 

DNA barcoding can be helpful in species 

identification within cryptic species groups (Hebert 

et al. 2004, Belyaeva and Taylor 2009). In general, 

sequence divergences are much lower among 

individuals of a species than between closely 

related species. For example, congeneric species 

of moths exhibit an average sequence divergence 

of 6.5% in the mitochondrial COI gene, whereas 

divergences among conspecific individuals 

average only 0.25% (Moore 1995, Hebert et al. 

2004). Similar values were obtained in birds, 

with intraspecific divergences of COI averaging 

0.27%, whereas congener divergences averaged 

7.93% (Hebert and Stoeckle et al. 2004). Among 

1781 congeneric species pairs of crustaceans, 

only 1.3% had COI gene divergences of < 2%, 

13.4% had COI gene divergences ranging 4%- 

8%, and 81.8% had COI gene divergences 

ranging 8%-32% (Hebert et al. 2003). In a study 

of the scale of intercontinental divergence for the 

cladoceran genus Daphnia, Adamowicz et al. 

(2009) observed a pairwise sequence divergence 

within the D. obtusa complex of up to a maximum 

of 16.9%, with divergences of up to 19% within 

the D. longispina complex. In our study, S. 

serrulatus and S. heilongjiangensis showed 14%- 

16% COI divergence from each other and from 

Simocephalus sensu stricto. These interspecific 

differences were similar to most crustaceans 

(Hebert et al. 2003). 

Based on the morphological differences 

described by Orlova-Bienkowskaja (2001), 3 

species - S. vetulus, S. vetuloides, and S. mixtus 

- were previously recorded in Taiwan. Indeed, our 

morphometric analysis of the valve shape revealed 

a significant difference between S. vetulus 

and S. mixtus from Taiwan, which appeared 

to support their taxonomic status as different 

species. However, when all 3 putative species 

were included in the analysis, the PCA did not 

separate S. vetulus, S. vetuloides, and S. mixtus 

from one another, as they formed a morphological 

continuum. This is consistent with a single 

morphologically variable species. Furthermore, 

differences in valve shape among S. vetulus, S. 

vetuloides, and S. mixtus collected in Taiwan were 

not associated with genetic variations. The genetic 

distances in COI among them were very small 

(0.6%-0.8%), a divergence level that corresponds 

Hap d: S. vetuloides, S. mixtus, S. vetulus 

57 

69 

99 

Hap e: S. vetuloides, S. mixtus, S. vetulus 

Hap g: S. vetuloides 

Hap f: S. vetulus 

Hap a: S. vetuloides, S. mixtus, S. vetulus 

99 Hap b: S. vetuloides, S. mixtus 

71 Hap c: S. vetuloides 

99 

Hap k: S. serrulatus 

Hap l: S. serrulatus 

86 

99 

99 

79 

Hap h: S. heilongjiangensis 

Hap i: S. heilongjiangensis 

Hap j: S. heilongjiangensis 

Daphnia similoides 

Daphnia similoides 

Diaphanosoma dubium 

0.02 

Fig. 4. Phylogenetic tree for Simocephalus species in Taiwan, derived using the Neighbor-joining (NJ) method based on mitochondrial 

(mt)DNA cytochrome oxidase subunit I (COI) sequences. The numbers indicate support values for 1000 bootstrap calculations.


scC-1 

scA-2 

bs-1 

Hap d 

sf-1 

ha-5 

scD-1 

scf-1 

Hap a 

dh-1 

hs3-1 

dgA-1 

khB-4 

dgB-1 

Hap e 

dd-3 

dy-2 

Hap f 

khC-5 

mn-2 dd-1 

tt-2 

Hap b 

scE-3 

gA-1 

hs3-3 

1j-2 

gs-1 

Hap g 

Hap c 

Fig. 5. Dorsal valve shapes of different haplotypes belonging to Simocephalus vetulus, S. vetuloides, and S. mixtus. Haplotypes a, b, e, 

and g have different valve shapes with large-scale variations. 

Hap d ( * ) 

Hap d ( * ) 

62 

Hap a ( * ) 

Hap a ( * 

99 

95 

) 

Hap b ( * ) 

Hap b 

63 

77 

( * 

75 

) 

Hap c ( * ) Hap c ( * ) 

Simocephalus vetulus (+) 

Simocephalus vetulus (+) 

99 

100 

Simocephalus cf. punctatus (#) 

85 Simocephalus cf. punctatus (#) 

97 

66 Hap g ( * ) 

Hap g 

73 

( * ) 

87 

Hap e ( * ) 

Hap e ( * ) 

Hap f ( * ) 

99 

100 

Hap f ( * ) 

0.02 * : Taiwan +: UK #: Mexico and Guatemala *: Taiwan +: UK #: Mexico and Guatemala 

20 

78 

69 

Simocephalus punctatus (#) 

Simocephalus cf. exspinosus (#) 


Simocephalus cf. mixtus (#) 


63 

Simocephalus punctatus (#) 





Hap j ( * ) Hap j ( * ) 

62 

100 Hap k ( * ) 

99 Hap k ( * ) 

Hap l ( * ) 

Hap l ( * ) 

Hap i ( * ) 

76 Hap i 

92 

( * ) 

100 

Hap h ( * ) 

99 

Hap h ( * ) 

Simocephalus serrulatus (#) Simocephalus serrulatus (#) 

D. dubium ( * ) D. similoides ( * ) 

D. similoides ( * ) D. dubium ( * ) 

Fig. 6. Reconstructed phylogenetic trees of Simocephalus. Sequences from GenBank were included in this analysis: S. vetulus 

(accession no., DQ889172) from the UK, S. cf. punctatus (EU702310 and EU702282) from Mexico and Guatemala, S. cf. exspinosus 

(EU702296 and EU702279) from Mexico and Guatemala, S. cf. mixtus (EU702305 and EU702281) from Mexico and Guatemala, and 

S. serrulatus (EU702312) from Mexico and Guatemala. Both the Neighbor-joining (NJ) and maximum-parsimony (MP) trees shared 

similar branching structures. Haplotypes a-f from our study were all grouped together.


to intraspecific variations. Therefore, we prefer 

to treat all morphotypes of Simocephalus sensu 

stricto from Taiwan as a single species, S. cf. 

vetulus, as the publication time of S. vetulus was 

earlier than those of the other 2 species. 

COI sequence comparison of S. cf. vetulus 

from Taiwan with the European S. vetulus showed 

that these were not conspecific (Fig. 6). As no 

sequences of S. mixtus or S. vetuloides from the 

areas of their primary distribution were available 

for comparison, it remains unclear whether the 

species found in Taiwan are conspecific with those 

species. It is possible that Simocephalus found 

in Taiwan is either S. mixtus or S. vetuloides or a 

new undescribed species. Future studies should 

compare sequences of S. vetulus, S. mixtus, and 

S. vetuloides collected from the type locations with 

sequences of S. cf. vetulus from Taiwan to verify 

its taxonomic status. 

According to allozymic studies by Hann 

(1995), intraspecific differentiation within S. cf. 

vetulus in North America was very slight. North 

American and European populations were genetically 

distinct according to the allozyme data, but 

no morphological distinctiveness was identified. 

In the past, conspecific populations from different 

continents were believed to be widespread 

within the Cladocera based on morphological 

identifications. An intercontinental distribution of 

a species is generally presumed to be a result 

of passive transport by migratory birds or other 

dispersal mechanisms (Dumont and Negrea 2002, 

Adamowicz et al. 2009). The alternative hypothesis 

of geographical isolation assumes that gene flow 

among populations of cosmopolitan species on 

different continents is interrupted, and therefore 

the question is how large their genetic divergence 

is relative to the geographical dis-continuum 

scale. For example, Xu et al. (2009) explored the 

global phylogeography of the non-cosmopolitan 

freshwater cladoceran Polyphemus pediculus 

(Linnaeus, 1761) (Crustacea, Onychopoda) using 

2 mitochondrial genes, COI and 16s ribosomal (r) 

RNA, and 1 nuclear marker, 18s rRNA. The P. 

pediculus complex represents an assemblage of at 

least 9 largely allopatric, cryptic species. The Far 

East harbors exceptionally high levels of genetic 

diversity at both the regional and local scales. 

In contrast, little genetic subdivision is apparent 

across the formerly glaciated regions of Europe 

and North America. 

Similar to Xu et al. (2009) and many other 

previous studies on cosmopolitan cladoceran 

species (Ishida et al. 2006, Rowe et al. 2007, 

Belyaeva and Taylor 2009, Abreu et al. 2010), our 

results indicate that S. cf. vetulus from Taiwan 

is probably not the same species as S. vetulus 

from the UK, and S. serrulatus from Taiwan is not 

conspecific with S. cf. serrulatus from Mexico. 

Simocephalus cf. vetulus from Taiwan appears to 

be geographically isolated from populations on 

other continents. Future studies should collect 

barcodes of all morphospecies of Simocephalus 

from different locations around the world in order 

to reconstruct their systematic relationships. 

Acknowledgments: We thank the National Science 

Council of Taiwan for their grant (NSC87- 

2311-B-134-001) to support part of this work. We 

are very grateful to the anonymous reviewers for 

their critical and constructive comments on our 

manuscript. 

REFERENCES 

Abreu MJ, MJ Santos-Wisniewski, O Rocha, TC Orlando. 

2010. The use of PCR-RFLP to genetically distinguish 

the morphologically close species: Ceriodaphnia dubia 

Richard, 1894 and Ceriodaphnia silvestrii Daday, 1902 

(Crustacean Cladocera). Braz. J. Biol. 70: 121-124. 

Adamowicz SJ, A Petrusek, JK Colbourne, PDN Hebert, JDS 

Witt. 2009. The scale of divergence: a phylogenetic 

appraisal of intercontinental allopatric speciation in a 

passively dispersed freshwater zooplankton genus. Mol. 


Belyaeva M, DJ Taylor. 2009. Cryptic species within the 

Chydorus sphaericus species complex (Crustacea: 

Cladocera) revealed by molecular markers and sexual 

stage morphology. Mol. Phylogen. Evol. 50: 534-546. 

Blaxter ML. 2004. The promise of a DNA taxonomy. Phil. 

Trans. R. Soc. B Biol. Sci. 359: 669-679. 

Boonsom J. 1984. The freshwater zooplankton of Thailand 

(Rotifera and Crustacea). Hydrobiologia 113: 223-229. 

Chen CS, CH Tzeng, TS Chiu. 2010. Morphological and 

molecular analyses reveal separations among 

spatiotemporal populations of anchovy (Engraulis 

japonicus) in the southern East China Sea. Zool. Stud. 

49: 270-282. 

Chiang SC, NS Du. 1979. Freshwater Cladocera. Fauna 

Sinica. Crustacea. Beijing, China: Science Press, 

Academia Sinica, 297 pp. 

Costa FO, JR deWarrd, J Boutillier, S Ratnasingham, RT 

Dooh, M Hajibabaei, PDN Hebert. 2007. Biological 

identifications through DNA barcodes: the case of the 

Crustacea. Can. J. Fish. Aquat. Sci. 64: 272-295. 

Du NS. 1993. Crustacean biology. Beijing, China: Science 

Press, 1003 pp. (in Chinese) 

Elias-Gutierrez M, FM Jeronimo, NV Ivanova, M Valdez- 

Moreno, PDN Hebert. 2008. DNA barcodes for 

Cladocera and Copepoda from Mexico and Guatemala: 

highlights and new discoveries. Zootaxa 1893: 1-42. 

Dumont HJ, SV Negrea. 2002. Introduction to the class 

Branchiopoda. (No. 19) Guides to the identification of the


microinveryebrates of the continental waters of the world. 

Leiden, the Netherlands: Backhuys Publishers, 398 pp. 

Flössner D. 1972. Krebstiere, Crustacea. Kiemen- und 

Blattfüsser, Branchiopoda. Fischläuse, Branchiura. 

Tierw. Deutschl. 60. Gustav Fischer Verlag, Jena. 501 p. 

(in German) 

Folmer O, M Black, W Hoeh, R Lutz, R Vrijenhoek. 1994. DNA 

primers for amplification of mitochondrial cytochrome c 

oxidase subunit I from diverse metazoan invertebrates. 

Mol. Mar. Biol. Biotechnol. 3: 294-299. 

Fryer G. 1957. Freeliving freshwater Crustacea from Lake 

Nyassa and adjoining waters. Part II. Cladocera and 

Conchostraca. Arch. Hydrobiol. 53: 223-239. 

Hall TA. 1999. BioEdit: a user-friendly biological sequence 

alignment editor and analysis program for Windows 95/98/ 

NT. Nucleic Acids. Symp. Ser. 41: 95-98. 

Hann BJ. 1995. Genetic variation in Simocephalus 

(Anomopoda: Daphniidae) in North America: patterns and 

consequences. Hydrobiologia 307: 9-14. 

Harding JP. 1961. Some South African Cladocera collected by 

Dr. A. D. Harrison. Ann. S. Afr. Mus. 46: 35-46. 

Hebert PDN, CA Ball, SL deWaard Jr. 2003. Biological identifications 

through DNA barcodes. Proc. R. Soc. Lond. B 

Biol. Sci. 270: 313-321. 

Hebert PDN, EH Penton, JM Burns, DH Janzen, W Hallwachs. 

2004. Ten species in one: DNA barcoding reveals cryptic 

species in the Neotropical skipper butterfly Astraptes 

fulgerator. PNAS 101: 14812-14817. 

Hebert PDN, S Ratnasingham, SL deWarrd JR. 2003. Barcoding 

animal life: cytochrome c oxidase subunit 1 

divergences among closely related species. Proc. R. Soc. 

Lond. B 270(Supplement): 96-99. 

Hebert PDN, MY Stoeckle, TS Zemlak, CM Francis. 2004. 

Identification of birds through DNA barcodes. Plos Biol. 2: 

1657-1663. 

Hemsen J. 1952. Ergebnisse Österreichischen Iran Expedition 

1949/50. Cladoceren und freilebende Copepoden, usw. 

Österr. Akad. Wiss. Mathem.-nat. Kl. Abt. I 161: 585-644. 

(in German) 

Ishida S, AA Kotov, DJ Taylor. 2006. A new divergent lineage of 

Daphnia (Cladocera: Anomopoda) and its morphological 

and genetical differentiation from Daphnia curcirostris 

Eylmann, 1887. Zool. J. Linn. Soc. 146: 385-405. 

Johnson DS. 1953. On some Cladocera from South African 

muds. Ann. Mag. Nat. Hist. 12: 923-928. 

Kim IH. 1998. Key to the Korean freshwater Cladocera. Kor. J. 

Syst. Zool. Spec. Issue 2: 43-65. (in Korean) 

Kumar S, K Tamura, M Nei. 2004. MEGA 3: integrated 

software for molecular evolutionary genetic analysis 

sequence alignment. Bioinformatics 5: 150-163. 

Lefébure T, CJ Douady, M Gouy, J Gibert. 2006. Relationships 

between morphological taxonomy and molecular 

divergence within Crustacea: proposal of a molecular 

threshold to help species delimitation. Mol. Phylogen. 

Evol. 40: 435-447. 

Manuilova EF. 1964. Vetvistousye rakoobraznye fauny SSSR. 

Opredeliteli po faune SSSR 88. Moscow and Leningrad: 

Nauka, 327 pp. (in Russian) 

Mayer E, PD Ashlock. 1991. Principles of systematic zoology, 

2nd ed. New York: McGraw-Hill, pp. 42-51. 

Michael RG, BK Sharma. 1998. Indian Cladocera: fauna of 

Indian and adjacent countries. Shillong, Meghalaya, 

India: Department of Zoology, North-Eastern Hill Univ., 

262 pp. 

Mizuno T, E Takahashi. 1991. An illustrated guide to freshwater 

zooplankton in Japan. Hiroshibacho, Suita-shi, Osaka, 

Japan: Hoikusha Publishing, 532 pp. 

Moore WS. 1995. Inferring phylogenies from mtDNA variation: 

mitochondrial-gene trees versus nuclear-gene trees. 

Evolution 49: 718-726. 

Negrea S. 1983. Cladocera. Fauna Republicii Socialiste 

Romania. Volume IV. Fascicula 12. Cladocera. Editura 

Academiei Republicii Romania. Bucuresti, 399p. 

Nei M. 1987. Molecular evolutionary genetics. New York: 

Columbia Univ. Press. 

Ni MH. 2005. Systematic studies of Simocephalus (Cladocera: 

Daphnnidae) from Taiwan. Master’s thesis, Department 

of Applied Science, National Hsinchu Univ. of Education, 

Hsinchu, Taiwan, 69 pp. 

Orlova-Bienkowskaja MY. 1998. A revision of the clarocen 

Genus Simocephalus (Crustacea: Daphniidae). Bull. Nat. 

Hist. Mus. Lond. (Zool.) 64: 1-62. 

Orlova-Bienkowskaja MY. 2001. Cladocera: Anomopoda 

Daphniidae: genus Simocephalus. Leiden, the Netherlands: 

Backhuys, 130 pp. 

Rajapaksa R, CH Fernando. 1982. The Cladocera of Sri Lanka 

(Ceylon), with remarks on some species. Hydrobiologia 

94: 49-69. 

Rowe CL, SJ Adamowicz, PDN Hebert. 2007. Three new 

cryptic species of the freshwater zooplankton genus 

Holopedium (Crustacea: Branchiopoda: Ctenopoda), 

revealed by genetic methods. Zootaxa 1656: 1-49. 

Rylov WM. 1930. Cladocera et Copepoda in Abhandlungen 

der Pamir-Expedition 1928. II. Zoologie: 105-133. 

Saitou N, M Nei. 1987. Neighbor-joining method. Mol. Biol. 

Evol. 4: 406-425. 

Sharam BK. 1978. A note on freshwater cladocerans from 

West Bengal. Bangladesh J. Zool. 6: 139-151. 

Sars GO. 1903. On the crustacean fauna of central Asia. Part 

II. Appendix. Cladocera. Ann. Mus. Zool. Acad. Sci. St. 

Petersburg 8: 157-264. 

Sars GO. 1916. The freshwater Entomostraca of Cape 

Province (Union of South Africa) Part I. Cladocera. Ann. 

S. Afr. Mus. 15: 303-351. 

Shi XL, XB Shi. 1996. On the species and distribution of 

Simocephalus in Heilongjiang Province, China. Acta 

Zootax. Sin. 21: 263-276. (in Chinese) 

Tautz D, P Arctander, A Minelli, RH Thomas, AP Vogler. 2003. 

A plea for DNA taxonomy. Trends Ecol. Evol. 18: 70-74. 

Tuo YS. 2002. Freshwater Cladocera of Taiwan. Master’s 

thesis, Institute of Mathematics and Science Education, 

Hsinchu Education College, Hsinchu, Taiwan, 60 pp. 

Uéno M. 1927. On some freshwater branchiopods from China. 

Annot. Zool. Jpn. 11: 157-163. 

Uéno M. 1966. Cladocera and Copepoda from Nepal. Jpn. J. 

Zool. 26: 95-100. 

Werestschagin G. 1923. Notiz über die Süsswasserfauna 

des Pamirs. Bull. I`Inst. Hydrobiol. Russie 6: 1-40. (in 

German) 

Xu S, PDN Hebert, AA Kotov, ME Cristescu. 2009. The noncosmopolitanism 

paradigm of freshwater zooplankton: 

insights from the global phylogeography of the predatory 

cladoceran Polyphemus pediculus (Crustacea, 

Onychopoda). Mol. Ecol. 18: 5161-5179. 

Yoon SM, HS Kim. 1987. A systematic study on the freshwater 

Cladocera from Korea. Kor. J. Syst. Zool. 3: 175-207. (in 

Korean) 

Yoon SM, W Kim. 2000. Taxonomic review of the cladoceran 

genus Simocephalus (Branchiopoda, Anomopoda, 

Daphnidae). Kor. J. Limnol. 33: 152-161.


Two New Species of Amphipods of the Superfamily Aoroidea (Crustacea: 

Corophiidea) from the Strait of Malacca, Malaysia, with a Description of 

a New Genus 

Bin Abdul Rahim Azman* and Bin Haji Ross Othman 

Marine Ecosystem Research Centre, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi, Selangor, 

Malaysia 


Bin Abdul Rahim Azman and Bin Haji Ross Othman (2012) Two new species of amphipods of the 

superfamily Aoroidea (Crustacea: Corophiidea) from the Strait of Malacca, Malaysia, with a description of a 

new genus. Zoological Studies 51(2): 232-247. A taxonomic study on the amphipods collected from muddy 

bottom habitats of the west coast of Peninsular Malaysia (Strait of Malacca) revealed 2 new species from the 

superfamily Aoroidea. Klebang barnardi gen. nov., sp. nov., and Grandidierella melakaensis, sp. nov., are 

described below. Klebang barnardi sp. nov. differs from the rest of its congeners in the combination of (1) a 

unique carpal configuration of gnathopod 2, (2) a largely expanded posterior margin of the carpus of gnathopod 1, 

and (3) a densely setose mandibular palp. Grandidierella melakaensis sp. nov., on the other hand, can be easily 

distinguished from other Grandidierella species in having (1) a distinctly projecting rostrum, (2) pereopod 5 with 

a merus and ischium of equal length, and (3) epimerons 1 and 2 with long plumose setae posteroventrally. 


