Research Article |
Corresponding author: Lingfeng Kong ( klfaly@ouc.edu.cn ) Academic editor: Edmund Gittenberger
© 2022 Biyang Xu, Lu Qi, Lingfeng Kong, Qi Li.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Xu B, Qi L, Kong L, Li Q (2022) Description of Alvania wangi Xu, Qi & Kong, sp. nov. (Mollusca, Gastropoda, Littorinimorpha, Rissoidae) from the East China Sea. ZooKeys 1110: 201-217. https://doi.org/10.3897/zookeys.1110.82173
|
Alvania wangi Xu, Qi & Kong, sp. nov. (Mollusca, Gastropoda, Littorinimorpha, Rissoidae) was discovered within the intertidal zone in the Nanji Islands and Zhoushan Islands, Zhejiang Province, China. It has a radula characteristic of Alvania Risso, 1826, a protoconch sculptured with micro pits and lamellae between spiral lirae, and a teleoconch with growth lines and subobsolete cords. Specimens were examined using an integrative taxonomic approach incorporating morphological observations and phylogenetic analyses of concatenated mitochondrial 16S rRNA and nuclear 28S rRNA gene sequences. The findings suggest that the new species is sister to Alvania circinata A. Adams, 1861 and is probably endemic to the shallow waters of the East China Sea.
Micromolluscs, morphology, new species, phylogenetics, systematics
Rissoidae Gray, 1847 is a family of highly diversified and widespread microgastropods (
Classification of Alvania species based on their external features is rendered difficult by considerable convergence in shell characteristics and variations in the degree of development of the upper oviduct gland in females and the number of seminal receptacles in males (
Algae were scraped from intertidal rocks at Dalei Island and Miaozihu Island (Table
Pictures of the two sampling sites A rocky intertidal zonation on the coast of Dalei Island (location 1) B distant view of part of Dalei Island C algae growing on the lower intertidal zone of Dalei Island D algae collected from Miaozihu Island E distant view of part of Miaozihu Island F rocky intertidal zonation on the coast of Miaozihu Island (location 2) (photographs by Biyang Xu).
Location | Locality name | Collection date | Collector | Geo-coordinates |
---|---|---|---|---|
1 | Dalei Island, Nanji Islands National Nature Reserve, Wenzhou, China | 23 Jul. 2020 | Biyang Xu, Lu Qi | 27°29.82'N, 121°06.17'E |
2 | Miaozihu Island, Zhongjieshan Islands Special Marine Reserve, Zhoushan, China | 09 Apr. 2021 | Biyang Xu, Lu Qi | 30°11.77'N, 122°41.41'E |
Shells were photographed with a DS-Fi2 digital camera (Nikon, Tokyo, Japan) mounted on a stereomicroscope. The image stacks of standard views of the shells (
Genomic DNA was extracted from the specimens using the TIANamp Marine Animals DNA Kit (Tiangen, Beijing, China), following the manufacturer’s protocol. DNA was extracted in elution buffer (25 μL) and stored at 4 °C for short-term use. The 28S and 16S sequences were then amplified (Table
Target gene, primer details and PCR conditions (temperature, time, and number of cycles) applied in the present study.
Gene | Primer | Sequence 5’-3’ | Reference | PCR conditions |
---|---|---|---|---|
28S | 28SDKF | F: GATCGGACGAGATTACCCGCTGAA | Strong et al. 2011 | 94 °C (7’), 58 °C (1’), 72 °C (2’) [x1]; 94 °C (1’), 52 °C (1’), 72 °C (2’) [x35]; 94 °C (1’), 52 °C (1’), 72 °C (7’) [x1] |
LSU 1600R | R: AGCGCCATCCATTTTCAGG | Williams et al. 2003 | ||
16S | 16SARis | F: TGCCTGTTTAGCAAAAACAT |
|
94 °C (5’), 52 °C (30’’), 72 °C (1’) [x1]; 94 °C (30’’), 52 °C (30’’), 72 °C (1’) [x40]; 94 °C (30’’), 52 °C (30’’), 72 °C (7’) [x1] |
16SBRis | R: CCGGTCTGAACTCAGATCATGT |
The 16S and 28S sequences were aligned independently using MUSCLE v3.8.31 (
K2P pairwise sequence distances (in percentage) between the analyzed specimens based on 16S rRNA.