Key words: Amphipoda, Klebang barnardi, Grandidierella melakaensis, New genus, Strait of Malacca. 

In their revision of the suborder Corophiidea, 

Myers and Lowry (2003) divided the superfamily 

Aoroidea into the 2 families of the Aoridae 

and Uniciolidae. We found 2 new species of 

amphipods each belonging to these families. The 

new species were discovered in benthic fauna 

samples from muddy bottom habitats of the Strait 

of Malacca at a depth range of 15-20 m in the 

vicinity where Listriella longipalma was described 

by Othman and Morino (2006). Complete 

drawings of the appendages of the male and some 

important characters of the female are presented. 

In addition, comparisons of the new species with 

related species are made. 


This study is based on benthic materials 

collected from the muddy-sand substrata in the 

vicinity of the Port of Sungai Udang, Melaka 

(Fig. 1). Samples were collected using a Smith- 

McIntyre grab (0.05 m 2 ) at depths ranging 15-20 m. 

Once hauled in, the contents of the grab were 

emptied into a container and wet sieved through 

a 0.05-mm-mesh sieve. The materials retained 

on the sieve were then carefully transferred into 

plastic containers and fixed with a 4% buffered 

formaldehyde-seawater solution. In the laboratory, 

animals were examined under a compound 

microscope and later selected for dissection. The 

appendages of the dissected specimens were 

examined and figures were produced under a Leica 

DMLB light microscope using a camera lucida. 


E-mail:abarahim@gmail.com 

232

Azman and Othman – A New Genus and Species of Aoroid Amphipod 233 

The following abbreviations are used: A, 

antenna; ABD, abdomen; G, gnathopod; HD, head; 

l, left; LL, lower lip; MD, mandible; MX, maxilla; 

MP, maxilliped; P, pereopod; PL, pleopod; r, right; 

T, telson; U, uropod; UR, urosome; UL, upper 

lip; , male; , female. The type materials of 

the new species are deposited at the Universiti 

Kebangsaan Malaysia Muzium Zoologi (UKMMZ), 

Bangi, Malaysia. 

RESULTS 

Corophiida Leach, 1814 

Aoroidea Stebbing, 1899 

Diagnosis (description based on Myers 

and Lowry 2003): Head rectangular, anterodistal 

margin recessed, lateral cephalic lobe weakly 

extended, eye, if present, situated proximal to 

lobe; anteroventral margin weakly recessed, 

moderately excavate. Mandible palp 3-articulated 

or absent, article 3, when present, asymmetrical, 

distally rounded, with setae extending along most 

of posterodistal margin, or approximately parallelsided 

with distal setae only; posterior margin with 

setae of variable length, or with comb of short 

6° 

0° 

THAILAND 

Strait of Malacca 

SUMATERA 

PENINSULAR MALAYSIA 

Fig. 1. Map showing the sampling area. 

N 

Port of Sungai Udang 

SINGAPORE 

1 km 

KLEBANG 

KEPULAUAN ANAMBAS 

setae and a few long, slender setae. Gnathopod 

1 enlarged in both sexes, or only in males; coxa 1 

enlarged, larger than coxa 2. Merus of gnathopod 

2 not enlarged. Pereopods 5-7 without accessory 

spines on anterior margin. Pereopod 7 longer or 

much longer than pereopod 6. Urosomites not 

coalesced. Uropods 1 and 2 without a dense array 

of robust setae. Peduncle of uropod 3 relatively 

short, length usually ≤ 2 times breadth; with 2, 1, 

or no rami. Telson without hooks or denticles. 

Aoridae Stebbing, 1899 

Diagnosis: Anteroventral margin of head 

moderately excavate. Pereopod 7 very elongate, 

entire propodus extending beyond pereopod 6. 

Grandidierella Coutière, 1904 

Diagnosis: Eyes small to medium. Accessory 

flagellum of antenna 1 minute, 1-segmented. 

Inner plate of maxilla 1 vestigial. Coxae very 

small, relatively short, of various sizes and shapes. 

Gnathopod 1 (male) complexly subchelate and 

much larger than gnathopod 2. Gnathopod 2 

subchelate. Dactylus of pereopods 6 and 7 

elongate, falcate. Uropods 1 and 2 biramous; 

rami slightly subequal; peduncle with ventrodistal 

process. Uropod 3 uniramous. Telson entire. 

Species composition: Grandidierella contains 

40 species of G. africana Schellenberg, 1936; G. 

bispinosa Schellenberg, 1938; G. bonnieroides 

Stephensen, 1948; G. cabindae (Schellenberg, 

1925); G. chelata K.H. Barnard, 1951; G. 

chaohuensis Hou and Li, 2002; G. dentimera 

Myers, 1970; G. elongata (Chevreux, 1926); G. 

exilis Myers, 1981; G. fasciata Ariyama, 1996; G. 

gilesi Chilton, 1921; G. gravipes K.H. Barnard, 

1935; G. grossimana Ledoyer, 1967; G. indentata 

Ledoyer, 1979; G. insulae Myers, 1981; G. 

ischienoplia Bochert and Zettler, 2010; G. japonica 

Stephensen, 1938; G. kanakensis Myers, 1998; 

G. koa J.L. Barnard, 1977; G. lignorum K.H. 

Barnard, 1935; G. longidactyla Ledoyer, 1982; 

G. lutosa K.H. Barnard, 1952; G. macronyx K.H. 

Barnard, 1935; G. mahafalensis Coutière, 1904 

(type species); G. makena J.L. Barnard, 1970; G. 

melakaensis sp. nov.; G. nottoni Shoemaker, 1935; 

G. nyala Griffiths, 1974; G. osakaensis Ariyama, 

1996; G. palama J.L. Barnard, 1977; G. perlata 

Schellenberg, 1938; G. propodentata Moore, 1986; 

G. rhizophorae Myers, 2009; G. robusta Ledoyer, 

1982; G. spinicoxa Myers, 1972; G. taihuensis 

Morino and Dai, 1990; G. teres Myers, 1981; G.


trispinosa Bano and Kazmi, 2010; G. unidentata 

Ren, 2006; and G. vietnamica Dang, 1968. 

Grandidierella melakaensis sp. nov. 

(Figs. 2-5) 

Material examined: Holotype. , Malaysia, 

Strait of Malacca, Melaka, Port of Sungai 

Udang, (2°14'3"N, 102°7'43"E), 17 m, muddy 

bottom, 26 May 1995, C. Zaidi, M. Soed, S. 

Zuhaimi (Smith-McIntyre grab). UKM I.D. 3611 

(UKMMZ-1273). Allotype. , data same as for 

holotype. (UKMMZ-1274). Paratypes. Data same 

as for holotype, UKMMZ-1275 (2 , 2 ); 

UKMMZ-1276 (3 , 6 ); UKMMZ-1277 

(5 , 3 ). 

Description: Female (holotype). Total body 

length 2.6 mm (from tip of rostrum to apex of 

telson). Head (HD, Fig. 3) with short, pointed 

rostrum, about as long as pereonites 1 and 2 

combined, with triangular-shaped anterior head 

lobe, inferior antennal sinus deep, beyond middle 

of head. Eye small, oval, placed just behind 

anterior head lobe. Antenna 1 (A1, Fig. 3) much 

longer than antenna 2, with peduncle longer than 

flagellum, length ratio of 9: 11: 4; flagellum shorter 

than peduncle, composed of 15 articles, distal one 

of which vestigial, each article distally provided 

with tuft of long and short setae. Antenna 2 (A2, 

Fig. 3) short and stout, 4-segmented in ratio of 5: 

7: 16: 14; 1st and 2nd peduncular articles very 

short, their combined length subequal to article 

3, broader than those of antenna 1; flagellum 

very short, slightly longer than 1/2 length of 

peduncular article 4, 3-articulate, all articles 

setiferus, distalmost article apically armed with 2 

stout spines surrounded by a tuft of setae. Apical 

margin of upper lip (UL, Fig. 3) broad, slightly 

concave medially, bearing minute bristle. Inner 

plate of lower lip (LL, Fig. 3) developed, broad 

and angular, minutely pubescent, outer plate with 

rounded shoulder, densely pubescent, and with 

strongly developed, rounded mandibular process. 

Incisor of mandible (MD, Fig. 3) well-developed, 

with 4 teeth on left mandible and 5 teeth on right 

one; lancinia mobilis armed with 4 teeth on both 

left and right mandibles; accessory blades 8 

on left mandible and 7 on right one; right molar 

process developed, with circular apex, fringed with 

apically branched processes; palp triarticulate. 

Inner plate of maxilla 1 (MX1, Fig. 3) small and 

short, with setae; outer plate distally truncate; 

palp biarticulate, extending slightly beyond outer 

plate, with rounded apex. Inner plate of maxilla 

2 (MX2, Fig. 3) broad medially, pointed distally, 

outer margin naked; outer plate extending just 

beyond inner one, both outer and inner margins 

naked. Inner plate of maxilliped (MP, Fig. 3) 

elongate, extending well beyond proximal article 

of palp, medially narrow, apically truncate; outer 

plate almost reaching end of palp article 2, inner 

margin straight and outer margin evenly convex, 

dense bristles on outer margin; palp consisting of 

4 articles, article 4 small, subtriangular, tapering to 

truncate tip and ending in stout spine. Pereonites 

1-5 subequal to each other in length, 6 and 4 of 

equal length, and 5-7 deeper than preceding ones, 

pereonite 1 anteroventrally roundly produced. 

Coxal plates small, shallow, separated. 

Gnathopod 1 (G1 , Fig. 2) subequal in 

size with gnathopod 2, length ratio of articles from 

basis to dactylus approximately 16: 3: 4: 15: 9: 7; 

basis stout, anterior margin straight; ischium short, 

subrectangular, anterior margin distally weakly 

produced and naked; merus slightly longer than 

ischium, distally tapering to become subtriangular, 

posterior margin and submargin throughout with 

numerous setae which are peculiarly very long and 

bristly; carpus about as long as basis, elongate, 

posterior margin weakly convex but crenulate and 

both its margin and submargin throughout densely 

covered with very long bristly setae; propodus 

narrower and slightly longer than 1/2 of carpus, 

slightly curved but with uniform width, densely 

covered with very long setae both anteriorly 

and posteriorly; dactylus shorter than propodus, 

stout, falcate, tapering to pointed tip, grasping 

margin minutely serrated medially. Length ratio 

of articles of gnathopod 2 (G2 , Fig. 2) from 


brood plate narrow and elongate, about as broad 

as basis and about 1/2 as long as gnathopod 2; 

basis elongate and parallel-sided; ischium short, 

with distally slightly produced anterior margin and 

naked posterior margin; merus slightly longer than 

ischium, subcircular, as long as broad; carpus 

shorter than propodus, naked along its length; 

propodus elongate, as broad as and subequal 

to basis in length, palm transverse, defined by 3 

stout spines, palm margin possessing some robust 

setae; dactylus stout, short, as long as palm, clawlike, 

grasping margin with a hump near proximal 

end. Pereopod 3 (P3, Fig. 4) longer than pereopod 

4; brood plate elongate and lanceolate; length ratio 

of articles from basis to dactylus approximately 

13: 3: 6: 4: 5: 8; basis linear; ischium short, 

subrectangular, anterior margin medially concave; 

merus longer than carpus, distally slightly broader;


 

G2 

G1 

G1 

G2 

Fig. 2. Grandidierella melakaensis sp. nov., holotype, female (UKMMZ-1273), 2.6 mm, allotype, male (UKMMZ-1274), 2.9 mm. Port of 

Sungai Udang, Melaka. Scale bars: G1 and G2 = 0.25 mm; G1 and G2 = 0.2 mm.


A2 

HD 

A1 

MP 

MX1 

MX2 

MD 

LL 

UL 

Fig. 3. Grandidierella melakaensis sp. nov., holotype, female (UKMMZ-1273), 2.6 mm. Port of Sungai Udang, Melaka. Scale bars: 

A2 = 0.25 mm; A1 and HD = 0.5 mm; MP and MD = 0.2 mm; UL, LL, MX1, and MX2 = 0.1 mm.


carpus shorter than propodus, anterior margin 

naked; propodus shorter than dactylus, rather 

narrower than preceding articles; dactylus very 

long and thin, slightly curved, slightly tapering to 

tip, both anterior and posterior margins naked. 

Pereopod 4 (P4, Fig. 4) larger than pereopod 5; 

brood plate lanceolate, rather large, with row of 

very long setae; length ratio of articles from basis 

P3 

P4 

P7 

P5 

P6 

Fig. 4. Grandidierella melakaensis sp. nov., holotype, female (UKMMZ-1273), 2.6 mm. Port of Sungai Udang, Melaka. Scale bars: P3 

and P5 = 0.2 mm; P4, P6, and P7 = 0.5 mm.


to dactylus approximately 11: 3: 7: 5: 6: 8; basis a 

little more than 1/3 length of pereopod 4; ischium 

short, anterior margin slightly convex; merus 

larger than carpus, distally slightly broader; carpus 

subequal to propodus, slightly wider than propodus, 

anterior margin gently concave; propodus longer 

but narrower than carpus; dactylus rather long and 

thin, longer than propodus, falcate, tapering to 

pointed tip, anteroproximally with a seta. Pereopod 

5 (P5, Fig. 4) shortest and smallest among all 

pereopods; length ratio of articles from basis to 

dactylus approximately 13: 6: 5: 5: 7: 3; basis 1/3 

as long as pereopod 5, proximally wider; ischium 

longer than merus, rectangular, anterodistally 

with pair of setae; merus as long as carpus but 

broader; carpus narrower than merus; propodus 

rather long and narrow; dactylus short, abruptly 

curved at apex, anterodistally with spine tooth and 

posterodistally submargin (grasping submargin) 

with seta. Pereopod 6 (P6, Fig. 4) reaching end of 

telson, much longer than pereopod 5 but shorter 

than pereopod 7; length ratio of articles from 


basis slightly expanded anteriorly; ischium very 

short, rectangular, slightly narrower than basis; 

merus elongate, rectangular, longer than carpus; 

carpus narrower than merus but as broad as 

propodus; propodus elongate, longer than both 

carpus and merus; dactylus short and falcate, 

pointed anteriorly, proximally wider and tapering to 

pointed distal end, anteriorly grasping margin and 

posteriorly convex margin armed with a spine each 

at about subapex. Pereopod 7 (P7, Fig. 4) very 

long, extending well beyond telson, length ratio 

of articles from basis to dactylus approximately 

11: 2: 9: 9: 12: 3; basis 1/4 as long as pereopod 

7, anteriorly slightly expanded; ischium very short 

and rectangular; merus rather long, rectangular; 

carpus almost as long as merus, but narrower; 

propodus longest among articles, narrow and 

rectangular; dactylus short, stout, falcate, pointed 

forward, anteriorly grasping margin and posteriorly 

convex margin with thin spine each at subapex 

and plumose seta at proximal end of posterior 

margin. Pleopods (PL1, PL2, PL3, Fig. 5) welldeveloped. 

Pleonites 1 and 2 equally elongate, but 

each obviously shorter than pleonite 3. Epimerons 

1 and 2 (ABD, Fig. 5) rectangular, but epimeron 3 

obtusely produced to rear at posteroventral angle 

and dorsomedially posterior end with an acute 

process, posteroventral margins of epimerons 1 

and 2 respectively bearing 4 and 7 plumose setae. 

Uropod 1 (U1, Fig. 5) extending slightly 

beyond uropod 2; peduncle longer than rami; outer 

ramus a little longer than inner one, with row of 

5 robust setae on outer margin, row of 4 robust 

setae on inner margin, and 3 robust setae on 

apex; inner ramus with row of 5 robust setae on 

outer margin, and 3 stout spines on apex, middle 

one of which distinctly shorter. Peduncle of uropod 

2 (U2, Fig. 5) a little longer than rami, outer margin 

bearing 2 robust setae, one at middle and one at 

distal end, distal 1/2 of inner margin with row of 

3 long stout robust setae; outer ramus distinctly 

shorter and narrower than inner one, with row of 3 

robust setae on outer margin, apex with 3 robust 

setae; inner ramus with row of 4 robust setae on 

outer margin, 2 robust setae on distal 1/2 of inner 

margin, and 3 long robust setae on apex, middle 

one longer. Uropod 3 (U3, Fig. 5) extending a little 

beyond uropod 2, uniramous, peduncle short and 

about 1/2 as long as ramus, with slightly convex 

lateral margins; ramus biarticulate but distal article 

vestigial, proximal article medially gently broader 

than its proximal and distal parts, both outer and 

inner margins with row of 4 long stiff setae each, 

and apically rounded margin with cross row of 3 

submarginal robust setae; distally small article 

armed with 1 very long stiff seta. Combined length 

of urosomites 1-3 almost as long as pleonite 3, 

and successively smaller in size. Telson (T, Fig. 

5) proximally wider, apical margin truncate, with a 

spine near dorsolateral angle. 

Male (sexually dimorphic characters): 

(allotype – UKMMZ-1274) Total body length 

2.9 mm (from tip of rostrum to apex of telson). 

Gnathopod 1 (G1 , Fig. 2) carpochelate, 

stouter and larger than gnathopod 2, coxal plate 

subquadrangular, length ratio of articles from 


basis stout, anterior margin straight and naked, 

posteriorly gently developed except at proximal 

end where basis narrowed, posterior margin with 

a seta in middle and another at distal end; ischium 

short, anterodistally slightly produced; merus 

longer than ischium, proximally broadest and 

tapering to tip, anterior margin naked, posterior 

margin rather convex; carpus very strong and 

massive, much longer than basis, nearly 2 times 

as long as broad, proximally narrow and distally 

uniformly broad, both anterior and posterior 

margins convex and carpus subovate, anterior 

margin naked except for minute seta near distal 

end, posterior margin covered throughout with 

several plumose setae on margin and submargins, 

posterodistal corner produced into very strong 

and large process which is outwardly deflected 

and ends in blunt tip, at base of which, on distal


U1 

U2 

U3 

ABD 

T 

PL2 

PL3 

PL1 

Fig. 5. Grandidierella melakaensis sp. nov., holotype, female (UKMMZ-1273), 2.6 mm. Port of Sungai Udang, Melaka. Scale bars: 

T = 0.1 mm; U1 = 0.25 mm; U2 and U3 = 0.2 mm; ABD, and PL1-PL3 = 0.5 mm.


margin, with a group of several plumose setae; 

propodus much shorter and narrower than carpus, 

proximally and distally broader than medial part, 

anterior margin uneven, posterior concave margin 

medially produced forming strong and apically 

blunt process, throughout its length covered with 

several plumose setae; dactylus rather stout, 

somewhat straight, proximally wider and tapering 

to blunt tip, grasping margin proximally bearing 

single small tooth and subapically with 2 pairs of 

small teeth, anterior margin with pair of setae near 

proximal end. Gnathopod 2 (G2 , Fig. 2) in both 

female and male rather similar except for length 

of basis which in male is distinctly longer than 

propodus (1.4 times as long as propodus). 

Remarks: The genus Grandidierella Coutière, 

1904, a member of amphipods of the family 

Aoridae, is characterized by a subcylindrical 

body, small- to medium-sized eyes, small 

coxae, gnathopod 1 larger than gnathopod 2, 

male gnathopod 1 carpochelate, and with a 

uniramous uropod 3. According to Myers (1970), 

Grandidierella presumably originated from the old 

Tethys Sea and is considered to have a tropical 

affinity. Records of this genus appear scattered 

throughout the Caribbean Sea to Madagascar, 

Tanzania, and India (Myers 1970). To date, the 

genus Grandidierella is known to contain 40 

species, with recent additions by Ren (2006), 

Myers (2009), Bochert and Zettler (2010), and 

Bano and Kazmi (2010). The present work 

reports on the 1st record of this genus occurring in 

Malaysian waters, along the coast of the state of 

Melaka, Peninsular Malaysia. 

Grandidierella melakaensis sp. nov. can be 

easily distinguished from all other species in the 

genus by a set of characters known only in this 

species: (1) an obviously projecting rostrum, (2) 

pereopod 5 having a merus and ischium of equal 

lengths, and (3) epimerons 1 and 2 with long 

plumose setae posteroventrally. Nonetheless, 

the specimens examined resemble G. elongata 

in having a triangular ocular lobe; and G. exilis, 

G. gilesi, G. mahafalensis, G. palama, and G. 

indentata in bearing several very long plumose 

setae on the propodus, carpus, and merus of 

gnathopod 2 of both the male and female and 

possessing a single posterodistal spine on male 

gnathopod 1, but clearly differ in many other 

respects, especially in the form of gnathopod 1. 

Furthermore, the inflated uropod 3 peduncle and 

very short mandibular palp article 1 in G. elongata, 

the much inflated uropod 3 peduncle in G. gilesi, 

and the ventral pereon process on pereonite 1 in G. 

exilis also differ. 