Species | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 |
---|---|---|---|---|---|---|---|---|---|---|---|---|
Alvania wangi sp. nov. | – | |||||||||||
Alvania aeoliae | 12.93 | – | ||||||||||
Alvania circinata | 8.69 | 13.37 | – | |||||||||
Alvania discors | 13.19 | 7.16 | 13.40 | – | ||||||||
Alvania lanciae | 13.46 | 6.00 | 14.20 | 8.36 | – | |||||||
Alvania lineata | 12.93 | 0.00 | 13.37 | 7.16 | 6.00 | – | ||||||
Alvania novarensis | 6.78 | 11.83 | 8.64 | 12.59 | 12.84 | 11.83 | – | |||||
Alvania ogasawarana | 7.74 | 12.63 | 9.11 | 12.86 | 13.66 | 12.63 | 5.33 | – | ||||
Alvania scabra | 14.83 | 8.21 | 15.27 | 9.39 | 8.92 | 8.21 | 13.40 | 14.47 | – | |||
Alvania tenera | 15.58 | 14.26 | 18.33 | 14.13 | 12.31 | 14.26 | 14.20 | 15.02 | 13.97 | – | ||
Crisilla galvagni | 13.78 | 12.19 | 15.24 | 13.73 | 11.96 | 12.19 | 13.66 | 12.89 | 12.75 | 14.55 | – | |
Cingula trifasciata | 13.90 | 10.77 | 14.14 | 12.26 | 11.25 | 10.77 | 12.29 | 13.65 | 12.32 | 12.35 | 12.60 | – |
All the materials analyzed in this study are deposited in the Laboratory of Shellfish Genetics and Breeding, Fisheries College, Ocean University of China, Qingdao, China.
K2P pairwise sequence distances (in percentage) between the analyzed specimens based on 28S rRNA.
Species | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 |
---|---|---|---|---|---|---|---|---|---|---|---|---|
Alvania wangi sp. nov. | – | |||||||||||
Alvania aeoliae | 4.51 | – | ||||||||||
Alvania circinata | 1.14 | 5.25 | – | |||||||||
Alvania discors | 5.89 | 2.69 | 6.06 | – | ||||||||
Alvania lanciae | 4.67 | 1.29 | 5.32 | 2.30 | – | |||||||
Alvania lineata | 4.51 | 0.00 | 5.25 | 2.69 | 1.29 | – | ||||||
Alvania novarensis | 3.22 | 5.56 | 3.38 | 6.29 | 5.47 | 5.56 | – | |||||
Alvania ogasawarana | 3.15 | 5.39 | 3.15 | 6.13 | 5.23 | 5.39 | 1.44 | – | ||||
Alvania scabra | 5.00 | 1.29 | 5.73 | 3.56 | 1.75 | 1.29 | 5.96 | 5.80 | – | |||
Alvania tenera | 4.43 | 2.45 | 5.08 | 3.55 | 2.53 | 2.45 | 5.38 | 5.14 | 3.15 | – | ||
Crisilla galvagni | 4.75 | 2.37 | 5.24 | 3.79 | 2.53 | 2.37 | 5.71 | 5.38 | 3.00 | 2.60 | – | |
Cingula trifasciata | 4.27 | 3.63 | 4.67 | 4.43 | 3.23 | 3.63 | 5.30 | 5.06 | 3.87 | 2.69 | 2.85 | – |
The 16S (489 bp) and 28S (1414 bp) regions of Alvania wangi Xu, Qi & Kong, sp. nov. were successfully amplified and sequenced. No cross-contamination or substitution saturation of 16S or 28S was detected. The K2P distances between Alvania wangi Xu, Qi & Kong, sp. nov. and the analyzed species ranged from 6.78% to 15.58% and 1.14% to 5.89% for 16S and 28S, respectively (Tables
Family Rissoidae Gray, 1847
China, Zhejiang: Pingyang County, the Nanji Islands National Nature Reserve, Dalei Island, 27°29.82'N, 121°06.17'E.
Holotype : Alcohol-fixed, photographed by SEM; original label: “CN, ZJ, Pingyang, Dalei, 27°29.82'N, 121°06.17'E, 23 Jul. 2020, B.Y. Xu & L. Qi” “LSGB mg325408 0601”.