Etymology: The new species of Grandidierella 

is named after its type locality, Melaka as 

melakaensis. 

Unciolidae Myers and Lowry, 2003 

Diagnosis (description from Myers and 

Lowry 2003): Anteroventral margin of head 

moderately excavate, or strongly excavate for 

receiving enlarged antenna 2. Pereopod 7 not 

very elongate, entire propodus not extending 

beyond pereopod 6. Included subfamilies/genera. 

Acuminodeutopinae: Acuminodeutopus J.L. 

Barnard, 1959; Klebang gen. nov.; Rudilemboides 

J.L. Barnard, 1959; and Wombalana Thomas 

and Barnard, 1991. Unciolinae: Dryopoides 

Stebbing, 1888; Janice Griffiths, 1973; Liocuna 

Myers, 1981a; Neohela Smith, 1881; Orstomia 

Myers 1998; Pedicorophium Karaman, 1981; 

Pseudunciola Bousfield, 1973; Pterunciola Just, 

1977; Ritaumius Ledoyer, 1978; Rildardanus J.L. 

Barnard, 1969; Uncinotarsus L’Hardy and Truchot, 

1964; Unciola Say, 1818; Unciolella Chevreux, 

1911; and Zoedeutopus J.L. Barnard, 1979. 

Remarks: Myers and Lowry (2003) established 

the family Unciolidae and included it 

together with the existing Aoridae Stebbing 

in the superfamily Aoroidea. It can easily be 

distinguished by a combination of characters that 

includes a moderate or strong excavation along 

the anteroventral margin of the head for receiving 

the enlarged antenna 2; antenna 1 article 3 short, 

≤ 1/2 the length of article 2; an enlarged gnathopod 

1; pereopods 5, 6, and 7 in a regular length 

progression; and all urosomites free. Currently, 

the Unciolidae is composed of the 2 subfamilies 

of the Acuminodeutopinae with 3 genera and 

the Unciolinae with 14 genera and is distributed 

worldwide in both cold and warm waters. 

Klebang gen. nov. 

Type species: Klebang barnardi sp. nov., present designation. 

Included species: K. barnardi sp. nov. 

Diagnosis: Rostrum short, ocular lobes 

moderate, produced to front, pointed. Eyes 

moderate. Antenna 1 slightly longer than antenna 

2, both slender; peduncular article 3 slightly shorter 

than article 1, article 2 longest, accessory flagellum 

present. Peduncular article 3 of antenna 2 short, 

flagellum with only 3 or 4 articles. Mandibular palp


setose; article 2 longest. Male gnathopods 1 and 

2 subequal, subchelate, and carpochelate. Outer 

ramus of uropod 1 with brush setae. Uropod 3 

uniramus; peduncle short; ramus elongate with 

robust setae on both margins. Telson semicircular 

and lobed. 

Remarks: The diagnosis of the new genus 

is based on the type-species described below. 

Klebang gen. nov. is closely related to 

Grandidierella Coutière, from which it shares 

several generic characters in having a subcylindrical 

body, an enlarged carpochelate 

gnathopod 1, free urosomites, and a uniramus 

uropod 3. A careful examination of the newly 

acquired material on the other hand, although 

closely similar morphologically to Grandidierella, 

suggests that it represents a new genus in the 

Aoroidea. Myers and Lowry (2003) provided 

a valuable updated key to the families and 

subfamilies of the Corophiidea. Some key characters 

show that our material naturally fits into the 

Acuminodeutopinae, like the short article 3 of 

antenna 1 at ≤ 1/2 the length of article 2, uropod 

3 lacking recurved robust setae, gnathopods 1 

and 2 not together forming a sieving basket, free 

urosomites, an enlarged gnathopod 1, pereopods 

5, 6, and 7 in a regular length progression, and 

most importantly the acute lateral cephalic lobes 

of the head. As shown by the excellent series of 

head drawings of selected genera in Myers and 

Lowry (2003), the acute head cephalic lobes are 

of special importance in the classification of this 

group (Fig. 4 in Myers and Lowry 2003). Currently, 

the acuminodeutopine clade includes only the 3 

genera of Acuminodeutopus, Rudilemboides, and 

Wombalano, and all 3 share the characteristic 

of having the acute, triangular, lateral cephalic 

lobes. Clearly within this clade only Wombalano 

possesses the same distinctive generic characters 

shown in the Klebang gen. nov. material in 

having a uniramus uropod 3. However, the 

unique formation of the male gnathopod 2 (with 

an expanded basis and carpus) in Wombalano 

is an advanced character that separates it from 

the Klebang gen. nov. material. At the same 

time, Klebang gen. nov. is highly distinctive in 

having this combination of characters: (1) the 

unique carpal configuration of gnathopod 2, (2) a 

largely expanded posterior margin of the carpus 

of gnathopod 1, and (3) the densely setose 

mandibular palp that has not yet been formulated. 

Therefore, we consider the current species to be 

representative of a new genus. 

Etymology: The name Klebang refers to 

Pantai Klebang, Melaka, Malaysia the general area 

in Melaka where this genus was discovered. 

Klebang barnardi sp. nov. 

(Figs. 6-8) 

Material examined: Holotype. , Malaysia, 

Strait of Malacca, Melaka, Port of Sungai Udang, 

St. CS, Petronas (2°14'43"N, 102°6'53"E), 20 m, 

muddy bottom, 22 Oct. 2003, C. Zaidi, M. Soed, 

S. Zuhaimi (Smith-McIntyre grab). UKM I.D. 

7187 (ref: UKMMZ-1350). Paratypes. From the 

same sample as holotype, UKMMZ-1352 (7 ); 

UKMMZ-1353 (4 ); UKMMZ-1354 (8 ). 

Description: Male (holotype). Total body 

length 6.7 mm (from tip of rostrum to apex of 

telson). Body rather slender. Head (HD, Fig. 6) 

broader and deeper than pereonite 1; rostrum 

not developed, anterior lateral head lobe (ocular 

lobe) extending forward and anteriorly pointed in 

triangular shape; inferior antennal sinus deep and 

straight vertically; eye distinct and located behind 

anterior head lobe. Antenna 1 (A1, Fig. 6) slightly 

longer than antenna 2, ratio of peduncular articles 

1-3 as 1.1: 1.5: 1; article 1 with 4 postero-marginal 

setae; flagellum with 5 articles, 2 times as long 

as peduncle; accessory flagellum uni-articulate, 

short. Peduncular article 3 of antenna 2 (A2, Fig. 

6) with 3 long and 1 short setae posterodistally; 

article 4 slightly shorter than article 5 with row of 

long setae along posterior margin; flagellum short, 

composed of 4 articles. Labrum of upper lip (UL, 

Fig. 7) broad, its apical margin weakly concave 

mid-ventrally and pubescent on each lobe. Inner 

plates of lower lip (LL, Fig. 7) highly developed 

and subtriangular, mandibular process narrow but 

well-developed; outer plates with bristly shoulders. 

Both mandibles (MD, Fig. 7) similar to each other 

except for number of accessory blades with 4 on 

right and 5 on left; incisor produced to interior, 

broad, with 5 teeth; lacinia mobilis on both sides 

4-toothed, followed by 4 or 5 accessory blades; 

molar process medium, ridged distally and serrate 

marginally, with a single seta; palp triarticulate. 

Inner plate of maxilla 1 (MX1, Fig. 7) reduced; 

outer plate with truncate apical margin; palp 

extending beyond outer plate, biarticulate. Inner 

plate of maxilla 2 (MX2, Fig. 7) slightly shorter than 

outer one; outer plate larger than inner one, distally 

broadest and with rounded apical margin. Inner 

plate of maxilliped (MP, Fig. 7) short, not extending 

beyond tip of palmer proximal article; outer plate 

extending beyond 1/2 of palmer article 2, outer 

margin naked, evenly convex; palp 4-articulated,


terminal article distally tapering and ending in a 

long nail-like spine-tooth. 

Gnathopod 1 (G1, Fig. 6) subchelate and 

carpochelate, subequal to gnathopod 2 in size; 

coxa plate shallow, rhomboidal, smaller than 

others, anteroventral angle markedly produced; 

length ratio of articles from basis to dactylus 

approximately 14: 3: 4: 12: 10: 7; basis linear, 

almost parallel-sided; ischium short, posterior 

margin 3 times as long as anterior margin; merus 

subrectangular, longer than wide, anterior margin 

naked; carpus robust, mainly subrectangular 

except proximally small and short, with triangular 

ending, greatly wider and longer than propodus, 

posterodistally 3/4 margin throughout equally 

produced into widely expanded plate which is 

proximoventrally oblique and distoventrally pointing 

forwards and ending in a small tooth; propodus 

shorter and narrower than carpus, anterior evenly 

convex and posterior margin barely concave; 

dactylus stout, fairly curved, about 1/2 as long 

as carpus, tapering to pointed tip. Gnathopod 2 

(G2, Fig. 6) longer than gnathopod 1, subchelate 

and carpochelate; coxa plate shallow with 

ventral margins medially produced into triangular 

expansion; length ratio of articles from basis to 

dactylus 18: 3: 5: 10: 14: 6; basis linear; ischium 

shortest of all articles, subrectangular; merus 

slightly longer than ischium, posterodistal angle 

with triangular spine-tooth; carpus at mid-length 

twice as long as merus but shorter than propodus, 

proximally narrowing into triangular end and distally 

widening with truncate apical margin, distal 1/2 of 

posterior margin produced into large elongated 

expansion which is proximally wider, distally 

tapering to rounded tip, outwardly deflected, 

and reaching near distal margin of propodus; 

propodus rather long and stout, proximally narrow 

and distally obviously broader, palm strongly 

transverse, with minutely serrated marginal spines; 

dactylus fitting on palm, stout, tapering to pointed 

tip, anteroproximally with long setae. Pereopod 3 

(P3, Fig. 8) thin and elongate; coxa plate shallow 

with ventral margins medially produced into 

triangular expansion; length ratio of articles from 


basis linear, almost uniform in width, 1/3 as long 

as pereopod 3; ischium short, subrectangular; 

merus shorter than carpus, anterodistally weakly 

produced; carpus rectangular; propodus narrower 

than carpus; dactylus rather long, 4/5 as long as 

propodus, gently curved, tapering to pointed tip, 

anteroproximally armed with a seta. Pereopod 4 

(P4, Fig. 8) rather similar to pereopod 3 but slightly 

shorter, coxa plate with ventral margins medially 

produced into triangular expansion; length ratio of 

articles from basis to dactylus approximately 15: 

3: 7: 7: 8: 5; and with less setation than pereopod 

3. Pereopod 5 (P5, Fig. 8) slightly longer than 

pereopod 4; coxa posteroventrally expanded into 

long and narrowly obtuse angle; length ratio of 


3: 11: 9: 9: 3; basis slightly expanded in proximal 

part, about 1/3 as long as pereopod 5; ischium 

short, anterior margin longer than posterior one; 

merus longer than carpus, uniform in width, apical 

margin anteriorly produced into triangular process; 

carpus subequal to merus in width, parallel-sided 

except near proximal end; propodus about as long 

as carpus; dactylus short, 1/3 as long as propodus, 

weakly curved, tapering to pointed tip, bearing 1 

plumose seta at anterior proximal end and 1 thin 

spine in middle of grasping margin. Pereopod 6 

(P6, Fig. 8) rather long, extending well beyond 

end of telson and uropods; coxa with posteriorly 

produced fairly narrow and rounded lobe, anteriorly 

and anteroventrally rounded; length ratio of 


2: 10: 5: 7: 4; basis almost linear and uniform in 

width, about 1/3 as long as pereopod 6; ischium 

short, posterodistally slightly produced; merus 2 

times longer than carpus, distinctly narrower than 

basis, twisted near distal end; carpus shorter than 

propodus, anterior and posterior margins curved 

forward forming a groove along its length; dactylus 

about 1/2 as long as propodus, tapering to sharply 

pointed tip, posterior margin with long slender 

spine at 2/3 from proximal end. Pereopod 7 (P7, 

Fig. 8) extremely long, extending well beyond end 

of pereopod 6; coxa comparatively shallower; 

length ratio of articles from basis to dactylus 7: 1: 

8: 4: 6: 3; basis weakly expanded, 1/4 as long as 

pereopod 7; ischium short, posterior margin distally 

slightly produced; merus longer but narrower 

than basis; anterior and posterior margins of 

carpus curved to rear forming a groove; propodus 

elongate and rather slender; dactylus 1/2 as long 

as propodus, weakly curved, tapering to pointed 

tip, with 1 long thin spine at 2/3 from proximal end. 

Epimeron 1 (ABD, Fig. 6) subrectangular, 

2 posteriorly evenly rounded, and 3 with roundly 

produced antero- and posteroventral angles. 

Urosomites 1-3 in combined length as long as 

epimeron 3. 

Pleopods 1-3 (PL1, PL2, PL3, Fig. 8) 

similar to each other; peduncles cylindrical and 

anterodistally with plumose setae, each one 

distinctly shorter than inner ramus but equal to


A1 

G1 

HD 

A2 

ABD 

G2 

Fig. 6. Klebang barnardi sp. nov., holotype, male (UKMMZ-1350), 6.2 mm. Port of Sungai Udang, Melaka. Scale bars: G1, G2, ABD, 

and HD = 0.5 mm; A1 and A2 = 0.2 mm.


MX1 

MX2 

MD L 

MD R 

LL 

UL 

U1 

MP 

U2 

T 

U3 

Fig. 7. Klebang barnardi sp. nov., holotype, male (UKMMZ-1350), 6.2 mm. Port of Sungai Udang, Melaka. Scale bars: MP, MD L-R, 

U2, U3, and T = 0.25 mm; MX1 and MX2 = 0.1 mm; UL and LL = 0.2 mm; U1 = 0.5 mm.


P3 

P4 

P6 

P7 

PL2 

P5 

PL3 

PL1 

Fig. 8. Klebang barnardi sp. nov., holotype, male (UKMMZ-1350), 6.2 mm. Port of Sungai Udang, Melaka. Scale bar: P3-P7 = 

0.5 mm; PL1-PL3 = 0.5 mm.


or slightly longer than outer one; rami densely 

covered with rather long swimming setae. 

Uropod 1 (U1, Fig. 7) extending well beyond 

ends of other uropods; peduncle longer than both 

rami; outer ramus slightly longer and broader than 

inner ramus, outer margin lined with row of spines, 

inner margin with row of robust setae, distal margin 

rounded and bearing set of 1 long and 2 short 

robust setae; inner ramus of almost uniform width, 

outer margin with row of spines and apically with 

group of 3 large and 1 very small robust setae. 

Uropod 2 (U2, Fig. 7) slightly extending beyond 

uropod 3; peduncle shorter than both rami, both 

outer and inner margins with row of robust setae; 

peduncular apex bearing triangular inter-ramal 

process, outer ramus subequal to inner one in 

length and apical margin with several robust setae; 

apical margin of inner ramus with group of robust 

setae. Uropod 3 (U3, Fig. 7) uniramous, peduncle 

extremely short, about 1/10 as long as ramus; 

ramus elongate, medially slightly wider, both outer 

and inner margins with row of robust setae; apex 

with 4 long stiff setae. Telson (T, Fig. 7) short, not 

reaching tip of uropod 3 peduncle, semicircular, 

ending in smaller medium circular lobe, with 2 

telsonic angles bearding robust seta plus 2 or 3 

plumose setae on each one. 

Remarks: Although Klebang resembles 

Acuminodeutopus, Rudilemboides, and 

Wombalano as mentioned above, it can be readily 

separated from the remaining genera by having 

(1) the unique carpal configuration of gnathopod 

2, (2) the largely expanded posterior margin of 

the carpus of gnathopod 1, and (3) the setose 

mandibular palp. 

Etymology: The species is named in honor 

of the late J. Laurens Barnard for his exceptional 

work on world gammaridean amphipods. 

Acknowledgments: This work was supported 

by a grant (UKM-ST-08-FRGS0020-2009) from 

the Ministry of Higher Education of Malaysia 

and a UKM research grant (UKM-GGPM- 

PLW-034-2010). 

REFERENCES 

Bano H, QB Kazmi. 2010. Grandidierella trispinosa, a new 

species of amphipod from the Karachi coast, Pakistan 

(Crustacea: Amphipoda: Aoridae). Turk. J. Zool. 34: 151- 

157. 

Barnard JL. 1970. Sublittoral Gammaridea (Amphipoda) of the 

Hawaiian Islands. Smithson. Contrib. Zool. 34: 1-286. 

Barnard JL. 1977. The cavernicolous fauna of Hawaiian lava 

tubes 9. Amphipoda (Crustacea) from brackish lava 

ponds on Hawaii and Maui. Pac. Insects 17: 267-299. 

Barnard KH. 1935. Report on some Amphipoda, Isopoda, and 

Tanaidacea in the collections of the Indian Museum. Rec. 

Indian Mus. 37: 279-319. 

Barnard KH. 1951. New records and descriptions of new 

species of isopods and amphipods from South Africa. 

Ann. Mag. Nat. Hist. 12: 698-709. 

Barnard KH. 1952. Description of a new species of amphipod. 

Trans. R. Soc. South Afr. 33: 279-282. 

Bochert R, ML Zettler. 2010. Grandidierella (Amphipoda, 

Aoridae) from Angola with description of a new species. 

Crustaceana 83: 1209-1219. 

Chevreux E. 1926. Amphipodes, 1: Gammariens (Cont.) In 

Voyage Goelette Fr. 20: 365-398. 

Chilton C. 1921. Fauna of the Chilka Lake. Amphipoda. Mem. 

Indian Mus. 5: 519-558. 

Griffiths CL. 1974. The Amphipoda of southern Africa. Part 3. 

The Gammaridea and Caprellidea of Natal. Ann. South 

Afr. Mus. 62: 209-264. 

Hou ZE, SQ Li. 2002. A new species of the genus 

Grandidierella from Lake Chaohu, China (Crustacea: 

Amphipoda: Aoridae). Acta Zootaxon. Sin. 27: 225-234. 

Ledoyer M. 1967. Amphipodes gammariens des herbiers 

de phanerogammes marines de la region de Tulear 

(Republique Malgache). Etude systematique et ecologique. 

Annales de l’Universite de Madagascar 5: 121- 

170. 

Ledoyer M. 1979. Expedition Rumphius II (1975). Crustaces 

parasites, commensaux etc. VI. Crustaces Amphipodes 

Gammariens. Bull. Mus. Natl. d'Hist. nat. Paris Sere 4 1: 

137-181. 

Ledoyer M. 1982. Crustaces Amphipodes Gammariens. 

Famille des Acanthonozomatidae a Gammaridae. Faune 

Madagascar 59: 1-598. 

Moore PG. 1986. A new species in the genus Grandidierella 

Coutière (Crustacea: Amphipoda) from an Australian solar 

salt-works. J. Nat. Hist. 20: 1393-1399. 

Myers AA. 1970. Taxonomic studies on the genus 

Grandidierella, with a description of G. dentimera sp. nov. 

Bull. Mar. Sci. 20: 135-147. 


Grandidierella Coutiére (Crustacea: Amphipoda) II. The 

Malagasy species. Bull. Mus. Natl. d'Hist. nat. Paris Sere 

3 Zool. 64: 789-796. 


Grandidierella Coutière (Crustacea, Amphipoda). III. 

Fijian, Australian and Saudi Arabian species. Bull. Mus. 

Natl. d’Hist. nat. Paris Sere 4 3: 213-226. 

Myers AA. 1998. The Amphipoda (Crustacea) of New 

Caledonia: Aoridae. Rec. Aust. Mus. 50: 187-210. 

Myers AA. 2009. Aoridae. In JK Lowry, AA Myers, eds. 

Benthic Amphipoda (Crustacea: Peracarida) of the Great 

Barrier Reef, Australia. Zootaxa 2260: 220-278. 

Myers AA, JK Lowry. 2003. A phylogeny and a new classification 

of the Corophiidea (Amphipoda). J. Crust. Biol. 

23: 443-485. 

Othman BHR, H Morino. 2006. Listriella longipalma sp. nov., 

a new amphipod species (Crustacea: Liljeborgiidae) from 

the Straits of Melaka, Malaysia. Zootaxa 1305: 21-32. 

Ren X. 2006. Crustacea Amphipoda Gammaridea (I). Fauna 

Sin. Invertebr. 41: 1-588. 

Schellenberg A. 1925. Amphipoda, Beiträge zur Kenntnis der 

Meeres fauna. Westafrikas 3: 113-204.


Schellenberg A. 1936. Zwei neue Amphipoden des Stillen 

Ozeans und zwei Berichtungen. Zool. Anzeiger 116: 153- 

156. 

Schellenberg A. 1938. Littoral Amphipoden des Topischen 

Pazifiks. K. svenska Vetensk Akad. Handl. 16: 1-105. 

Shoemaker CR. 1935. A new species of amphipod of the 

genus Grandidierella and a new record for Melita nitida 

from Sinaloa, Mexico. J. Wash. Acad. Sci. 25: 65-71. 

Stebbing TRR. 1908. South African Crustacea (Part IV). Ann. 

South Afr. Mus. 6: 1-96. 

Stephensen K. 1938. Grandidierella japonica n. sp. A new 

amphipod with stridulating organ from brackish water in 

Japan. Annot. Zool. Jpn. 17: 179-184 

Stephensen K. 1948. Amphipods from Curaçao, Bonaire, 

Aruba and Margarita. Stud. Fauna Curaçao, Aruba, 

Bonaire Venezuelan Islands 3: 1-20.


Leucosiid Crabs of the Genus Hiplyra Galil, 2009 (Crustacea: Brachyura: 

Leucosiidae) from the Persian Gulf and Gulf of Oman, with Description 

of a New Species 

Reza Naderloo 1,2, * and Michael Apel 3 

1 

Research Institute and Natural Museum of Senckenberg, Senckenberganlage 25, 60325 Frankfurt am Main, Germany 

2 

School of Biology, College of Science, Univ. of Tehran, Tehran, Iran 

3 

Museum Mensch und Natur, Maria-Ward-Straße 1b, 80638 München, Germany. E-mail:apel@musmn.de 


Reza Naderloo and Michael Apel (2012) Leucosiid crabs of the genus Hiplyra Galil, 2009 (Crustacea: 

Brachyura: Leucosiidae) from the Persian Gulf and Gulf of Oman, with description of a new species. Zoological 

Studies 51(2): 248-258. Four species of the leucosiid genus Hiplyra Galil, 2009, are reported here from the 

Persian Gulf and Gulf of Oman. A new species, H. ramli sp. nov. was collected along the coast of Fujairah (United 

Arab Emirates) in the western part of the Gulf of Oman. This new species differs from congeners in the shape 

of the male 1st gonopod, the morphology of the female gonopore, and the armature of the 6th segment of the 

male abdomen. Hiplyra elegans (Gravier 1920) is also recorded from the Iranian coast of the Gulf of Oman for 

the 1st time. Two species from the area, H. variegata (Rüppell, 1830) and H. sagitta Galil 2009, are included in 

this study, and a key is provided for the genus in the area. http://zoolstud.sinica.edu.tw/Journals/51.2/248.pdf 

Key words: Brachyura, Leucosiidae, Hiplyra, Persian Gulf, Gulf of Oman. 

Crabs of the family Leucosiidae are common 

faunal elements of littoral and sublittoral softsediment 

habitats in the Persian Gulf and Gulf of 

Oman. They are the most diverse of all brachyuran 

families (Stephensen 1946, Titgen 1982, Apel 

2001). Apel (2001) listed 30 leucosiid species from 

the Persian Gulf plus 2 additional species only 

known from the Gulf of Oman and commented that 

records of 4 more species reported from the region 

are doubtful. Thus almost 1/6 of all brachyuran 

crab species of the Persian Gulf belong to the 

Leucosiidae (Apel 2001). Some additional new 

species were also described and recorded from the 

Persian Gulf in recent years, raising the number 

of leucosiid crabs in the region to 35 species 

(Naderloo and Sari 2005). Recently, Galil (2009) 

added 2 more species (Hiplyra sagitta Galil, 2009, 

and Lyphira perplexa Galil, 2009) when she revised 

Philyra Leach, 1817. Therefore, the actual number 

of leucosiid species recorded from the Persian Gulf 

is currently 37. However, the leucosiid fauna of 

the Gulf of Oman remains poorly known, and only 

11 species of this group have been recorded there 

(Nobili 1906, Stephensen 1946, Tan and Ng 1995, 

Apel 2001). By adding 2 recorded species herein, 

the number of known leucosiid species from the 

Gulf of Oman rises to 13. 

Galil (2009), in her recent treatment of 

Philyra, divided the genus into 8 genera. Among 

those, Hiplyra Galil, 2009, comprises 6 species 

distributed in the Indo-West Pacific: H. elegans 

Gravier, 1920; H. longimana A. Milne Edwards, 

1874; H. michellinae Galil, 2009; H. platycheir 

De Haan, 1841; H. sagitta Galil, 2009; and H. 

variegata (Rüppell, 1830). The genus is characterized 

by elongate adult chelipeds with the 

*To whom correspondence and reprint requests should be addressed. E-mail:rnaderloo@senckenberg.de 

248

Naderloo and Apel – Hiplyra in Northern Indian Ocean 249 

cutting edge of the movable finger entire and 

blade-shaped, the inner margin of the immovable 

finger fringed with dense setae, and segments 2-6 

of the male abdomen triangular being fused with 

the lobate proximal margins (Galil 2009). Two 

species of this genus, H. variegata (recorded by 

Stephensen 1946) and H. sagitta (described by 

Galil (2009) from the Persian Gulf) were previously 

recorded from the Persian Gulf and adjacent 

waters. A reexamination of the material identified 

by Stephensen (1946) as H. variegata; however, 

revealed that specimens collected from the Gulf of 

Oman in Jask, differed from the descriptions and 

illustrations of H. variegata provided by Rüppell 

(1830) and Galil (2009). Those specimens are 

assigned here to H. elegans, which was previously 

known from Madagascar and Sri Lanka (Galil 

2009). A new species is described from the east 

coast of the United Arab Emirates (UAE) in the 

Gulf of Oman. The number of species currently 

placed in the genus Hiplyra is now raised to 7, 

of which 4 occur in the Persian Gulf and Gulf of 

Oman. 

Drawings were made using a camera lucida 

attached to a Leica MZ8 stereomicroscope (Leica, 

Germany). The following abbreviations were used: 

CL, carapace length; CB, carapace breadth; ML, 

length of merus of male cheliped; G1, 1st male 

gonopod; juv., juvenile; ovig., ovigerous; SMF, 

Senckenberg Museum, Frankfurt am Main; ZMK, 

Zoological Museum of Copenhagen. 

SYSTEMATIC ACCOUNT 

Hiplyra elegans (Gravier, 1920) 

(Figs. 1, 2) 

Philyra platychira Laurie 1906: 363. 

Philyra variegata var. elegans Gravier, 1920: 379, figs. 1-7. 

Philyra variegata Stephensen 1946: 89-93 (not Hiplyra 

variegata (Rüppell, 1830) (part of the material from st. 73, 

Jask, Iran)). 

Philyra elegans Galil 2009: 292-293, 315 (in key), fig. 7. 

Type locality: Madagascar. 

Material examined: Gulf of Oman, 5 

(ZMK CRU929, CL = 9.90 mm, CB = 9.33 mm), 

tidal zone, St. 73, Jask, Gulf of Oman, 20 Apr. 

1937, G. Thorson. 

Additional material: 7 , 1 (SMF 11119), 

Madagascar, Stumpf and Ebenau; 1 , 1 (SMF 

11118), Madagascar. 

Diagnosis: Carapace about as long as wide; 

anterior margin of efferent channel straight, 

separated from lateral granulated margin by deep 

U-shaped incision; somite 6 of male abdomen 

smooth, with no process, male telson elevated 

on lateral portion; G1 widened distally, with very 

small apical process subdistally, directed laterally; 

1st somite of female abdomen not lobate; female 

gonopore with membranous oval process directed 

anteroposteriorly. 

Redescription: Carapace (Fig. 2A) about as 

long as wide, very slightly longer (CL/CB = 1.05), 

distinctly convex; dorsal surface finely punctate 

medially, laterally, and posteriorly; carapace regions 

weakly defined, grooves delimiting cardiac 

and intestinal regions distinct; branchiocardiac 

grooves shallow; frontal region nearly smooth, 

slightly depressed immediately behind frontal 

ridge. Front nearly as wide as posterior margin of 

carapace, produced, slightly extended medially; 

shallow furrow extending posteriorly in frontal 

region. Upper orbital margin finely granular, deep 

fissure occurring laterally, short setae along inner 

margin of upper orbital margin. Epibranchial 

margin moderately swollen, with small granules; 

anterolateral margin with large granules, becoming 

smaller posteriorly; posterolateral margin regularly 

granular, granules continuing to posterior margin, 

small granules below posterior margin. Anterior 

margin of efferent channel straight, separated 

from lateral granulated margin by deep U-shaped 

incision. Subhepatic and pterygostomial regions 

minutely granular. 

Ischium of 3rd maxilliped distinctly longer than 

merus, about 1.5-times merus length, outer surface 

faintly granular; merus elongated-triangular, outer 

surface weakly granular, large granules on distal 

margin; exopod large, wider distally, outer surface 

smooth, margins minutely serrate. Thoracic 

sternal plates granular, granules larger anteriorly; 

anterior margin of abdominal sulcus regularly with 

large granules. 

Male chelipeds (Figs. 1A, 2A) long; merus 

long, very slightly shorter than carapace breadth 

(mean ML/CB = 0.95); upper surface proximally 

granular, anterior margin with large granules, 

becoming larger medially; anterior surface with 

small granules; posterior margin with small 

granules, becoming larger proximally. Anterior 

lower and upper margins of carpus minutely 

granular. Manus long, with smooth upper surface, 

row of small granules on lower portion of inner 

surface extending from proximal part almost to 

base of fingers; lower margin granular, upper 

margin faintly serrate. Movable finger distinctly 

shorter than manus, about 2/3 of manus length,


arched, cutting edge blade-shaped; immovable 

finger shorter than movable finger, curved gently 

downward; cutting edge with small teeth along 

edge, 2 distal ones large-triangular; short dense 

setae along cutting edge of immovable finger, 

shorter distally; short setae along round process of 

distal margin of manus on articulation to movable 

finger. 

Male abdomen (Fig. 1B) elongated-triangular; 

segments 2-5 completely fused, proximal margin 

of fused somites 2-5 with large granules, medial 

depression proximally, lateral margins with small 

granules; somite 6 firmly merged with fused 

segments 2-5, not freely movable; lateral margin 

sharply diverging proximally, gently converging 

distally along most of its length, outer surface 

smooth, with no process; telson elongatedtriangular, 

distinctly shorter than somite 6, with 

2 elevations basally on lateral portion, margins 

smooth. 

G1 (Fig. 1C, D) curved laterally in proximal 

1/3 (Fig. 1D); apical portion wide; small apical 

process subdistal, directed laterally; long setae 

around apical process; sperm channel curving on 

(A) 

(B) 

1 mm 

(C) 

(D) 

(E) 

1 mm 

1 mm 

1 mm 

Fig. 1. Hiplyra elegans (Gravier, 1920). Male holotype (ZMK CRU929) (A-D); female paratype (SMF 11119) (E). (A) cheliped of male 

(left), upper surface; (B) male abdomen; (C) G1 (right) dorsal surface; (D) G1 (right), ventral surface; (E) female gonopore (right).


dorsal surface. 

Female gonopore (Fig. 1E) on inner anterior 

edge of sternite 5, nearly round; large membranous 

oval process directed anteroposteriorly. First 

somite of female abdomen not distinctly trilobate, 

with granular distal margin. 

Remarks: Stephensen (1946) listed substantial 

material from the Persian Gulf and Gulf of 

Oman under the name Philyra variegata (Rüppell, 

1830). We had the opportunity to reexamine most 

of Stephensen’s (1946) material, compared it with 

Rüppell’s type material of H. variegata from the 

Red Sea, and found that some specimens were 

not H. variegata but H. elegans instead. Hiplyra 

elegans is distinguished from H. variegata by the 

carapace shape, morphology of the G1, the form 

of the male abdomen, and the gonopore structure 

of females. The carapace of H. elegans is slightly 

longer than wide (mean CL/CB = 1.05), while the 

carapace of H. variegata is as long as wide, and 

even in large specimens is only slightly wider than 

long. The apical process of G1 in H. elegans is 

very small, subdistal, and directed laterally (Fig. 

1D), while in H. variegata, the small apical process 

is completely distal and directed ventrally (Fig. 7A). 

(A) 

(B) 

Fig. 2. Hiplyra elegans (Gravier, 1920). Male holotype, CL = 

9.90 mm, CB = 9.33 mm (ZMK CRU929). (A) dorsal surface; (B) 

ventral surface. 

For the male abdomen, the telson in H. elegans 

has 2 distinct elevations proximally on the lateral 

portions (Fig. 1D), while that of H. variegata is 

smooth, with no elevation (Fig. 7C). In addition, 

these 2 species have distinct morphologies of 

the female gonopore allowing females of these 

congeners to readily be distinguished. While H. 

elegans has a distinct oval membranous process 

which is directed anteroposteriorly (Fig. 1E), the 

female gonopore of H. variegata has a large 

opening (Fig. 7D) on the inner side of a prominent 

elevation. As Galil (2009) discussed, the 1st 

somite of the female abdomen of H. variegata 

is distinctly trilobate, while this somite is simple 

in females of H. elegans. It must be noted that 

drawings provided by Stephensen (1946: 88, fig. 

15F-K) clearly depict H. variegata, in particular, 

the male abdomen which shows a smooth telson 

lacking any elevation. 

Distribution: Madagascar, Gulf of Oman, Sri 

Lanka. 

Hiplyra ramli sp. nov. 

(Figs. 3, 4) 

Type locality: Al Aqah, Fujairah, east coast of 

UAE, Gulf of Oman. 

Material examined: Holotype 1 (SMF 

38466, CL = 7.4. mm, CB = 6.8 mm), Al Aqah, near 

Sandy Beach Hotel, Fujairah, UAE, Gulf of Oman, 

25°30'N, 56°22'E, sandy substrate, under stones 

and corals, 3-4 m depth, 4 July 1995, M. Apel. 

Paratypes: 6 , 9 (4 ovig.) (SMF 

38467), same data as for holotype. 

Diagnosis: Carapace slightly longer than wide; 

anterior margin of efferent channel nearly straight, 


U-shaped incision; somite 6 of male abdomen with 

triangular arrow-shaped process on distal portion; 

telson wide-triangular, swollen on basal portion; G1 

distally widened, with small apical process directed 

dorsally; female gonopore obliquely directed 

anterodorsally, small membranous oval process on 

outer margin of opening. 

Description: Carapace (Fig. 4A) slightly 

longer than wide (CL/CB = 1.1), distinctly convex; 

dorsal surface finely punctate medially, laterally, 

and posteriorly; carapace regions weakly defined, 

distinct grooves delimiting cardiac and intestinal 

regions; branchiocardiac grooves shallow; 

frontal region nearly smooth, slightly depressed 

immediately behind frontal ridge. Front slightly 

shorter than posterior margin of carapace, 

produced, slightly extended medially; shallow


furrow extending to rear in frontal region. Upper 

orbital margin finely granular, deep fissure present 

laterally. 

Epibranchial margin with small granules; 

anterolateral margin with large granules anteriorly, 

becoming smaller posteriorly; posterolateral margin 

finely granular, granules continuing to posterior 

margin, small granules below posterior margin. 

Anterior margin of efferent channel nearly straight, 


U-shaped incision. Subhepatic and pterygostomial 

regions minutely granular. 

Ischium of 3rd maxilliped slightly longer than 

merus, outer surface nearly smooth, distal margin 

minutely granular; merus long-triangular, outer 

surface finely granular, granules larger distally 

on outer surface; exopod large, wider distally, 

outer surface smooth, margins minutely serrate. 

Abdominal sternums granular, granules larger 

anteriorly; anterior margin of abdominal sulcus 

granular. 

Male chelipeds (Figs. 3A, 4A) with moderately 

(A) 

1 mm 

(B) 

(C) 

(D) 

(E) 

1 mm 

1 mm 

Fig. 3. Hiplyra ramli sp. nov. Male holotype (SMF 38466) (A-D); female paratype (SMF 38466) (E). (A) cheliped of male (left), upper 

surface; (B) male abdomen; (C) G1 (right) dorsal surface; (D) G1 (right), ventral surface; (E) female gonopore (right).


long merus, distinctly shorter than carapace 

breadth (mean ML/CB = 0.72); upper surface 

granular proximally; anterior margin with large 

granules, granules becoming larger medially; 

posterior margin with small granules, proximally 

moderately larger. Anterior lower and upper 

margins of carpus minutely granular. Upper 

surface of manus smooth, faint row of very small 

granules on lower portion, extending parallel 

to lower margin in proximal 1/2; lower margin 

granular; upper margin faintly serrate. Movable 

finger slightly shorter than manus, arched 

medially, cutting edge blade-shaped; immovable 

finger shorter than movable finger, curved gently 

downward; cutting edge with small triangular teeth 

distally, 2 or 3 distal ones larger; short dense setae 

along cutting edge of immovable finger, shorter 

distally; short setae along round process of distal 

margin of manus on articulation to movable finger. 

Male abdomen (Figs. 3B, 4B) long-triangular, 

scarcely granular; somites 2-5 completely fused, 

fused somites proximally with large granules, 

medially with depression, lateral margins 

(A) 

(B) 

Fig. 4. Hiplyra ramli sp. nov. male holotype, CL = 7.4. CB = 6.8 

(SMF 38466). (A) dorsal surface; (B) ventral surface. 

proximally with small granules; somite 6 firmly 

merged to fused somites 2-5, not freely movable; 

lateral margin sharply diverging proximally, gently 

converging distally along most of its length, 

prominent elevated arrow-shaped process distally 

on outer surface; telson elongate-triangular, slightly 

shorter than somite 6, with 2 processes at basis of 

lateral portion, margins smooth. 

G1 (Fig. 3C, D) slightly curved laterally, 

narrowing medially; apical portion expanded, with 

long setae on lateral margin, relatively short setae 

on mesial margin; small apical process directed 

dorsally; sperm channel curved on dorsal surface. 

Female gonopore (Fig. 3E) on inner anterior 

edge of sternite 5, obliquely directed anterodorsally; 

small membranous oval process on outer 

margin of opening. 

Remarks: Hiplyra ramli sp. nov. is a relatively 

small-sized species, which is morphologically 

closest to H. sagitta and H. elegans. With regard 

to the lengths of the carapace and male chelipeds, 

the new species; however, is clearly distinct from 

H. elegans and more closely allied to H. sagitta. 

Hiplyra elegans has a slightly wider carapace 

(CL/CB = 1.05), while this ratio in the 2 other 

species is 1.1. The relatively long adult chelipeds 

of H. elegans with a long merus (ML/CB = 0.95) 

distinguishes H. elegans from H. ramli sp. nov., 

which has only moderately long chelipeds 

(ML/CB = 0.72). There are 3 further distinct 

differences between the new species and all other 

congeners. The male abdomen of H. ramli sp. nov. 

has a wide triangular process on the distal portion 

of segment 6 (Fig. 3B), while this process in H. 

sagitta is distinctly elongate and arrow-shaped, 

with a distinct groove (Fig. 5C), and the male 

abdominal somite 6 of H. elegans is completely 

smooth, with no process (Fig. 1B). Hiplyra ramli 

sp. nov. has a telson with 2 proximal elevations 

which are very similar to those of H. elegans 

and clearly distinct from the narrow and smooth 

telson of H. sagitta. G1 of the new species is 

characterized by having a small distally broadened 

apical process which is directed dorsally, while in 

the 2 other species, the apical process is directed 

laterally (Fig. 3C, D). 

Furthermore, the distinctive form of the 

female gonopore easily distinguishes this species 

from its congeners (see “Remarks” for H. elegans). 

It should be noted that the available 

specimens of the new species revealed that the 

chelipeds of males are slightly longer than those of 

females, with the ratio of ML/CB in males ranging 

0.64-0.77 (n = 10), while this ratio was 0.56-0.64


(n = 13) in females. 

Distribution: Presently only known from the 

Gulf of Oman coast of the UAE (Fujairah). 

Etymology: The species is named after the 

Arabic word “raml” for sand, since it was collected 

in sandy substrate. The name is used as a noun 

in apposition. 

Hiplyra sagitta Galil, 2009 

(Figs. 5, 6) 

Philyra platychira Alcock 1896: 242. 

Philyra platycheir Tirmizi and Kazmi 1986: 100, fig. 29. 

Philyra variegata Stephensen 1946: 89-93 (not Hiplyra 

variegata (Rüppell 1830) (part of the material from st. 27, 

near Bushehr, Persian Gulf)). 

Hiplyra sagitta Galil 2009: 296-297, 315 (in key), figs. 11, 12A. 

Type locality: Near Bushehr, Persian Gulf, 

Iran. 

Material examined: Persian Gulf: 2 

(CL = 9.68, 16.04 mm, CB = 9.45, 14.56 mm) 

(ZMK CRU880), St. 32, 7.5 m, N of Kharg I., G. 

Thorson, 23 Mar. 1937; 1 (CL = 16.67 mm, 

CB = 15.12 mm), 3 (CL = 15.42-19.07 mm, 

CB = 14.09-17.66 mm) (SMF 38392), 22 m, 

Kuwait, 28°53'N, 48°24'E, trawl, 24 Apr. 1995, F. 

Krupp; 2 (CL = 15.55, 17.00 mm, CB = 14.23, 

16.13 mm) (SMF 38393), 13-17 m, Kuwait, 

29°10'N, 48°28'E, trawl, 23 Apr. 1995, F. Krupp. 

Diagnosis: Carapace (Fig. 6A) slightly 

longer than wide (CL/CB = 1.1); dorsal surface 

finely punctate medially, laterally, and posteriorly. 