Paratypes : Alcohol-fixed, five specimens, original label: “CN, ZJ, Pingyang, Dalei, 27°29.82'N, 121°06.17'E, 23 Jul. 2020, B.Y. Xu & L. Qi” “LSGB mg325408 0602 to 0606”; alcohol-fixed, ten specimens, original label: “CN, ZJ, Zhoushan, Miaozihu, 30°11.77'N, 122°41.41'E, 09 Apr. 2021, B.Y. Xu & L. Qi” “LSGB mg316141 0601 to 0610”.
Shell minute, ovate-conical, thin, with weakly convex whorls, non-umbilicate. Protoconch paucispiral, sculptured with micro pits and lamellae between spiral lirae. Teleoconch with subobsolete cords and growth lines. Umbilicus chink very narrow and slit-like. Aperture oval, broadly rounded anteriorly, slightly angled posteriorly; peristome simple; outer lip orthocline, without varix. Periostracum thin.
Shell
: (Figs
Holotype of Alvania wangi Xu, Qi & Kong, sp. nov. (A–D) shell A apertural view of shell B scanning electron micrographs of apertural view of shell C lateral view of shell D dorsal view of shell E protoconch F apical view of protoconch (G, H) operculum G outer face of operculum H inner face of operculum. Scale bars: 500 μm (A–D); 200 μm (E); 100 μm (F–H).
Operculum
: (Fig.
Radula
: (Fig.
Paratype of Alvania wangi Xu, Qi & Kong, sp. nov. (A–D) shell A apertural view of shell B scanning electron micrographs of apertural view of shell C lateral view of shell D dorsal view of shell E protoconch F apical view of protoconch (top two arrowheads show the two growth lines of the protoconch; bottom arrowhead indicates demarcation between protoconch and teleoconch) G radula H oblique view of central teeth (arrowhead indicates pustules on base of central teeth) I central teeth J lateral and marginal teeth. Scale bars: 500 μm (A–D); 200 μm (E, F); 10 μm (G); 2 μm (H); 5 μm (I, J).
Soft parts
: Yellowish head and foot. A pair of black-pigmented eyes (Fig.
The species is named after Prof. Rucai Wang, who established LSGB and was one of the founders of shellfish culture in China.
In addition to the type locality, this species can also be found in the middle intertidal zone of Miaozihu Island, the northeastern part of Zhoushan City, China, 30°11.77'N, 122°41.41'E.
The characteristics of Alvania wangi Xu, Qi & Kong, sp. nov. are consistent with those of Alvania described by
The new species described in the present study differs from the previously reported Alvania species with respect to the sculptures on its shells. Molecular evidence supports the morphological identification. Moreover, phylogenetic reconstruction revealed consistent topologies of Alvania in both BI (Fig.
Bayesian consensus phylogram based on analysis of the concatenated 16S and 28S sequences. Numbers on branches indicate nodal support (in percentage) by Bayesian posterior probabilities (BPP; only values ≥ 90% are shown; values of 100% are represented by asterisks). Thick lines mark branches that are consistent with the topology of the ML tree.
Notably, the addition of Alvania wangi Xu, Qi & Kong, sp. nov. changes the topology of some subclades within the Alvania clade (
Maximum-likelihood phylogram based on analysis of the concatenated 16S and 28S sequences. Numbers on branches indicate nodal support (in percentage) by ML bootstrap (BTSP; only values ≥ 70% are shown; values of 100% are represented by asterisks). Thick lines mark branches that are consistent with the topology of the BI tree.
In the subclade marked in red (Figs
The protoconch of Alvania wangi Xu, Qi & Kong, sp. nov. is not sculptured with granules between a few spiral lirae like that of most Alvania species (
This research was supported by the Hainan Provincial Joint Project of Sanya Yazhou Bay and Technology City Grant 320LH019, the National Natural Science Foundation of China under Grant 31772414, and the Fundamental Research Funds for the Central Universities under Grant 201964001. The authors specially thank Dr Takenori Sasaki (University of Tokyo, Japan) for his advice on the examination of the new species.
GenBank accession numbers for species included in the molecular analyses
Data type: docx file
Explanation note: GenBank accession numbers for species included in the molecular analyses.
A comparison among Alvania species found in the East China sea and adjacent waters
Data type: docx file
Explanation note: A comparison among Alvania species found in the East China sea and adjacent waters.