Anterior margin of efferent channel straight, 

(A) 

(B) 

(C) 

(D) 

1 mm 

1 mm 

Fig. 5. Hiplyra sagitta Galil, 2009. Male (ZMK CRU880) (A-C); female (SMF 38393) (D). (A) G1 (right) dorsal surface; (B) G1 (right), 

ventral surface; (C) male abdomen; (D) female gonopore (right).


separated from lateral granulated margin by 

somewhat wide U-shaped incision. Ischium of 

3rd maxilliped slightly longer than merus, about 

1.2-times merus length. Male abdomen (Figs. 

5C, 6B) elongate-triangular; segment 6 with long 

arrow-shaped process, telson narrow and smooth. 

Male chelipeds (Fig. 6) moderately long; movable 

finger about as long as manus, or slightly shorter. 

Immovable finger with small denticles along cutting 

edge, 2 large triangular teeth subdistally, cutting 

edge with dense short setae. G1 (Fig. 5A, B) 

long, narrow, with moderately large apical process, 

directed laterally. Female gonopore (Fig. 5D) 

small, on inner side of large elevation. 

Remarks: Hiplyra sagitta was recently 

described from Bushehr in the Persian Gulf by 

Galil (2009). She mentioned that H. sagitta differs 

from its congeners by having a triangular incision 

which separates the anterior margin of the efferent 

channel from the lateral granulated margin (Galil 

2009: 297), while this incision is narrow and 

U-shaped in the 3 other species she examined. 

Another distinct character mentioned by Galil 

(2009) is the particular arrow-shaped process on 

the distal part of male abdominal somite 6 which 

(A) 

(B) 

Fig. 6. Hiplyra sagitta Galil, 2009, male, CL = 16.79, CB 

= 15.13 mm (SMF 38392). (A) dorsal surface; (B) ventral 

surface. 

is absent in all other known congeners except 

for the newly described H. ramli sp. nov. In the 

latter, the process; however, is distinct from that 

of H. sagitta in its short and triangular form (Fig. 

3B). Apart from the 2 discriminative characters 

presented by Galil (2009), we add the feature of 

the distinctive apical part of G1 and the structure 

of the female gonopore, which separate H. sagitta 

from other congeners treated here (discussed 

under “Remarks” of the new species, H. ramli sp. 

nov.). 

The holotype and paratypes described by 

Galil (2009) are from Stephensen’s (1946) material 

examined under H. variegata from Bushehr in the 

Persian Gulf. 

Hiplyra sagitta is one of the largest species in 

the genus with the largest male found at Kharg I. in 

the Persian Gulf (CL = 16.04 mm, CB = 14.56 mm) 

and the largest female recorded from Kuwait in the 

Persian Gulf (CL = 19.07 mm, CB = 17.66 mm). 

Distribution: Persian Gulf, India, Andaman 

Sea. 

Hiplyra variegata (Rüppell, 1830) 

(Figs. 7, 8) 

Myra variegata Rüppell 1830: 17, pl. 4-4. 

Philyra platycheira Paulson 1875: 83, pl. 10, fig. 3. Alcock 

1896: 242 (specimens from the Persian Gulf). 

Philyra variegata Nobili 1906: 169. Laurie 1915: 410. Balss 

1915: 14. Stephensen 1946: 89, figs. 15f-k, 16. Serène 

1968: 46. Guinot 1967: 249 (in list). Titgen 1982: 248 (in 

list). 

Philyra platychira Balss 1915: 14. 

Hiplyra variegata Galil 2009: 287-299, 315 (in key), fig. 13. 

Tape locality: Red Sea, Egypt. 

Material examined: Lectotype 1 (CL = 

7.66 mm, CB = 7.73 mm) (SMF 11121), among 

corals, Sinai Peninsula, Egypt, id. E. Rüppell, 

1827. Paralectotype: 9 , 4 (SMF 11121), 

data same as for lectotype. Persian Gulf: 2 

(CL = 6.05, 10.10 mm, CB = 5.68, 9.24 mm) (ZMK 

CRU886), 56 m, sandy clay, 13 nautical miles W 

of outermost light-buoy at Bushehr, Bushehr, G. 

Thorson, 13 Mar. 1937; 27 , 11 (SMF 

38462), sandy, 6 m depth, S of Rams, UAE, 

25°50'N, 55°00'E, 11 July 1995, M. Apel; 1 , 

2 (ovig.) (SMF 38463), sandy, 0-6 m depth, N 

coast of As Sham, Ras al Khaymah, UAE, 26°02'N, 

55°05'E, 10 July 1995, M. Apel. Red Sea: 1 

(ovig.) (SMF 38464), mangroves, Umm al Gamar I., 

Egypt, 27°22'N, 33°55'E, 13 Sept. 1994. 

Diagnosis: Carapace (Fig. 8A) as long as 

wide, slightly wider than long; dorsal surface


finely granular laterally and posteriorly. Anterior 

margin of efferent channel straight, separated from 

lateral granulated margin by narrow U-shaped 

incision. Ischium of 3rd maxilliped distinctly longer 

than merus, about 1.5-times merus length. Male 

abdomen (Figs. 7C, 8B) elongate-triangular; 

segment 6 and telson completely smooth, with 

no process or elevation. Male cheliped (Fig. 8A) 

moderately long; movable finger about 1.5-times 

manus length. Immovable finger with small 

denticles along cutting edge, 2 large triangular 

teeth subdistally, cutting edge densely covered with 

short setae. G1 (Fig. 7A, B) long, narrow; small 

apical process distally, directed ventrally. Female 

gonopore (Fig. 7D) on oval transverse elevation, 

with large opening directed anteroposteriorly. 

Remarks: This small-size species was briefly 

described and illustrated by Rüppell (1830) from 

the Red Sea. Galil (2009) redescribed the species 

by examining the type material and mentioned 

that the original description and illustration of the 

species were not correct, as Rüppell (1830) did not 

mention the minutely dentate row beyond the setae 

along the cutting edge of the immovable finger. 

This character; however, was mentioned by Alcock 

(1896: 243), who examined material from the 

(A) 

(B) 

(C) 

(D) 

1 mm 

1 mm 

Fig. 7. Hiplyra variegata (Rüppell, 1830). Male paratype (SMF 11121) (A-C); paratype (SMF 11121) (D). (A) G1 (right), ventral 

surface; (B) G1 (right), dorsal surface; (C) male abdomen; (D) female gonopore (right).


Persian Gulf and by Nobili (1906) who studied the 

type material of H. variegata (Rüppell 1830). Such 

an indentation was seen in the material examined 

in the present paper. Galil (2009) recorded 2 other 

characters as discriminative for distinguishing the 

species from its congeners, including a marbled 

color pattern of the carapace and 2 triangular 

teeth distally on the cutting edge of the immovable 

finger. 

We found 3 additional morphological characters 

which we believe are even more significant 

and readily distinguish it from all other congeners 

treated here. Hiplyra variegata has a unique 

G1 structure and female gonopore, and its male 

abdomen is completely smooth with no elevation 

or process on the 6th male abdominal somite 

or telson (Fig. 7A-D). Detailed discussions on 

the differences between H. variegata and its 

congeners are presented under “Remarks” of the 

former species. 

Distribution: Kenya, Red Sea, Gulf of Aden, 

Persian Gulf, Gulf of Oman. 

(A) 

DISCUSSION 

The genus Hiplyra Galil, 2009, was recently 

separated from Philyra Leach, 1817, using the 

following characters: apical process of G1 minute, 

the presence of a thick fringe of setae on the inner 

margin of the movable finger, and the cheliped 

merus being longer than the carapace in males 

(Galil 2009: 314). The 1st 2 characters clearly 

distinguish Hiplyra from Philyra. The 3rd character 

is rather confusing as in all known species of 

Hiplyra, even the type species, H. platycheir (De 

Haan, 1841), the merus is actually clearly shorter 

than the carapace. 

Hiplyra currently includes 7 species, which are 

primarily distinguished from each other using the 

morphology of the carapace and male abdomen 

(Galil 2009). Apart from these 2 characters, 2 

more-important discriminative characters including 

G1 and the female gonopore were found to be 

useful here to separate closely related species. 

The morphology of the female gonopore allows 

females of the different Persian Gulf species to be 

distinguished and will probably work for other taxa 

as well. The 4 species discussed in the present 

study are morphologically close and all are found 

in sandy substrates of the shallow subtidal zone. 

Hiplyra variegata and H. elegans have patchy 

distributions in the western Indian Ocean which 

could be largely due to the lack of extensive 

sampling, particularly in the subtidal zone. We 

believe that the recently described species, H. 

sagitta Galil, 2009, and H. ramli sp. nov. will be 

found further westwards when further surveys are 

done in those regions. 

Key to the genus Hiplyra known from the 

Persian Gulf and Gulf of Oman 

(B) 

Fig. 8. Hiplyra variegata (Rüppell, 1830), male lectotype, 

CL = 7.66, CB = 7.73 mm (SMF 11121). (A) dorsal surface; (B) 

ventral surface. 

1. Somite 6 of male abdomen with elevated arrow-shaped 

process ............................................................................. 2 

Somite 6 of male abdomen smooth, without a process .... 3 

2. Somite 6 of male abdomen with long arrow-shaped 

process, creating distinct groove; telson narrow, smooth, 

with no elevation; G1 distally narrow, with relatively large 

apical process directed laterally .................. Hiplyra sagitta 

3. Somite 6 of male abdomen with triangular arrow-shaped 

process on distal portion; telson wide-triangular, swollen 

on basal portion; G1 distally widened, with small apical 

process directed dorsally ................... Hiplyra ramli sp. nov. 

4. Male telson elevated on lateral portion; G1 widened distally, 

with very small apical process subdistally, directed laterally; 

1st somite of female abdomen not lobate ............................ 

.................................................................... Hiplyra elegans 

- Male telson completely smooth; G1 narrowing distally, 

apical process located distally, directed ventrally; 1st somite 

of female abdomen trilobate .................... Hiplyra variegata


Acknowledgments: We are grateful to J. Olesen 

(ZMK) for kindly providing us with the valuable 

brachyuran material collected from the “Danish 

Scientific Expedition in Iran” conducted in 1937/38. 

We are indebted to Prof. M. Türkay (SMF) for 

his support as supervisor of both authors, and 

to Deutscher Akademischer Austausch Dienst 

(DAAD) for financial support in the form of a PhD 

scholarship to R. Naderloo. Furthermore, we are 

grateful to J.A. Khan and the team of the Arabian 

Seas Expedition who gave great support to one of 

the authors (M. Apel) during a survey of the UAE 

coastline in 1995. 

REFERENCES 

Alcock A. 1896. Materials for carcinological fauna of India. N. 

2: The Brachyura Oxystomata. J. Assoc. Soc. Beng. 65: 

134-296. 

Apel M. 2001. Taxonomie und Zoogeographie der Brachyura, 

Paguridea und Porcellanidae (Crustacea: Decapoda) des 

Persisch-Arabischen Golfes: 1-268. PhD dissertation, 

Johann Wolfgang Goethe-Univ., Frankfurt am Main, 

Germany. 

Balss H. 1915. Anomuren, Dromiaceen und Oxystomen. 

XXXI. Die Decapoden des Roten Meeres. Expeditionen 

S.M. Schiff “Pola” in das Rote Meer nordliche und sudliche 

halfte 1895/96-1897/98. Berichte der Kommission für 

ozeanographische Forschungen, 18 pp. 

Galil B. 2009. An examination of the genus Philyra Leach, 

1817 (Crustacea, Decapoda, Leucosiidae) with description 

of seven new genera and six new species. Zoosystema 

31: 279-320. 

Gravier C. 1920. Sur une collection de crustacés recueillis à 

Madagascar par M. le Lieutenant Decary. Bull. Mus. Hist. 

Nat. Paris 26: 376-383. 

Guinot D. 1967. La faune carcinologique (Crustacea, 

Brachyura) de l’Ocean Indien occidental et de la Mer 

Rouge. Catalogue remarques biogéographiques et 

bibliographie. Mém. Inst. Fond. Afr. 77: 235-352. 

Laurie RD. 1915. 1906. Report on the Brachyura collected 

by Professor Herdman at Ceylon, in 1902. In WA 

Henderman ed. Report to the Government of Ceylon on 

the Pearl Oyster Fisheries of the Gulf of Manaar. Part v. 

Supplementary Report 40: 349-432, pls. 1, 2. 

Laurie RD. 1915. Reports on the marine biology of the 

Sudanese Red Sea. XXI. On the Brachyura. J. Linn. 

Soc. Lond. 31: 407-475, figs. 1-5, pls. 42-45. 

Naderloo R, A Sari. 2005. Iranian subtidal leucosiid crabs 

(Crustacea: Decapoda: Brachyura) of the Persian Gulf: 

taxonomy and zoogeography. Iran. J. Anim. Biosys. 1: 

31-46. 

Nobili G. 1906. Faune carcinologique de la Mer Rouge 

décapodes et stomatopodes. Ann. Sci. Nat. (Zool.) 4: 

1-347, figs. 1-12, pls. 1-11. 

Paulson OM. 1875. Izsledovaniya rakoobraznykh Krasnago 

Morya s zametkami otnositel’no rakoobraznykh drugikh 

morei. Chast‘ I. Podophthalmata i Edriophthalmata 

(Cumacea). Kiew, Kul’zhenko 1875: I-XIV + 1-144, pls. 

1-21. 

Rüppell E. 1830. Beschreibung und Abbildung von 24 

Arten kurzschwanzigen Krabben, als Beitrag zur 

Naturgeschichte des rothen Meers. Frankfurt, Germany: 

H.L. Brönner, 28 pp. 

Serène R. 1968. Prodromus for a check list of the nonplanctonic 

marine fauna of South East Asia. Sing. Nat. 

Acad. Sci. Spec. Pub. 1: 1-122. 

Stephensen K. 1946. The Brachyura of the Iranian 

Gulf. Danish scientific investigations in Iran, part IV. 

Copenhagen: E. Munksgaard, pp. 57-237. 

Tan CGS, PKL Ng. 1995. A revision of the Indo-Pacific genus 

Oreophorus Rüppel, 1830 (Crustacea: Decapoda: 

Brachyura: Leucosiidae). In B Richer De Forges, ed. 

Les fonds meubles des lagons de Nouvelle-Calédonie 

(Sédimentologie, benthos). Etudes & Thèses, Vol. 2. 

Paris: Orstom, pp. 101-189. 

Tirmizi NM, QB Kazmi. 1986. Marine fauna of Pakistan. 4. 

Crustacea: Brachyura (Dromiacea, Archaebrachyura, 

Oxystomata, Oxyrhyncha). Publication I, BCCI Foundation 

Chair, Institute of Marine Sciences, Univ. of 

Karachi, Pakistan, pp. 1-244. 

Titgen RH. 1982. The systematics and ecology of the 

decapods of Dubai, and their zoogeographic relationships 

to the Persian Gulf and the western Indian Ocean. PhD 

dissertation, Texas A&M Univ., Texas, USA.


A Predictive Model to Differentiate the Fruit Bats Cynopterus brachyotis 

and C. cf. brachyotis Forest (Chiroptera: Pteropodidae) from Malaysia 

Using Multivariate Analysis 

Vijaya K. Jayaraj 1, *, Charlie J. Laman 2 , and Mohd T. Abdullah 2 

1 

Faculty of Agro Industry and Natural Resources, Universiti Malaysia Kelantan, Locked bag 36, Pengkalan Chepa, Kelantan 16100, 

Malaysia 

2 

Department of Zoology, Faculty of Resource Science and Technology, Universiti Malaysia Sarawak, Kota Samarahan 94300, Sarawak, 

Malaysia 


Vijaya K. Jayaraj, Charlie J. Laman, and Mohd T. Abdullah (2012) A predictive model to differentiate the 

fruit bats Cynopterus brachyotis and C. cf. brachyotis Forest (Chiroptera: Pteropodidae) from Malaysia using 

multivariate analysis. Zoological Studies 51(2): 259-271. Field discrimination of Cynopterus brachyotis and C. 

cf. brachyotis Forest (as designated by Francis 2008) in southern Thailand, Peninsular Malaysia, and Borneo is 

problematic. These 2 forms are sympatric in this region but are confined to different habitat types: C. brachyotis 

inhabits open habitats, orchards, and agricultural areas, while C. cf. brachyotis Forest is confined to primary and 

old secondary forests. In this study, we attempted to develop prediction models to identify both C. brachyotis 

and C. cf. brachyotis Forest in this region based on multivariate statistics. Two predictive models were 

generated using a canonical discriminant function, and it was found that 5 characters can be used to accurately 

identify museum vouchers of C. brachyotis and C. cf. brachyotis Forest. Four characters are needed for field 

identification of these 2 forms of Cynopterus in southern Thailand, Peninsular Malaysia, and Borneo. A review 

of the current taxonomy and classification indicated that there is a need to describe the 6 existing forms of the C. 

brachyotis complex in the Indo-Malayan region. This will aid conservationists, field ecologists, and taxonomists 

in taxonomic- and conservation-related decisions about this species complex. 


Key words: Cynopterus brachyotis, Discriminant function analysis, Habitat type. 

The genus Cynopterus F. Cuvier 1824, 

commonly known as dog-faced fruit bats or shortnosed 

fruit bats are widely distributed in the Indo- 

Malayan region (Corbet and Hill 1992). The 

taxonomic status of this genus has undergone 

many revisions, and the most recent classification 

by Simmons (2005) lists 7 species in this genus: 

C. brachyotis (Müller, 1838); C. horsfieldii Gray, 

1843; C. luzoniensis Peters, (1861); C. minutus 

Miller, 1906; C. nusatenggara Kitchener and 

Maharadatunkamsi, 1991; C. sphinx (Vahl, 

1797); and C. tithaecheilus (Temminck, 1825). 

Discriminating between species in this genus is 

often problematic given the many variations and 

overlap between species representatives across 

a geographical gradient. Work such as that by 

Bumrungsri and Racey (2005) is often done to 

discriminate similar sympatric species in this 

genus. 

The nominate C. brachyotis type specimen 

was described by Müller (1838), but currently the 

status of C. brachyotis is uncertain, as recent 

studies indicated that it may actually be a complex 

of species (Campbell et al. 2004). Corbet and Hill 


E-mail:jayaraj_vijayakumaran@yahoo.com 

259

260 

Jayaraj et al. – A Model to Differentiate Cynopterus brachyotis Forms 

(1992) listed 19 synonyms of C. brachyotis, but 

Simmons (2005) recognized only seven of them, 

with most of them lacking data on their status and 

current distribution. Abdullah (2003) compared 

morphological measurements of Cynopterus 

from various sources (Andersen 1912, Hill and 

Thonglongya 1972, Lekagul and McNeely 1977, 

Medway 1978, Hill 1983, Payne et al. 1985, 

Kitchener and Maharadatunkamsi 1991 1996, 

Ingle and Heaney 1992, Nor 1996) and found 

that a lot of morphological measurements overlap 

within and between species across its distribution. 

This species is widely distributed throughout 

Southeast Asia (Fig. 1) and can be found at areas 

up to 1600 m in elevation in Borneo (Lekagul and 

McNeely 1977, Medway 1978, Bergmans and 

Rozendall 1988, Corbet and Hill 1992, Peterson 

and Heaney 1993, Abdullah 2003). It can be found 

in many habitats (but most frequently in disturbed 

forest) including lower montane forest, dipterocarp 

forest, gardens, mangroves, and strand vegetation. 

Francis (1990) found that there were forearm 

length differences in C. brachyotis caught in 

primary forests and that from secondary habitats 

in Sepilok, Sabah. This observation was later 

investigated by Abdullah et al. (2000) and Abdullah 

(2003) using molecular and external morphometric 

c 

b 

d 

Fig. 1. Distribution of 8 subspecies of C. brachyotis in the 

Indo-Malayan region (Mickelburgh et al. 1992, Simmons 

2005). (a) C. b. altitudinis found in highlands of the Main 

Range, Peninsular Malaysia; (b) C. b. brachysoma found in 

the Andaman Is.; (c) C. b. ceylonensis found in Sri Lanka; (d) 

C. b. concolor found on Enganno I.; (e) C. b. hoffeti found in 

Vietnam; (f) C. b. insularum found in the Kangean Is. and Laut 

Kecil Is.; (g) C. b. javanicus found in Bali, Java, Madura, and 

Penidah; and (h) C. b. brachyotis found in Bangka, Belitung, 

Borneo, Lombok, the Nicobar Is., Peninsular Malaysia, the 

Philippines, Singapore, Sulawesi, Sumatra and Thailand. 

a 

f 

e 

g 

h 

data on samples from Borneo and Peninsular 

Malaysia to the southern tip of Thailand. Results of 

those studies showed that 2 forms of C. brachyotis 

inhabited 2 contrasting habitats (in Peninsular 

Malaysia and Borneo). The larger form was found 

to inhabit open areas, whereas the smaller form 

was confined to primary forests. Abdullah et al. 

(2000) postulated that these differences found in 

C. brachyotis are based on ecological differences 

in the habitats they occupy. Later Campbell 

et al. (2004) reexamined the species complex 

using different genetic markers and discovered 

4 additional distinct lineages in the C. brachyotis 

complex scattered in the Indo-Malayan region. 

These 4 lineages are respectively found in India, 

Myanmar, Sulawesi, and the Philippines. Abdullah 

and Jayaraj (2006) later performed a cluster 

analysis on the type specimen of C. brachyotis 

using morphological measurements described 

by Müller (1938), and the results showed that the 

nominate C. brachyotis was clustered with the 

larger form of C. brachyotis. 

A recent study using microsatellites and 2 

mitochondrial (mt)DNA genes by Fong (2011) 

showed congruent findings with Abdullah et al. 

(2000), Abdullah (2003), Campbell et al. (2004 

2006), and Julaihi (2005) of the existence of 

2 C. brachyotis lineages in southern Thailand, 

Peninsular Malaysia, and Borneo. The morphometrics 

of this species also showed same 

findings but there were misclassifications of some 

samples (Jayaraj et al. 2004 2005). Campbell et 

al. (2007) also reviewed the morphological and 

ecomorphological aspects of this species using 

multivariate statistics and found that the wing 

loading and aspect ratio was not an informative 

character that can be used to differentiate the 2 

forms of C. brachyotis. Another study on flight 

parameters also showed similar results (Menon 

2007). 

Results from general descriptive statistics, 

mtDNA, microsatellites, and morphometric studies 

showed congruency of the existence of 2 divergent 

forms of C. brachyotis. As Abdullah and Jayaraj’s 

(2006) study showed that the larger form was 

indeed the assigned C. brachyotis, it is apparent 

that the small form may be a new species of 

Cynopterus yet to be described. However, a recent 

taxonomy of the Cynopterus by Simmons (2005) 

did not include this new form, and Francis (2008) 

assigned C. cf. brachyotis Sunda to the large form 

of C. brachyotis commonly found in open areas 

and C. cf. brachyotis Forest to the small form of C. 

brachyotis commonly found in primary forests. For


261 

the easy interpretation of this paper, we assign C. 

brachyotis as the known large form as verified by 

Abdullah and Jayaraj (2006), and C. cf. brachyotis 

Forest as the new undescribed form found in 

primary forests. 

In terms of forearm length differences, 

Francis (1990) showed that C. brachyotis has a 

mean forearm length of 62.1 mm (n = 22) and C. 

cf. brachyotis Forest has a mean forearm length 

of 58.4 mm (n = 21). Abdullah (2003) reported 

that the forearm length of C. cf. brachyotis Forest 

was 59.43 (± standard deviation (SD) 2.70) mm, 

and C. brachyotis had a mean forearm length of 

63.87 (± 5.02) mm. Campbell et al. (2006) used 

a forearm length of 63.8 (± 1.6) mm to identify C. 

brachyotis and a forearm length of 59.5 (± 1.7) mm 

to identify C. cf. brachyotis Forest. 

The high reliance on forearm length to 

distinguish these 2 forms is problematic as 

various authors have reported different forearm 

length measurements used for differentiation. 

The development of additional characters to 

differentiate these 2 forms would be useful in the 

field, as this will aid field ecologists in accurately 

identifying both C. brachyotis and C. cf. brachyotis 

Forest in southern Thailand, Peninsular Malaysia, 

and Borneo. Thus, in this study, we attempted to 

further describe detailed morphometric variations 

that exist in the genus Cynopterus from Peninsular 

Malaysia and Borneo using multivariate statistics. 

The approach was to develop a classification 

function that can be used to differentiate C. 

brachyotis and C. cf. brachyotis Forest in the field 

and verify museum specimens. 


In total, 74 specimens (10 individuals of 

C. horsfieldii, 34 individuals of C. brachyotis, 

29 individuals of C. cf. brachyotis Forest, and 1 

individual of Eonycteris major) were used in this 

study. These specimens were either collections 

from field sampling done in various localities within 

Borneo and Peninsular Malaysia or museum 

samples from the zoological museum at Universiti 

Malaysia Sarawak (Sarawak, Malaysia) and 

the Department of Wildlife and National Parks 

(PERHILITAN) Museum (Pahang, Malaysia). Due 

to a limited number of samples of Cynopterus, we 

opted to focus on the problem of differentiating 

C. brachyotis and C. cf. brachyotis Forest using 

multivariate statistics. Only specimens of C. 

brachyotis and C. cf. brachyotis Forest previously 

confirmed by Abdullah (2003) and Fong (2011) 

using DNA sequences of the partial Cytochrome 

b (700 bps) and Cytochrome Oxidase 1 (486 bps) 

were used in this study. 

Twenty-eight morphological measurements 

(skull, dental, and external morphological 

measurements; Fig. 2) were recorded following 

Kitchner et al. (1995) and Jayaraj et al. (2004 

2005). Abbreviations for the characters measured 

are as follow: BL, bulla length; C1BW, canine tooth 

basal width; C1C1B, breadth across both canine 

outside surfaces; C1M3L, canine molar length or 

maxillary tooth row length; CW, cranial width; DBC, 

distance between cochleae; DL, dentary length; 

D3MCL, 3rd digit metacarpal length; D4MCL, 

4th digit metacarpal length; D5MCL, 5th digit 

metacarpal length; D3P1L, 3rd digit 1st phalanx 

length; D3P2L, 3rd digit 2nd phalanx length; EL, 

ear length; GBPL, greatest basial pit length; GSL, 

great skull length; IOW, interorbital width; M3L, 

3rd molar tooth crown length; M3W, 3rd molar 

tooth crown width; M3M3B, breadth across outside 

surfaces of both 3rd molar teeth; MW, mastoid 

width; PES, pes length; PL, palatal length; POW, 

postorbital width; PPL, postpalatal length; RL, 

radius length; TL, tibia length; TVL, tail to ventral 

length; and ZW, zygomatic width. Bat skulls were 

extracted after morphological data were collected 

following Nargorsen and Peterson (1980). 

A cluster analysis using Euclidean distances 

with the unweighted pair-groups method 

average (UPGMA) was performed to construct 

a morphometrics-based phylogeny and confirm 

the initial grouping of samples (Everitt 1993). 

The E. major measurements were used as the 

outgroup for this analysis. Data of confirmed 

groupings were then subjected to a t-test to check 

for sexual dimorphism. Levene’s test for equality 

of variances was used as a selection criterion for 

the assumption of equal or unequal variances 

prior to the t-test (Zar 1984). The normality of 

the data was checked using a normal probability 

plot and the Shapiro-Wilk test. The assumption 

of homoscedasticity was tested using Box’s M 

test, and the assumption of multicolinearity was 

checked by observing the tolerance value for all 

independent variables (Joseph et al. 1992). Next, 

the data were subjected to a stepwise discriminant 

function analysis following Joseph et al. (1992) 

and Manly (1994). Two separate analyses 

were performed: 1) using a combination of all 

available characters and 2) using only external 

morphological characters. Data were analyzed 

using Minitab 2002 v13.2 (2006 Minitab, Pine Hall

262 


Rd State College, PA, USA) and SPSS vers. 13 

(SPSS, Chicago, IL, USA). 

RESULTS 

The UPGMA cluster analysis (Fig. 3) shows 

th groupings of Cynopterus spp. based on 

morphological measurements. Based on the 

phylogram, there are 3 major clades consisting 

of C. horsfieldii, C. cf. brachyotis Forest, and C. 

brachyotis. Of the 28 characters examined, 3 

characters (IOW for C. horsfieldii and D3MCL 

and D5MCL for C. brachyotis) were found to be 

sexually dimorphic (Table 1). The means and 

standard deviations (SDs) of all characters are 

shown in table 2. PES was log10-transformed 

to achieve normality, whereas PPL, PL, and TL 

were excluded from the analysis as these data did 

not follow a normal distribution either prior to or 

after transformation to achieve normality. Box’s 

M statistics had a value of 23.406 (probability of 

p = 0.483, p > 0.001) indicating homoscedasticity. 

Thus, the data were analyzed using a pooled 

covariance matrix for classification. Multicolinearity 

among the independent variables was not present, 

as tolerance values for all variables were > 0.10. 

For analysis of all remaining characters, the 

stepwise method identified 1 discriminant function 

(Function 1) that was statistically significant based 

C1C1B 

C1BW 

PL 

C1M3L 

M3W 

M3L 

IOW 

POW 

M3M3B 

GBPL 

CW 

GSL 

PPL 

BL 

MW 

DBC 

ZW 

DL 

D3P2L 

D3P1L 

D3MCL 

D4MCL 

RL 

EL 

D5MCL 

TL 

TVL 

PES 

Fig. 2. Skull, dental, and external measurements taken during this study. The abbreviations of body measurements please refer to 

“MATERIALS AND METHODS” section.


263 

Distance 

46.44 30.96 15.48 0.00 

1 Lalang Dam, Bario 

4 Salt Lake, Bario 

7 Samunsam W.S. 





6 P. Balak, Bangi 

8 Sungai Dusun, Selangor 


12 Batang Ai N.P. 

11 Mount Penrisen 





28 Kubah N.P. 






22 Kubah N.P. 



27 Kubah N.P. 


26 Kubah N.P. 

29 Kubah N.P. 

33 Kubah N.P. 


34 Kubah N.P. 

39 G. Pueh, Sematan 

32 G. Silam, Lahat Datu 






41 P. Talang Kecil 















42 Gading N.P. 






50 Gading N.P. 





67 Kubah N.P. 


64 Kubah N.P. 







C. cf. brachyotis 

Forest 

C. brachyotis 

C. horsfieldii 

E. major 

Fig. 3. UPGMA cluster analysis of Cynopterus spp.

264 


on Wilks’ lambda (Table 3), and 6 characters 

(GBPL, M3L, M3W, TVL, D3P2L, and RL; Table 

4) were generated from the stepwise procedure. 

The characters with the highest weight on function 

1 were RL (0.957) and M3L (0.506), whereas 

M3L (3.912) and M3W (-3.454) had the highest 

discriminant loadings. All 6 characters determined 

by the stepwise procedure produced a discriminant 

function with an accuracy rate of 100% (see 

accuracy rates, Table 5). 

For analysis of only external morphological 

characters, the stepwise method identified a 

discriminant function (Function 1) that was statistically 

significant (Table 6) with 4 characters (TVL, 

D3P1L, D3MCL, and RL; Table 7) generated from 

the stepwise procedure. The character with the 

highest weight and loading was RL (weight = 1.240; 

loading = 0.706), while D3MCL (-0.731) had the 

2nd-highest weight. All 4 characters determined 

by the stepwise procedure produced a discriminant 

function with an accuracy rate of 96.8% (see 

accuracy rates, Table 8). 

A histogram of the discriminant scores 

of the discriminant function for all characters 

Table 1. Sexual dimorphism test using a t-test for equality of means (equal/unequal variances; only sexually 

dimorphic characters are shown) 

C. horsfieldii C. brachyotis 

Character IOW D3MCL D5MCL 

t 3.434 1.346 1.113 

d.f. 8 32 32 

Significance (2-tailed *) 0.009 0.021 0.090 

Conclusion sexually dimorphic sexually dimorphic sexually dimorphic 

Characters are defined in “MATERIALS AND METHODS”. 

Table 2. Means and standard deviations (SDs) of all characters used in this analysis 

Cynopterus cf. brachyotis Forest C. brachyotis Overall 

Character Mean S.D. Mean S.D. Mean S.D. 

GSL 27.39 0.76 28.45 0.88 27.92 0.97 

IOW 5.60 0.32 5.92 0.36 5.76 0.37 

POW 6.32 0.60 6.48 0.65 6.40 0.63 

CW 12.06 0.39 12.39 0.36 12.23 0.41 

MW 12.23 0.40 12.66 0.43 12.45 0.47 

ZW 17.93 0.79 18.40 0.80 18.16 0.82 

DBC 5.62 1.07 4.72 0.79 5.17 1.04 

BL 2.60 0.58 2.18 0.42 2.39 0.55 

GBPL 6.95 0.93 5.72 0.90 6.34 1.10 

C1BW 1.61 0.24 1.44 0.20 1.52 0.24 

C1C1B 5.92 0.29 6.05 0.30 5.99 0.30 

M3M3B 8.37 0.36 8.44 0.36 8.40 0.36 

C1M3L 8.94 0.39 9.10 0.28 9.02 0.34 

M3L 1.83 0.11 1.95 0.14 1.89 0.14 

M3W 1.25 0.15 1.18 0.13 1.21 0.14 

TVL 11.40 1.95 11.47 2.63 11.43 2.29 

EL 14.48 1.34 14.67 1.29 14.58 1.31 

D3P1L 26.63 1.37 28.38 1.25 27.51 1.57 

D3P2L 33.75 2.32 36.19 2.42 34.97 2.65 

D3MCL 41.47 1.76 43.06 1.71 42.27 1.90 

D4MCL 38.87 1.40 40.94 1.63 39.91 1.83 

D5MCL 39.64 1.43 42.31 1.44 40.98 1.96 

RL 58.08 1.40 63.55 2.04 60.82 3.26 

LogPES 1.02 0.04 1.04 0.07 1.03 0.06 

Characters are defined in “MATERIALS AND METHODS”.


265 

(Fig. 4) showed that C. brachyotis and C. 

cf. brachyotis Forest formed distinct groups, 

whereas the histogram of the discriminant scores 

of the discriminant function for only external 

morphological characters (Fig. 5) showed some 

misclassifications (2 individuals). The discriminant 

functions based on the unstandardized canonical 

coefficient functions (Tables 3, 7) can be used 

Table 3. Wilks’ lambda test of discriminant 

function 1 (with all available characters) 

Table 6. Wilks’ lambda test of discriminant 

function 1 (with external morphological characters) 

Wilks’ lambda Chi-squared Eigenvalue 

Percent of 

variance 

Wilks’ lambda Chi-squared Eigenvalue 

Percent of 

variance 

0.157 94.412 5.368 100% 

0.195 96.337 4.188 100% 

Cumulative 

percent 

Canonical 

correlation 

d.f. Significance ** 

Cumulative 

percent 

Canonical 

correlation 

d.f. Significance ** 

100% 9.18 6 0.00 

100% 0.897 4 0.00 

Table 4. Standardized and unstandardized 

canonical discriminant function coefficients (with all 

characters) 

Character Function 1 

Table 7. Standardized and unstandardized 

canonical discriminant function coefficients (with 

external morphological characters) 

Character Function 1 

Standardized 

Unstandardized 

Standardized 

Unstandardized 

GBPL -0.371 -0.405 

M3L 0.506 3.912 

M3W -0.481 -3.454 

TVL -0.346 -0.149 

D3P2L 0.350 0.148 

RL 0.957 0.546 

Constant - -37.326 


TVL -0.479 -0.216 

D3P1L 0.572 0.442 

D3MCL -0.731 -0.433 

RL 1.240 0.706 

Constant - -34.507 


Table 5. Classification results (pooled covariance 

matrix) of the stepwise discriminant function 

analysis (with all available characters) 

Table 8. Classification results (pooled covariance 

matrix) of the stepwise discriminant function 

analysis (with external morphological characters) 

Group 

Predicted group 

membership 

Total 

Group 

Predicted group 

membership 

Total 

1 2 

1 2 

Original Count 1 29 0 29 

2 0 34 34 

Percent 1 100% 0% 100% 

2 0% 100% 100% 

Cross-validated a Count 1 29 0 29 

2 0 34 34 

Percent 1 100% 0% 100% 

2 0% 100% 100% 

Both 100% of the original and cross validated. a grouped cases 

were correctly classified. 

Original Count 1 32 2 34 

2 0 29 29 

Percent 1 94.1% 5.9% 100% 

2 0% 100% 100% 

Cross-validated a Count 1 32 2 34 

2 0 29 29 

Percent 1 94.1% 5.9% 100% 

2 0% 100% 100% 

Both 96.8% of the original and cross-validated. a grouped cases 

were correctly classified.

266 


as a tool to determine whether a specimen is 

C. brachyotis or C. cf. brachyotis Forest. The 

predictive models are as follows: 

for all remaining characters 

ŷ = -0.405a + 3.912b - 3.454c - 0.149d + 

0.148e + 0.546f - 37.326 (constant) (a) 

and for only external morphological characters 

ŷ = -0.216d + 0.442 - 0.433h - 0.706f - 34.507 

(constant); 

(b) 

where ŷ is the discriminant score (a negative score 

indicates C. cf. brachyotis Forest and a positive 

score indicates C. brachyotis), a is the GBPL, b 

is the M3L, c is the M3W, d is the TVL, e is the 

D3P2L, f is the RL, g is the D3P1L, and h is the 

D3MCL. 

DISCUSSION 

General discussion of statistical results 

Based on the cluster analysis, a clear division 

(approximately 15.48% distance, based on 

estimates from the graph) was observed between 

C. brachyotis and C. cf. brachyotis Forest. Visual 

observations of samples during field sampling 

indicated that adult C. brachyotis can be vaguely 

identified due to the brown fur with a pronounced 

yellowish or reddish tinge, and these bats usually 

have a forearm of > 60 mm. Adults of C. cf. 

brachyotis Forest have a smaller body size with 

duller coloration and usually have a forearm length 

of < 60 mm. 

Comparison with previous bat surveys 

(Timoh 2006, Fukuda et al. 2008) and personal 

observations indicate that C. brachyotis was 

sampled across a wide variety of vegetation 

types with different capture rates, whereas C. 

cf. brachyotis Forest was confined to primary 

forests. Capture rates of C. brachyotis were 44% 

in secondary forests, 41% in orchards, and 72% 

in oil palm plantations (Fukuda et al. 2008). The 

high capture rate in oil palm plantations is probably 

associated with the abundance of oil palm fruit, 

i.e., a food source (Fukuda et al. 2008). We also 

speculated that this abundant food source would 

also likely increase the life expectancy of C. 

brachyotis in oil palm plantations as many older 

individuals were captured (with distinct reddishbrown 

fur on their shoulders and worn out or 

missing teeth in most individuals) in Timoh’s (2006) 

study. 

In this study, the analyses revealed that the 

RL, M3L, and M3W had the highest discriminant 

loading and weight, and this was reflected by 

the importance of these characters during the 

identification process. The RL or forearm length 

is one of the characters useful in identifying bats, 

especially fruit bats of the family Pteropodidae. 

This character was also previously used to differentiate 

C. brachyotis, C. cf. brachyotis Forest, 

and other Cynopterus in Malaysia (Abdullah et 

Frequency 

8 

6 

4 

2 

Canonical Discriminant Function 

Mean = -2.22 

Std. Dev. = 1.004 

N = 29 

C. cf. brachyotis Forest 

C. brachyotis 

Mean = 2.34 

Std. Dev. = 1.048 

N = 34 

Frequency 

10 

8 

6 

4 

2 

Canonical Discriminant Function 

Mean = 2.16 

Std. Dev. = 0.801 

N = 29 

C. cf. brachyotis Forest 

C. brachyotis 

Mean = 1.84 

Std. Dev. = 1.142 

N = 34 

0 

-5.0 -2.5 0.0 2.5 5.0 

Discriminant Scores 

0 

-4 -2 0 2 4 

Discriminant Scores 

Fig. 4. Histogram of discriminant scores of both C. brachyotis 

and C. cf. brachyotis Forest for all available characters. 

Fig. 5. Histogram of discriminant scores of both C. brachyotis 

and C. cf. brachyotis Forest for external morphological 

characters.


267 

al. 2000, Abdullah 2003, Campbell et al. 2004 

2006 2007, Jayaraj et al. 2004 2005, Fong 2011). 

Although M3L and M3W are not generally used 

for species identification, molar differences in C. 

horsfieldii, C sphinx, and C. brachyotis are a key 

character which can be used to differentiate these 

3 species of Cynopterus in Malaysia. The D3MCL 

and D3P1L both contribute to the length and size 

of the wings, and this may reflect the habitats that 

both species occupy. 

The cluster and discriminant function 

analyses showed that C. brachyotis and C. cf. 

brachyotis Forest populations are morphologically 

distinct, congruent with previous results using 

molecular methods (Abdullah 2003, Campbell et 

al. 2004 2006, Julaihi 2005, Fong 2011). Although 

the topology of the dendogram generated by 

the cluster analysis was not similar to previous 

molecular studies, it was able to differentiate 

C. brachyotis from C. cf. brachyotis Forest. 

The different topologies might be a reflection 

of the morphological appearances of these 

bats. Morphologically both C. brachyotis and 

C. cf. brachyotis Forest look similar, whereas C. 

horsfieldii is very much larger with distinct cusps 

on the lower premolar and 1st lower molar; these 

characteristics are not present in C. brachyotis or C. 

cf. brachyotis Forest. 

The prediction models developed will 

be particularly useful in accurately identifying 

C. brachyotis and C. cf. brachyotis Forest in 

Malaysia. Specifically function (a) can be used 

to verify museum specimens, and function (b) 

will be more appropriate for field identification. 

Function (a) requires cranial, dental, and external 

morphological measurements; thus, unverified 

museum specimens can be identified once the 

skull is extracted, reducing the cost of validating 

the species using molecular tools. Although having 

a lower accuracy rate, function (b) can be used in 

the field as only external morphological characters 

are needed to identify the species. If needed, 

however, a tissue sample via skin scraping or a 

wing punch can be taken for species verification 

in the lab. An accurate identification method will 

definitely aid ecologists, conservationists, and law 

enforcement officials in studying and conserving 

this species complex. 

Body sizes and relation to habitat types of 

Cynopterus brachyotis and C. cf. brachyotis 

Forest 

Body size can be related to the flight performance 

of bats as the total body mass is negatively 

correlated with wing loading, a measure of the 

ability to navigate around obstacles (Aldridge 

1986, Aldridge and Rautenbach 1987, Jones et 

al. 1993, Rhodes 2002) and maneuverability in 

cluttered areas (Aldridge and Rautenbach 1987, 

Jones et al. 1993, Kalcounis and Brigham 1995, 

Brigham et al. 1997, Rhodes 2002). This can be 

directly linked to the habitats of both species, with 

C. brachyotis occupying less-cluttered habitats and 

C. cf. brachyotis Forest occupying dense areas 

(Abdullah et al. 2000, Abdullah 2003, Jayaraj 

et al. 2004 2005). Body size seems to be the 

discriminating factor in the cluster analysis for 

effectively discriminating these 2 species, which 

explains why both species can be separated, but 

body size per se does not depict the entire picture 

of the divergence of these bats. In terms of the 

flight apparatus and dimensions, both species 

apparently did not undergo the change in wing 

shape indicated in a recent study by Campbell et 

al. (2007), but rather a change in body size which 

might have been due to selective pressures for C. 

brachyotis and C. cf. brachyotis Forest to fit into 

their respective habitats. Similarly, Menon (2007) 

revealed that the aspect-ratio and wing-loading 

indices cannot be used to differentiate these 2 

species in Borneo. 

Previous studies (Freeman 1981, Schluter 

1993, Wain-Wright 1996) noted that there was a 

relationship between the structure of the feeding 

apparatus and diet in bats. As M3W and M3L 

are associated with feeding and foraging, it was 

speculated that the shape and dimension of the 

dentition are associated with the diet. Current 

knowledge of the diet and foraging behavior of C. 

brachyotis in Malaysia was previously documented 

by Lim (1970), Phua and Corlett (1989), Fujita 

and Tuttle (1991), Francis (1994), Funakoshi and 

Zubaid (1997), Tan et al. (1998), Mohd Azlan et al. 

(2000), and Hodgkison et al. (2003), but none of 

those authors focused on differences in the diets 

and foraging behaviors of C. brachyotis and C. 

cf. brachyotis Forest. Thus a more-detailed study 

of the diets and foraging behaviors would shed 

more light on ecological differences between C. 

brachyotis and C. cf. brachyotis Forest. 

Implications of recent studies for the taxonomic 

status of the Cynopterus brachyotis 

complex 

It was proven by various studies that C. 

brachyotis is a species complex with 6 distinct

268 


lineages. Genetically C. brachyotis has 6 forms; 4 

geographically distinct lineages respectively from 

India, Myanmar, Sulawesi, and the Philippines, 

and 2 sympatric forms (recognized as C. cf. 

brachyotis Forest and C. brachyotis in this study) 

in southern Thailand, Peninsular Malaysia, and 

Borneo. These 2 sympatric forms are found in 

distinct habitats: C. brachyotis is found in open 

areas, and C. cf. brachyotis Forest is found in 

the primary and old secondary forests (Abdullah 

2003, Campbell et al. 2004 2006, Jayaraj et al. 

2004 2005, Julaihi 2005, Fukuda et al. 2008, Fong 

2011). Cynopterus brachyotis is the ancestral 

lineage of all Cynopterus in Peninsular Malaysia 

and Borneo with nucleotide divergence ranging 

8%-9%, whereas C. cf. brachyotis Forest is closely 

related to C. horsfieldii, differing by only a genetic 

divergence of 3.5% (Abdullah 2003). 

This scenario is not new to the taxonomy 

of Cynopterus as C. nusatenggara described by 

Kitchner and Maharadatunkamsi (1991 1996) 

was also found within Cynopterus populations 

during field sampling on islands of Nusa Tenggara, 

Indonesia. Cynopterus bats are currently represented 

by 7 species (Simmons 2005), but there 

are a lot of variations in terms of body size and 

coloration between and within species. These 

variations were observed in island populations and 

highland populations, and are due to differences 

in vegetation and other ecological factors (see 

Hill and Thonglongya 1972, Lekagul and McNeely 

1977, Medway 1978, Payne et al. 1985, Kitchner 

and Maharadatunkamsi 1991 1996, Ingle and 

Heaney 1992, Schmitt et al. 1995, Nor 1996, 

Abdullah et al. 2000, Storz et al. 2001, Abdullah 

2003, Campbell et al. 2004 2006 2007, Jayaraj et 

al. 2004, Menon 2007, Fukuda et al. 2008, Fong 

2011). 

Menon (2007) collected an unidentified 

Cynopterus specimen from Satang I., Borneo, 

Malaysia, and this specimen was later identified 

using DNA techniques. The forearm length of 

this Cynopterus specimen was 69 mm indicating 

it was C. sphinx, but DNA identification indicated 

that it was C. brachyotis (unpubl. data). A molar 

examination of the specimen did not show a clear 

distinction between C. brachyotis and C. sphinx. 

Such an observation is the norm when individuals 

from this genus are collected in a wide range of 

vegetative types, which indicates that there are 

high intra- and interspecific variations among 

Cynopterus representatives. The lack of such 

knowledge indicates the necessity for a current 

large-scale study on inter- and intraspecific forms 

of Cynopterus across their distribution. Although 

C. brachyotis is widely distributed, information on 

the current status of the 6 lineages of C. brachyotis 

especially is not clear. Confounded by the nonrecognition 

of these new C. brachyotis lineages 

(Forest, India, Myanmar, Sulawesi, and the 

Philippines) as distinct species (see Abdullah and 

Jayaraj 2006), the survival of these rare species 

may be threatened if no clear and proper planning 

for conservation is put in place. 

In terms of biogeography, the existing recognized 

Cynopterus species of C. brachyotis, 

C. horsfieldii, C. luzoniensis, C. minutus, C. 

nusatenggara, C. sphinx, and C. tithaecheilus are 

distributed in the Indo-Malayan region and their 

distributions overlap. Simmons (2005) listed their 

distributions as follow: C. brachyotis is distributed 

in Sri Lanka, India, Nepal, Burma, Thailand, 

Cambodia, Vietnam, South China, Malaysia, the 

Nicobar and Andaman Is., Borneo, Sumatra, 

Sulawesi, Magnole, Sanana, Sangihe I., and 

Talaud I. with possible occurrence in the Palawan 

region of the Philippines; C. horsfieldii is limited to 

Thailand, Cambodia, Peninsular Malaysia, Borneo, 

Java, Sumatra, the Lesser Sunda Is., and adjacent 

small islands; C. luzoniensis is found in Sulawesi, 

the Philippines, and adjacent small islands; C. 

minutus is found in Sumatra, Java, Borneo, and 

Sulawesi; C. nusatenggara is found in Lombok, 

Moyo, Sumbawa, Sangeang, Komodo, Flores, 

Sumba, Adonara, Lembata, Pantar, Alor, and the 

Wetar Is.; C. sphinx is found in Sri Lanka, Pakistan, 

Bangladesh, India, South China, Southeast Asia 

including Burma, Vietnam, Cambodia, Peninsular 

Malaysia, Sumatra, and possibly in Borneo; and 

C. tithaecheilus is found in Sumatra, Java, Bali, 

Lombok, Timor, and adjacent small islands. 

In Malaysia; however, only 5 species of 

Cynopterus coexist together, i.e., C. horsfieldii, 

C. sphinx, C. brachyotis, C. minutus, and C. cf. 

brachyotis Forest. Cynopterus horsfieldii, C. 

brachyotis, and C. cf. brachyotis Forest have a 

high geographic distributional overlap (Abdullah 

2003, Campbell et al. 2004 2006 2007), but 

C. cf. brachyotis Forest’s distribution extends 

farther north into Thailand, Vietnam, and probably 

Cambodia and Laos (Campbell et al. 2004 

2006). Ecologically, C. sphinx and C. brachyotis 

are common in open habitats, orchards, and 

agricultural areas, whereas C. horsfieldii and C. 

cf. brachyotis Forest are found in primary and old 

secondary forests in Peninsular Malaysia and 

southern Thailand. Cynopterus cf. brachyotis 

Forest is also rare in Peninsular Malaysia, as its


269 

occurrence is dictated by the existence of primary 

and old secondary forests. Cynopterus sphinx 

is found in both habitat types, but declines in 

number near forest edges (Campbell et al. 2006). 

Similar observations were found in Borneo, but 

with the exclusion of C. sphinx as records of this 

species occurring in Borneo are only from Central 

Kalimantan (Payne et al. 1985, Abdullah et al. 

1997), and to date, there are no recent records of 

this species in Malaysian Borneo. The occurrence 

of C. minutus in Borneo is still in question, as 

there is little information on it, but a recent survey 

by Benda (2010) did record C. minutus in Sabah. 

The forearm length of C. minutus captured in his 

study was 54.3-58.1 (mean, 55.69, SD, 1.644) mm 

(n = 5), which is slightly smaller but overlaps with 

forearm length measurements of C. cf. brachyotis 

Forest in Abdullah (2003), Campbell et al. (2004 

2006 2007), Jayaraj et al. (2004 2005), Jayaraj 

(2009), and Fong (2011). 

As Abdullah and Jayaraj’s (2006) preliminary 

investigation of the nominate specimen of C. 

brachyotis revealed that the type specimen of C. 

brachyotis described by Müller (1838) is the larger 

form, it is apparent that the remaining C. brachyotis 

lineages (Forest, India, Myanmar, Sulawesi, and 

the Philippines) require further study to clarify their 

phylogenetic positioning and taxonomic status. To 

date, there are more than 10 studies (see Abdullah 

et al. 2000, Abdullah 2003, Campbell et al. 2004 

2006 2007, Jayaraj et al. 2004 2005, Julaihi 2005, 

Abdullah and Jayaraj 2006, Jayaraj 2009, Fong 

2011) that have validated the existence of C. cf. 

brachyotis Forest, but there are no published 

studies on the remaining C. brachyotis lineages 

in the Indo-Malayan region. Thus, a complete 

phylogenetic tree of all 7 recognized species and 

recorded divergent forms of Cynopterus (including 

the 6 divergent forms of C. brachyotis) should 

be generated to clarify the taxonomic status of 

all Cynopterus spp. in the Indo-Malayan region. 

Clarification of C. luzoniensis from Sulawesi and 

Palawan is also needed, as there is the possibility 

that the Sulawesi and Philippine forms of C. 

brachyotis previously described by Campbell et al. 

(2004) could possibly be C. luzoniensis, or these 2 

C. brachyotis forms may differ from C. luzoniensis 

altogether. Finally, because C. minutus is 

recognized as a distinct species (Simmons 2005), 

there is a need to check the status of this species 

in Borneo as little information is available. 

Two models to differentiate C. brachyotis 

and C. cf. brachyotis Forest were developed 

using multivariate statistics with a high accuracy 

rate of of identifying both C. brachyotis and C. cf. 

brachyotis Forest. Based on the 1st prediction 

model (function a), 6 chara-cters are needed 

to accurately differentiate C. brachyotis from 

C. cf. brachyotis Forest in southern Thailand, 

Peninsular Malaysia, and Borneo. This model 

would be more appropriate for use on museum 

specimens as skull and dental characters are 

needed for the calculation. The 2nd prediction 

model (function b) can be used during field 

sampling, as only external morphological 

measurements are needed for identification. 

These prediction models can subsequently be 

used by bat biologists to correctly identify adult C. 

brachyotis forms in southern Thailand, Peninsular 

Malaysia, and Borneo, thus aiding in research and 

conservation efforts of both C. brachyotis and C. 

cf. brachyotis Forest in this region. Further suggestions 

on taxonomic research of this species 

complex should include verification of multiple 

genetic markers, examination of detailed morphometrics, 

and a review of the taxonomic status of 

the 6 existing C. brachyotis forms in the Indo- 

Malayan region. Conservation of this species 

complex needs to be carefully planned in order to 

ensure that all 6 divergent forms do not go extinct, 

as these are suspected of being undescribed 

species in the Indo-Malayan region. 

Acknowledgments: We would like to thank Dr. L. 

S. Hall for the inspiration to go further and realize 

our potential, to F.A.A. Khan, A.K.H. Guan, B. 

Ketol, F.P. Har and all staffs in Molecular Ecology 

Laboratory Universiti Malaysia Sarawak (UNIMAS) 

for all their support and comments to improve our 

work and being great companions during field trips 

and laboratory sessions. We would also like to 

thank the Sarawak Forest Department for issuing 

permit no. 04608 and the Sarawak Forestry 

Corporation for their hospitality during our visit 

to protected areas in Sarawak. We extend our 

gratitude to the Faculty of Resource Science and 

Technology, UNIMAS, Department of Wildlife and 

National Parks (Kuala Lumpur), Sabah Parks, 

Sabah Wildlife Department, and many other 

individuals for various administrative and logistical 

support throughout the course of the study. We 

thank 2 critical anonymous reviewers who tremendously 

helped us improve the taxonomic 

perspectives of an initial draft of this paper. The 

main author, JVK, would also like to thank M. 

Muhamad for her comments on the statistical 

analysis and the overall manuscript. This study 

was funded by a Malaysian government IRPA

270 


grant (09-02-09-1022-EA001) awarded to MTA and 

colleagues, a UMK Short Term Grant (R/SGJP/ 

A03.00/00481A/001/2010/000037) awarded to JVK 

and YCW and ARA, and a UNIMAS ZAMALAH 

scholarship awarded to JVK. 

REFERENCES 

Abdullah MT. 2003. Biogeography and variation of Cynopterus 

brachyotis in Southeast Asia. PhD dissertation, Univ. of 

Queensland, St. Lucia, Australia. 

Abdullah MT, VK Jayaraj. 2006. Preliminary investigation on 

the relationship of the nominate C. brachyotis with the 

small-sized and large-sized C. brachyotis using clustering 

analysis. Sarawak Mus. J. 62: 223-236. 

Abdullah MT, C Moritz, GC Grigg, LS Hall. 2000. Evidence 

of cryptic species within Cynopterus brachyotis by using 

mtDNA sequence. In Z Yaacob, S Moo-Tan, S Yorath, 

eds. Proceedings of the International Conference on In- 

Situ And Ex-Situ Biodiversity Conservation in the New 

Millennium. Kota Kinabalu, Malaysia: Yayasan Sabah. 

Abdullah MT, MA Rahman, LS Hall. 1997. New records for 

bats in Sarawak, Malaysia. Malay. Nat. J. 50: 365-367. 

Aldridge HDJN. 1986. Manoeuvrability and ecological 

segregation in the little brown (Myotis lucifugus) and Yuma 

(M. yumamensis) bats (Chiroptera: Vespertilionidae). 

Can. J. Zool. 64: 370-382. 

Aldridge HDJN, IL Rautenbach. 1987. Morphology, echolocation 

and resource partitioning in insectivorous bats. J. 

Anim. Ecol. 56: 763-778. 

Andersen K. 1912. Catalogue of the Chiroptera in the 

collections of the British Museum. Vol. I. Megachiroptera. 

London: British Museum of Natural History. 

Benda P. 2010. On a small collection of bats (Chiroptera) from 

western Sabah (North Borneo, East Malaysia). Vespertilio 

13-14: 45-76. 

Bergmans W, FG Rozendaal. 1988. Notes on collections 

of fruit bats from Sulawesi and some off-lying islands 

(Mammalia, Megachiroptera). Zoologische Verhandelingen 

248: 1-74. 

Brigham RM, SD Grindal, MC Firman, JL Morissette. 1997. 

The influence of structural clutter on activity patterns of 

insectivorous bats. Can. J. Zool. 75: 131-136. 

Bumrungsri S, PA Racey. 2005. Field discrimination between 

lesser short-nosed fruit bat (Cynopterus brachyotis Müller, 

1838) and greater short-nosed fruit bat (C. sphinx Vahl, 

1797) (Chiroptera: Pterpodidae) in southern Thailand. 

Nat. Hist. Bull. Siam Soc. 53: 111-121. 

Campbell P, CJ Schneider, AM Adnan, A Zubaid, TH Kunz. 

2004. Phylogeny and phylogeography of Old World 

fruit bats in the Cynopterus brachyotis complex. Mol. 


Campbell P, CJ Schneider, AM Adnan, A Zubaid, TH Kunz. 

2006. Comparative population structure of Cynopterus 

fruit bats in Peninsular Malaysia and southern Thailand. 

Mol. Ecol. 15: 29-47. 

Campbell P, CJ Schneider, AM Adnan, A Zubaid, TH 

Kunz. 2007. Morphological and ecological correlates 

of coexistence in Malaysian fruit bats (Chiroptera: 

Pteropodidae). J. Mammal. 88: 105-118. 

Corbet GB, JE Hill. 1992. The mammals of the Indomalayan 

region: a systematic review. Oxford, UK: Oxford Univ. 

Press. 

Cuvier F. 1824. Des dents des mammiferes. F. G. Strasbourg, 

France: Levrault, 256 pp. 

Everitt BS. 1993. Cluster analysis, 3rd ed. New York: Halsted 

Press. 

Fong PH. 2011. Genetic variation and population structure 

of the genus Cynopterus in Malaysia. Master thesis, 

Universiti Malaysia Sarawak, Kota Samarahan, Malaysia. 

Francis CM. 1990. Trophic structure of bat communities in the 

understorey of lowland dipterocarp rain forest in Malaysia. 

J. Trop. Ecol. 6: 421-431. 

Francis CM. 1994. Vertical stratification of fruit bats 

(Pteropodidae) in the lowland dipterocarp rainforest in 

Malaysia. J. Trop. Ecol. 10: 523-530. 

Francis CM. 2008. A field guide to the mammals of Southeast 

Asia. London: New Holland Publishers, 392 pp. 

Freeman PW. 1981. Correspondence of food habits and 

morphology in insectivorous bats. J. Mammal. 62: 164- 

166. 

Fujita MS, MD Tuttle. 1991. Flying foxes (Chiroptera: 

Pteropodidae): threatened animals of key ecological and 

economic importance. Conserv. Biol. 5: 455. 

Fukuda D, OB Tisen, K Momose, S Sakai. 2008. Bat diversity 

in the vegetation mosaic around a lowland dipterocarp 

forest of Borneo. Raffles Bull. Zool. 57: 213-221. 

Funakoshi K, A Zubaid. 1997. Behavioral and reproductive 

ecology of the dog-faced fruit bats, Cynopterus brachyotis 

and C. horsfieldi, in a Malaysian rainforest. Mammal 

Study 22: 95-108. 

Gray JE. 1843. List of the specimens of Mammalia in the 

collection of the British Museum. London: British Museum 

(Natural History) Publications, 216 pp. 

Hill JE. 1983. Bats (Mammalia: Chiroptera) from Indo- 

Australia. Bull. Br. Mus. Nat. Hist. (Zool.) 45: 103-208. 

Hill JE, K Thonglongya. 1972. Bats from Thailand and 

Cambodia. Bull. Br. Mus. Nat. Hist. (Zool.) 22: 171-196. 

Hodgkison R, ST Balding, A Zubaid, TH Kunz. 2003. Fruit 

bats (Chiroptera: Pteropodidae) as seed dispersers and 

pollinators in a lowland Malaysian rain forest. Biotropica 

35: 491-502. 

Ingle NR, LR Heaney. 1992. A key to the bats of the Philippine 

islands. Fieldiana Zool. 69: 1-44. 

Jayaraj VK. 2009. The phylogenetic relationships of 

Megachiroptera in Malaysia inferred from morphological 

and DNA analyses. Master’s thesis. Universiti Malaysia 

Sarawak, Kota Samarahan. 

Jayaraj VK, CJ Laman, MT Abdullah. 2004. Morphological 

variation in the genus Cynopterus of Peninsular Malaysia 

and Borneo. In AIM Ismail, HL Koh, YA Hasan, eds. 

Proceedings of the Regional Conference on Ecological 

and Environmental Modelling (ECOMOD 2004), Penang, 

Malaysia, pp. 69-81. 

Jayaraj VK, CJ Laman, MT Abdullah. 2005. Application of 

multivariate techniques in determining morphological 

variation in the genus Cynopterus of Peninsular Malaysia 

and Borneo. In AA Tuen, I Das, eds. International 

Conference on Biogeography and Biodiversity: Wallace in 

Sarawak – 150 Years Later: Sarawak. Malaysia, 226 pp. 

Jones G, M Morton, PM Hughes, RM Budden. 1993. Echolocation, 

flight morphology and foraging strategies of 

some West African hipposiderid bats. J. Zool. (Lond.) 

230: 285-400. 

Joseph FH Jr, RE Anderson, RL Tatham, WC Black. 1992. 

Multivariate data analysis with readings, 3rd ed. New


271 

York: Macmillan. 

Julaihi AM. 2005. A phylogenetic study of the subfamily 

Pteropodinae inferred by using partial mitochondrial DNA 

cytochrome b gene. BSc thesis, Univ. Malaysia Sarawak 

(UNIMAS), Kota Samarahan, Sarawak. 

Kalcounis MC, RM Brigham. 1995. Intraspecific variation in 

wing loading affects habitat use by little brown bats (Myotis 

lucifugus). Can. J. Zool. 73: 89-95. 

Kitchener DJ, Maharadatunkamsi. 1991. Description of a new 

species of Cynopterus (Chiroptera: Pteropdidae) from 

Nusa Tenggara Indonesia. Rec. West. Aust. Mus. 51: 

307-363. 

Kitchener DJ, Maharadatunkamsi. 1996. Geographic variation 

in morphology of Cynopterus nusatenggara (Chiroptera, 

Pteropodidae) in southeastern Indonesia, and description 

of two new subspecies. Mammalia 60: 255-276. 

Kitchener DJ, WC Packer, Maharadatunkamsi. 1995. Morphological 

variation in Pteropus lombocensis (Chiroptera: 

Pteropodidae) in Nusa Tenggara, Indonesia. Rec. Aust. 

Mus. 17: 61-67. 

Koopman KF. 1994. Handbook of zoology vol. 8. Chiroptera: 

systematics. Berlin: Walter de Gruyter. 

Lekagul B, JA McNeely. 1977. Mammals of Thailand. 

Sahankarnbhat, Bangkok, 177 p. 

Lim BL. 1970. Food habits and breeding cycle of the 

Malaysian fruit-eating bat, Cynopterus brachyotis. J. 

Mammal. 51: 174-177. 

Manly BFJ. 1994. Multivariate statistical methods. A primer, 

2nd ed. London: Chapman and Hall. 

Medway L. 1978. Mammals of Borneo: field keys and an 

annotated checklist. Kuala Lumpur: Monographs of the 

Malayan Branch of the Royal Asiatic Society no. 7. 

Menon V. 2007. A study on the wing-loading and aspect-ratio 

for fruit bats of family Pteropodidae. BSc thesis, Universiti 

Malaysia Sarawak (UNIMAS), Kota Samarahan, Sarawak. 

Mickleburgh SP, AM Hutson, PA Racey. 1992. Old world fruit 

bats: an action plan for their conservation. Sultanate of 

Oman and Gland, Switzerland: IUCN/FFPS/ZSL/WWF/ 

JWPT/NWF. 

Miller GS Jr. 1906. Seven new Malayan bats. Proc. Biol. Soc. 

Washington 19: 63. 

Mohd Azlan J, RSK Sharma, M Zakaria. 2000. Species 

diversity and relative abundance of understorey bats at Air 

Hitam Forest Reserve, Selangor, Malaysia. Malay. Nat. J. 

54: 69-75. 

Müller S. 1838. Over eenige nieuwe zoogdieren van Borneo. 

Tijdschrift voor Natuurlijke Geschiedenis en Physiologie, 5: 

134-150. 

Nargorsen DW, RL Peterson. 1980. Mammal collector’s 

manual. Life Science Miscellaneous Publications. 

Toronto: Royal Ontario Museum. 

Nor SM. 1996. The mammalian fauna on the islands at the 

northern tip of Sabah, Borneo. Fieldiana Zool. 83: 1-51. 

Payne J, CM Francis, K Phillipps. 1985. A field guide to the 

mammals of Borneo. Kota Kinabalu, Malaysia: The 

Sabah Society and World Wildlife Fund Malaysia. 

Peters HW. 1861. Monatsberichte der Koniglich Preussischen 

Akademie der Wissenschaften zu Berlin 1861: 708. 

Peterson AT, LR Heaney. 1993. Genetic differentiation 

in Philippines bats of the genera Cynopterus and 

Haplonycteris. Biol. J. Linn. Soc. 49: 203-218. 

Phua PB, RT Corlett. 1989. Seed dispersal by the lesser shortnosed 

fruit bat (Cynopterus brachyotis, Pteropodidae, 

Megachiroptera). Malay. Nat. J. 42: 251-256. 

Rhodes MP. 2002. Assessment of source of variance and 

patterns of overlap in microchiropteran wing morphology 

in southeast Queensland, Australia. Can. J. Zool. 80: 

450-460. 

Schluter D. 1993. Adaptive radiation in sticklebacks: size, 

shape, and habitat use efficiency. Ecology 74: 699-709. 

Schmitt LH, DJ Kitchener, RA How. 1995. A genetic perspective 

of mammalian variation and evolution in the 

Indonesian archipelago: biogeographic correlates in the 

fruit bat genus Cynopterus. Evolution 49: 399-414. 

Simmons NB. 2005. Order Chiroptera. In DE Wilson, DM 

Reeder, eds. Mammal species of the world: a taxonomic 

and geographical reference, 3rd ed. Washington DC: 

Smithsonian Institution Press. 

Storz JF, HR Bhat, TH Kunz. 2001. Genetic consequences 

of polygyny and social structure in an Indian fruit bat, 

Cynopterus sphinx. Inbreeding, outbreeding, and 

population subdivision. Evolution 55: 1215-1223. 

Tan KH, A Zubaid, TH Kunz. 1998. Food habits of Cynopterus 

brachyotis (Muller) (Chiroptera: Pteropodidae) in 

Peninsular Malaysia. J. Trop. Ecol. 14: 299-307. 

Temminck CJ. 1825. Monographes de Mammalogie. G. 

Dufour & E. D’Ocagne, Paris, 1: 198. 

Timoh JR. 2006. Diversity and abundance of bats in an oil 

palm plantation and neighboring forest in Bratak oil 

palm estate, Bau, Sarawak. BSc thesis, Univ. Malaysia 

Sarawak (UNIMAS), Kota Samarahan, Sarawak. 

Vahl M. 1979. Beskrivelse på tre nye arter flagermuse. Skrifter 

Naturhistorie-Selskabet Copenhagen, 4: 121-138. 

Wain-Wright PC. 1996. Ecological explanation through 

functional morphology: the feeding biology of sunfishes. 

Ecology 77: 1339-1343. 

Zar JH. 1984. Biostatistical analysis. 2nd ed. Englewood 

Cliffs, NJ: Prentice-Hall.

272 

ZOOLOGICAL STUDIES 

INSTRUCTIONS TO CONTRIBUTORS 

Zoological Studies publishes original research papers in six major fields, including Behavioral biology, 

Ecology, Evolution, Systematics and Biogeography, Comparative physiology and Animals/plants 

interaction. Manuscripts are welcome from around the world, but must be written in English. Authors who 

submit exceptionally long manuscripts may be asked to defray a portion of related printing cost. Color 

photographs can be printed at the author , s expense. The journal will provide 25 free reprints of accepted 

articles per publication; additional reprints are available for order at the author , s expense. 

With the exception of invited review papers, submissions must include a cover letter containing the 

basic information and stating that the manuscript is based on previously unpublished original research 

and has not been submitted to another journal for publication. If the paper concerns the use of animals or 

specimens in research, a statement to the effect that the author(s) has adhered to the legal requirements of 

the country in which the work was carried out or to any institutional guidelines should be included. Authors 

are encouraged to provide the names and e-mail addresses of four possible reviewers. 

The Editorial Board has final authority concerning acceptance or rejection of any manuscript. As a 

condition of publication, the authors , copyright automatically belongs to Zoological Studies. If the author(s) 

does not have clear title to the copyright of any part of the manuscript, it is the sole responsibility of the 

author(s) to obtain written permission from the copyright holder and present it to the editor of Zoological 

Studies. 

The following format guidelines should be followed for all papers submitted. 

I. Submission procedure 

Manuscripts must be submitted via e-mail as electronic files to the Editorial Office: zoolstud@gate. 

sinica.edu.tw. The text should be submitted as a Microsoft Word file and a PDF file. The MS Word file will 

allow a timely review process by allowing reviewers to insert comments on the electronic copy. Figures 

should be included at the end of the PDF file containing the text, but for publication of accepted manuscripts, 

separate text and figure files are requested as described below. To reduce the PDF file size for more-efficient 

transmission, embed fonts, use the“optimize”function in Adobe Acrobat (or other program), and use no 

more than 300 dpi resolution for figures. To aid the Editor in file management, please begin all filenames with 

the surname of the first author; it would also be useful to include the date: e.g., Randall_et_al_4Sep02.doc 

(spell out month to avoid confusion). Important: Please place the date of submission in the top right corner 

of the title page and change the date on subsequent revisions. All corresponding authors will receive a 

confirmation of receipt of the manuscript via e-mail. Authors who have not received a confirmation within 

one week should check with the editorial office. After an electronic submission has been examined and 

determined to be appropriate for Zoological Studies, it will be sent electronically to reviewers, who will return 

it the same way. 

Peer review involves the following steps: 

1. Author submits manuscript; recommend 4 potential overseas referees; 

2. Editorial Office checks formatting; 

3. Chief Editor assigns a Subject Editor; 

4. Subject Editor assigns Reviewers; 

5. Reviewers submit review reports; 

6. Subject Editor makes recommendation; 

7. Chief Editor makes final decision; and 

8. Author is informed of decision. 

Manuscript Types 

Reports: Reports are full-length papers and should not exceed 8000 words (including tables and figure 

legends). 

Invited Reviews: The Chief Editor invites an author to write a review. Invited reviews should normally be 

the same length as a report.

II. Title Page 

The title page should include the manuscript title; names of all authors; address(es) of where the 

research was conducted and, if different, all current addresses of the authors including fax and e-mail if 

available; a short running title of less than 40 characters; name, address, telephone, and fax numbers where 

correspondence should be sent; and no more than five keywords preferably not in the title. 

III. Abstract 

The abstract should be a factual condensation of the entire paper, including a statement of purpose, a 

clear description of observations and findings, and a concise presentation of the conclusions. It should not 

exceed 300 words. Literature citations should be avoid. 

IV. Text 

Manuscripts should include the following sections: Abstract, Materials and Methods, Results, 

Discussion, Acknowledgments, References, Figures, and Tables. Begin each section on a separate sheet. 

The full text of the Abstract to the References should be double-spaced with a minimum of 1.5-inch margins. 

Numbered lines should be marked through the text to make it easier to refer to corrections in the review 

process. The font of the entire manuscript should be set to 12 point Times New Roman. Scientific binomials 

should be italicized. 

V. References 

References should be cited in the text using the following formats: (Smith 1992), (Smith et al. 1992), 

or (Smith 1978a b 1983 1992, Jones 1990). Bibliographic citations should be arranged alphabetically 

according to the surname of the primary author, and formatted as in the following examples. 

Aranishi F. 2005b. Rapid PCR-RFLP method for discrimination of imported mackerel and domestic 

mackerel. Mar. Biotechnol. (in press) 

Chen W. 1974. Butterflies of Taiwan in colour. Taipei: Chinese Culture Press. (in Chinese) 

Elzinga A, N Alonzo. 1983. Analysis for methylated amino acids in proteins. In CHW Hirs, SN Timasheff, 

eds. Methods in enzymology. Vol. 91, Part I. New York: Academic Press, pp. 8-13. 

Fishbase. 2005. A global information system on fishes. Available at http://fishbase.sinica.edu.tw/home.htm 

Fisher CR, JJ Childress. 1986. Translocation of fixed carbon from symbiotic bacteria to host tissues in the 

gutless bivalve Solemya reidi. Mar. Biol. 93: 59-68. 

Fujioka T, H Chiba. 1988. Notes on distributions of some Japanese butterflies. Spec. Bull. Lep. Soc. Jap. 6: 

141-149. (in Japanese with English summary) 

Mills SC, JD Reynolds. 2003. The bitterling-mussel interaction as a test case for co-evolution. J. Fish Biol. 

63 (Supplement A): 84-104. 

Munday PL, PJ Eyre, GP Jones. 2003. Ecological mechanisms for coexistence of colour polymorphism in a 

coral-reef fish: an experimental evaluation. Oecologia 442: 519-526. 

Lee CL. 1998. A study on the feasibility of the aquaculture of the southern bluefin tuna in Australia. 

Department of Agriculture, Fisheries and Forestry (AFFA), Canberra, ACT 1998, 92 pp. 

Summerfelt RC, GE Hall, eds. 1987. Age and growth in fish. Ames, IA: Iowa State University Press. 

VI. Tables 

Tables should not duplicate material found in the text or in accompanying illustrations. Tables must be 

numbered consecutively in the order of mention in the text, and be described in brief but complete legends. 

All tables must be typed double-spaced without vertical lines, one table per page. All symbols (a, b, c, etc.) 

and abbreviations used must be briefly and clearly explained in the table footnotes. Asterisks should be 

used to indicate levels of significance: a single asterisk (*) for p ≤ 0.05, double asterisks (**) for p ≤ 0.01, and 

triple asterisks (***) for p ≤ 0.001). 

VII. Figures 

Figures should be in the following format. 

1. Figures must be in finished form and ready for reproduction. 

2. Number the figures using Arabic numerals according to the order of mention in the text. 

3. Appropriate lettering and labeling should be used with letters and numbers which will be at least 

1.5 mm high in the final reproduction. 

273

274 

4. The Font of the lettering should be Arial. All figures should be one or two column widths (either 8 or 

17 cm) in size. The maximum printed page height is 23 cm. Include scale bars where appropriate. Color and 

grayscale photograph should be saved in EPS format. 

5. Color photographs should be at a resolution of 300 pixels/inch. Grayscale photographs should be 

saved in 8 bits/channel. Photographs should be saved in CMYK which is suitable for printing. Do not save 

the format in indexed color. 

6. Line drawings should be prepared in TIFF format at a resolution of 1200 pixels/inch. Figures are 

edited using EXCEL, so please provide the original files. 

7. Authors should prepare any TIFF- or EPS-formatted figures at the intended final size which is 

suitable for editing, and also prepare figures with no labels or words after the manuscript is accepted. 

8. If all parts of a figure can be clearly seen in the printed version, then this is a good indication that the 

figure will be acceptable. 

9. The maximum size for all originals should not exceed the size of a printed page. High-quality original 

artwork or glossy prints should be submitted for reproduction mounted on appropriate mounting cards. 

10. Authors may indicate their size preferences of each figure (i.e., two-column width,“do not 

reduce,”etc.). All lines must be dark and sharply drawn. Reproductions may be used for review copies of a 

manuscript. 

VIII. Figure Legends 

Each figure should be accompanied by a title and explanatory figure legend. All associated descriptive 

legends should be typed (double-spaced) on a separate sheet; sufficient detail should be given in each 

legend to understand the figure independent of the text. 

IX. Nucleotide and Protein Sequences 

Newly reported nucleotide and protein sequences must be deposited in the DDBJ/EMBC/GenBank 

databases. Accession numbers must be included in the final version of the manuscript. 

X. Special Notes on Taxonomic Papers 

Taxonomic papers submitted to Zoological Studies will be considered by the uniqueness of the taxa 

under study (e.g., a poorly described taxonomic group). Authors describing a new species are encouraged 

to incorporate a revision of that particular group or relationships to existing species. Simple taxonomic 

descriptions are no longer considered for publication in Zoological Studies. Those papers submitted to 

Zoological Studies should follow the following style conventions. 

1. Upon the first mention of a species or infra-familial in both the abstract and text, the author of the 

animal taxon must be cited referring to the International Code of Zoological Nomenclature. Do not abbreviate 

the generic name of a taxon upon first mention or at the beginning of a sentence. Author , s names of a taxon 

must not be abbreviated except for Linnaeus (as L.) and Fabricius (as Fabr.). When multiple authorships are 

involved, authors, names should be separated by“et”or“and”. When citing authors of a taxon, citation of 

the year is optional. If used, however, the year must be enclosed within parentheses or square brackets, and 

the citation must be considered a reference citation within the article and be listed in the references. 

2. New taxa or synonymies that are erected should be clearly and appropriately marked as: comb. 

nov., com. rev., nom. nov., sp. nov., stat. nov., stat. rev., syn. nov., etc. A new taxon must list the name of the 

describing author(s) after the binomial or trinomial, even if it is the same as the manuscript author(s). 

3. Types: Descriptions and revisions also require comments on the types involved. Comments on types 

should be in a separate paragraph, and should include collection data and deposition information. 

4. Keys: Keys are not essential in taxonomic work, but are highly recommended. Keys must be concise, 

clear, easy to follow, and have reversibility provisions. Keys must also be in adjacent couplet style, and each 

couplet should preferably contain more than a single, non-overlapping attribute. 

5. Materials examined: Holotype and paratype(s) must be designated if a new taxon is being published. 

Designation of an allotype is not necessary. The collecting site, number of specimens examined, sex, date, 

and collector should be stated. 

6. The result section of the systematic papers should be in the order of scientific name, 

synonyms, Material examined (inc. holotype and paratype), Etymology, Diagnosis, Description (inc. 

Measurements), then a Distribution. The Discussion section should be included at the end of main 

text.

Indexed/Abstracted in: 

Biological Abstracts 

Chemical Abstracts 

Current Awareness in Biological Sciences 

Current Contents 

Entomology Abstracts 

Life Sciences 

Zoological Record 

Vol. 51, No. 2 

March, 2012 

ORIGINAL PAPERS 

J.T. Wang, P.J. Meng, Y.Y. Chen, 

and C.A. Chen 

S. Keshavmurthy, C.M. Hsu, C.Y. 

Kuo, V. Denis, J.K. Leung, S. 

Fontana, H.J. Hsieh, W.S. Tsai, 

W.C. Su, and C.A. Chen 

J.T. Wang, Y.Y. Chen, P.J. Meng, 

Y.H. Sune, C.M. Hsu, K.Y. Wei, and 

C.A. Chen 

H.U. Dahms, L.C. Tseng, S.H. 

Hsiao, Q.C. Chen, B.R. Kim, and 

J.S. Hwang 

M.R. Zargaran, N. Erbilgin, and Y. 

Ghosta 

B. Huo, C.X. Xie, B.S. Ma, X.F. 

Yang, and H.P. Huang 

L. Gonçalves, C.I. da Silva, and 

M.L.T. Buschini 

J.S. Wu, P.J. Chiang, and L.K. Lin 

M.F. Lin, M.V. Kitahara, H. 

Tachikawa, S. Keshavmurthy, and 

C.A. Chen 

S.S. Young, M.H. Ni, and M.Y. Liu 

B.A.R. Azman and B.H.R. Othman 

R. Naderloo and M. Apel 

V.K. Jayaraj, C.J. Laman, and M.T. 

Abdullah 

137 

143 

150 

160 

175 

185 

195 

204 

213 

222 

232 

248 

259 

COMPARATIVE PHYSIOLOGY 

Determination of the Thermal Tolerance of Symbiodinium Using the Activation 

Energy for Inhibiting Photosystem II Activity 

ECOLOGY 

Larval Development of Fertilized “Pseudo-Gynodioecious” Eggs Suggests 

a Sexual Pattern of Gynodioecy in Galaxea fascicularis (Scleractinia: 

Euphyllidae) 

Diverse Interactions between Corals and the Coral-Killing Sponge, Terpios 

hoshinota (Suberitidae: Hadromerida) 

Biodiversity of Planktonic Copepods in the Lanyang River (Northeastern 

Taiwan), a Typical Watershed of Oceania 

Changes in Oak Gall Wasps Species Diversity (Hymenoptera: Cynipidae) in 

Relation to the Presence of Oak Powdery Mildew (Erysiphe alphitoides) 

Age and Growth of Oxygymnocypris stewartii (Cyprinidae: Schizothoracinae) 

in the Yarlung Tsangpo River, Tibet, China 

Collection of Pollen Grains by Centris (Hemisiella) tarsata Smith (Apidae: 

Centridini): Is C. tarsata an Oligolectic or Polylectic Species? 

Monogamous System in the Taiwan Vole Microtus kikuchii Inferred from 

Microsatellite DNA and Home Ranges 

SYSTEMATICS AND BIOGEOGRAPHY 

A New Shallow-Water Species, Polycyathus chaishanensis sp. nov. 

(Scleractinia: Caryophylliidae), from Chaishan, Kaohsiung, Taiwan 

Systematic Study of the Simocephalus Sensu Stricto Species Group 

(Cladocera: Daphniidae) from Taiwan by Morphometric and Molecular 

Analyses 

Two New Species of Amphipods of the Superfamily Aoroidea (Crustacea: 

Corophiidea) from the Strait of Malacca, Malaysia, with a Description of a 

New Genus 

Leucosiid Crabs of the Genus Hiplyra Galil, 2009 (Crustacea: Brachyura: 

Leucosiidae) from the Persian Gulf and Gulf of Oman, with Description of a 

New Species 

A Predictive Model to Differentiate the Fruit Bats Cynopterus brachyotis and 

C. cf. brachyotis Forest (Chiroptera: Pteropodidae) from Malaysia Using 

Multivariate Analysis

Download PDF - Zoological Studies - Academia Sinica

Create successful ePaper yourself

Delete template?

Save as template?